|
|
||||||||
Department of Anatomy and Cell Biology, University of Iowa College of Medicine, Iowa City, Iowa 52242
| |
ABSTRACT |
|---|
|
|
|---|
In the human fetal lung, surfactant protein A
(SP-A) is encoded by two highly similar genes, SP-A1 and SP-A2, which
are developmentally and hormonally regulated. Using primer extension
analysis, we evaluated the levels of SP-A1 and SP-A2 mRNA transcripts
in human fetal lung explants and in a human adult lung adenocarcinoma
cell line (H441 cells) cultured in the absence or presence of either dibutyryladenosine 3',5'-cyclic monophosphate (DBcAMP, 1 mM), dexamethasone (10
7 M),
or insulin (2.5 µg/ml). In the human fetal lung explants, the content
of SP-A1 mRNA was approximately four times that of SP-A2 mRNA. DBcAMP
increased SP-A1 mRNA levels by 100% and SP-A2 mRNA levels by 500%,
thus reducing the ratio of SP-A1 mRNA to SP-A2 mRNA to ~1:1.
Dexamethasone inhibited all of the SP-A1 and SP-A2 mRNA transcripts to
the same extent, by ~70%, whereas insulin inhibited all SP-A mRNA
transcripts by ~60%. The ratio of SP-A1 to SP-A2 mRNA in
dexamethasone- or insulin-treated explants was the same as the ratio
observed in controls. In the H441 cells, SP-A1 mRNA levels were ~1.5
times that of SP-A2 mRNA levels. DBcAMP increased both SP-A1 and SP-A2
mRNA levels by 100%. Dexamethasone inhibited SP-A1 mRNA levels in the
cell line by 60%, whereas SP-A2 mRNA levels were not significantly
affected. Insulin inhibited SP-A1 mRNA levels in the cell line by 40%
without affecting SP-A2 mRNA levels. These findings suggest that the
two human SP-A genes are regulated differently in the two model
systems.
lung; surfactant protein A; hormones; gene regulation; adenosine 3',5'-cyclic monophosphate
| |
INTRODUCTION |
|---|
|
|
|---|
A CRITICAL EVENT in the maturation of the fetus is the differentiation of lung alveolar type II cells (16). The alveolar type II cell synthesizes and secretes pulmonary surfactant, a lipoprotein substance that lines the alveolus and reduces surface tension at the air-fluid interface (32). Surfactant is composed of ~80% glycerophospholipids, 10% cholesterol, and 10% protein (32). Four surfactant-associated proteins (SPs) have been described, namely SP-A, SP-B, SP-C, and SP-D (30). These proteins have varied molecular characteristics and postulated functions, and at least the first three are required for proper surfactant function (30).
SP-A is the most abundant and best characterized SP (5). SP-A is synthesized as an ~35,000 dalton sialoglycoprotein monomer that consists of an NH2-terminal type IV collagen-like domain and a COOH-terminal lectin-like domain (6). The 35-kDa SP-A monomer forms trimers that subsequently aggregate in groups of six to form a flower bouquet-type structure (29). SP-A has sequence and structural homology with a group of proteins known as collectins, all of which are involved in host defense mechanisms (22). SP-A, together with SP-B and SP-C, has been shown to facilitate the surface tension-lowering properties of surfactant phospholipids (9). SP-A also acts as a homeostasis agent within the alveolus by regulating type II cell phospholipid synthesis, secretion, and recycling (15, 27, 33). More recently, evidence has accumulated that SP-A is involved in host defense mechanisms at the level of the alveolus against bacterial, viral, and fungal pathogens (28). Thus SP-A is an important surfactant component that contributes to many lung functions.
Two human SP-A genes and an SP-A pseudogene have been identified (13, 14, 31). Similarly, two SP-A genes have been identified in the baboon (7). In the human, the SP-A genes and pseudogene are located in a locus on chromosome 10, q21-q24 (1). The two human SP-A genes are 94% identical in their nucleotide sequence and encode proteins that differ by eight amino acids (13). It has been suggested that the SP-A protein trimers that make up the flower bouquet structure are heterotrimers that consist of two SP-A1 molecules and one SP-A2 molecule (29). Five SP-A1 mRNA transcripts and four SP-A2 mRNA transcripts have been described (12, 17). The various SP-A1 and SP-A2 mRNA transcripts differ in the 5'-untranslated region of the mRNA (12, 17). The functional significance of these different SP-A mRNA transcripts is currently not understood.
SP-A is induced in the fetal lung type II cell toward the end of
gestation and is regulated in a biphasic manner by glucocorticoids, hormones that are used clinically to accelerate lung development (20,
24). At relatively high concentrations
(
10
7 M), dexamethasone
decreases SP-A mRNA and protein levels in human fetal lung explants
(20). In contrast, at concentrations
10
8 M, glucocorticoids
increase SP-A levels (20). The second messenger adenosine
3',5'-cyclic monophosphate (cAMP) has been shown to be a
powerful inducer of SP-A in human fetal lung explants (21). In
contrast, it has been shown that high concentrations of insulin inhibit
SP-A gene expression (3). The studies described above were performed
using methods that detected both SP-A gene products together. In a
recent study, McCormick and Mendelson (18) described the effects of
dibutyryladenosine 3',5'-cyclic monophosphate (DBcAMP) alone or with dexamethasone, a synthetic glucocorticoid, on SP-A1 and
SP-A2 gene expression in human fetal lung explants (18).
In the fetal baboon lung, SP-A1 mRNA is detected before SP-A2 mRNA (7).
In addition, in lung tissue obtained from a 28-wk human neonate who
died shortly after birth, SP-A1 mRNA, but not SP-A2 mRNA, was
detectable by primer extension analysis (18). It was shown that DBcAMP
increased levels of SP-A2 mRNA to a greater extent than SP-A1 mRNA
(18). Dexamethasone at 10
7
M inhibited the stimulatory effect of DBcAMP on SP-A2 mRNA but had less
of an effect on SP-A1 mRNA (18). The effects of glucocorticoids alone
on either SP-A1 mRNA or SP-A2 mRNA levels have not yet been described,
nor has the effect of insulin.
In the present study, we examined the effects of DBcAMP, dexamethasone, and insulin on the relative amounts of SP-A1 and SP-A2 mRNA transcripts. We used two model systems to conduct the study, i.e., human fetal lung explants (25) and the H441 cell line (8). H441 cells are a pulmonary adenocarcinoma cell line that expresses both SP-A mRNA and SP-B mRNA (8). We found that the three physiological mediators, glucocorticoids, cAMP, and insulin, regulated both human SP-A genes. In addition, the various mRNA transcripts within each SP-A gene class were also regulated by these mediators. Finally, we found that, in some respects, the regulation of the two SP-A genes differed in the human fetal lung explants compared with the H441 cell line.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Human organ culture. The experimental
protocol for this study was approved by the Human Research Review
Committee at the University of Iowa. Human fetal lung explants were
cultured in vitro essentially as previously described (25). Explants
were cultured in Waymouth's MB 752/1 media without additives
(control) or in media containing one of the following substances:
DBcAMP (1 mM), dexamethasone (10
7 M), or human insulin
(2.5 µg/ml). Stock solutions were prepared as follows: DBcAMP (Sigma
Chemical, St. Louis, MO) was dissolved in sterile water at a
concentration of 100 mM and stored at
20°C; dexamethasone
(Sigma) was dissolved in ethanol at a concentration of
10
3 M and stored at
20°C; insulin (Boehringer Mannheim, Indianapolis, IN) was
solubilized in 0.1 N HCl at a concentration of 2 mg/ml and stored at
70°C. Media were changed daily. Explants were harvested after 6 days in culture, frozen rapidly in liquid nitrogen, and stored
at
70°C until used for analysis.
Cell culture. H441 cells derived from
a human lung adenocarcinoma cell line were maintained in RPMI 1640 medium (GIBCO BRL Life Technologies, Grand Island, NY) containing 100 U/ml penicillin, 100 µg/ml streptomycin, 0.25 µg/ml amphotericin B,
and 10% fetal bovine serum in 100-mm plastic tissue culture dishes
(19). Cells were allowed to grow to confluency (usually 7 days) and
then passed after a 1:4 split. Media were changed 4 days after
subculturing. Experiments were carried out on confluent cells
(day 7 of culture). One day before the
experiment, cells were transferred to serum-free RPMI 1640 media. This
24-h preincubation was followed by the replacement of the media with
either serum-free media containing no additives (control) or media
containing DBcAMP (1 mM), dexamethasone
(10
7 M), or human insulin
(2.5 µg/ml). Media containing the regulatory factors were removed
after 24 h of incubation, and the cells were removed from the dishes
using a rubber scraper, pelleted by centrifugation, frozen, and stored
at
70°C until analysis.
RNA isolation and Northern blot
analysis. Total RNA was isolated from the cultured
fetal lung explant tissue obtained from one 35-mm tissue culture dish
and from one 100-mm tissue culture dish of H441 cells using the
single-step method of Chomczynski and Sacchi (2). RNA was quantitated
by determining the absorbance at 260 nm, and purity was assessed by
determining the ratio of absorbance at 260 nm to that at 280 nm. Ten
micrograms of total RNA from each sample were separated by gel
electrophoresis on a 1.2% agarose-5% formaldehyde gel. A Polaroid
photograph of the ethidium bromide-stained gel was obtained under
ultraviolet (UV) light. The RNA was transferred by capillary action to
a positively charged nylon membrane (Nytran plus, Schleicher and
Schuell, Keene, NH) and cross-linked to the membrane by UV irradiation
(GS Gene Linker UV Chamber; Bio-Rad Life Sciences, Hercules, CA). A
cDNA probe for human SP-A was radiolabeled with
[
-32P]deoxycytosine
triphosphate (3,000 Ci/mmol; Amersham Life Science, Bedford, MA) using
a random-primer kit (Boehringer Mannheim). The 0.9-kb SP-A cDNA probe
was obtained from Dr. Jeffrey Whitsett (University of Cincinnati,
Cincinnati, OH). Northern blot analysis was performed essentially as
described previously (3). Reactive bands on the X-ray film were
quantitated using scanning densitometry. Loading errors were corrected
by densitometric quantitation of the 18S ribosomal RNA bands
on the photograph of the ethidium bromide-stained agarose gel.
Northern blot analysis using oligonucleotide
probes. Northern blot analysis using oligonucleotide
probes was performed using protocols described by Henderson et al.
(10). RNA (20 µg) from control and DBcAMP-treated human fetal lung
explants was analyzed for SP-A1 and SP-2 mRNA. Oligonucleotide probes
specific for SP-A1 and SP-A2, as recently described (11), were
synthesized. The oligonucleotides were labeled by the addition of a
homopolymeric tail of
[
-32P]deoxyadenosine
residues to their 3'-end using terminal
deoxynucleotidyltransferase (Promega, Madison, WI) and
[
-32P]dATP (6,000 Ci/mmol; Amersham). Unincorporated nucleotides were removed with a
Sephadex G-25 spin column (Boehringer Mannheim). The membranes were
prehybridized, hybridized, and washed essentially as described by
Henderson et al. (10). The membranes were then air-dried and exposed to
Kodak X-AR film between two intensifying screens (DuPont) at
70°C.
Primer extension analysis. An
oligonucleotide primer (GGGGATACCAGGGCTTCCAACACAAACG) that is
complementary to nucleotides 1117-1144 of the human SP-A1 gene
(31) and nucleotides 1144-1171 of the human SP-A2 gene (13) was
labeled at its 5'-end using
[
-32P]ATP (5,000 Ci/mmol; Amersham) and T4 polynucleotide kinase (New England Biolabs,
Beverly, MA), as described (17, 23). The unincorporated radioactive
nucleotide was removed with a Sephadex G-25 spin column (Boehringer
Mannheim). Primer extension was carried out using a modification of a
standard protocol (23). Five micrograms of total RNA were incubated
with 0.2 pmol of the radiolabeled primer for 10 min at 70°C and
then cooled on ice for 10 min. The primer was extended using 200 units
of Superscript II reverse transcriptase (GIBCO BRL) at 42°C for 1 h
in 20 µl of buffer containing 50 mM
tris(hydroxymethyl) aminomethane hydrochloride (pH 8.3), 75 mM KCl, 3 mM MgCl2, 1 mM each dATP, dGTP,
dCTP, and dTTP, 20 units of ribonuclease inhibitor, 1 mM
dithiothreitol, and 50 µg/ml actinomycin D. The extended transcripts
were recovered as described (23) and separated on a 6%
polyacrylamide-7 M urea sequencing gel using standard procedures (23).
The gel was dried on a gel drier (Bio-Rad Life Sciences) and exposed to
Kodak X-AR film with an intensifier screen (Lighting Plus, DuPont,
Wilmington, DE) at
70°C. Band densities were quantitated by
densitometric analysis.
Data analysis. Experiments were repeated three to seven times. Results are based on band densities, measured as contour (mean optical density × area) using a scanner and densitometry software (QS30; Protein and DNA Imaging, Huntington Station, NY). The values in each experiment were normalized to the control condition for that experiment, which was made equal to one. The change in band value when compared with the control was used to calculate the percent increase or decrease in the relative abundance of the various mRNA transcripts represented by the band. Because control values in every experiment were normalized to one, analysis of variance was not performed. Instead, statistical analysis was performed using Dunnett's test, paired Student's t-test, and linear regression (34). Data are expressed as means ± SE.
| |
RESULTS |
|---|
|
|
|---|
As illustrated in Fig. 1, the amount of
SP-A mRNA detected in primer extension assays from six different
cultured fetal lung samples varied considerably from experiment to
experiment. Although not all of the bands are visible in every lane
depicted in Fig. 1, in the individual experiments, exposures were
adjusted so that all bands were visible. Two nomenclatures have been
proposed for the naming of the various SP-A mRNA transcripts (Table
1; see Refs. 12, 17). The 235-bp band
represents three relatively minor splice variants, one SP-A1
(SP-A1
) and two SP-A2 (SP-A2
, SP-A2
), that comigrate
and were not resolved on the sequencing gel used in this study. Two
closely migrating minor SP-A1 transcripts (SP-A1
,
) migrated at
220 bp. A major SP-A2 transcript of ~201 bp was identified, which may
represent two very similar, closely migrating SP-A2 transcripts
(SP-A2
,
; see Refs. 12 and 17). A major SP-A1 transcript of 161 bp
(SP-A1
) and a minor SP-A1 transcript of 166 bp (SP-A1
) were also
identified in all control RNA samples. In control explants, SP-A1
comprised the majority of all SP-A1 transcripts, whereas the
comigrating SP-A2
,
transcripts comprised the majority of all the
SP-A2 mRNA transcripts (Table 1). In seven experiments, each performed
using cultured human fetal lung explant tissue obtained from a
different fetus, we found that SP-A1
constituted ~75% of the
major SP-A mRNA transcripts present (Table 2). The ratio of SP-A1
mRNA levels to SP-A2
,
mRNA levels in the individual experiments
ranged from 2.06 to 7.75, with a mean ratio of 4.9 ± 0.7.
|
|
Human fetal lung experiments. The effects of three physiological mediators, DBcAMP, dexamethasone, and insulin, on the relative expression of the SP-A genes in human fetal lung explants were evaluated by primer extension analysis in five experiments (Fig. 2). DBcAMP significantly increased total SP-A mRNA by 195.8 ± 96.3%, whereas dexamethasone significantly decreased total SP-A mRNA by 78.4 ± 9.9%, and insulin also significantly decreased total SP-A mRNA by 67.4 ± 0.8% (P < 0.05, Dunnett's test).
|
The effects of three physiological mediators on the relative amounts of
the major SP-A1 and SP-A2 mRNA transcripts in the total explant SP-A
mRNA pool were also evaluated. As shown in Fig.
3A, DBcAMP
significantly increased the levels of SP-A2
,
mRNAs (569.6 ± 273.5%) when compared with controls
(P < 0.05, Dunnett's test). The
response of the SP-A2 gene in human fetal lung explants to DBcAMP was
variable and ranged from an increase of 200 to 1,200%. The effect of
DBcAMP on SP-A1 mRNA levels was not significant. Dexamethasone
significantly decreased the relative amount of the SP-A1
and
SP-A2
,
mRNA transcripts (by 78.8 ± 9.8 and 82.2 ± 9.3%,
respectively; Fig. 3A). Insulin also
significantly decreased the SP-A1
and SP-A2
,
mRNA transcript
levels (59.8 ± 7.7 and 67.2 ± 13.2%, respectively)
when compared with controls (Fig.
3A). The inhibitory effects of
insulin and dexamethasone on either SP-A1
mRNA or SP-A2
,
mRNA
did not differ in magnitude.
|
DBcAMP significantly decreased the proportion of the major SP-A1 mRNA
transcript (SP-A1
) and significantly increased the proportion of the
major SP-A2 mRNA transcripts (SP-A2
,
) in the total pool of
explant SP-A mRNA (Table 2). Dexamethasone,
at 10
7 M, which is an
inhibitory concentration, did not significantly alter the percentage of
the major SP-A1 and SP-A2 mRNA transcripts present in the explants when
compared with controls (Table 2). Insulin also had no significant
effect on the percentage of SP-A1 and SP-A2 major mRNA transcripts in
the explants when compared with controls (Table 2).
|
We evaluated the effects of DBcAMP, dexamethasone, and insulin on the
three minor SP-A transcript bands observed in the primer extension
assay (Fig. 2). In mRNA from control explants, the SP-A1
transcript
comprised ~25% of the total SP-A1 mRNA detected, the SP-A1
,
transcripts comprised ~5% of the total SP-A1 mRNA detected, and the
235-bp band, which consists of two SP-A2 (SP-A2
,
) and one SP-A1
transcript (SP-A1
), constituted ~2.5% of the total SP-A1 mRNA and
25.9 ± 0.01% of the SP-A2 mRNA transcripts (Table 1). As shown in
Fig. 3B, the SP-A1
, SP-A1
,
,
SP-A1
, and SP-A2
,
transcripts were all increased by DBcAMP,
although the effects were not significant. In contrast, the relative
amounts of all of the minor SP-A1 and SP-A2 mRNA transcripts were
decreased significantly by dexamethasone and insulin (Fig.
3B).
H441 cell line experiments.
Essentially the same bands representing the nine different SP-A1 and
SP-A2 mRNA transcripts were detected in primer extensions of RNA
isolated from the cell line (Fig. 4). As
shown in Table 1, the SP-A1
mRNA transcript comprised the majority
of the total SP-A1 mRNA pool. The SP-A2
and -
mRNA transcripts
together comprised the majority of the total SP-A2 mRNA transcripts
(Table 1). The proportions of most of the SP-A1 and SP-A2 mRNA
transcripts observed in the H441 cell line did not differ significantly
from that observed in the human fetal lung explants (Table 1). The
exceptions were the SP-A1
transcript, which represented a
greater proportion of the SP-A1 mRNA in the H441 cell line than in the
explants, and the SP-A1
,
transcripts, which were less abundant in
the H441 cell line than in the human fetal lung explants (Table 1).
|
The effects of DBcAMP, dexamethasone, and insulin on the levels of total SP-A mRNA as detected by primer extension in the H441 cell line were evaluated in five experiments. DBcAMP significantly increased total SP-A mRNA by 97.8 ± 29.0%, whereas dexamethasone significantly decreased the total amount of SP-A mRNA detected in the H441 cells by 62.0 ± 10.2%. Insulin also significantly decreased the total SP-A mRNA pool by 55.5 ± 9.7% in the H441 cell line.
The relative amounts of the SP-A1
and SP-A2
,
mRNA transcripts
in the H441 cell line were significantly increased by DBcAMP (72.2 ± 20.6 and 92.6 ± 27.2%, respectively; Fig.
5A).
Dexamethasone significantly decreased the relative amount of SP-A1
mRNA by 63.2 ± 10.4%, and insulin significantly decreased SP-A1
mRNA by 38.4 ± 13.2% in the H441 cells (Fig.
5A). Dexamethasone and insulin had
no significant effect on SP-A2
,
mRNA levels in the H441 cell line
(Fig. 5A).
|
SP-A1
mRNA comprised ~60% of the major SP-A mRNA transcripts
(Table 2). The proportions of the major SP-A1 and SP-A2 mRNA transcripts were not significantly affected by DBcAMP in H441 cells
(Table 2). In contrast, dexamethasone and insulin significantly decreased the proportion of SP-A1
mRNA and significantly increased the proportion of SP-A2
,
mRNA transcripts present in the cell line (Table 2).
SP-A1
was significantly increased 112.2 ± 34.3% by DBcAMP in
the H441 cell line (Fig. 5B).
Dexamethasone treatment significantly decreased the minor
SP-A1
transcript by 69.0 ± 8.5%, whereas insulin had
no significant effect (Fig. 5B).
SP-A1
and -
mRNA transcripts were only detected in two of the
five cell line experiments. Thus the effects of the mediators on these
transcripts could not be determined. DBcAMP significantly increased the
relative level of the 235-bp band (SP-A1
, SP-A2
,
) observed in
the primer extension analysis by 117 ± 80% (Fig.
5B). In contrast, insulin and
dexamethasone had no significant effect on these transcripts (Fig.
5B).
Validation of primer extension analysis. To validate the use of primer extension analysis to measure the relative abundance of SP-A1 vs. SP-A2 mRNA, we performed Northern blot analysis using oligonucleotide probes specific for SP-A1 mRNA or SP-A2 mRNA (Fig. 6A). As shown in Fig. 6A, SP-A1 mRNA was more easily detected in control human fetal lung explants than SP-A2 mRNA. Densitometric analysis of the oligonucleotide blot showed that SP-A1 mRNA comprised ~80% of the SP-A mRNA detected in controls (Fig. 6C, left). Similar results were obtained when the relative amounts of SP-A1 and SP-A2 mRNAs present in the control explants were determined by primer extension analysis (Fig. 6, B and C, right). We observed that DBcAMP increased the levels of SP-A1 mRNA approximately twofold and the levels of SP-A2 mRNA about sevenfold in the oligonucleotide Northern blot analysis (Fig. 6C, left). In the primer extension analysis of the same sample, DBcAMP increased SP-A1 mRNA about twofold and increased SP-A2 mRNA about fivefold (Fig. 6C, right). Thirty different RNA samples obtained from five explant experiments and five cell line experiments were analyzed by both primer extension analysis and Northern blot analysis for total SP-A mRNA. The relative amount of total SP-A mRNA as determined by primer extension analysis was plotted against the relative amount of total SP-A mRNA as determined by Northern blot analysis (Fig. 6D). The total SP-A mRNA quantitations, as determined by the two different methods, were highly correlated (r = 0.91, P < 0.05).
|
| |
DISCUSSION |
|---|
|
|
|---|
Estimates of the proportions of the various SP-A transcripts in total
lung mRNA have been made previously using rapid amplification of cDNA
ends (12, 17). To a great extent, the proportions determined in the
present study, using densitometry, agree with the previously reported
data (12, 17). For SP-A1 mRNA, we determined that the major transcript,
SP-A1
, was ~65% of the total SP-A1 mRNA, a value similar to that
reported previously by McCormick et al. (17) and slightly lower than
the 81% reported by Karinch and Floros (12). For SP-A2 mRNA, the major
transcripts, SP-A2
and SP-A2
, which were not resolved in our
primer extension analysis, comprised 78% of the total SP-A2 mRNA. In
contrast, both previous reports estimated that these transcripts were
93% of the total SP-A2 mRNA in human lung (12, 17).
McCormick et al. (17) reported the ratio of the major SP-A1 transcripts to SP-A2 transcripts was ~1.9 in human fetal lung explants, with no range reported, and a ratio of ~0.33 in adult human lung (n = 4). Karinch et al. (11) reported a mean ratio of 4.7 in adult human lung tissue, with a range of 0.9-6.8 (n = 21). We observed a ratio of ~4.9 ± 0.72, with a range of ~2.1-7.8 (n = 7), in control human fetal lung explants. The observed variation in ratios of SP-A1 to SP-A2 mRNA may reflect variability in the human population. Karinch et al. (11) have postulated that the ratio of the SP-A1 to SP-A2 major transcripts is a parameter that is influenced by the SP-A1 and SP-A2 alleles expressed by each individual. In the H441 cells, we calculated a SP-A1-to-SP-A2 mRNA ratio of 1.6 ± 0.2 (n = 5 experiments); the range was 1.2-2.3. The narrow range of the ratios of SP-A1 to SP-A2 mRNA observed in the H441 cells probably reflects the clonal nature of the cells, which are expressing one genotype.
The stimulatory effect of DBcAMP on SP-A gene expression in the human fetal lung explants has been reported previously (21); however, this is the first report showing a similar finding in a lung epithelial cell line. Interestingly, the magnitude of the stimulatory effect of DBcAMP was less in the H441 cell line than in the human fetal lung explants, which are a mixed cell population system. We also observed a relatively great degree of variation in the response of different human fetal lung explants to DBcAMP. This variation may reflect genotypic or other differences among the different human fetal lung samples. In the explant system, DBcAMP altered the proportion of the major SP-A1 and SP-A2 transcripts, whereas in the H441 cell line, DBcAMP did not significantly alter the ratio of SP-A1 to SP-A2. We speculate that SP-A genotypic differences may in part explain the differences in the magnitude of responses observed between the human fetal lung explants and the H441 cell line. The SP-A genotype of the H441 cell line is 6A4 6A4 1A 1A (Dr. J. Floros, personal communication), which could be a fairly rare genotype. The frequencies of the 6A4 and 1A alleles are 8 and 15%, respectively (4). It is possible that the various human SP-A alleles could be regulated differently at pre- or posttranscriptional levels.
In the human fetal lung explants, dexamethasone had no effect on the proportion of SP-A1 mRNA to SP-A2 mRNA. In contrast, in the H441 cell line, a significant effect of dexamethasone on this parameter was observed; i.e., dexamethasone decreased the proportion of SP-A1 mRNA and increased the proportion of SP-A2 mRNA. The disparate effects of the glucocorticoid observed in the H441 cell line vs. the human fetal lung explant model may reflect genotypic differences or secondary effects on epithelial cells mediated by the effects of dexamethasone on nonepithelial cells present in the human fetal lung explants. Alternatively, because the H441 cell line is derived from a lung tumor, it may differ from normal lung epithelial cells with respect to its response to glucocorticoids.
In the human fetal lung explants, there was no significant effect of insulin on the relative proportion of SP-A1 vs. SP-A2 mRNA. However, in the H441 cell line, insulin significantly decreased the proportion of SP-A1 mRNA and significantly increased the proportion of SP-A2 mRNA. It is interesting to note that both inhibitory regulators of SP-A gene expression, i.e., dexamethasone and insulin, had no significant effect on the relative proportions of SP-A1 vs. SP-A2 mRNA in the human fetal lung explant system. However, in the H441 cells, both inhibitors decreased the proportion of SP-A1 mRNA and increased the proportion of SP-A2 mRNA.
In the present study, we also evaluated the effects of the
physiological mediators on the minor SP-A transcripts, SP-A1
, SP-A1
,
, SP-A1
, and SP-A2
,
. In the human fetal lung
explants, DBcAMP did not significantly increase levels of any of the
minor SP-A transcripts. In contrast, in the H441 cell line, SP-A1
and the SP-A1
and SP-A2
,
mRNA transcripts were significantly
increased by DBcAMP. In the explants, dexamethasone and insulin
inhibited the levels of all of the minor SP-A transcripts. In contrast, in the H441 cells, the only significant effect observed was that of
dexamethasone on SP-A1
. The SP-A protein encoded by the SP-A1
and
-
and SP-A2
and -
transcripts may have a slightly different amino acid sequence and thus may serve a diferent function (17).
cAMP tended to increase the expression of both human SP-A genes,
whereas both were inhibited by dexamethasone
(10
7 M) and insulin.
However, the SP-A2 gene was more sensitive to DBcAMP treatment than the
SP-A1 gene in the human fetal lung explants but not in the H441 cell
line. The ratio of SP-A1 mRNA to SP-A2 mRNA was ~5:1 in control
explants and ~1:1 in DBcAMP-treated explants. In the H441 cell line,
the ratio in control cells is ~1:1, and it is not changed by DBcAMP
treatment. Whether a change in the relative abundance of the two
different SP-A mRNAs is reflected in the proportions of SP-A1 and SP-A2
proteins remains to be determined. It has been proposed that the native
SP-A protein exists as an octadecamer composed of six SP-A
heterotrimers, each of which consists of two SP-A1 molecules and one
SP-A2 molecule (29). Although alternative molecular structures of SP-A
have not been reported, our data are consistent with the possibility
that different SP-A protein trimers or other aggregates may exist. In
the DBcAMP-treated explants, in which the ratio of SP-A1 mRNA to SP-A2
mRNA is 1:1, one might speculate that the two SP-A proteins might also
exist in a 1:1 ratio and that structures other than the putative SP-A heterotrimer might be formed. The existence and putative function of
such postulated SP-A molecules remains to be investigated. A dimeric
form of SP-A, which is not reduced during sodium dodecyl sulfate-polyacrylamide gel electrophoresis, has been consistently observed in alveolar proteinosis samples (26). In contrast to the
disparate effects of DBcAMP on the two human SP-A genes observed in the
human fetal lung explants, dexamethasone and insulin inhibited both
SP-A genes in the human fetal lung explants in a remarkably similar
manner.
We used the H441 cell line in this study because it is an epithelial cell line and as such is a simpler system than the human fetal lung explants, which consist of many different cell types. The H441 cell line expresses SP-A and SP-B mRNA and protein, and the regulation of the SP genes in the H441 cell line appears to be very similar to that previously reported using the human fetal lung explant system (19). However, we did find some differences in the regulation of the SP-A2 gene by dexamethasone and insulin in the two model systems. Dexamethasone and insulin inhibited the SP-A2 gene much more profoundly in the human fetal lung explants than in the H441 cells.
| |
ACKNOWLEDGEMENTS |
|---|
We acknowledge Dr. Joanna Floros for comments and advice, the expert technical assistance of Kristin Hurd in maintenance of the H441 cell line, and Jennifer Satterfield and Rose Marsh for preparation of the manuscript.
| |
FOOTNOTES |
|---|
This investigation was supported by National Institutes of Health Grants HL-50050 and DK-25295.
Address for reprint requests: J. M. Snyder, Dept. of Anatomy and Cell Biology, Univ. of Iowa College of Medicine, Iowa City, IA 52242.
Received 24 June 1997; accepted in final form 7 October 1997.
| |
REFERENCES |
|---|
|
|
|---|
1.
Bruns, G.,
H. Stroh,
G. M. Veldman,
S. A. Latt,
and
J. Floros.
The 35 kd pulmonary surfactant-associated protein is encoded on chromosome 10.
Hum. Genet.
76:
58-62,
1987[Medline].
2.
Chomczynski, P.,
and
N. Sacchi.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal. Biochem.
162:
156-159,
1987[Medline].
3.
Dekowski, S. A.,
and
J. M. Snyder.
Insulin regulation of messenger ribonucleic acid for the surfactant associated proteins in human fetal lung in vitro.
Endocrinology
131:
669-676,
1992
4.
Floros, J.,
S. Diangelo,
M. Koptides,
A. M. Karinch,
P. K. Rogan,
H. Nielsen,
R. G. Spragg,
K. Watterberg,
and
G. Deiter.
Human SP-A locus: allele frequencies and linkage disequilibrium between the two surfactant protein A genes.
Am. J. Respir. Cell Mol. Biol.
15:
489-498,
1996[Abstract].
5.
Floros, J.,
and
A. M. Karinch.
Human SP-A: then and now.
Am. J. Physiol.
268 (Lung Mol. Cell. Physiol. 12):
L162-L165,
1995
6.
Floros, J.,
R. Steinbrink,
K. Jacobs,
D. Phelps,
R. Kriz,
L. Sultzman,
M. Recny,
S. Jones,
H. W. Taeusch,
H. A. Frank,
and
E. F. Fritsch.
Isolation and characterization of cDNA clones for the 35kDa pulmonary surfactant associated protein (PSP-A).
J. Biol. Chem.
261:
9029-9033,
1986
7.
Gao, E.,
Y. Wang,
S. M. McCormick,
J. Li,
S. R. Seidner,
and
C. R. Mendelson.
Characterization of two baboon surfactant protein A genes.
Am. J. Physiol.
271 (Lung Cell. Mol. Physiol. 15):
L617-L630,
1996
8.
Gazdar, A. F.,
R. Ilona,
Y. Kurita,
H. K. Oie,
J. L. Mulshine,
J. C. Clark,
and
J. A. Whitsett.
Peripheral airway cell differentiation in human lung cancer cell lines.
Cancer Res.
50:
5481-5487,
1990
9.
Hawgood, S.,
B. J. Benson,
J. Schilling,
D. Damm,
J. A. Clements,
and
R. T. White.
Nucleotide and amino acid sequences of pulmonary surfactant protein SP 18 and evidence for cooperation between SP 18 and SP 28-36 in surfactant lipid adsorption.
Proc. Natl. Acad. Sci. USA
85:
66-70,
1987.
10.
Henderson, G. S.,
J. T. Conary,
J. M. Davidson,
S. J. Stewart,
F. S. House,
and
T. L. McCurley.
A reliable method for Northern blot analysis using synthetic oligonucleotide probes.
Biotechniques
10:
190-197,
1991[Medline].
11.
Karinch, A. M.,
D. E. deMello,
and
J. Floros.
Effect of genotype on the levels of surfactant protein A mRNA and on the SP-A2 splice variants in adult humans.
Biochem. J.
321:
39-47,
1997.
12.
Karinch, A. M.,
and
J. Floros.
5' Splicing and allelic variants of the human pulmonary surfactant protein A gene.
Am. J. Respir. Cell Mol. Biol.
12:
77-85,
1995[Abstract].
13.
Katyal, S. L.,
G. Singh,
and
J. Locker.
Characterization of a second human surfactant-associated protein SP-A gene.
Am. J. Respir. Cell Mol. Biol.
8:
445-452,
1992.
14.
Korfhagen, T. R.,
S. W. Glasser,
M. D. Bruno,
M. J. McMahan,
and
J. A. Whitsett.
A portion of the human surfactant protein A (SP-A) gene locus consists of a pseudogene.
Am. J. Respir. Cell Mol. Biol.
4:
463-469,
1991.
15.
Kuroki, Y.,
R. J. Mason,
and
D. R. Voelker.
Pulmonary surfactant apoprotein A structure and modulation of surfactant secretion by rat alveolar type II cells.
J. Biol. Chem.
263:
3388-3394,
1988
16.
Mallampalli, R. K.,
M. J. Acarregui,
and
J. M. Snyder.
Differentiation of the alveolar epithelium in the fetal lung.
In: Lung Growth and Development, edited by J. A. McDonald. New York: Dekker, 1997, p. 119-162.
17.
McCormick, S. M.,
V. Boggaram,
and
C. R. Mendelson.
Characterization of mRNA transcripts and organization of human SP-A1 and SP-A2 genes.
Am. J. Physiol.
266 (Lung Cell. Mol. Physiol. 10):
L354-L366,
1994
18.
McCormick, S. M.,
and
C. R. Mendelson.
Human SP-A1 and SP-A2 genes are differentially regulated during development and by cAMP and glucocorticoids.
Am. J. Physiol.
266 (Lung Cell. Mol. Physiol. 10):
L367-L374,
1994
19.
O'Reilly, M. A.,
A. F. Gazdar,
R. E. Morris,
and
J. A. Whitsett.
Differential effects of glucocorticoid on expression of surfactant proteins in a human lung adenocarcinoma cell line.
Biochim. Biophys. Acta
970:
194-204,
1988[Medline].
20.
Odom, M. J.,
J. M. Snyder,
V. Boggaram,
and
C. R. Mendelson.
Glucocorticoid regulation of the major surfactant associated protein (SP-A) and its messenger ribonucleic acid and of morphological development of human fetal lung in vitro.
Endocrinology
123:
1712-1720,
1988
21.
Odom, M. J.,
J. M. Snyder,
and
C. R. Mendelson.
Adenosine 3', 5'-monophosphate analogs and
-adrenergic agonists induce the synthesis of the major surfactant apoprotein in human fetal lung in vitro.
Endocrinology
121:
1155-1163,
1987
22.
Reid, K. B.
Structure/function relationships in the collectins (mammalian lectins containing collagen-like regions).
Biochem. Soc. Trans.
21:
464-468,
1993[Medline].
23.
Sambrook, J.,
E. F. Fritsch,
and
T. Maniatis.
Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1989, p. 7.79-7.83.
24.
Snyder, J. M.
The biology of surfactant-associated proteins.
In: Pulmonary Surfactant: Biochemical, Functional, Regulatory, and Clinical Concepts, edited by J. R. Bourbon. Boca Raton, FL: CRC, 1991, p. 105-126.
25.
Snyder, J. M.,
J. M. Johnston,
and
C. R. Mendelson.
Differentiation of type II cells of human fetal lung in vitro.
Cell Tissue Res.
220:
17-25,
1981[Medline].
26.
Snyder, J. M.,
H. F. Rodgers,
H. C. Nielson,
and
J. A. O'Brien.
Uptake of the 35 kDa major surfactant apoprotein (SP-A) by the neonatal rabbit lung tissue.
Biochim. Biophys. Acta
1002:
1-7,
1988.
27.
Thakur, N. R.,
M. Tesan,
N. E. Tyler,
and
J. E. Bleasdale.
Altered lipid synthesis in type II pneumonocytes exposed to lung surfactant.
Biochem. J.
240:
679-690,
1986[Medline].
28.
Van Golde, L. M.
Potential role of surfactant proteins A and D in innate lung defense against pathogens.
Biol. Neonate
67:
2-17,
1995.
29.
Voss, T.,
K. Melchers,
G. Scheirle,
and
K. P. Schafer.
Structural comparison of recombinant pulmonary surfactant protein A derived from two human coding sequences: implications for the chain composition of natural human SP-A.
Am. J. Respir. Cell Mol. Biol.
4:
88-94,
1991.
30.
Weaver, T. E.,
and
J. A. Whitsett.
Function and regulation of expression of pulmonary surfactant-associated proteins.
Biochem. J.
273:
249-264,
1991.
31.
White, R. T.,
D. Damm,
J. Miller,
K. Spratt,
J. Schilling,
S. Hawgood,
B. Benson,
and
B. Cordell.
Isolation and characterization of the human pulmonary surfactant apoprotein gene.
Nature
317:
361-363,
1985[Medline].
32.
Wright, J. R.,
and
J. A. Clements.
Metabolism and turnover of lung surfactant.
Am. Rev. Respir. Dis.
136:
426-444,
1987[Medline].
33.
Young, S. L.,
J. R. Wright,
and
J. A. Clements.
Cellular uptake and processing of surfactant lipids and apoprotein SP-A by rat lung.
J. Appl. Physiol.
66:
1336-1342,
1989
34.
Zar, J. H.
Biostatistical Analysis. Englewood Cliffs, NJ: Prentice-Hall, 1984, p. 402-403.
This article has been cited by other articles:
![]() |
G. Wang, X. Guo, P. Silveyra, S. R. Kimball, and J. Floros Cap-independent translation of human SP-A 5'-UTR variants: a double-loop structure and cis-element contribution Am J Physiol Lung Cell Mol Physiol, April 1, 2009; 296(4): L635 - L647. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Liu, M. Yi, M. Smith, and C. R. Mendelson TTF-1 response element is critical for temporal and spatial regulation and necessary for hormonal regulation of human surfactant protein-A2 promoter activity Am J Physiol Lung Cell Mol Physiol, August 1, 2008; 295(2): L264 - L271. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. N. Mikerov, T. M. Umstead, X. Gan, W. Huang, X. Guo, G. Wang, D. S. Phelps, and J. Floros Impact of ozone exposure on the phagocytic activity of human surfactant protein A (SP-A) and SP-A variants Am J Physiol Lung Cell Mol Physiol, January 1, 2008; 294(1): L121 - L130. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. R. S. Tagaram, G. Wang, T. M. Umstead, A. N. Mikerov, N. J. Thomas, G. R. Graff, J. C. Hess, M. J. Thomassen, M. S. Kavuru, D. S. Phelps, et al. Characterization of a human surfactant protein A1 (SP-A1) gene-specific antibody; SP-A1 content variation among individuals of varying age and pulmonary health Am J Physiol Lung Cell Mol Physiol, May 1, 2007; 292(5): L1052 - L1063. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. E. Oberley, C. L. S. George, and J. M. Snyder A new tool to investigate differences between human SP-A1 and SP-A2 Am J Physiol Lung Cell Mol Physiol, May 1, 2007; 292(5): L1050 - L1051. [Full Text] [PDF] |
||||
![]() |
M. R. Garbrecht, T. J. Schmidt, Z. S. Krozowski, and J. M. Snyder 11beta-Hydroxysteroid dehydrogenase type 2 and the regulation of surfactant protein A by dexamethasone metabolites Am J Physiol Endocrinol Metab, April 1, 2006; 290(4): E653 - E660. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Wang, X. Guo, and J. Floros Differences in the translation efficiency and mRNA stability mediated by 5'-UTR splice variants of human SP-A1 and SP-A2 genes Am J Physiol Lung Cell Mol Physiol, September 1, 2005; 289(3): L497 - L508. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Wang, X. Guo, and J. Floros Human SP-A 3'-UTR variants mediate differential gene expression in basal levels and in response to dexamethasone Am J Physiol Lung Cell Mol Physiol, May 1, 2003; 284(5): L738 - L748. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-S. Yang, M.-C. W. Yang, B. Wang, and J. C. Weissler BR22, a Novel Protein, Interacts with Thyroid Transcription Factor-1 and Activates the Human Surfactant Protein B Promoter Am. J. Respir. Cell Mol. Biol., January 1, 2001; 24(1): 30 - 37. [Abstract] [Full Text] |
||||
![]() |
K. R. KHUBCHANDANI and J. M. SNYDER Surfactant protein A (SP-A): the alveolus and beyond FASEB J, January 1, 2001; 15(1): 59 - 69. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Wang, D. S. Phelps, T. M. Umstead, and J. Floros Human SP-A protein variants derived from one or both genes stimulate TNF-alpha production in the THP-1 cell line Am J Physiol Lung Cell Mol Physiol, May 1, 2000; 278(5): L946 - L954. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. R. Hoover and J. Floros SP-A 3'-UTR is involved in the glucocorticoid inhibition of human SP-A gene expression Am J Physiol Lung Cell Mol Physiol, June 1, 1999; 276(6): L917 - L924. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. B. Sweezey, F. Ghibu, S. Gagnon, E. Schotman, and Q. Hamid Glucocorticoid receptor mRNA and protein in fetal rat lung in vivo: modulation by glucocorticoid and androgen Am J Physiol Lung Cell Mol Physiol, July 1, 1998; 275(1): L103 - L109. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Acarregui, A. R. Kumar, S. T. Penisten, and J. M. Snyder O2 regulates surfactant protein A mRNA transcription and stability in human fetal lung in vitro Am J Physiol Lung Cell Mol Physiol, March 1, 1998; 274(3): L343 - L350. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Yi, G.-X. Tong, B. Murry, and C. R. Mendelson Role of CBP/p300 and SRC-1 in Transcriptional Regulation of the Pulmonary Surfactant Protein-A (SP-A) Gene by Thyroid Transcription Factor-1 (TTF-1) J. Biol. Chem., January 18, 2002; 277(4): 2997 - 3005. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |