|
|
||||||||
Department of Pediatrics, University of Kentucky Medical School, Lexington, Kentucky 40536
| |
ABSTRACT |
|---|
|
|
|---|
Elastic fibers are thought to provide structural support for secondary septa as the lung undergoes the transition from the saccular to the alveolar stage. The synthesis of the soluble precursor of elastin, tropoelastin, occurs during a finite developmental period. We have investigated the developmental regulation of tropoelastin gene transcription and mRNA expression in fetal and postnatal rat lung fibroblasts and have assessed the changes in tropoelastin gene expression caused by hyperoxic exposure during secondary septal development. With the use of an RT-PCR assay and intron-specific primers to detect heterogeneous nuclear RNA (hnRNA) and intron-spanning primers to detect mRNA in freshly isolated rat lung fibroblasts, tropoelastin gene expression was found to be upregulated late in gestation. From days 18 to 21 of gestation, there was a 4.5-fold increase in tropoelastin hnRNA (P < 0.0001) and a 6-fold increase in mRNA (P = 0.002). After birth, tropoelastin expression was downregulated. Signals decreased from fetal day 21 to postnatal day 2 for both tropoelastin hnRNA (P = 0.021) and mRNA (P = 0.043). Tropoelastin hnRNA decreased further from days 2 to 6 (P = 0.04). Both tropoelastin hnRNA and mRNA were again upregulated during alveolarization from days 9 to 11, indicating that, once upregulated, transcription of the tropoelastin gene is not constant but varies with fetal and postnatal age. Exposure to >95% oxygen, when initiated on postnatal day 2 or 3 and continued until day 11, significantly diminished the developmental increase in tropoelastin hnRNA (P < 0.005) and mRNA (P < 0.05) normally seen on days 9-11, indicating that the postnatal upregulation of tropoelastin gene expression is inhibited by hyperoxic exposure in the early postnatal period.
developmental regulation of tropoelastin gene transcription; hyperoxia and tropoelastin gene expression; reverse transcription-polymerase chain reaction of intron-specific primers; tropoelastin heterogenous nuclear ribonucleic acid; hyperoxic injury in neonatal lung; bronchopulmonary dysplasia
| |
INTRODUCTION |
|---|
|
|
|---|
IN THE DEVELOPING LUNG, elastic fibers are assembled in the extracellular matrix as the lung undergoes the transition from the saccular to the alveolar stage. A role for elastic fibers in providing structural support for emerging alveolar septa has been suggested by the temporal association between the appearance of bundles of elastic fibers at the tips of secondary septa and the formation of new alveoli (9, 10, 15). A decrease in lung elastin, due either to the proteolytic destruction of existing elastic fibers (6) or to a reduction in synthesis resulting from decreased bioavailability of copper (22, 30), has been linked with impaired septation, further supporting the concept that elastic fibers play a vital role in normal secondary septal development.
In the lung, as in other tissues, the synthesis of the soluble
precursor of elastin, the tropoelastin monomer, occurs primarily during
the late fetal and early postnatal periods, ceasing after maturation of
the organ is completed. In the absence of injury, tropoelastin
synthesis is not reinitiated. The developmental regulation of
tropoelastin synthesis in the interstitial lung fibroblast has been of
particular interest because this cell is the primary source of
interstitial elastin in the alveolar wall. Because the regulatory
control of tropoelastin synthesis is reported to vary with cell type
during development, tropoelastin gene expression in whole lung
homogenate may not accurately reflect that in the interstitial
fibroblast. In the postnatal lung, tropoelastin mRNA levels, shown by
in situ hybridization to peak on day 4 in vascular smooth muscle cells, did not peak in interstitial
fibroblasts until day 11 (3). Rich et
al. (35) demonstrated that in vitro exposure to insulin-like growth
factor I increased tropoelastin mRNA and protein in aortic smooth
muscle cells but not in lung fibroblasts from 2- or 3-day-old pups. The
insulin-like growth factor I-induced increase in elastin gene
transcription in smooth muscle cells was later shown by this group to
be due to the displacement from the elastin-promoter-enhancer region of
Sp1, a negative regulatory factor (19). Transforming growth factor-
(TGF-
) was shown by McGowan (27) to increase tropoelastin
steady-state mRNA and soluble elastin levels in lung fibroblasts but
not in smooth muscle cells. Taken together, these findings demonstrate
the importance of evaluating elastin gene expression in specific cell
types as opposed to whole lung homogenate.
In the rat lung fibroblast, tropoelastin message expression, detected
by in situ hybridization, increases during alveolarization on
days
8-12 and returns
to background levels by day 23 (3). Tropoelastin gene transcription and message expression were initially thought to be coordinately regulated; thus it was assumed that gene
induction and upregulation in lung fibroblasts occurred at the time of
secondary septal development and that both transcription and message
expression were downregulated in the mature lung. Swee et al. (37)
recently challenged this concept, reporting that in cultured adult lung
fibroblasts tropoelastin gene transcription is not downregulated,
although steady-state tropoelastin mRNA levels are low, suggesting that
the termination of tropoelastin expression after septation is under
posttranscriptional control. Recent studies support the concept that,
in the postnatal lung fibroblast, elastin production is influenced by
tropoelastin mRNA stability. A TGF-
1-mediated increase in
tropoelastin mRNA stability has been shown to occur in lipid-laden
neonatal rat lung fibroblasts (29) and in a human fetal lung fibroblast
cell line (GM05389) (23). The age-related differences in tropoelastin
mRNA stability observed by Swee et al. (37) may be attributable, at
least in part, to the fact that the content of latent plus active
TGF-
s is 4.5-fold higher in the lungs of 8-day rat pups compared
with levels in adult lungs (29).
Although progress has been made in defining the conditions under which tropoelastin mRNA stability is increased, there is little information as to which factors are operative during lung development. Furthermore, the precise time course of the developmental regulation of tropoelastin gene transcription has not been previously delineated. In the present study, we have examined the temporal changes in tropoelastin gene and message expression in rat lung fibroblasts during the late fetal and early postnatal periods. The limited number of freshly isolated fibroblasts that could be obtained from neonatal rat lungs prompted the use of an assay involving RT-PCR with intron-specific primers to assess levels of tropoelastin heterogeneous nuclear RNA (hnRNA) as a measure of ongoing tropoelastin gene transcription (24). The results of the present study demonstrate that tropoelastin gene transcription is upregulated by fetal day 21 but that transcription is not maintained at a constant level after upregulation. Instead, tropoelastin gene transcription decreases after birth until the second postnatal week when transcription again increases but to levels substantially lower than those seen on fetal day 21.
We also investigated the effects of in vivo hyperoxic exposure on the developmental regulation of tropoelastin gene transcription to determine whether changes at the transcriptional level contributed to the altered tropoelastin protein and message expression seen in the lungs of neonatal rat pups exposed to hyperoxia (4-6). The potential influence of hyperoxic exposure on elastin synthesis in the immature lung is of particular relevance for the premature infant chronically ventilated with high concentrations of supplemental oxygen in whom alveolar formation is impaired (26). Our results indicate that hyperoxic exposure of the immature rat lung to high concentrations of oxygen does, in fact, alter tropoelastin gene transcription and suggest that continued exposure could decrease transcription in the premature infant as well.
| |
METHODS |
|---|
|
|
|---|
Isolation of Rat Lung Fibroblasts
The offspring of timed-pregnant Sprague-Dawley dams (Harlan Sprague Dawley, Indianapolis, IN) were used in these experiments. Fetuses (n = 10-12) were killed on days 18, 20, and 21 of gestation (term = 22 days). Postnatal pups (n = 3-5), born between 8 and 10 AM, were killed at ages ranging from 2 to 23 days. The day of birth was designated day 0.The lungs were removed, rinsed with calcium- and magnesium-free Hanks'
balanced salt solution (HBSS) and minced into 1- to 2-mm3 pieces. The minced lung
tissue was incubated in HBSS containing 0.3 mg/ml of type IV
collagenase and 0.5 mg/ml of trypsin in a shaking water bath maintained
at 37°C. At each of six 10-min intervals, the minced tissue was
passed through a 25-ml pipette 10 times to dissociate the cells. The
cells in suspension were then removed from the lung homogenate and
added to an equal volume of cold (4°C) complete medium containing
1:1 (vol/vol) DMEM-Ham's F-12, 10% fetal bovine serum, penicillin
(10,000 units/100 ml), streptomycin (10,000 µg/100 ml), and glutamine
(29.2 mg/100 ml). Enzymes and tissue culture reagents were purchased
from GIBCO BRL (Life Technologies, Grand Island, NY). Fresh collagenase-trypsin was then added to the
remaining lung homogenate, and the homogenate was returned to the
shaking water bath. At the end of the 1-h digestion, the cells were
pelleted by centrifugation, plated in complete medium in a T-75 flask,
and incubated at 37°C in 95% air-5%
CO2 for 1 h. The nonadherent cells
were aspirated, the flasks were rinsed thoroughly with HBSS, and the
adherent fibroblasts were frozen at
80°C. Although the
purity of each flask was not assessed before RNA extraction, this
differential adherence protocol has been found, in our hands, to result
in >95% fibroblasts at 24 h as evidenced by their spindle-shaped
appearance when viewed at the light-microscopic level and by
immunohistochemical staining for vimentin (39).
Extraction of Total RNA
Isolated fibroblasts and whole lungs were homogenized with a Polytron homogenizer (Brinkman Instruments, Westbury, NY). Total RNA was extracted from isolated fibroblasts with TRI-REAGENT-LS and from whole lung with TRI-REAGENT according to the manufacturer's recommended protocol (Molecular Research Center, Cincinnati, OH). Glycogen (100 µg) was used as a carrier when extracting RNA from isolated fibroblasts because the sample size was sometimes as low as 1-5 × 103 cells.RT-PCR
RT. RT-PCR (13) was performed with a Gene-Amp RNA PCR kit (Perkin-Elmer, Foster City, CA). The protocol recommended by the manufacturer was modified by adding 0.2 units of RNase-free DNase I (Worthington, Freehold, NJ) to remove contaminating DNA before the addition of reverse transcriptase (18). The primer pairs used to amplify tropoelastin hnRNA do not distinguish between genomic DNA and cDNA; thus the removal of contaminating genomic DNA was essential. The final reaction volume contained the following: 0.4 µg of RNA; 20 units of RNase inhibitor; 1 mM CaCl2; 1 mM each dGTP, dATP, dTTP, and dCTP; 5 mM MgCl2; 5 µM random hexamers; 1× PCR buffer II (10 mM Tris · HCl, pH 8.3, and 50 mM KCl); and 50 units of Moloney murine leukemia virus reverse transcriptase (added after the DNase treatment). The initial reaction mix (19 µl) was first incubated in the cycler (2400 Perkin-Elmer Cetus) for 30 min at 37°C to remove genomic DNA, then heated at 75°C for 5 min to inactivate DNase I, and cooled to 4°C. Next, 50 units (1 µl) of Moloney murine leukemia virus reverse transcriptase and 20 units of RNase inhibitor were added to the reaction mix, which was then incubated at room temperature for 10 min followed by a 30-min incubation at 42°C. The RT reaction was terminated by heating at 90°C for 5 min and cooling at 4°C for 5 min. Parallel no-RT reactions, in which 1 µl of diethyl pyrocarbonate-treated water was substituted for 1 µl of reverse transcriptase, were run for each sample and primer pair combination.PCR. The PCR amplification stock
solution was prepared on ice and aliquoted into separate tubes. Each 49 µl of stock solution contained 2 mM
MgCl2; 10 mM
Tris · HCl (pH 8.3); 50 mM KCl; 0.04 mM dCTP; 0.08 mM
each dGTP, dATP, and dTTP; 10 µCi of
[
-32P]dCTP (3,000 Ci/mmol); 1.25 units of AmpliTaq DNA polymerase; and 50 pmol of each
primer. After the addition of 1.0 µl of sample cDNA, the tubes were
placed in a cycler (2400 Perkin-Elmer Cetus) heated to 95°C and
incubated for 1 min 45 s to inactivate reverse transcriptase. The
heated cover on the 2400 Perkin-Elmer cycler prevented refluxing and
condensation during thermal cycling, thus avoiding the necessity to
overlay the tubes with mineral oil. The samples were then denatured at
94°C for 30 s, annealed at 60°C for 30 s, and extended at
72°C for 1.5 min. The number of amplification cycles ranged from 14 for cyclophilin and tropoelastin mRNA to 26 for tropoelastin hnRNA. The
radiolabeled PCR products were resolved by electrophoresis on 12.5%
polyacrylamide gels. The dried gels were quantitated with a
PhosphorImager (Molecular Dynamics, Sunnyvale, CA). Autoradiographic
films of the gels were also quantitated with a BioImager (Millipore,
Ann Arbor, MI). The identities of the amplified cDNAs were confirmed on
an automated sequencer (Perkin-Elmer) located in the Macromolecular
Structure Analysis Facility at the University of Kentucky (Lexington).
PCR Primers
The tropoelastin primers were designed to amplify two specific regions of tropoelastin RNA. The intron-specific primer pair, used to amplify hnRNA, contained sequences found in the 3' region of exon 35 (5' primer) and the 5' region of intron 35 (3' primer). The exon 35 primer and the intron 35 primer were used together to minimize the possibility that excised introns would also be amplified. The 5' forward primer and the 3' reverse-complement primer for tropoelastin hnRNA were AAAACCCCCGAAGCCCTA and ACCTCTGACTCTGTCTCTTT, respectively. The amplified product of the hnRNA primer pair is 94 bp. The primers used to amplify tropoelastin mRNA included the 5' forward primer for tropoelastin hnRNA described above and a 3' reverse-complement primer, ACATTCTCCACCAAGCAGTA, a sequence located in the 5' region of exon 36. The tropoelastin mRNA primer pairs resulted in a 154-bp PCR product. The sequences selected for tropoelastin primers and products avoided exons known to be alternatively spliced (17, 32). To amplify the cyclophilin 205-bp product, the 5' forward and 3' reverse-complement primer sequences used were ATGGTCAACCCCACCGTGTT and GCGTGTGAAGTCACCACCCT, respectively.In Vivo Exposure to Hyperoxia
On postnatal day 2, pups from four to five dams were assigned to new litters that were similar with respect to weight, ratio of male to female pups, and number of pups born to each dam. Hyperoxic exposures were initiated when the pups were 2-5 days of age. The pups were exposed to humidified oxygen at a flow rate of 10 l/min in a Lucite exposure chamber (17.5 × 19.5 × 9.5 inches) as described previously (4). The oxygen concentration in the chamber was maintained at >95%, with the exception of brief interruptions twice a day to replenish food and water, clean the exposure chambers, and rotate the dams from the hyperoxic to the normoxic environment or vice versa. The oxygen concentration in the exposure chamber was monitored at frequent intervals with oxygen sensor N.22 and oxygen analyzer S-3A/I (Omnitech Electronics, Columbus, OH). Control litters were maintained in room air in standard laboratory cages. Pups in both the control and exposed litters were weighed daily. At the end of the oxygen exposure, exposed and age-matched control pups were killed by a lethal intraperitoneal injection of pentobarbital sodium (120 mg/kg). The lungs were removed, and the fibroblasts were isolated as described in Isolation of Rat Lung Fibroblasts.Statistical Analysis of Data
The statistical significance of changes in signal for tropoelastin hnRNA and mRNA with increasing fetal and postnatal age was determined by Student's t-test with commercial software (Systat Version 7.0, SPSS, Chicago, IL). Values were considered to be significantly different when P < 0.05.| |
RESULTS |
|---|
|
|
|---|
RT-PCR Assay
Tropoelastin gene regulation at the transcriptional and posttranscriptional levels was evaluated with an RT-PCR assay to assess signals for both mRNA and hnRNA, the precursor of mRNA. The amount of hnRNA present is a function of the rates of transcription and processing and is, therefore, an indirect measure of transcriptional activity. The quantitation of hnRNA by RT-PCR permitted us to estimate the rate of gene transcription in as few as 1-5 × 103 freshly isolated rat lung fibroblasts. In contrast, quantitation of the rate of tropoelastin gene transcription by nuclear runoff assay would have required 1 × 107 cells and thus a prohibitively large number of animals.Total RNA from fibroblasts isolated from the lungs of 8- to 12-day-old rat pups was first treated with DNase I, which was subsequently heat denatured, and was then reverse transcribed and amplified for 25 cycles with intron-specific primers to amplify tropoelastin hnRNA. Parallel reactions that did not contain reverse transcriptase were run for each of the samples to verify the absence of genomic DNA. The PCR products were separated by PAGE, and the gel was stained with ethidium bromide to identify the molecular-weight standards, dried, and exposed to radiographic film. The 94-bp PCR product representing tropoelastin hnRNA was seen in each of the samples treated with reverse transcriptase but was absent in each of the samples not treated with reverse transcriptase, demonstrating the absence of contaminating genomic DNA after treatment with DNase I (Fig. 1). In all subsequent RT reactions, the absence of contaminating genomic DNA was confirmed for each RNA sample.
|
Initial experiments were conducted to optimize RT-PCR by determining the relationship of signal strength for tropoelastin hnRNA to the amount of input RNA and to the PCR cycle number. Conditions were first optimized for tropoelastin hnRNA because this was the least abundant of the RNAs to be evaluated. RNA obtained from whole lung homogenate from an 11-day-old rat was added in increasing amounts (0.05, 0.10, 0.30, 0.50, and 1.00 µg) to the RT reaction. After amplification for 24 cycles, the increase in tropoelastin hnRNA signal was found to be linearly proportional to input RNA as RNA increased from 0.05 to 0.5 µg. Between 0.5 and 1.0 µg of input RNA, the slope of the line leveled off slightly. Similar assays were conducted with both the tropoelastin mRNA and the cyclophilin primer pairs. When amplified for 19 cycles, the tropoelastin mRNA signal was linear between 0.1 and 0.5 µg of input RNA. Cyclophilin, a constitutively expressed gene (31), was also linear between 0.1 and 0.5 µg of input RNA when amplified for 18 cycles. In subsequent assays, 0.4 µg of input RNA was used to generate cDNA.
Using 0.4 µg of input RNA from fetal (day 21) rat lung fibroblasts, we then evaluated signal strength for tropoelastin hnRNA (20, 22, 24, and 26 cycles), tropoelastin mRNA (14, 16, 18, and 20 cycles), and cyclophilin (14, 16, 18, and 20 cycles). A linear increase in signal was observed for tropoelastin hnRNA from 22 to 26 cycles, for tropoelastin mRNA from 14 to 20 cycles, and for cyclophilin from 14 to 20 cycles.
Influence of Fetal vs. Postnatal Age on Expression of Tropoelastin hnRNA and mRNA in Isolated Fibroblasts
Tropoelastin hnRNA and mRNA were evaluated in freshly isolated rat lung fibroblasts obtained from 10-12 fetal pups in each of three litters at 18, 20, and 21 days of gestation (term is 22 days). The lungs were removed, and the fibroblasts were isolated as described in Isolation of Rat Lung Fibroblasts. Total RNA was reverse-transcribed and amplified, and the resultant PCR products were separated by PAGE (Fig. 2A). Unless otherwise indicated, the data were normalized for cyclophilin, a constitutively expressed gene (36). Upregulation of tropoelastin gene and message expression occurred late in gestation. From days 18 to 21 of gestation, there was a 4.5-fold increase in tropoelastin hnRNA levels and a 6-fold increase in tropoelastin mRNA levels (Fig. 2, B and C, respectively) When compared with levels on day 18 of gestation, both tropoelastin hnRNA and mRNA signals were increased significantly on fetal day 21 (P < 0.0001 and P = 0.002, respectively). Increases in both tropoelastin hnRNA and mRNA were also significant before normalization for cyclophilin (P = 0.004 and P = 0.014, respectively), indicating that the observed increases in tropoelastin hnRNA and mRNA from fetal days 18 to 21 were not an artifact of normalization for cyclophilin.
|
After birth, there was a significant decrease in both tropoelastin hnRNA (P = 0.021) and mRNA (P = 0.043) in lung fibroblasts (Fig. 3). Tropoelastin hnRNA levels decreased 58% from fetal day 21 (n = 4 litters) to postnatal day 2 (n = 3 litters); tropoelastin mRNA decreased 47% from fetal day 21 (n = 4 litters) to postnatal day 2 (n = 3 litters). A 50% decrease in tropoelastin hnRNA (P = 0.04) was seen from postnatal days 2 to 6 (n = 3 litters).
|
The results of the RT-PCR assay of single RNA samples from pooled fibroblasts obtained from 2-3 rat pups at each age from days 2 to 6 and from days 8 to 11 indicated that tropoelastin transcription is not further downregulated beyond postnatal day 3 and that transcription remains essentially unchanged from day 3 until days 9-11 when gene expression is again upregulated (Fig. 4). A comparison of tropoelastin hnRNA and mRNA signals from pooled lung fibroblasts obtained at ages ranging from day 18 of gestation until postnatal day 23 demonstrated that, once upregulated in the postnatal lung fibroblast, tropoelastin gene transcription remained upregulated on day 23, whereas mRNA was decreased in day 23 lung fibroblasts to levels that approximated those seen on fetal day 18, in agreement with the demonstration of posttranscriptional control of elastin expression in the mature lung by Swee et al. (37) (Fig. 5).
|
|
The late fetal and early postnatal changes in tropoelastin hnRNA versus mRNA were then compared by normalizing the data to the hnRNA and mRNA levels obtained on day 18 of gestation (Fig. 6). The percent increase in tropoelastin mRNA was consistently greater than the percent increase in hnRNA. This difference was particularly striking during days 9-11, suggesting an increase in mRNA stability during alveolarization. Taken together, these results indicate that tropoelastin gene expression is mediated at both the transcriptional and posttranscriptional levels in the rat lung fibroblast.
|
Influence of Postnatal Age at the Onset of Hyperoxic Exposure on the Developmental Expression of Tropoelastin hnRNA and mRNA in Whole Lung Homogenate and Isolated Fibroblasts
The influence of hyperoxic exposure on tropoelastin gene and message expression was evaluated in each of four separate oxygen exposure regimens. To approximate the range of gestational ages over which the premature infant is exposed to high concentrations of oxygen, exposures were initiated at multiple time points and continued for different periods of time during alveolar formation. Total RNA was extracted from whole lung homogenate in one of the hyperoxia exposure experiments. In three additional exposures, total RNA was extracted from pooled samples of freshly isolated lung fibroblasts.In the first exposure, whole lung homogenate was obtained from
11-day-old control rat pups and from pups continuously exposed to
>95% oxygen from 2 to 11, 3 to 11, or 5 to 11 days of age, for a
total exposure duration of 9, 8, or 6 days, respectively. The lungs
were removed and trimmed of extraneous tissue, and total RNA was
extracted from homogenized lungs and subjected to RT-PCR as described
in RT-PCR. Values for
tropoelastin hnRNA and mRNA were again normalized to cyclophilin. In
preliminary experiments, the expression of
-actin and cyclophilin
mRNAs in rat lung fibroblasts were compared. The ratios of
-actin to
cyclophilin were found to be essentially constant at five separate time
points during the course of an 8-day hyperoxic exposure. The mean value
(±SD) for the
-actin-to-cyclophilin ratio was 1.34 ± 0.19, indicating that the two constitutively expressed genes are equally
valid as standards for the normalization of the RT-PCR data from
oxygen-exposed rat lungs.
When compared with values seen in the 11-day control pups, signals for both tropoelastin hnRNA and tropoelastin mRNA were decreased in the lungs from pups exposed to hyperoxia from 2 to 11, 3 to 11, and 5 to 11 days (Fig. 7). Initiation of the exposure on day 3 resulted in an 83% decrease in both tropoelastin hnRNA and mRNA relative to 11-day control pups. Substantial decreases were also seen when the exposure was initiated on postnatal day 2 (52% for hnRNA and 66% for mRNA) or on postnatal day 5 (43% for hnRNA and 60% for mRNA). Although tropoelastin hnRNA and mRNA obtained from whole lung homogenate comprises the tropoelastin synthesized in any or all of three distinct compartments in the lung, the vasculature, airways, and stroma, the results of previous in situ hybridization experiments indicate that, on postnatal day 11, the tropoelastin mRNA signal in lung cells other than fibroblasts is minimal in rat pups (3).
|
In the second hyperoxic exposure, pups were continuously exposed to >95% oxygen from 3 to 11, 4 to 11, 5 to 11, or 6 to 11 days to further assess the effect of age at the onset of exposure on peak postnatal tropoelastin gene expression (Fig. 8). Values represent pooled samples of freshly isolated lung fibroblasts from 2-3 pups for each exposure regimen. There was no evidence of a consistent trend with increasing age at the onset of the exposure. Values for tropoelastin hnRNA were decreased to 9, 26, 44, and 19% of 11-day control values after exposure for 8, 7, 6, and 5 days, respectively. Tropoelastin mRNA values were increased to 134% of control values in the 4- to 11-day exposure regimen. For the 3- to 11-day exposure, tropoelastin mRNA values were 48% of 11-day control values; for the 5- to 11- and 6- to 11-day exposures, tropoelastin mRNA values were 76 and 92% of control values, respectively.
|
In the third experiment, we assessed the influence of duration of hyperoxic exposure on tropoelastin gene expression. The oxygen exposure was initiated on postnatal day 2, and the pups were exposed continuously to >95% oxygen until they were killed on days 6, 8, 9, 10, or 11 after exposure for 4, 6, 7, 8, or 9 days, respectively (Fig. 9). Hyperoxic exposure was again seen to alter tropoelastin gene and message expression when the values were compared with age-matched control values. Shorter exposure times, 4, 6, and 7 days, increased tropoelastin hnRNA 21, 40, and 21%, respectively. Tropoelastin mRNA levels were increased 261% after the 4-day exposure and 60% after the 6-day exposure. The 7-day exposure resulted in a 10% decrease in tropoelastin mRNA. After the 8- and 9-day exposures, both hnRNA and mRNA were decreased. The greater decrease was seen in the 8-day exposure; hnRNA was decreased by 59% and mRNA was decreased by 67%. The 9-day exposure resulted in more modest decreases in both hnRNA (28%) and mRNA (4%). Taken together, these results indicate that when exposure is initiated on postnatal day 2, shorter exposures of 4-7 days increased tropoelastin hnRNA and mRNA, whereas longer exposures, 8 or 9 days, are associated with a decrease in tropoelastin hnRNA and mRNA. There is no apparent explanation for the observation that the 8-day exposure resulted in a greater decrease in hnRNA and mRNA than the 9-day exposure.
|
In the fourth exposure regimen, we compared the effects of age when the exposure was initiated, 2 versus 3 days of age, on tropoelastin hnRNA and mRNA. The pups were exposed from 2 to 9, 10, or 11 days of age and from 3 to 9, 10, or 11 days of age (Fig. 10). The results of this exposure indicated that, when initiated on postnatal day 2 or 3, hyperoxic exposure decreased expression of tropoelastin hnRNA and mRNA relative to age-matched control values; however, a clear effect of the exposure start date was not seen in this experiment.
|
The combined results of the four exposures demonstrate that hyperoxic exposure caused a significant decrease in tropoelastin hnRNA or mRNA when initiated on postnatal day 2 or 3. After exposure for 2-11 days (n = 3 exposures), tropoelastin hnRNA values decreased 48 ± 18% relative to control values (P = 0.005); mRNA values decreased 44 ± 35% (P = 0.048). After exposure for 3-11 days (n = 3 exposures), tropoelastin hnRNA values decreased 75 ± 21% (P = 0.002) and mRNA values decreased 65 ± 16% (P = 0.001) relative to control values. The decreases seen in tropoelastin hnRNA and mRNA in pups exposed for 3-11 days were not significantly greater than the decreases seen in pups exposed for 2-11 days.
| |
DISCUSSION |
|---|
|
|
|---|
We have shown that tropoelastin gene transcription and message
expression in fetal rat lung fibroblasts are coordinately upregulated before birth, downregulated after birth, and then upregulated again
during alveolarization. Our conclusions regarding tropoelastin gene
transcription are based on the amplification and detection of
intron-specific sequences from recently transcribed hnRNA. Using
RT-PCR, we evaluated the steady-state levels of
tropoelastin hnRNA to provide an indirect measure of the
transcriptional activity of the gene. The amount of hnRNA present at
any given time is a function of both the rate of transcription and the
rate of nuclear processing. The use of this technique to assess rates
of gene transcription has been validated in recent studies comparing
hnRNA levels of genes for tropoelastin (37),
1(I) procollagen (37), and
stromelysin (40) with the results of nuclear runoff assays. The
temporal pattern of tropoelastin gene expression was assessed in
freshly isolated, as opposed to cultured, fibroblasts because of the
possibility that in vitro rates of tropoelastin gene transcription might not accurately reflect transcription rates in vivo.
Using an RT-PCR-based intron amplification technique similar to the one used herein, Swee et al. (37) reported that tropoelastin gene transcription, which was barely detectable in fetal day 19 lungs, was induced and upregulated by postnatal day 3 and that the level of gene expression seen on day 3 was maintained in the adult rat, although tropoelastin message expression had ceased. Confirmation of their RT-PCR results by nuclear runoff assays indicated that the continued expression of tropoelastin hnRNA in the adult lung fibroblast reflected ongoing transcription and was not attributable to slower processing of hnRNA. In the present study, we assessed tropoelastin hnRNA levels at multiple late fetal and early postnatal ages and found that tropoelastin gene transcription is, in fact, upregulated before day 3. Furthermore, we have shown that tropoelastin hnRNA levels on day 3 are decreased substantially from the peak levels seen in fetal day 21 lung fibroblasts, indicating that the upregulation of transcription seen before birth is a transient phenomenon.
Although the regulation of tropoelastin gene transcription has received
considerable attention, few studies have provided information that is
relevant to the developmental upregulation of tropoelastin gene
transcription in the perinatal rat lung fibroblast. Pierce et al. (33)
noted a dramatic increase in tropoelastin mRNA in whole lung homogenate
from 19 to 21 days of gestation and suggested that plasma cortisol,
which peaks on fetal day 19.5 and then
decreases steadily until birth (12), either induces or maintains
tropoelastin expression in the fetal lung. A significant increase in
tropoelastin mRNA in fetal day 19 fibroblasts cultured in the presence of
10
7 M cortisol for 24 h was
observed by Yee et al. (41). Cortisol was also found by these
investigators to activate the transcription of stable transfected cDNA
for TGF-
3 under the control of the glucocorticoid-inducible
long-terminal repeat promoter in a fetal rat lung fibroblast cell line.
Furthermore, inhibition of TGF-
3 production with antisense
oligonucleotides prevented the cortisol-induced increase in
tropoelastin mRNA, suggesting a role for this growth factor in the
regulation of tropoelastin expression. Observations by Swee et al. (37)
that dexamethasone, when administered to pregnant rats on
days
16-18 of
gestation, upregulates tropoelastin gene transcription in the fetal
lung by day 19 suggest that although endogenous glucocorticoids have a much lower affinity for
glucocorticoid receptors, cortisol may also influence tropoelastin
transcription in vivo.
Retinoic acid (RA), shown to upregulate tropoelastin gene transcription
in neonatal rat lung lipid interstitial fibroblasts (LIF) in vitro
(25), could also play a critical role in the regulatory control of this
gene during development. Subsequent studies by this group delineated
the developmental changes in retinoids in LIF (28).
All-trans RA and mRNAs for RA receptor (RAR)-
and RAR-
were observed to peak between fetal
day 19 and postnatal
day 2. Both RAR-
and RAR-
mRNAs
decreased by day 4, then increased
again on day 8. A further increase was
seen in RAR-
by day 12; however,
neither RAR mRNA reached the peak levels seen on postnatal
day 2. The close temporal correlation
with the developmental pattern of tropoelastin gene transcription
observed in the present study suggests that RA and RARs may influence
the regulatory control of tropoelastin transcription in rat lung LIF both preceding and during alveolarization. The administration of
exogenous glucocorticoids to human infants increases serum retinol concentrations (16); thus endogenous glucocorticoids may also
influence the bioavailability of RA.
We have observed a close correlation between changes in levels of
tropoelastin hnRNA and mRNA in late fetal and early postnatal lung
fibroblasts, consistent with the observations of others (31) that
upregulation of tropoelastin is controlled at the transcriptional level. In the adult lung fibroblast, however, tropoelastin expression is also controlled by posttranscriptional mechanisms (37). TGF-
1, which has no effect on tropoelastin gene transcription, has been shown
to increase tropoelastin mRNA stability in vitro both in LIF (29) and
in a human fetal lung fibroblast cell line (23). A role for TGF-
1 in
the relative increase in tropoelastin mRNA versus hnRNA seen in our
study on postnatal days
9-11 and in the marked decrease in tropoelastin mRNA but not in hnRNA in the
day 23 lung fibroblast is suggested by
observations that 8-day rat lungs contain 4.5 times more latent plus
endogenously active TGF-
than do adult lungs (29).
The second objective of this study was to assess the effects of in vivo hyperoxic exposure on the normal developmental pattern of tropoelastin gene transcription in rat lung fibroblasts. We have previously identified hyperoxia-induced changes in the expression of elastin protein (6) and tropoelastin mRNA (4) and demonstrated that postnatal age at the onset of the hyperoxic exposure influenced steady-state levels of tropoelastin mRNA in the postnatal lung (5). The present studies were conducted to determine whether transcriptional control of tropoelastin expression was altered by hyperoxic exposure during lung development. Our results indicated that hyperoxic exposure alters both tropoelastin gene transcription and steady-state levels of tropoelastin mRNA and that hnRNA and mRNA were coordinately regulated during the exposure. In three separate experiments, exposure to >95% oxygen, either from days 2 to 11 or from days 3 to 11, significantly decreased both tropoelastin hnRNA and mRNA relative to 11-day control values. When initiated on day 2, shorter exposures, e.g., 4 or 6 days, resulted in increased tropoelastin hnRNA and mRNA expression relative to age-matched control values, whereas the 7-day exposure had a negligible effect on tropoelastin expression.
Of the cytokines known to be involved in the inflammatory response to
hyperoxic exposure in the lung, the effects on tropoelastin expression
in lung fibroblasts are known for only a few. The early-response mediators of inflammation, tumor necrosis factor-
and
interleukin-1
, decrease tropoelastin gene transcription in dermal
fibroblasts (21) and LIF (1), respectively. Johnston et al. (20) found that although both cytokines peaked in the hyperoxic adult mouse lung
after 72 h, in the neonatal mouse, the increase in interleukin-1
was
delayed, peaking after 7.5 days of exposure. Peak levels of tumor
necrosis factor-
were seen after 10 days (20). Thus either or both
of these cytokines could contribute to the decreases in tropoelastin hnRNA and mRNA seen in pups exposed from
days 2 to 11 or from days
3 to 11.
Basic fibroblast growth factor (bFGF) could also play a role in the oxidant-induced alterations in tropoelastin gene transcription. bFGF has been shown by Brettel and McGowan (2) to decrease tropoelastin gene transcription, mRNA, and protein in rat lung LIF in vitro. Others have shown that a brief (3-4 day) hyperoxic exposure increased bFGF mRNA (34) and rates of transcription of both bFGF and the FGF flg receptor (7), whereas after a 14-day exposure, the rates of transcription of bFGF and the FGF flg receptor returned to control levels, bFGF decreased to levels slightly greater than the control level, and flg protein decreased to 50% of the control level (7). Furthermore, the bioavailability of bFGF stored in the extracellular matrix is also likely to be increased as a result of proteolytic degradation of the matrix during periods of tissue injury and repair in response to hyperoxia (14, 38).
Our observation that longer oxygen exposures decreased both tropoelastin hnRNA and mRNA is of potential relevance to the premature infant requiring prolonged ventilation with supplemental oxygen. Hyperoxic exposure dramatically impairs septation in the lungs of the neonatal rat (8), the premature infant (26), and the premature baboon (11). Because elastic fibers are thought to play a critical role in alveolarization (10), the results of the present study suggest that decreased rates of tropoelastin gene transcription in the immature lung exposed to hyperoxia could well be a factor in the impaired septation. Furthermore, the data imply that the response to hyperoxia may be a function of both age at onset and duration of exposure. The evidence presented herein for a biphasic response of tropoelastin gene transcription in the rat lung fibroblast during the late fetal and early postnatal period will facilitate studies directed at determining the relative importance of endogenous glucocorticoids, retinoids, and other factors in the regulatory control of the tropoelastin gene during lung development. It will be important to determine in future experiments the extent to which age at the onset of exposure and duration of the exposure influence tropoelastin gene expression to better predict the risk for hyperoxia-induced changes in tropoelastin gene expression in the premature infant.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Santosh Arcot and Charles Boyd for suggestions in the initial phase of this study, Steven Estus for advice regarding the optimization of reverse transcription-polymerase chain reaction conditions for the detection of tropoelastin heterogeneous nuclear RNA and for the primer pairs for cyclophilin, and Stephen McGowan for helpful discussions about the manuscript.
| |
FOOTNOTES |
|---|
This work was supported by National Heart, Lung, and Blood Institute Grant HL-31172 (to M. C. Bruce).
Address for reprint requests: M. C. Bruce, Dept. of Pediatrics, Division of Neonatology, Univ. of Kentucky, 800 Rose St., Lexington, KY 40536.
Received 2 September 1997; accepted in final form 25 February 1998.
| |
REFERENCES |
|---|
|
|
|---|
1.
Berk, J. L.,
C. Franzblau,
and
R. H. Goldstein.
Recombinant interleukin-1
inhibits elastin formation by a neonatal rat lung fibroblast subtype.
J. Biol. Chem.
266:
3192-3197,
1991
2.
Brettell, L. M.,
and
S. E. McGowan.
Basic fibroblast growth factor decreases elastin production by neonatal rat lung fibroblasts.
Am. J. Respir. Cell Mol. Biol.
10:
306-315,
1994[Abstract].
3.
Bruce, M. C.
Developmental changes in tropoelastin mRNA levels in rat lung: evaluation by in situ hybridization.
Am. J. Respir. Cell Mol. Biol.
5:
344-350,
1991.
4.
Bruce, M. C.,
E. N. Bruce,
K. Janiga,
and
A. Chetty.
Hyperoxic exposure of developing rat lung decreases tropoelastin mRNA levels that rebound postexposure.
Am. J. Physiol.
265 (Lung Cell. Mol. Physiol. 9):
L293-L300,
1993
5.
Bruce, M. C.,
C. Honaker,
and
P. Karathanasis.
Postnatal age at onset of hyperoxic exposure influences developmentally regulated tropoelastin gene expression in the neonatal rat lung.
Am. J. Respir. Cell Mol. Biol.
14:
177-185,
1996[Abstract].
6.
Bruce, M. C.,
R. Pawlowski,
and
J. F. Tomashefski.
Changes in lung elastic fiber structure and concentration associated with hyperoxia in the developing rat lung.
Am. Rev. Respir. Dis.
140:
1067-1074,
1989[Medline].
7.
Buch, S.,
R. N. N. Han,
J. Liu,
A. Moore,
J. D. Edelson,
B. A. Freeman,
M. Post,
and
A. K. Tanswell.
Basic fibroblast growth factor and growth factor receptor gene expression in 85% O2-exposed rat lung.
Am. J. Physiol.
268 (Lung Cell. Mol. Physiol. 12):
L455-L464,
1995
8.
Bucher, J. R.,
and
R. J. Roberts.
The development of the newborn rat lung in hyperoxia: a dose-response study of lung growth, maturation, and changes in antioxidant enzyme activities.
Pediatr. Res.
15:
999-1008,
1981[Medline].
9.
Burri, P. H.
Fetal and postnatal development of the lung.
Annu. Rev. Physiol.
46:
617-628,
1984[Medline].
10.
Burri, P. H.,
and
E. R. Weibel.
Ultrastructure and morphometry of the developing lung.
In: Development of the Lung, edited by W. A. Hodson. New York: Dekker, 1977, vol. 6, p. 215-268. (Lung Biol. Health Dis. Ser.)
11.
Coalson, J. J.,
V. Winter,
and
R. A. deLemos.
Decreased alveolarization in baboon survivors with bronchopulmonary dysplasia.
Am. J. Respir. Crit. Care Med.
152:
640-646,
1995[Abstract].
12.
Cohen, A.
Plasma corticosterone concentrations in the foetal rat.
Horm. Metab. Res.
5:
66,
1973[Medline].
13.
Estus, S.
Optimization and validation of RT-PCR as a tool to analyze gene expression during apoptosis.
In: NeuroMethods, edited by J. Poirier. Totowa, NJ: Humana, 1997, p. 67-84.
14.
Folkman, J.,
M. Klagsbrun,
J. Sasse,
M. Waszinski,
D. Ingber,
and
I. Vlodavsky.
A heparin-binding angiogenic protein-basic fibroblast growth factor is stored within basement membrane.
Am. J. Pathol.
130:
393-400,
1988[Abstract].
15.
Fukuda, Y.,
V. J. Ferrans,
and
R. G. Crystal.
The development of alveolar septa in fetal sheep lung. An ultrastructural and immunohistochemical study.
Am. J. Anat.
167:
405-439,
1983[Medline].
16.
Georgieff, M. K.,
M. C. Mammel,
M. M. Mills,
E. W. Gunter,
D. E. Johnson,
and
T. R. Thompson.
Effect of postnatal steroid administration on serum vitamin A concentrations in newborn infants with respiratory compromise.
J. Pediatr.
114:
301-304,
1989[Medline].
17.
Heim, R. A.,
R. A. Pierce,
S. B. Deak,
D. J. Riley,
C. D. Boyd,
and
C. A. Stolle.
Alternative splicing of rat tropoelastin mRNA is tissue-specific and developmentally regulated.
Matrix
11:
359-366,
1991[Medline].
18.
Huang, Z.,
M. J. Fasco,
and
L. S. Kaminsky.
Optimization of DNase I removal of contaminating DNA from RNA for use in quantitative RNA-PCR.
Biotechniques
20:
1012-1020,
1996[Medline].
19.
Jensen, D. E.,
C. B. Rich,
A. J. Terpstra,
S. R. Farmer,
and
J. A. Foster.
Transcriptional regulation of the elastin gene by insulin-like growth factor involves disruption of Sp1 binding. Evidence for the role of Rb in mediating Sp1 binding in aortic smooth muscle cells.
J. Biol. Chem.
270:
6555-6563,
1995
20.
Johnston, C. J.,
T. W. Wright,
C. K. Reed,
and
J. N. Finkelstein.
Comparison of adult and newborn pulmonary cytokine expression after hyperoxia.
Exp. Lung Res.
23:
537-552,
1997[Medline].
21.
Kahari, V.-M.,
Y. Q. Chen,
M. M. Bashir,
J. Rosenbloom,
and
J. Uitto.
Tumor necrosis factor-
down-regulates human elastin gene expression.
J. Biol. Chem.
267:
26134-26141,
1997
22.
Kida, K.,
and
W. M. Thurlbeck.
The effects of
-aminoproprionitrile on the growing rat lung.
Am. J. Pathol.
101:
693-710,
1980[Abstract].
23.
Kucich, U.,
J. C. Rosenbloom,
W. R. Abrams,
M. M. Bashir,
and
J. Rosenbloom.
Stabilization of elastin mRNA by TGF-
: initial characterization of signaling pathway.
Am. J. Respir. Cell Mol. Biol.
17:
10-16,
1997
24.
Lipson, K. E.,
and
R. Baserga.
Transcriptional activity of the human thymidine kinase gene determined by a method using the polymerase chain reaction and an intron-specific probe.
Proc. Natl. Acad. Sci. USA
86:
9774-9777,
1989
25.
Liu, R.,
C. Harvey,
and
S. E. McGowan.
Retinoic acid increases elastin in neonatal rat lung fibroblast cultures.
Am. J. Physiol.
265 (Lung Cell. Mol. Physiol. 9):
L430-L437,
1993
26.
Margraf, L. R.,
J. F. Tomashefski,
M. C. Bruce,
and
B. Dahms.
Morphometric analysis of the lung in bronchopulmonary dysplasia.
Am. Rev. Respir. Dis.
143:
391-400,
1991[Medline].
27.
McGowan, S. E.
Influences of endogenous and exogenous TGF-
on elastin in rat lung fibroblasts and aortic smooth muscle cells.
Am. J. Physiol.
263 (Lung Cell. Mol. Physiol. 7):
L257-L263,
1992
28.
McGowan, S. E.,
C. S. Harvey,
and
S. K. Jackson.
Retinoids, retinoic acid receptors, and cytoplasmic retinoid binding proteins in perinatal rat lung fibroblasts.
Am. J. Physiol.
269 (Lung Cell. Mol. Physiol. 13):
L463-L472,
1995
29.
McGowan, S. E.,
S. K. Jackson,
P. J. Olson,
T. Parekh,
and
L. I. Gold.
Exogenous and endogenous transforming growth factors-
influence elastin gene expression in cultured lung fibroblasts.
Am. J. Respir. Cell Mol. Biol.
17:
25-35,
1997
30.
O'Dell, B. L.,
K. H. Kilburn,
W. N. McKenzie,
and
R. J. Thurston.
The lung of the copper-deficient rat: a model for developmental pulmonary emphysema.
Am. J. Pathol.
91:
413-432,
1978[Abstract].
31.
Parks, W. C.
Posttranscriptional regulation of lung elastin production.
Am. J. Respir. Cell Mol. Biol.
17:
1-2,
1997
32.
Pierce, R. A.,
A. Alatawi,
S. B. Deak,
and
C. D. Boyd.
Elements of the rat tropoelastin gene associated with alternative splicing.
Genomics
12:
651-658,
1992[Medline].
33.
Pierce, R. A.,
W. Mariencheck,
S. Sandefur,
E. C. Crouch,
and
W. C. Parks.
Glucocorticoids upregulate tropoelastin expression during late stages of fetal lung development.
Am. J. Physiol.
268 (Lung Cell. Mol. Physiol. 12):
L491-L500,
1995
34.
Powers, M. R.,
S. R. Planck,
J. Berger,
M. A. Wall,
and
J. T. Rosenbaum.
Increased expression of basic fibroblast growth factor in hyperoxic-injured mouse lung.
J. Cell. Biochem.
56:
536-543,
1994[Medline].
35.
Rich, C.,
D. Z. Ewton,
B. M. Martin,
J. R. Florini,
M. Bashir,
J. Rosenbloom,
and
J. A. Foster.
IGF-I regulation of elastogenesis: comparison of aortic and lung cells.
Am. J. Physiol.
263 (Lung Cell. Mol. Physiol. 7):
L276-L282,
1992
36.
Ryffel, B.,
G. Woerly,
B. Greiner,
B. Haendler,
M. J. Mihatsch,
and
B. M. J. Foxwell.
Distribution of the cyclosporine binding protein cyclophilin in human tissues.
Immunology
72:
399-404,
1991[Medline].
37.
Swee, M. H.,
W. C. Parks,
and
R. A. Pierce.
Developmental regulation of elastin production: expression of tropoelastin pre-mRNA persists after down-regulation of steady-state mRNA levels.
J. Biol. Chem.
270:
14899-14906,
1995
38.
Thompson, K.,
and
M. Rabinovitch.
Exogenous leukocyte and endogenous elastases can mediate mitogenic activity in pulmonary artery smooth muscle cells by release of extracellular matrix-bound basic fibroblast growth factor.
J. Cell. Physiol.
166:
495-505,
1996[Medline].
39.
Uhal, B. D.,
and
D. E. Rannels.
DNA distribution analysis of type II pneumocytes by laser flow cytometry: technical considerations.
Am. J. Physiol.
261 (Lung Cell. Mol. Physiol. 5):
L296-L306,
1991
40.
Yang, M.,
and
M. Kurkinen.
Different mechanisms of regulation of the human stromelysin and collagenase genes: analysis by a reverse-transcription-coupled-PCR assay.
Eur. J. Biochem..
222:
651-658,
1994[Medline].
41.
Yee, W.,
J. Wang,
J. Liu,
I. Tseu,
M. Kuliszewski,
and
M. Post.
Glucocorticoid-induced tropoelastin expression is mediated via transforming growth factor-
3.
Am. J. Physiol.
270 (Lung Cell. Mol. Physiol. 14):
L992-L1001,
1996
This article has been cited by other articles:
![]() |
L. Cao, J. Wang, I. Tseu, D. Luo, and M. Post Maternal exposure to endotoxin delays alveolarization during postnatal rat lung development Am J Physiol Lung Cell Mol Physiol, May 1, 2009; 296(5): L726 - L737. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Boucherat, M.-L. Franco-Montoya, C. Thibault, R. Incitti, B. Chailley-Heu, C. Delacourt, and J. R. Bourbon Gene expression profiling in lung fibroblasts reveals new players in alveolarization Physiol Genomics, December 19, 2007; 32(1): 128 - 141. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Mondrinos, S. Koutzaki, P. I. Lelkes, and C. M. Finck A tissue-engineered model of fetal distal lung tissue Am J Physiol Lung Cell Mol Physiol, September 1, 2007; 293(3): L639 - L650. [Abstract] [Full Text] [PDF] |
||||
![]() |
P.-P. Kuang, X.-H. Zhang, C. B. Rich, J. A. Foster, M. Subramanian, and R. H. Goldstein Activation of elastin transcription by transforming growth factor-beta in human lung fibroblasts Am J Physiol Lung Cell Mol Physiol, April 1, 2007; 292(4): L944 - L952. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. D. Phelps, D. L. Updike, E. C. Bullen, P. Grammas, and E. W. Howard Transcriptional and posttranscriptional regulation of angiopoietin-2 expression mediated by IGF and PDGF in vascular smooth muscle cells Am J Physiol Cell Physiol, February 1, 2006; 290(2): C352 - C361. [Abstract] [Full Text] [PDF] |
||||
![]() |
P.-P. Kuang and R. H. Goldstein Regulation of elastin gene transcription by proteasome dysfunction Am J Physiol Cell Physiol, September 1, 2005; 289(3): C766 - C773. [Abstract] [Full Text] [PDF] |
||||
![]() |
P.-P. Kuang and R. H. Goldstein Regulation of elastin gene transcription by interleukin-1{beta}-induced C/EBP{beta} isoforms Am J Physiol Cell Physiol, December 1, 2003; 285(6): C1349 - C1355. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Veness-Meehan, R. A. Pierce, B. M. Moats-Staats, and A. D. Stiles Retinoic acid attenuates O2-induced inhibition of lung septation Am J Physiol Lung Cell Mol Physiol, November 1, 2002; 283(5): L971 - L980. [Abstract] [Full Text] [PDF] |
||||
![]() |
P.-P. Kuang, J. L. Berk, D. C. Rishikof, J. A. Foster, D. E. Humphries, D. A. Ricupero, and R. H. Goldstein NF-kappa B induced by IL-1beta inhibits elastin transcription and myofibroblast phenotype Am J Physiol Cell Physiol, July 1, 2002; 283(1): C58 - C65. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Srinivasan, J. Strange, F. Awonusonu, and M. C. Bruce Pre- and Postnatal Lung Development, Maturation, and Plasticity: Insulin-like growth factor I receptor is downregulated after alveolarization in an apoptotic fibroblast subset Am J Physiol Lung Cell Mol Physiol, March 1, 2002; 282(3): L457 - L467. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. R. Stenmark Cell-, age-, and phenotype-dependent differences in the control of gene expression Am J Physiol Lung Cell Mol Physiol, October 1, 2001; 281(4): L762 - L765. [Full Text] [PDF] |
||||
![]() |
A. Liebeskind, S. Srinivasan, D. Kaetzel, and M. Bruce Retinoic acid stimulates immature lung fibroblast growth via a PDGF-mediated autocrine mechanism Am J Physiol Lung Cell Mol Physiol, July 1, 2000; 279(1): L81 - L90. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Cooper, B. Mueck, S. Yousefi, S. Potter, and G. Jarai cDNA-RDA of genes expressed in fetal and adult lungs identifies factors important in development and function Am J Physiol Lung Cell Mol Physiol, February 1, 2000; 278(2): L284 - L293. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Awonusonu, S. Srinivasan, J. Strange, W. Al-Jumaily, and M. C. Bruce Developmental shift in the relative percentages of lung fibroblast subsets: role of apoptosis postseptation Am J Physiol Lung Cell Mol Physiol, October 1, 1999; 277(4): L848 - L859. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |