|
|
||||||||
Departments of 1 Pharmacology and 3 Biochemistry and 2 Respiratory Sciences Center, University of Arizona, Tucson, Arizona 85724
| |
ABSTRACT |
|---|
|
|
|---|
Inflammation plays a central role in the
pathogenesis of asthma. Glucocorticoids are first-line
anti-inflammatory therapy in the treatment of asthma and are effective
inhibitors of inflammatory cytokines. Clinical data demonstrate that
granulocyte-macrophage colony-stimulating factor (GM-CSF) production by
airway epithelial cells may be an important target of inhaled
glucocorticoid therapy. We examined the regulatory mechanisms of GM-CSF
expression by interleukin-1
(IL-1
) and the synthetic
glucocorticoid dexamethasone in the BEAS-2B human bronchial epithelial
cell line. IL-1
stimulation resulted in a 15-fold induction of
GM-CSF protein, which was associated with a corresponding 47-fold
maximal induction of GM-CSF mRNA levels. Treatment with the
transcriptional inhibitor actinomycin D before IL-1
stimulation
completely abolished induction of GM-CSF mRNA, whereas incubation with
cycloheximide had no effect. Taken together, these data demonstrate
that IL-1
induction of GM-CSF is mediated through transcriptional
mechanisms. Dexamethasone treatment of BEAS-2B cells produced an 80%
inhibition of IL-1
-induced GM-CSF protein and a 51% inhibition of
GM-CSF mRNA. GM-CSF mRNA was rapidly degraded in these cells, and
dexamethasone treatment did not significantly affect this decay rate.
We conclude that, in the BEAS-2B bronchial epithelial cell line,
IL-1
induction and dexamethasone repression of GM-CSF expression are
mediated predominantly through transcriptional mechanisms.
granulocyte-macrophage colony-stimulating factor; asthma; bronchial
epithelium; interleukin-1
; dexamethasone
| |
INTRODUCTION |
|---|
|
|
|---|
THE IMPORTANCE OF AIRWAY inflammation in the pathogenesis of asthma has been recognized during the past decade, and there is increasing evidence that lung cells and cytokines participate in the inflammatory process (4). Airway epithelial cells function as a protective barrier to the external environment but can also initiate and amplify airway inflammation by producing a number of proinflammatory mediators such as granulocyte-macrophage colony-stimulating factor (GM-CSF; see Refs. 12, 15, 25). GM-CSF plays a significant role in the inflammatory cascade by stimulating cell recruitment, activation, and survival (9). In normal airways, GM-CSF is expressed at low or undetectable levels but is significantly increased in the epithelium of asthmatics (24). This enhanced expression may contribute to eosinophilia, a hallmark characteristic observed in asthma (26, 27). In addition, clinical studies involving segmental antigen challenge and bronchoalveolar lavage of allergic asthmatics have shown that GM-CSF remains chronically elevated after challenge compared with other eosinophil-active cytokines (22). These data indicate important roles for both the bronchial epithelium and GM-CSF in mediating asthmatic inflammation.
Glucocorticoids are the most effective agents for the management of chronic asthma (5). The anti-inflammatory effects of glucocorticoids are attributed in part to inhibition of cytokine production. For example, in asthmatic patients, inhaled glucocorticoids significantly reduced GM-CSF secretion from the lung epithelium, and this reduction correlated with improved lung function and decreased airway hyperresponsiveness (24). In vitro studies have shown that steroids inhibit GM-CSF expression in human lung tissue as well as in tracheal epithelial cells (7, 12). These data suggest that bronchial epithelial cells are a target for glucocorticoids and can mediate an anti-inflammatory response in the airways, in part through decreased expression of GM-CSF. However, the specific mechanisms through which glucocorticoids reduce GM-CSF expression in airway epithelial cells or in other cell types have not been examined.
Glucocorticoids mediate their effects by binding to a cytoplasmic
glucocorticoid receptor, forming an active complex that can translocate
into the nucleus and regulate gene expression (5). Both transcriptional
and posttranscriptional mechanisms have been proposed for
glucocorticoid inhibition of cytokine gene expression based on in vitro
studies with other cell types. Transcriptional repression by
glucocorticoids may be mediated by interaction between the
glucocorticoid receptor and transcription factors, resulting in the
inactivation of stimulatory
trans-acting factors (8, 11, 16, 21),
or by glucocorticoid induction of inhibitor proteins, which prevent
translocation of transcription factors to the nucleus, thereby
preventing gene activation (3, 20). The glucocorticoids have also been
shown to destabilize mRNA transcripts through posttranscriptional
interactions (19, 28). The manner in which this destabilization occurs
is unknown. In this paper, we have addressed whether steroids inhibit
GM-CSF expression by transcriptional or posttranscriptional mechanisms
in airway epithelial cells. Our data show that interleukin-1
(IL-1
) induces GM-CSF mRNA and protein through transcriptional
activation and that glucocorticoids inhibit this induction by
transcriptional repression of GM-CSF.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Cell culture. The human bronchial
epithelial cell line BEAS-2B transformed with the SV40 large T-antigen
was a gift from Dr. C. Harris (National Institutes of Health, Bethesda,
MD). Cells were maintained on collagen-fibronectin-coated
15-cm2 intergrid tissue culture
plates (Falcon; VWR Scientific, Phoenix, AZ) in serum-free LHC-9 media
(Biofluids, Rockville, MD) supplemented with 50 µg/ml each
penicillin-streptomycin at 37°C and 5%
CO2 (14). Twenty-four hours before
experimental use, the culture media were replaced with
hydrocortisone-deficient LHC-9 media. Cells were harvested by
trypsinization (1× trypsin-EDTA; GIBCO-BRL, Gaithersburg, MD)
with 1% polyvinylpyrrolidone (Biofluids), pelleted at 800 g, and either immediately used for
experimentation or quick-frozen in liquid
N2 and stored at
80°C.
GM-CSF protein analysis. GM-CSF
protein assays were performed in six-well tissue culture plates
(Falcon) using BEAS-2B cells seeded at a density of 150,000 cells/well
in hydrocortisone-deficient LHC-9 media 24 h before use. At the start
of each experiment, culture media were replaced with fresh
hydrocortisone-deficient LHC-9 media (1 ml). After incubation for the
periods of time indicated, culture supernatants were collected and
pelleted at 16,000 g for 5 min to
remove cellular debris. Supernatants were stored at
20°C. GM-CSF protein was measured in the culture supernatants with a commercial sandwich enzyme-linked immunosorbent assay (ELISA; Amersham,
Arlington Heights, IL) using a mouse monoclonal antibody specific for
the human GM-CSF protein and a polyclonal antibody conjugated to the
horseradish peroxidase enzyme. Absorption was measured at 450 nm with a
spectrophotometer, and samples were quantitated from the linear portion
of the standard curve, with detection limits of 7.8 and 500 pg/ml.
GM-CSF probe construction. mRNA was
isolated from BEAS-2B cells stimulated with 1 ng/ml IL-1
for 8 h
using the guanidinium thiocyanate method (MicroFastTrack; Invitrogen,
San Diego, CA). mRNA (200 ng) was then transcribed to cDNA with random
hexamers and reverse transcriptase (200 units Superscript RT;
GIBCO-BRL). The following oligonucleotide primers were used for PCR
amplification of cDNA encoding the human GM-CSF gene. Oligonucleotide
primers 5'-A
CCCGCCTGGAGCTGTACAAG
(sense) and
5'-A
ACTGGCTCCCAGCAGTCAAA (antisense) were synthesized by National Biosciences (Plymouth, MN) and
corresponded to the human GM-CSF gene at positions 1662-1682 in
exon 3 and positions 2656-2675 in exon 4 (12). Restriction sites
for Not I (sense) and
Xho I (antisense) were incorporated at
the 5'-terminus of each primer and are underlined above. The PCR
reaction was performed in a 50-µl volume and contained 5 units of
Taq polymerase (Stratagene, La Jolla,
CA), 1.5× Taq polymerase buffer,
1 mM dNTPs, and 0.25 µg of each primer. Cycling parameters consisted
of an initial denaturation at 95°C for 4 min followed by 30 cycles
of annealing at 59°C for 2 min, extension at 72°C for 3 min,
and denaturation at 94°C for 1 min, with a final extension at
72°C for 10 min. The GM-CSF PCR product was cloned into the EcoR I site in the multiple cloning
region of the pCR2.1 vector by TA Cloning (Invitrogen). The resulting
clone, pCR-GM, contained 205 bp of the human GM-CSF gene and was used
for Northern blot analysis. pCR-GM was sequenced by Sanger dideoxy
termination sequencing (Sequenase; United States Biochemical,
Cleveland, OH) to confirm identity.
mRNA extraction and Northern blot
analysis. mRNA was extracted from BEAS-2B cells using
the guanidinium thiocyanate method (MicroFastTrack; Invitrogen). mRNA
pellets were resuspended in diethyl pyrocarbonate-treated
water, denatured, and separated by electrophoresis on a
1% agarose-7% formaldehyde gel. mRNA was transferred by capillary
action onto a nylon membrane (Nytran; Schleicher & Schuell, Keene, NH)
and immobilized by ultraviolet cross-linking. Membranes were
prehybridized at 42°C for 2 h. Sequential hybridization was done
overnight at 42°C with
[
-32P]dCTP-labeled
GM-CSF and cyclophilin cDNA probes. Membranes were stripped between
hybridizations by 15 min of gentle boiling in stripping solution. DNA
probes were labeled by incubation with random hexamers and Klenow
fragments (Boehringer Mannheim, Indianapolis, IN). GM-CSF was probed
with the 205-bp EcoR I fragment from
pCR-GM, and cyclophilin was probed with the 103-bp
Kpn
I-BamH I fragment from
pTRI-Cyclophilin-Hu (Ambion, Austin, TX). Prehybridization and
hybridization solution was 50% deionized formamide, 5× sodium chloride-sodium citrate (SSC), 0.2% SDS, 50 mM
KH2PO4,
pH 7.0, 2× Denhardt's solution, and 30 µg/ml salmon
testes DNA (Sigma Chemical, St. Louis, MO). Stripping solution was 0.1 M Tris · HCl, pH 8.0, 1% SDS, and 1 mM EDTA. After
hybridization, membranes were washed two times for 15 min in 0.1×
SSC and 0.1% SDS at room temperature and exposed to Kodak Biomax film
(Scientific Imaging Systems, New Haven, CT) for 4-48 h at
80°C. Autoradiographs were quantitated by densitometric
analysis using a Bio-Rad 700 Imager (Bio-Rad, Hercules, CA). The band
density for GM-CSF was calculated in ratio to the band density for
cyclophilin to control for mRNA loading. The ratio of GM-CSF to
cyclophilin was used to calculate the degree of induction of GM-CSF
mRNA (see Fig. 2B) and the percent inhibition of GM-CSF (see Figs. 4B and
5).
Reagents. Human recombinant IL-1
was purchased from Genzyme (Cambridge, MA). Dexamethasone (Dex) was
purchased from Sigma Chemical and was solubilized in 100% ethanol. The
glucocorticoid receptor antagonist RU-486 was a gift from
Roussel-UCLAF and was solubilized in 100% ethanol. Actinomycin D
was purchased from GIBCO-BRL. Cycloheximide (CHX) was purchased from
Calbiochem (La Jolla, CA).
Statistical methods. Data are presented as means ± SE. The slope variances for the data in Fig. 5 (n = 5 for each point) representing mRNA decay were tested with two regression models (log linear regression and quadratic linear regression) to determine statistical significance (10). Based on the adjusted r2 values and significance tests for the hypothesis of the coefficients, the data fit a log linear regression model. Individual experimental values for the inhibition studies shown in Figs. 4B and 6A were compared using the one-sample Student's t-test. For all analysis, statistical difference was inferred with P < 0.05.
| |
RESULTS |
|---|
|
|
|---|
GM-CSF protein expression in BEAS-2B
cells. The expression of GM-CSF protein in response to
IL-1
was examined in the BEAS-2B cell line. IL-1
was added to
each well of subconfluent BEAS-2B cells, and duplicate wells of culture
supernatants were collected at each time point (0, 1, 2, 4, 6, 8, and
10 h) and analyzed for GM-CSF protein by ELISA. IL-1
induced a
threefold increase in GM-CSF protein above the basal level after 2 h of
stimulation (Fig.
1A).
Protein levels continued to increase in a time-dependent manner, with a
15-fold induction observed after 10 h of stimulation. To determine if
this induction was dose dependent, BEAS-2B cells were incubated for 10 h with IL-1
concentrations ranging from 0.001 to 10 ng/ml. A
sigmoidal dose-response curve was observed, with a 50% effective
concentration of 0.2 ng/ml (Fig.
1B). Maximal induction of GM-CSF was
observed with 1 ng/ml IL-1
, and this concentration was used for all
subsequent experiments.
|
IL-1
induction of GM-CSF mRNA through
transcriptional mechanisms. GM-CSF mRNA levels were
measured by Northern blot analysis in BEAS-2B cells stimulated with
IL-1
(1 ng/ml). Basal levels of GM-CSF mRNA were extremely low;
however, after IL-1
stimulation, GM-CSF message was rapidly induced
and detected within 30 min (Fig. 2,
A and
B). An average 47 ± 14-fold
maximum induction of GM-CSF mRNA over basal levels was reached at 60 min (n = 4 individual experiments).
The transcript was estimated to be 0.9 kb by size comparison with
transcripts for cyclophilin (0.7 kb) and
-actin (1.0 kb).
Cyclophilin levels were analyzed after determination of GM-CSF levels
to control for mRNA loading and were not found to change with
treatment. The mechanism of transcriptional induction was examined by
incubating BEAS-2B cells with the transcription inhibitor actinomycin D
(10 µg/ml) for 30 min before IL-1
stimulation. GM-CSF mRNA
transcripts were not detectable in cells pretreated with actinomycin D
(Fig. 3A,
lanes 3,
5, and
7). To determine if de novo protein
synthesis was required for IL-1
transcriptional activation, the
protein synthesis inhibitor CHX (10 µg/ml) was added to the BEAS-2B
cells 30 min before IL-1
stimulation (Fig. 3B). GM-CSF mRNA transcripts were
not significantly reduced in cells pretreated with CHX (Fig. 3,
lanes 3 and
5). Treatment with CHX alone did not
cause significant inhibition of GM-CSF mRNA levels (Fig. 3,
lane 6). These data show that
IL-1
induction of GM-CSF mRNA in the BEAS-2B bronchial epithelial
cells is primarily due to transcriptional activation of the GM-CSF
gene, and de novo protein synthesis is not a significant requirement
for this activation.
|
|
Glucocorticoid inhibition of GM-CSF
mRNA. The glucocorticoid effect on GM-CSF mRNA
expression was examined by treating the BEAS-2B cells with IL-1
in
the presence and absence of the synthetic glucocorticoid hormone Dex.
mRNA was isolated at 0.5-h intervals for 2 h after treatment. Northern
analysis revealed a reduction in GM-CSF mRNA levels by 36 ± 3.4, 51 ± 13, and 47 ± 13% at the 60-, 90-, and 120-min time points,
respectively, in the presence of Dex (Fig.
4, A and
B).
|
Glucocorticoid regulation of GM-CSF mRNA
stability. To determine if Dex inhibition of GM-CSF
mRNA expression is a result of mRNA destabilization, we examined the
decay rate of GM-CSF mRNA in the presence and absence of Dex. BEAS-2B
cells were stimulated with either IL-1
alone or IL-1
and Dex for
2 h before the addition of actinomycin D. mRNA was isolated at 10-, 20-, and 30-min time points after actinomycin D treatment for Northern
analysis. No significant effect of Dex on GM-CSF mRNA decay rate was
demonstrated by comparison of the decay curves in the presence and
absence of Dex (Fig. 5). Data were fit to a
log linear regression model (P = 0.3624).
|
Glucocorticoid inhibition of GM-CSF
protein. BEAS-2B cells were incubated for 10 h with
IL-1
in the presence or absence of Dex and analyzed for GM-CSF
protein expression by ELISA as described in MATERIALS AND
METHODS. The presence of Dex caused an 80% inhibition of
IL-1
-induced GM-CSF protein expression (Fig.
6A,
P < 0.001). The glucocorticoid
receptor antagonist RU-486 prevented the inhibitory effect of Dex on
IL-1
-induced GM-CSF protein, demonstrating the involvement of the
glucocorticoid receptor (Fig. 6A).
RU-486 alone did not have a significant inhibitory effect on GM-CSF
protein (P > 0.1). BEAS-2B cells
were also incubated with Dex at selected time points before and after
IL-1
treatment to examine the kinetics of glucocorticoid inhibition
(Fig. 6B). Addition of Dex 1 h
before IL-1
stimulation resulted in equivalent inhibition to Dex
added simultaneously with IL-1
or 1 h after IL-1
stimulation. Later addition of Dex significantly reduced the ability of
glucocorticoids to inhibit IL-1
-induced GM-CSF protein.
|
| |
DISCUSSION |
|---|
|
|
|---|
Inflammatory cytokines such as GM-CSF are important in initiating and
amplifying the airway inflammatory response characteristic of asthma.
In this report, we examined the molecular mechanisms of GM-CSF
expression in the BEAS-2B bronchial epithelial cell line. The BEAS-2B
cells are immortalized human bronchial epithelial cells that maintain
phenotypic and genotypic characteristics of normal human bronchial
epithelial cells such as expression of keratin, normal doubling time,
sensitivity to serum, and lack of tumorigenicity (18). Previous work
done in our laboratory has shown the BEAS-2B cells to have a similar
number of glucocorticoid receptors and a similar binding affinity for
Dex to explanted cultures of primary human bronchial epithelial cells
(unpublished data). GM-CSF protein levels in these primary cultures
were shown to increase in response to IL-1
stimulation and decrease
with Dex treatment (unpublished data). These observations led us to believe the BEAS-2B cells would be an excellent model for analysis of
GM-CSF regulation.
In the absence of stimulation, the BEAS-2B cells secrete extremely low
levels of GM-CSF. The proinflammatory cytokine IL-1 is found in
elevated concentrations in the airways of asthmatics and has been shown
to stimulate GM-CSF expression in bronchial epithelial cells (6, 15).
In the BEAS-2B cells, we observed a significant induction of GM-CSF
protein and mRNA levels in response to IL-1
stimulation (Figs. 1 and
2). Transcripts were detected by Northern analysis within 30 min of
stimulation, suggesting that IL-1
was affecting GM-CSF expression
through direct transcriptional activation or posttranscriptional mRNA
stabilization. Other studies have examined the regulation of GM-CSF by
IL-1 and found evidence for both mechanisms, depending on the cell
type. In fibroblasts and glioblastoma cells, IL-1 induced GM-CSF mRNA
levels through transcriptional induction, as demonstrated by activation
of GM-CSF promoter constructs (13, 17). In contrast, in B lymphocytes, IL-1-induced GM-CSF mRNA levels were a result of increased mRNA stability (1). Little is known about mRNA stabilization mechanisms in
mammalian cells, but in studies examining mRNA instability, there is
evidence that adenosine-uridine (AU)-rich sequences found in the 3'-untranslated regions of several genes, including
GM-CSF, are involved in mediating mRNA degradation (19, 23). In our study, we found that IL-1
induction of GM-CSF expression was primarily due to direct transcriptional activation. Treatment of
BEAS-2B cells with the transcription inhibitor actinomycin D before
IL-1
stimulation completely abrogated the ability of IL-1
to
induce GM-CSF mRNA levels (Fig. 3). The complete lack of any detectable
GM-CSF transcripts in the cells pretreated with actinomycin D indicates
that IL-1
does not have a significant stabilization effect on
existing GM-CSF mRNA in these cells but does not completely rule out
this possibility.
We also investigated whether the induction of GM-CSF by IL-1
required de novo protein synthesis. We found that, in cells pretreated
with CHX, there was not a significant reduction in IL-1
-induced
GM-CSF mRNA transcripts at the time points tested (Fig.
3B), suggesting that there was not a
requirement for protein synthesis. However, there was an induction in
mRNA levels observed at the 2-h time point when cells were treated with
both IL-1
and CHX. We feel that this can be explained by studies
done in fibroblasts, which show that CHX can increase levels of GM-CSF RNA through posttranscriptional stabilization (2). From these results,
we cannot conclusively state that de novo protein synthesis is not
required for IL-1
induction of GM-CSF because the induction of mRNA
levels above that of cells treated with IL-1 alone is not seen at the
1-h time point. We feel that we can conclude that de novo protein
synthesis is not a significant requirement for the initial induction of
GM-CSF by IL-1
or a significant inhibition of mRNA transcripts would
have been observed at the 1-h time point. If these transcripts were due
entirely to the effect of CHX, we would have expected to see detectable
transcripts in lane 6 of Fig.
3B in which cells were treated with
CHX alone for 2.5 h.
Glucocorticoid therapy effectively relieves asthmatic airway
inflammation and inhibits inflammatory cytokine production in the cells
of the lung (5). Studies have shown that glucocorticoids inhibit GM-CSF
expression in both tracheal epithelial cells and human lung tissue (7,
12), but these studies have not addressed the mechanisms by which this
inhibition occurs. In this study, we observed that simultaneously
treating BEAS-2B cells with IL-1
and Dex resulted in a 50% decrease
in GM-CSF mRNA levels and an 80% decrease in secreted protein levels
(Figs. 4 and 6). Glucocorticoids produce their effects by binding and
activating cytoplasmic glucocorticoid receptors. The activated
glucocorticoid receptors can increase gene transcription by forming a
homodimer, translocating into the nucleus, and binding to DNA consensus
sites termed glucocorticoid response elements (5). However, in genes
downregulated by glucocorticoids, glucocorticoid response elements
are generally absent, indicating that glucocorticoids may function
through other mechanisms to inhibit expression of target genes.
Glucocorticoids have been shown to act through posttranscriptional
mechanisms to decrease mRNA stability. Zitnik et al. (28) showed that
glucocorticoids caused a 95% decrease in lung fibroblast interleukin-6
production, and this was attributed in part to a significant decrease
in the half-life of the interleukin-6 mRNA. In a study on regulation of
the cyclooxygenase-2 gene, Ristimaki et al. (19) found that glucocorticoids changed the half-life of cyclooxygenase-2 mRNA from 1 to 0.4 h in human synovial fibroblasts. The cyclooxygenase-2 gene
contains a conserved 3' AU-rich sequence similar to GM-CSF that
may be involved in cyclooxygenase-2 mRNA destabilization (19). We
examined the decay rate of GM-CSF mRNA in the BEAS-2B cells and found
that it was not significantly affected by glucocorticoid treatment
(Fig. 5). This indicates that the inhibition of GM-CSF protein and mRNA
levels in these epithelial cells is a result of transcriptional
repression rather than posttranscriptional mRNA instability.
We conclude that IL-1
induction and glucocorticoid repression of
GM-CSF gene expression in airway epithelial cells is mediated predominantly through transcriptional mechanisms. Future studies to
identify these transcriptional mechanisms will be important in defining
the molecular role of glucocorticoids in the treatment of asthma.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Dr. Duane Sherrill for assistance with the statistical analysis.
| |
FOOTNOTES |
|---|
This work was supported by National Heart, Lung, and Blood Institute Grant HL-14136 and by a grant from the Arizona Disease Control Research Commission, Phoenix, Arizona.
Address for reprint requests: J. W. Bloom, Respiratory Sciences Center, 1501 N. Campbell Ave., Tucson, AZ 85724.
Received 24 December 1997; accepted in final form 21 April 1998.
| |
REFERENCES |
|---|
|
|
|---|
1.
Akahane, K.,
R. B. Cohen,
M. Bickel,
and
D. H. Pluznik.
IL-1
induces granulocyte-macrophage colony-stimulating factor gene expression in murine B lymphocyte cell lines via mRNA stabilization.
J. Immunol.
146:
4190-4196,
1991[Abstract].
2.
Akashi, M.,
G. Shaw,
M. Gross,
M. Saito,
and
H. P. Koeffler.
Role of AUUU sequences in stabilization of granulocyte-macrophage colony-stimulating factor RNA in stimulated cells.
Blood
78:
2005-2012,
1991
3.
Auphan, N.,
J. A. Di Donato,
C. Rosette,
A. Helmberg,
and
M. Karin.
Immunosuppression by glucocorticoids: inhibition of NF-
B activity through induction of I
B synthesis.
Science
270:
286-290,
1995
4.
Barnes, P. J.
Cytokines as mediators of chronic asthma.
Am. J. Respir. Crit. Care Med.
150:
S42-S49,
1994.
5.
Bloom, J. W.,
and
R. L. Miesfeld.
Molecular mechanisms of glucocorticoid action.
In: Severe Asthma: Pathogenesis and Clinical Management, edited by S. J. Szefler,
and D. Y. M. Leung. New York: Dekker, 1996, p. 255-284.
6.
Broide, D. H.,
M. Lotz,
A. J. Cuomo,
D. A. Coburn,
E. C. Federman,
and
S. I. Wasserman.
Cytokines in symptomatic asthma airways.
J. Allergy Clin. Immunol.
89:
958-967,
1992[Medline].
7.
Churchill, L.,
B. Friedman,
R. P. Schleimer,
and
D. Proud.
Production of granulocyte-macrophage colony-stimulating factor by cultured human tracheal epithelial cells.
Immunology
75:
189-195,
1992[Medline].
8.
Cippitelli, M.,
A. Sica,
V. Viggiano,
J. Ye,
P. Ghosh,
M. J. Birrer,
and
H. A. Young.
Negative transcriptional regulation of the interferon-
promoter by glucocorticoids and dominant negative mutants of c-Jun.
J. Biol. Chem.
270:
12548-12556,
1995
9.
Cox, G.,
T. Ohtoshi,
C. Vancheri,
J. A. Denburg,
J. Dolovich,
J. Gauldie,
and
M. Jordana.
Promotion of eosinophil survival by human bronchial epithelial cells and its modulation by steroids.
Am. J. Respir. Cell Mol. Biol.
4:
525-531,
1991.
10.
Draper, N. R.,
and
H. Smith.
Applied Regression Analysis. New York: Wiley, 1966.
11.
Jonat, C.,
H. J. Rahmsdorf,
K. Park,
A. C. B. Cato,
S. Gebel,
H. Ponta,
and
P. Herrlich.
Antitumor promotion and antiinflammation: down-modulation of AP-1 (Fos/Jun) activity by glucocorticoid hormone.
Cell
62:
1189-1204,
1990[Medline].
12.
Kato, M.,
and
R. P. Schleimer.
Antiinflammatory steroids inhibit granulocyte/macrophage colony-stimulating factor production by human lung tissue.
Lung
172:
113-124,
1994[Medline].
13.
Kaushansky, K.
Control of granulocyte-macrophage colony-stimulating factor production in normal endothelial cells by positive and negative regulatory elements.
J. Immunol.
143:
2525-2529,
1989[Abstract].
14.
Lechner, J. F.,
and
M. A. LaVeck.
A serum-free method for culturing normal human bronchial epithelial cells at clonal density.
J. Tissue Culture Methods
9:
43-48,
1985.
15.
Marini, M.,
M. Soloperto,
M. Mezzetti,
A. Fasoli,
and
S. Mattoli.
Interleukin-1 binds to specific receptors on human bronchial epithelial cells and upregulates granulocyte/macrophage colony-stimulating factor synthesis and release.
Am. J. Respir. Cell Mol. Biol.
4:
519-524,
1991.
16.
Mukaida, N.,
M. Morita,
Y. Ishikawa,
N. Rice,
S. Okamoto,
T. Kasahara,
and
K. Matsushima.
Novel mechanism of glucocorticoid-mediated gene repression.
J. Biol. Chem.
269:
13289-13295,
1994
17.
Nimer, S. D.,
M. J. Gates,
H. P. Koeffler,
and
J. C. Gasson.
Multiple mechanisms control the expression of granulocyte-macrophage colony-stimulating factor by human fibroblasts.
J. Immunol.
143:
2374-2377,
1989[Abstract].
18.
Reddel, R. R.,
Y. Ke,
B. I. Gerwin,
M. G. McMenamin,
J. F. Lechner,
R. T. Su,
D. E. Brash,
J. G. Park,
J. S. Rhim,
and
C. C. Harris.
Transformation of human bronchial epithelial cells by infection with SV40 or adenovirus-12 SV40 hybrid virus, or transfection via strontium phosphate coprecipitation with a plasmid containing SV40 early region genes.
Cancer Res.
48:
1904-1909,
1988
19.
Ristimaki, A.,
K. Narko,
and
T. Hla.
Down-regulation of cytokine-induced cyclo-oxygenase-2 transcript isoforms by dexamethasone: evidence for post-transcriptional regulation.
Biochem. J.
318:
325-331,
1996.
20.
Scheinman, R. I.,
P. C. Cogswell,
A. K. Lofquist,
and
A. S. Baldwin, Jr.
Role of transcriptional activation of I
B-
in mediation of immunosuppression by glucocorticoids.
Science
270:
283-286,
1995
21.
Scheinman, R. I.,
A. Gualberto,
C. M. Jewell,
J. A. Cidlowski,
and
A. S. Baldwin, Jr.
Characterization of mechanisms involved in transrepression of NF-
B by activated glucocorticoid receptors.
Mol. Cell. Biol.
15:
943-953,
1995[Abstract].
22.
Shaver, J. R.,
J. G. Zangrilli,
S. K. Cho,
R. A. Cirelli,
M. Pollice,
A. T. Hastie,
J. E. Fish,
and
S. P. Peters.
Kinetics of the development and recovery of the lung from IgE-mediated inflammation: dissociation of pulmonary eosinophilia, lung injury, and eosinophil-active cytokines.
Am. J. Respir. Crit. Care Med.
155:
442-448,
1997[Abstract].
23.
Shaw, G.,
and
R. Kamen.
A conserved AU sequence from the 3' untranslated region of GM-CSF mRNA mediates selective mRNA degradation.
Cell
46:
659-667,
1986[Medline].
24.
Sousa, A. R.,
R. N. Poston,
S. J. Lane,
J. Nakhosteen,
and
T. H. Lee.
Detection of GM-CSF in asthmatic bronchial epithelium and decrease by inhaled corticosteroids.
Am. Rev. Respir. Dis.
147:
1557-1561,
1993[Medline].
25.
Stadnyk, A. W.
Cytokine production by epithelial cells.
FASEB J.
8:
1041-1047,
1994[Abstract].
26.
Xing, Z.,
T. Braciak,
Y. Ohkawara,
J. M. Sallenave,
R. Foley,
P. J. Sime,
M. Jordana,
F. L. Graham,
and
J. Gauldie.
Gene transfer for cytokine functional studies in the lung: the multifunctional role of GM-CSF in pulmonary inflammation.
J. Leukoc. Biol.
59:
481-488,
1996[Abstract].
27.
Xing, Z.,
Y. Ohkawara,
M. Jordana,
F. Graham,
and
J. Gauldie.
Transfer of granulocyte-macrophage colony-stimulating factor gene to rat lung induces eosinophilia, monocytosis, and fibrotic reactions.
J. Clin. Invest.
97:
1102-1110,
1996[Medline].
28.
Zitnik, R. J.,
N. L. Whiting,
and
J. A. Elias.
Glucocorticoid inhibition of interleukin-1-induced interleukin-6 production by human lung fibroblasts: evidence for transcriptional and post-transcriptional regulatory mechanisms.
Am. J. Respir. Cell Mol. Biol.
10:
643-650,
1994[Abstract].
This article has been cited by other articles:
![]() |
L. Zhou, A. Tan, S. Iasvovskaia, J. Li, A. Lin, and M. B. Hershenson Ras and Mitogen-Activated Protein Kinase Kinase Kinase-1 Coregulate Activator Protein-1- and Nuclear Factor-{kappa}B-Mediated Gene Expression in Airway Epithelial Cells Am. J. Respir. Cell Mol. Biol., June 1, 2003; 28(6): 762 - 769. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Suzuki, M. Yamaya, K. Sekizawa, N. Yamada, K. Nakayama, S. Ishizuka, M. Kamanaka, T. Morimoto, Y. Numazaki, and H. Sasaki Effects of dexamethasone on rhinovirus infection in cultured human tracheal epithelial cells Am J Physiol Lung Cell Mol Physiol, March 1, 2000; 278(3): L560 - L571. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ito, E. Jazrawi, B. Cosio, P. J. Barnes, and I. M. Adcock p65-activated Histone Acetyltransferase Activity Is Repressed by Glucocorticoids. MIFEPRISTONE FAILS TO RECRUIT HDAC2 TO THE p65-HAT COMPLEX J. Biol. Chem., August 3, 2001; 276(32): 30208 - 30215. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |