|
|
||||||||
1 Pulmonary Disease Division,
Department of Medicine, Veterans Affairs Medical Center, University
of Pennsylvania School of Medicine, Philadelphia, Pennsylvania
02908-9019; 2 Pulmonary and
Critical Care Section, Little is known about the effects of prolonged
hypoxic exposure on membrane ion transport activity. The
Na+/H+
antiport is an ion transport site that regulates intracellular pH in
mammalian cells. We determined the effect of prolonged hypoxic exposure
on human pulmonary arterial endothelial cell antiport activity, gene
expression, and localization. Monolayers were incubated under
hypoxic or normoxic conditions for 72 h. Antiport activity was
determined as the rate of recovery from intracellular acidosis. Antiport isoform identification and gene expression were determined with RT-PCR and Northern and Western blots. Antiport localization and
F-actin cytoskeleton organization were defined with immunofluorescent staining. Prolonged hypoxic exposure decreased antiport activity, with
no change in cell viability compared with normoxic control cells. One
antiport isoform
[Na+/H+
exchanger isoform (NHE) 1] that was localized to the basolateral cell surface was present in human pulmonary arterial endothelial cells.
Hypoxic exposure had no effect on NHE1 mRNA transcript expression, but
NHE1 protein expression was upregulated. Immunofluorescent staining
demonstrated a significant alteration of the F-actin cytoskeleton after
hypoxic exposure but no change in NHE1 localization. These results
demonstrate that the decrease in NHE1 activity after prolonged
hypoxic exposure is not related to altered gene expression. The change
in NHE1 activity may have important consequences for vascular
function.
chronic hypoxia; pulmonary arterial endothelial cells; intracellular pH; membrane ion transport
THE PULMONARY ENDOTHELIUM is exposed to variations in
oxygen tension during normal gas exchange and in disease states
involving the lungs and cardiovascular system. The endothelial cell
membrane is a key target of these changes in oxygen tension related to its unique location at the blood-tissue interface. Acute hypoxia alters
the activity of membrane ion transport systems in many different cell
types and organ systems (1, 2, 5, 19, 21-23, 41, 45, 47).
Hypoxia-induced changes in ion transport or intracellular ion
homeostasis in the endothelium have important functional consequences
related to changes in vascular reactivity that can modify gas exchange
in the lung (45).
Prior work concerning the relationship of oxygen tension to cell
function and ion transport has focused on the effects of an acute
change in oxygen tension lasting minutes to hours. Prolonged changes in
oxygen tension (hours to days) may also modify ion transport, leading
to changes in organ function (32, 34, 37, 39). The effects of a
prolonged change in oxygen tension on endothelial cell membrane ion
transport and cell function are poorly defined (21). One mechanism by
which changes in oxygen tension can alter membrane function is the
induction of changes in gene expression of specific receptors or ion
channels (36, 37). These studies raise the interesting possibility that
the endothelial cell membrane may be a specific target for vascular "remodeling" after hypoxic exposure in addition to other sites of
the vascular wall (44).
Na+/H+
exchangers (NHEs) are integral transmembrane proteins found in all
mammalian cells and play a role in the regulation of several processes
including intracellular pH
(pHi), cell volume, and
vectorial ion transport (17). Regulation of these cellular processes is
vital for maintaining optimal cell function and viability. In addition,
these exchangers also play a key role in the regulation of mediator
release from endothelial cells in response to external stimuli (3, 12,
13). These mediators (nitric oxide, platelet-activating factor, and
eicosanoids) have a significant impact on vascular function (14). Thus
involvement in basic cellular processes, including signal transduction
pathways involved in mediator release, suggests that changes in
antiport activity may modify vascular function.
Little is known about the effect of prolonged hypoxic exposure on the
activity of the membrane ion transport sites, including NHEs, that
regulate pHi. We hypothesized that
prolonged hypoxic exposure alters
Na+/H+
antiport [NHE isoform 1 (NHE1)] activity in human pulmonary
arterial endothelial cells (HPAECs). Using cultured human endothelial
cells, we defined the effect of prolonged hypoxic exposure on
Na+/H+
antiport activity and determined whether the observed changes in ion
transport activity were secondary to changes in antiport gene
expression or subcellular localization. To our knowledge, this is the
first study of the effect of a prolonged decrease in oxygen tension on
the activity and gene expression of a specific endothelial cell
membrane ion transport site that regulates
pHi.
Cell Culture and Reagents
![]()
ABSTRACT
Top
Abstract
Introduction
Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Methods
Results
Discussion
References
![]()
METHODS
Top
Abstract
Introduction
Methods
Results
Discussion
References
Experimental Design and Methods
The cell monolayers were incubated in EGM-2% FCS under either hypoxic (95% N2-5% CO2) or normoxic (21% O2-5% CO2-balance N2) conditions for 72 h. Hypoxic exposure (PO2 ~25-30 Torr) was achieved by incubation in an airtight chamber (Billups Rothenburg) for 72 h. Prior studies demonstrated the reliability of altering oxygen tensions with this method, with no significant changes in the osmolality, ionic content, or pH of the incubation medium (8, 32, 43). Monolayers were inspected with phase microscopy before the start of each experiment. We determined the effect of prolonged changes in ambient oxygen tension on endothelial cell Na+/H+ antiport activity, gene expression, and localization with the following protocols.Na+/H+
antiport activity.
Antiport activity, expressed as the rate of recovery from intracellular
acidosis, in monolayers incubated under either normoxic or hypoxic
conditions was determined with the fluoroprobe
2',7'-bis(carboxyethyl)-5,6-carboxyfluorescein (Molecular
Probes) as previously described (9). Measurement of
pHi with this probe is a dual
excitation-to-single emission ratio technique in which the ratio of the
pH-sensitive (490-nm) to the pH-insensitive (440-nm) fluorescent signal
provides a measurement of pHi that
is independent of fluoroprobe concentration or cell number.
Na+/H+
antiport activity is determined from the kinetics of acid recovery after acidification of the monolayers in MEM (pH 6.5) containing 1 µM
nigericin, in which choline chloride is substituted for NaCl on an
equimolar basis. This maneuver acidifies the monolayers related to the
ionophore-induced K+ exit from and
H+ entry into the cell. Acid
recovery is initiated by addition of normal
Na+-containing MEM. Under these
conditions, acid recovery is Na+
dependent and sensitive to blockade with amiloride analogs, which are
specific
Na+/H+
antiport inhibitors (9). Experiments are performed in nominally HCO
3-free, HEPES-buffered MEM to
minimize the activity of other
pHi-regulating systems. Antiport
activity is measured as the rate of recovery from acidosis 10-20 s
after the initiation of acid recovery over a well-defined pH range
(6.5-6.7) and is expressed as the change in
pHi per minute. The fluorescent signal is calibrated by the H+
equilibration method as previously described (4a, 9).
Determination of Na+/H+ antiport isoforms by RT-PCR. Total RNA was extracted with standard methods (7). Primers for the cDNA synthesis and PCR amplification of the four Na+/H+ antiport isoforms were chosen from the published rat sequences located near the 3'-end of the coding region where there are low sequence homologies between known antiport isoforms (4). cDNA was synthesized from RNA samples with 0.5 µg of oligo(dT) primer, 299 U of Moloney murine leukemia virus reverse transcriptase (GIBCO BRL), 0.5 mM deoxynucleotide 5'-triphosphate mix, 10 mM dithiothreitol in 22 µl of reaction buffer containing 100 mM Tris · HCl (pH 8.4), 50 mM KCl, and 2.5 mM MgCl2 for 1 h at 42°C. Each reaction was performed in parallel with an identical mixture without reverse transcriptase as a control. The reaction was terminated by heating to 95°C for 5 min.
For PCR, 10 µl of the cDNA solution were supplemented with a PCR mix to make a total volume of 100 µl. Each PCR reaction tube contained 10 mM Tris · HCl (pH 8.4), 50 mM KCl, 2.5 mM MgCl2, 0.5 mM deoxynucleotide 5'-triphosphate, 2.5 U Taq DNA polymerase (Promega)-7 µM anti-Taq polymerase antibody mixture, and 100 pmol of each NHE primer. Anti-Taq polymerase was used as an alternative to "hot start" PCR to optimize the reaction. A DNA thermal cycler (Perkin-Elmer GeneAmp PCR system 2400) executed the following protocol: 94°C for 4 min (initial melt); 35 cycles of 94°C for 1 min, 60°C for 1 min, and 72°C for 1.5 min; and then a final extension step of 72°C for 7 min. NHE1-4 primers for the PCR reactions were designed from the published rat sequences specific for each isoform as previously described (4, 42). These primers (3'
5') were NHE1 sense, TCTGCCGTCTCAACTGTCTCTA; NHE1 antisense, CCCTTCAACTCCTCATTCACCA; NHE2 sense, GCAGATGGTAATAGCAGCGA; NHE2 antisense,
CCTTGGTGGGGGCTTGGGTG; NHE3 sense, GGAACAGAGGCGGAGGAGCAT;
NHE3 antisense, GAAGTTGTGTGCCAGATTCTC; NHE4 sense,
GGCTGGGATTGAAGATGTATGT; and NHE4 antisense,
GCTGGCTGAGGATTCCTGTAA.
Na+/H+ antiport gene expression. Northern and Western blots were performed with probes for the NHE1 antiport isoform because this was the only isoform detected in both HPAECs and HPMECs.
NORTHERN BLOT. Poly(A)+ RNA was extracted from the monolayers with a commercially available kit (Ambion). Poly(A)+ RNA samples (5 µg/lane) were fractionated on a 1% agarose-formaldehyde gel and transferred to a nylon membrane. The membranes were prehybridized for 6 h at 65°C with 5× Denhardt's solution, 6× saline-sodium citrate (SSC; 1× SSC is 0.15 M NaCl and 0.015 M sodium citrate, pH 7.0), 1% SDS, 10% dextran sulfate, and 100 µg/ml of denatured salmon sperm DNA. The membranes were hybridized with the same solution containing 107 counts/min (cpm) of denatured 32P-labeled DNA probe at 65°C for 16 h. The membranes were washed two times in 2× SSC-0.5% SDS at room temperature for 10 min, followed by two washes in 0.1× SSC-0.5% SDS at 65°C for 20 min. Membranes were then exposed to Kodak XAR film at
70°C with the aid of an intensifying screen. Full-length cDNA of rat NHE1 was used as a
specific probe in the Northern blot analysis. The cDNAs were labeled
with
[32P]deoxynucleotides
with a random-primer labeling kit (Strategene). The NHE1 cDNAs were
generous gifts from Drs. Gary Shull (University of Cincinnati,
Cincinnati, OH) and John Orlowski (McGill University, Montreal,
Canada). We also compared the level of
-actin mRNA expression in
hypoxic versus normoxic cells to determine whether hypoxic exposure
altered endothelial cell transcript expression in a nonspecific manner.
WESTERN BLOT.
We compared the level of NHE1 protein expression in normoxic versus
hypoxic cells (72 h) with a Western analysis performed in the following
manner. Monolayers were lysed in Tris buffer (10 mM Tris, 2 mM
MgCl2, 2 mM EDTA, 2 mM EGTA, pH
7.4, 250 mM sucrose, 2 µg/ml of aprotonin, 2.5 µg/ml of leupeptin,
2 µg/ml of pepstatin, 1 mM
o-phenanthroline, and 1 mM
phenylmethylsulfonyl fluoride). Lysed cells were homogenized and
centrifuged at 800 g for 15 min at
4°C. The supernatant was subjected to high-speed centrifugation for
1 h at 40,000 g at 4°C to obtain a
crude membrane preparation that was resuspended in water for SDS-PAGE
and Western analysis. Membrane preparations were resolved by 10%
SDS-PAGE and electrotransferred to nitrocellulose membranes. An
antiserum (1:500 dilution) against NHE1 was used, and immunodetection
was enhanced with chemiluminescence with horseradish
peroxidase-conjugated goat anti-rabbit antibody (Amersham). The NHE1
antiserum was provided by Dr. Eugene Chang (University of Chicago,
Chicago, IL). This antibody to the cytoplasmic tail of NHE1 has been
characterized in prior studies as a reliable probe for the recognition
of the intact NHE1 protein (24).
Immunofluorescent staining for NHE1 and
F-actin. NHE1 localization and F-actin cytoskeleton
organization were determined with a double-label immunofluorescent
staining technique as previously described (46). Monolayers were fixed
with paraformaldehyde and incubated with rhodamine-phallodoin (1:20) or
primary antiserum (1:50) for 2 h. The monolayers were then rinsed and
incubated with the secondary antibody for 1 h, followed by mounting on
permanent glass slides. The primary NHE1 antibody (polyclonal
anti-rabbit IgG) was recognized by an FITC-conjugated anti-rabbit IgG
secondary antibody. An inverted microscope (Zeiss Axiovert TV100)
coupled to a confocal scanning unit (Bio-Rad MRC-1000) was used to
determine NHE1 localization and F-actin cytoskeleton organization.
Assessment of Cell Injury
We utilized a standard 51Cr-release assay to assess the degree of injury to HPAEC monolayers after hypoxic exposure as previously described (8, 9). Monolayers seeded onto 24-well plates were incubated for 72 h under either hypoxic or normoxic conditions. The monolayers were labeled with 51Cr 24 h before the start of an experiment by incubating the plates overnight in MEM plus 10% FCS containing 3 µCi/ml of sodium chromate-51/well. On the day of an experiment, the monolayers were washed two times with 0.5 ml of PBS (pH 7.35), fresh medium was added, and the monolayers were incubated for 72 h under either hypoxic or normoxic conditions. At the end of the incubation period, the medium in each well was harvested and centrifuged, and the radioactivity in the supernatant and pellet was determined in a gamma counter. Cell-bound 51Cr was determined by lysing the cells with 0.5 ml of 1 N NaOH added to each well for 5-10 min. The contents of each well were aspirated into a counting tube, and each well was also washed with 0.5 ml of PBS added to the cell lysate. The percentage of 51Cr release over 72 h under each condition was derived from the ratio of counts per minute released into the culture supernatant to the total counts per minute incorporated during labeling (total cpm = supernatant cpm + cell lysate cpm). The percentage of 51Cr release was determined in triplicate per plate. In each experiment, the average of these triplicate determinations was considered an n of 1. Injury was also assessed by the phase-microscopic appearance of the each monolayer.Determination of Buffering Capacity
Intracellular buffering capacity (
) was determined in standard
fashion with the NH4Cl prepulse
technique as previously described (4a). The monolayers were first
acidified in nominally Na+- and
HCO
3-free MEM and were then
sequentially exposed to decreasing concentrations of
NH4Cl (20, 10, 5, and 0 mM). These
stepwise reductions in extracellular
NH4Cl produce a fall in
pHi over the range of
~7.1-6.75 in our cell line. Each stepwise reduction in
NH4Cl leads to a new stable value
of pHi in each monolayer. The
change in extracellular NH+4 leads to a
change in pHi because
extracellular NH+4 rapidly dissociates to
NH3, which diffuses into the cells
and titrates protons. The magnitude of the change in
pHi is related to the intrinsic
buffering capacity. Buffering capacity was calculated as the amount of
acid load divided by the observed change in
pHi produced by this load
according to the following equation:
(in mM/U pH) =
[NH4]i/
pHi,
where
[NH4]i
is the change in the internal NH+4
concentration and
pHi represents the change in
pHi between successive doses of
NH4Cl. The acid load is estimated as the
[NH4]i
if it is assumed that all NH+4 leaves the
cell as NH3, releasing
H+ in the process.
[NH4]i
is calculated from the pHi value
in the presence of a given dose of
NH4Cl, with a
pKa value of 9.0 and the
assumption of a complete equilibration of intracellular and extracellular NH3 at an external
pH of 7.4. Buffering capacity was determined under conditions where the
Na+/H+
antiport was inhibited (Na+-free
MEM) to eliminate any contribution from this acid-extruding system. The
values for buffering capacity are expressed as means ± SE over a
specified pHi range as noted
above.
Data Analysis
Results are presented as means ± SE. Differences between means for percent 51Cr release and rate of acid recovery were compared with an unpaired t-test. Differences between means were considered significant if P was <0.05.| |
RESULTS |
|---|
|
|
|---|
Figure 1 illustrates the basic features of the pHi measurement protocol, including measurement of baseline pHi, acidification, acid recovery, and the results of a hypoxic exposure in an HPAEC monolayer. After measurement of baseline pHi, each monolayer was acidified and stabilized at an acidified value (pHi ~6.6), followed by the initiation of acid recovery with the addition of Na+-containing MEM as described in METHODS. A 72-h hypoxic exposure did not produce any significant change in baseline pHi compared with normoxic control monolayers incubated for a similar time period. In contrast, prolonged hypoxic exposure leads to a significant decrease in Na+/H+ antiport activity, measured as the initial rate of acid recovery, in large-vessel HPAEC monolayers compared with normoxic control cells incubated under identical conditions.
|
These data on the rate of acid recovery were confirmed by the averaged results for all the experiments illustrated in Fig. 2. In these experiments, we also determined if there was a significant difference in the rate of acid recovery in large-vessel HPAECs versus HPMECs after hypoxic exposure. Both cell types demonstrated a significant reduction in the rate of acid recovery under identical conditions. Thus there was no evidence of a heterogeneous response to a prolonged hypoxic exposure between pulmonary endothelial cells from different anatomic locations in the lung. In addition, there was no difference in baseline pHi in monolayers after prolonged hypoxic exposure versus normoxic control cells (data not shown). In separate experiments, we determined the buffering capacity of monolayers exposed to hypoxia for 72 h versus normoxic control monolayers under identical conditions. Buffering capacity was similar in both experimental groups (15.9 ± 2.0 and 11.9 ± 1.7 mM/pH for normoxic control and hypoxic monolayers, respectively, over a pHi range of 6.8-7.1). Thus an alteration in intrinsic buffering capacity cannot explain the diminished antiport activity after prolonged hypoxic exposure.
|
We determined the relationship among hypoxic exposure, diminished Na+/H+ antiport activity, and cell viability with two standard indexes of overt cell injury. Hypoxic exposure for 72 h did not alter endothelial cell viability, measured as percent 51Cr release (45.5 ± 0.6 and 56.5 ± 0.8% 51Cr release in hypoxic and normoxic control monolayers, respectively; n = 6/experimental group). These findings were confirmed with phase-contrast microscopy that demonstrated that the appearance of the monolayers was unaltered after a 72-h hypoxic exposure compared with normoxic control monolayers (data not shown). In fact, the 51Cr-release assay demonstrated that hypoxic exposure was associated with a small preservation of cell viability under these experimental conditions. These results suggest that the decrease in Na+/H+ antiport activity after prolonged hypoxic exposure cannot be explained on the basis of overt cell injury.
As illustrated in Fig. 3A, we identified the antiport isoform subtype in large-vessel HPAECs with RT-PCR with PCR primers created from published rat sequences, which are specific for NHE1-4 as previously described (4, 42). We identified only one specific RT-PCR reaction product in these cells using the probe for NHE1. The specificity of this reaction product for NHE1 was confirmed with the following criteria. First, the size of this reaction product was comparable to the expected size for NHE1 (~422 bp). Second, reamplification of this product with a pair of nested primers for NHE1 produced PCR products with the expected size of 213 bp (Fig. 3B). Third, restriction analysis of the product obtained from the nested primers with the restriction enzyme Apa I produced fragments with the expected sizes of 61 and 152 bp (Fig. 3C). As a positive control, PCR products of the same size were also detected in the human kidney (data not shown). These results indicate that large-vessel HPAECs contain only the NHE1 mRNA transcript of the Na+/H+ antiport. No other PCR reaction products were identified with specific probes for NHE2-4 in these cells. No PCR products were obtained when reverse transcriptase was omitted from the reaction. Similar findings were obtained with HPMECs (data not shown).
|
These results set the stage for the investigation of the effect of
prolonged hypoxic exposure on NHE1 gene expression. A representative Northern blot, illustrated in Fig. 4,
demonstrates that a 72-h hypoxic exposure did not alter steady-state
NHE1 mRNA transcript expression in large-vessel HPAECs compared with
normoxic control cells. This experiment was repeated several times
(n = 4) with similar results. There
was a similar qualitative lack of change in
-actin mRNA expression
after hypoxic exposure compared with normoxic control cells. These
results suggest that prolonged hypoxic exposure does not lead to a
change in NHE1 gene transcription rate or mRNA stability.
|
In Fig. 5, a representative Western blot illustrates the effect of a 72-h hypoxic exposure on NHE1 protein expression in membrane preparations of large-vessel HPAECs compared with normoxic control cells. In contrast to the reduction in NHE1 activity after hypoxic exposure (Figs. 1 and 2), we observed a modest increase in NHE1 protein expression after hypoxic exposure in membrane preparations from these cells. This experiment was repeated several times (n = 4) with similar results. A densitometric analysis indicated that NHE1 protein expression was increased 22.5 ± 6.1% compared with control cells. Thus diminished protein expression cannot account for the observed decrease in NHE1 activity in intact endothelial cell monolayers.
|
We determined the effect of hypoxic exposure on NHE localization and F-actin cytoskeletal organization with a double-label immunofluorescent staining technique in large-vessel HPAEC monolayers in which NHE1 was visualized with confocal microscopy. These experiments were performed at two time points after hypoxic exposure: 24 and 72 h. In normoxic control cells, NHE1 was almost exclusively localized to the surface of each monolayer that was in contact with the glass coverslip ("basolateral" surface). There was no visible NHE1 staining in these cells on the cell surface in contact with the environment ("apical" surface). A 24-h hypoxic exposure did not alter the appearance of the immunofluorescent staining or the normal basolateral location of NHE1 in these monolayers (data not shown). In contrast, a 24-h hypoxic exposure produced a significant change in F-actin cytoskeletal morphology, with a loss of central F-actin bands, compared with normoxic control cells. Hypoxic exposure for 72 h demonstrated similar findings, with no change in the normal basolateral NHE1 location and an even more prominent loss of central F-actin bands (Fig. 6).
|
| |
DISCUSSION |
|---|
|
|
|---|
The present results demonstrate that HPAECs in vitro possess the NHE1 of the Na+/H+ antiport. Prolonged hypoxic exposure decreases NHE1 activity, with no change in mRNA transcript expression and a modest increase in protein expression in membrane preparations from these cells. These findings were not associated with overt cell injury. These results indicate that prolonged hypoxic exposure changes the activity of a specific membrane ion transport site as part of a spectrum of altered membrane function. A similar decrease in NHE1 activity after prolonged hypoxic exposure was also observed in HPMECs, demonstrating the absence of a heterogeneous response to prolonged hypoxic exposure.
The pharmacological response to inhibition of the Na+/H+ antiport by amiloride analogs is an indicator of isoform subtype in a given cell or tissue (26). NHE1 is the amiloride analog-sensitive isoform of the Na+/H+ antiport. Prior work (4, 13) suggested the presence of this isoform in endothelial cells using this type of pharmacological characterization. Using a similar approach in prior work (8, 9), we predicted that pulmonary endothelial cells possess the amiloride-sensitive isoform (NHE1). In these studies, inhibition of Na+/H+ exchange with the amiloride analog methylisobutylamiloride (10 µmol/l) produced a >95% inhibition of acid recovery. Nevertheless, to our knowledge, the present work is the first direct demonstration of isoform subtype in any type of endothelial cell in vitro. As predicted, the present experiments demonstrate that HPAECs (and HPMECs) contain only the NHE1 located on the basolateral cell surface (Fig. 3, A-C). These results are compatible with findings in other cell types in vitro demonstrating that NHE1 is the ubiquitous antiport isoform found in all mammalian cells (17). NHE1 is involved in the regulation of pHi, cell volume, and growth and differentiation in selected cell types (17). NHE1 does not have any known role in vectorial ion transport as suggested for other antiport isoforms (NHE2-4) (4, 26). Therefore, the presence of this specific antiport isoform in pulmonary endothelial cells suggests that vectorial transport of Na+ in these cells does not involve the NHE. Extrapolation of these findings to the endothelium in vivo must await further study.
Acute hypoxia is associated with a decrease in membrane ion transport activity in a variety of cell types and organ systems. An acute change in oxygen tension inhibited K+-channel activity in chemoreceptor cells of the mammalian carotid body (23). In the liver, acute hypoxia decreased Na-K-ATPase activity in hepatocytes and sinusoidal endothelial cells, which was reversible within minutes of reperfusion with normoxic medium (3). Similar effects of acute hypoxic exposure on Na-K-ATPase activity were observed in the kidney and heart (19, 40). In the pulmonary vasculature, acute hypoxia leads to alterations of intracellular Ca2+ homeostasis and K+-channel activity, which have been implicated in the acute hypoxic pressor response in the whole lung (41, 45, 47).
In contrast, the effects of prolonged hypoxic exposure on membrane ion
transport are poorly defined. Prolonged hypoxia decreased the amplitude
of the action potential in the cardiac pacemaker cells related to
reduced inward Ca2+ current (22).
In brain capillary endothelial cells, prolonged hypoxic exposure
produced opposite effects on the ion transport mechanisms regulating
K+ uptake, leading to decreased
Na-K-ATPase activity but a compensatory increase in
Na+/K+/Cl
cotransport (21). A similar decrease in Na-K-ATPase
activity was noted in alveolar epithelial cells after prolonged hypoxic exposure (32). In the pulmonary vasculature, prolonged hypoxic exposure
augmented ion channel-dependent relaxation (34) and reduced the
rectifier K+ current in pulmonary
arterial smooth muscle cells (39). These complex, sometimes
contrasting, effects on different ion transport systems highlight the
difficulty of extrapolating the pattern of response from one cell type
to another (2, 11). In one of the few studies of the effects of
prolonged hypoxic exposure on lung cells, the modification of ion
transport was cell specific (32), illustrating this point. Endothelial
cells demonstrate heterogeneous responses to various stimuli (11).
Therefore, one cannot safely assume the presence of the same response
in similar cell types, even within the same organ system (2). Our
results demonstrate that the effect of prolonged hypoxic exposure on
NHE1 activity in HPAECs and HPMECs is uniform, with no evidence of a
heterogeneous response between these cell types.
Little is known about the effects of oxygen deficits on pHi and the ion transport sites, such as the Na+/H+ antiport, that regulate this parameter. In general, changes in pHi and intracellular Na+ concentration stimulate ion transport systems as part of a compensatory response to maintain intracellular ion homeostasis (1, 10). Cell types differ in their specific responses. In cardiac Purkinje fibers and brain tissue, acute hypoxic exposure or inhibition of oxidative phosphorylation ("chemical hypoxia") decreases pHi and increases intracellular Na+ concentration, an effect that is not modified by Na+/H+ antiport inhibition (5, 31). In contrast, chemical hypoxia acutely decreases pHi in hepatocytes, which is modified by Na+/H+ antiport inhibition (15). The present study is the first report on the effect of prolonged hypoxic exposure on pHi in endothelial cell monolayers. We did not demonstrate a significant change in baseline pHi, overt cell injury, or buffering capacity after prolonged hypoxic exposure compared with normoxic control cells despite the observed decrease in NHE1 activity. Differences in response to prolonged hypoxic exposure among cell types are not surprising because the cellular response is a complex adaptation involving more than one ion transport site (21). We speculate that the overall response is probably cell-type specific, related to differences in regulatory pathways and/or the basal activity of the ion transport systems in a given cell type.
Among mammalian cells, endothelial cells are noted for their tolerance to hypoxia, with little or no loss of viability compared with other cell types (30, 43). We confirmed these findings in the present study; hypoxic cells demonstrated no loss of viability after prolonged hypoxic exposure compared with normoxic control cells. Pulmonary endothelial cells, in particular, have a large capacity to maintain cell function under oxygen-deficit conditions and maintain or even increase the levels of intracellular ATP after prolonged hypoxic exposure (43). Severe ATP depletion (<10% of normal value) is associated with diminished antiport activity in other cell types (16, 26). Therefore, collectively, these data suggest that the observed decrease in NHE1 activity in pulmonary endothelial cells cannot be explained on the basis of cytotoxicity and/or ATP depletion.
The absence of a change in pHi or cell viability after prolonged hypoxic exposure led us to consider whether altered gene expression was involved in the change in NHE1 activity. Membrane proteins, including receptors, channels, and ion transporters, are key targets for hypoxia-induced changes in gene expression (20, 28, 30, 32, 36, 37). Recent studies in lung cells illustrate how hypoxia-induced changes in gene expression of membrane proteins can modify cell function. The upregulation of Na+ channels in alveolar epithelial cells in response to a change from a hypoxic to a normoxic environment at birth facilitates fluid absorption from alveoli in fetal lungs (28). Other membrane proteins in cells of the vascular wall are substrates for chronic hypoxia-induced remodeling of the cell membrane (4a, 37). These hypoxia-induced changes in membrane protein gene expression have the potential to induce significant changes in vascular function. However, the effect of prolonged hypoxic exposure on vascular function has not been determined. Based on this emerging evidence of altered gene expression of membrane proteins (4a, 37), we postulated that prolonged hypoxic exposure would alter NHE1 gene expression in pulmonary endothelial cells.
Hypoxic exposure might cause translational arrest or a nonspecific global decrease in protein synthesis observed in some hypoxia-sensitive cells (20). This hypothesis was refuted based on the absence of any change in NHE1 mRNA transcript expression (Fig. 4) in conjunction with a moderate increase in NHE1 protein expression in membrane preparations (Fig. 5). Therefore, the decrease in NHE1 activity that we observed cannot be explained as part of a decrease in ion transport activity secondary to a global decrease in protein synthesis. Prior findings (21, 30, 36, 37) demonstrate that prolonged hypoxic exposure induces complex cell- and tissue-specific changes involving both upregulation and downregulation of different membrane receptors or ion transport activity. Thus the present results cannot be directly extrapolated to other cell types or organ systems as noted above.
Similarly, the decrease in NHE1 activity cannot be explained by a specific effect of prolonged hypoxic exposure on antiport gene expression. Normal NHE1 mRNA transcript expression suggests that there is no significant change in the NHE1 gene transcription rate or mRNA stability after hypoxic exposure. The increase in NHE1 membrane protein expression indicates that a decrease in the number of antiporter molecules in the cell membrane cannot account for diminished NHE1 activity. Additional mechanisms of diminished NHE1 activity can also be eliminated. Insertion of NHE1 protein into a different membrane domain or internalization of NHE1 sites might theoretically account for a change in antiport activity (26, 27). These possibilities are unlikely based on the immunofluorescent staining results that demonstrate that hypoxic exposure did not alter the normal basolateral location of the protein in endothelial cells (Fig. 6). We cannot exclude the possibility that immunofluorescent staining may overestimate functional NHE1 sites in the membrane by recognizing sites that may be immunoreactive but that do not possess full ion transport capability.
Concurrent changes in NHE1 activity and F-actin cytoskeletal morphology after prolonged hypoxic exposure (Fig. 6) suggest another mechanistic possibility. Several ion transport sites, including Na-K-ATPase, Na+ channels, and the Na+/H+ antiport, are integral membrane proteins with functional links to integrins and associated cytoskeletal elements (6, 16, 18, 25, 33). For example, the Na+/H+ antiport colocalizes with F-actin (18), suggesting an important physical interaction of cytoskeletal elements with membrane ion transport sites. Oxygen deficits and ATP depletion lead to cytoskeletal rearrangement or disruption (25, 29, 30, 38) that can modify membrane ion transport. For example, in renal tubule cells, ATP depletion leads to a redistribution of Na-K-ATPase from the basolateral into the apical membrane domain and cytoplasm and a reduction in ATPase activity, along with alteration of the actin cytoskeleton (25). Our immunofluorescent findings, consisting of a loss of central actin fibers after prolonged hypoxic exposure, are very similar to the findings in bovine aortic endothelial cells under similar conditions (38). We did not demonstrate a change in NHE1 localization after hypoxic exposure, unlike the effect of ATP depletion on Na-K-ATPase distribution in renal tubule cells (25). Nevertheless, changes in cytoskeletal architecture may modify ion transport activity in a more subtle manner because changes in F-actin morphology are linked to a range of functional abnormalities in endothelial cells that occur in the absence of altered cell viability (30, 38).
In conclusion, the results suggest that the hypoxia-induced decrease in NHE1 activity is not the result of cell injury, altered NHE1 gene expression, a decrease in the number of NHE1 molecules in the cell membrane, or altered NHE1 localization. Because NHE1 activity is linked to the F-actin cytoskeleton (16, 18), we speculate that the change in NHE1 activity may be related to the hypoxia-induced alteration of this cytoskeletal component. Future experiments will be needed to explore this possibility and determine whether hypoxia-induced changes in the signal transduction pathway leading to antiport activation may also involve changes in NHE1 calcium sensitivity, altered sensitivity to Na+, or the phosphorylation sites of the protein.
These findings have implications for "remodeling" of the pulmonary vasculature after chronic hypoxic exposure. Our results suggest that the endothelial cell membrane may also be an important site for vascular remodeling after hypoxic exposure. Thus the endothelial cell membrane may respond or adapt to pathophysiological conditions with changes in ion transport activity similar to the other cells of the vascular wall (36, 37). An unanswered question is whether the NHE1 "adaptation" that we observed is beneficial or has pathophysiological consequences. In addition to its role in the regulation of pHi and ion homeostasis, NHE1 activity is linked to other endothelial cell functions including release of vasoactive mediators such as nitric oxide, prostanoids, and platelet-activating factor (3, 12, 13). Therefore, we speculate that a decrease in endothelial cell NHE1 activity may have important consequences for pulmonary vascular reactivity, cell viability, or remodeling of the vascular wall after hypoxic exposure.
| |
ACKNOWLEDGEMENTS |
|---|
We gratefully acknowledge the help of Dr. Eugene Chang for providing the sodium/hydrogen exchanger isoform 1 (NHE1) antiserum used in the Western analysis. The full-length complementary deoxyribonucleic acids of rat NHE1 used as a probe in the Northern analysis were generous gifts from Drs. Gary Shull (University of Cincinnati, Cincinnati, OH) and John Orlowski (McGill University, Montreal, Canada).
| |
FOOTNOTES |
|---|
This study was supported by the Veterans Affairs Merit Review Program (S. Rounds), the Cystic Fibrosis Foundation (S. Rounds), a grant from the Dean of Brown University, Providence, Rhode Island (to S. Rounds), and National Institute of Diabetes and Digestive and Kidney Diseases Grant R29-DK-47403 (to S. Sun).
A preliminary report of this work was presented at the American Thoracic Society Meeting in May 1997 and published in abstract form.
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Address for reprint requests: M. Cutaia, VA Medical Center, Research Service, 3900 University and Woodland Ave., Philadelphia, PA 19104-9019.
Received 16 January 1998; accepted in final form 18 May 1998.
| |
REFERENCES |
|---|
|
|
|---|
1.
Anderson, S. E. I.,
E. Murphy,
C. Steenberg,
R. E. London,
and
P. M. Cala.
Na+/H+ exchange in myocardium: effects of hypoxia and acidification on Na+ and Ca2+.
Am. J. Physiol.
259 (Cell Physiol. 28):
C940-C948,
1990
2.
Angermuller, S.,
M. Schunk,
K. Kusterer,
T. Konrad,
and
K. H. Usadel.
Alterations of Na/K ATPase activity after hypoxia and reoxygenation in the perfused rat liver: an electron microscopic cytochemical study.
J. Hepatol.
22:
565-575,
1995[Medline].
3.
Ayajiki, K.,
M. Kindermann,
M. Hecker,
I. Fleming,
and
R. Busse.
Intracellular pH and tyrosine phosphorylation but not calcium determine shear stress-induced nitric oxide production in native endothelial cells.
Circ. Res.
78:
750-758,
1996
4.
Borensztein, P.,
M. Froissart,
K. Laghmani,
M. Bichara,
and
M. Paillard.
RT-PCR analysis of Na+/H+ exchanger mRNAs in rat medullary thick ascending limb.
Am. J. Physiol.
268 (Renal Fluid Electrolyte Physiol. 37):
F1224-F1228,
1995
4a.
Boron, W. F.
Control of intracellular pH.
In: The Kidney: Physiology and Pathophysiology, edited by D. W. Seldin. New York: Raven, 1992, chapt. 9, p. 219-263.
5.
Bright, C. M.,
and
D. Ellis.
Intracellular pH changes induced by hypoxia and anoxia in isolated sheep heart Purkinje fibers.
Exp. Physiol.
77:
165-175,
1992[Abstract].
6.
Cantiello, H. E.
Role of the actin cytoskeleton on epithelial Na channel regulation.
Kidney Int.
48:
970-984,
1995[Medline].
7.
Chomczynski, P.,
and
N. Sacchi.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal. Biochem.
162:
156-159,
1987[Medline].
8.
Cutaia, M.,
and
N. Parks.
Oxidant stress decreases Na+/H+ antiport activity in bovine pulmonary artery endothelial cells.
Am. J. Physiol.
267 (Lung Cell. Mol. Physiol. 11):
L649-L659,
1994
9.
Cutaia, M. V.,
and
N. Parks.
Effect of hyperoxia and exogenous oxidant stress on pulmonary artery endothelial cell Na+/H+ antiport activity.
J. Lab. Clin. Med.
128:
154-164,
1996[Medline].
10.
Fukushima, T.,
T. K. Waddell,
S. Grinstein,
G. G. Goss,
J. Orlowski,
and
G. P. Downey.
Na+/H+ exchange activity during phagocytosis in human neutrophils: role of Fc
receptors and tyrosine kinases.
J. Cell Biol.
132:
1037-1052,
1996
11.
Gerritsen, M. E.,
and
C. M. Bloor.
Endothelial cell gene expression in response to injury.
FASEB J.
7:
523-532,
1993[Abstract].
12.
Gerritsen, M. E.,
C. A. Perry,
T. Moatter,
E. J. Cragoe,
and
M. S. Medow.
Agonist-specific role for Na+/H+ antiport in prostaglandin release from microvessel endothelium.
Am. J. Physiol.
256 (Cell Physiol. 25):
C831-C839,
1989
13.
Ghigo, D.,
F. Bussolino,
G. Gargarino,
R. Heller,
F. Turrini,
G. Pescarmona,
E. J. Cragoe,
L. Pegoraro,
and
A. Bosia.
Role of Na+/H+ exchange in thrombin-induced platelet-activating factor production by human endothelial cells.
J. Biol. Chem.
263:
19437-19446,
1988
14.
Giaid, A.,
and
D. Saleh.
Reduced expression of endothelial nitric oxide synthase in the lungs of patients with pulmonary hypertension.
N. Engl. J. Med.
333:
214-221,
1995
15.
Gores, G. J.,
A. L. Nieminen,
B. E. Wray,
B. Herman,
and
J. J. Lemasters.
Intracellular pH during chemical hypoxia in cultured rat hepatocytes: protection by intracellular acidosis against the onset of cell death.
J. Clin. Invest.
83:
386-396,
1989.
16.
Goss, G. G.,
M. Woodside,
S. Wakabayashi,
J. Pouyssegur,
T. Waddell,
G. P. Downey,
and
S. Grinstein.
ATP dependence of NHE-1, the ubiquitous isoform of the Na+/H+ antiporter: analysis of phosphorylation and subcellular localization.
J. Biol. Chem.
269:
8741-8748,
1994
17.
Grinstein, S.
Na+/H+ Exchange. Boca Raton, FL: CRC, 1988.
18.
Grinstein, S.,
M. Woodside,
T. K. Waddell,
G. P. Downey,
J. Orlowski,
J. Pouyssegur,
D. C. P. Wong,
and
J. K. Foskett.
Focal localization of the NHE-1 isoform of the Na+/H+ antiport: assessment of effects on intracellular pH.
EMBO J.
12:
5209-5218,
1993[Medline].
19.
Grinwald, P. M.
Sodium pump failure in hypoxia and reoxygenation.
J. Mol. Cell. Cardiol.
24:
1393-1398,
1992[Medline].
20.
Hochachka, P. W.,
L. T. Buck,
C. J. Doll,
and
S. C. Land.
Unifying theory of hypoxia tolerance: molecular/metabolic defense and rescue mechanisms for surviving oxygen lack.
Proc. Natl. Acad. Sci. USA
93:
9493-9498,
1996
21.
Kawai, N.,
R. M. McCarron,
and
M. Spatz.
Effect of hypoxia on Na/K/Cl cotransport in cultured brain capillary endothelial cells of the rat.
J. Neurochem.
66:
2572-2579,
1996[Medline].
22.
Kohlhardt, M.,
Z. Mnich,
and
G. Maier.
Alterations of the excitation process of the sinoatrial pacemaker cell in the presence of anoxia and metabolic inhibitors.
J. Mol. Cell. Cardiol.
9:
477-488,
1977[Medline].
23.
Lopez-Lopez, J.,
C. Gonzalez,
J. Urena,
and
J. Lopez-Barneo.
Low PO2 selectively inhibits K+ channel activity in chemoreceptor cells of the mammalian carotid body.
J. Gen. Physiol.
93:
1001-1015,
1989
24.
McSwine, R. L.,
G. Babnigg,
M. W. Musch,
E. B. Chang,
and
M. L. Villereal.
Expression and phosphorylation of NHE1 in wild-type and transformed human and rodent fibroblasts.
J. Cell. Physiol.
161:
351-357,
1994[Medline].
25.
Molitoris, B. A.,
A. Geerdes,
and
J. R. McIntosh.
Dissociation and redistribution of Na/K ATPase from its surface membrane actin cytoskeletal complex during cellular ATP depletion.
J. Clin. Invest.
88:
462-469,
1991.
26.
Noel, J.,
and
J. Pouyssegur.
Hormonal regulation, pharmacology, and membrane sorting of vertebrate Na+/H+ exchanger isoforms.
Am. J. Physiol.
268 (Cell Physiol. 37):
C283-C296,
1995
27.
Noel, J.,
D. Roux,
and
J. Pouyssegur.
Differential localization of Na+/H+ exchanger isoform (NHE1 and NHE3) in polarized epithelial cell lines.
J. Cell Sci.
109:
929-939,
1996[Abstract].
28.
Pitkanen, O.,
A. K. Transwell,
G. Downey,
and
H. O'Brodovich.
Increased PO2 alters the bioelectric properties of fetal distal lung epithelium.
Am. J. Physiol.
270 (Lung Cell. Mol. Physiol. 14):
L1060-L1066,
1996
29.
Phillips, P. G.,
L. M. Birnby,
and
A. Narendram.
Hypoxia induces capillary network formation in cultured bovine pulmonary microvessel endothelial cells.
Am. J. Physiol.
268 (Lung Cell. Mol. Physiol. 12):
L789-L800,
1995
30.
Pinsky, D.,
and
D. Stern.
Hypoxia-induced modulation of endothelial cell function.
In: Reperfusion Injuries and Clinical Capillary Leak Syndrome, edited by B. A. Zikria,
M. O. Oz,
and R. W. Carlson. Armonk, NY: Futura, 1994, chapt. 2, p. 31-55.
31.
Pirttila, T. R.,
and
R. A. Kauppinen.
Recovery of intracellular pH in cortical brain slices following anoxia studied by nuclear magnetic resonance spectroscopy: role of lactate removal, extracellular sodium and sodium/hydrogen exchange.
Neuroscience
47:
155-164,
1992[Medline].
32.
Planes, C.,
G. Friedlander,
A. Loiseau,
C. Amiel,
and
C. Clerici.
Inhibition of Na-K-ATPase activity after prolonged hypoxia in an alveolar epithelial cell line.
Am. J. Physiol.
271 (Lung Cell. Mol. Physiol. 15):
L70-L78,
1996
33.
Prat, A. G.,
E. J. Holtzman,
D. Brown,
C. C. Cunningham,
I. L. Reisin,
T. R. Kleyman,
M. McLaughlin,
G. R. Jackson,
J. Lydon,
and
H. R. Cantiello.
Renal epithelial protein (Apx) is an actin cytoskeleton-regulated Na+ channel.
J. Biol. Chem.
271:
18045-18053,
1996
34.
Rodman, D. M.
Chronic hypoxia selectively augments rat pulmonary artery Ca2+ and K+ channel-mediated relaxation.
Am. J. Physiol.
263 (Lung Cell. Mol. Physiol. 7):
L88-L94,
1992
36.
Schmedtje, J. F.,
W. L. Liu,
and
Y. Chen.
pH is critical to the regulation of expression of the beta2-adrenergic receptor gene in hypoxia.
Biochim. Biophys. Acta
1314:
25-33,
1996[Medline].
37.
Shaul, P. W.,
K. H. Muntz,
D. DeBeltz,
and
L. M. Buja.
Effects of prolonged hypoxia on adenylate cyclase activity and beta-adrenergic receptors in pulmonary and systemic arteries of the rat.
Circ. Res.
66:
1526-1534,
1990
38.
Shreeniwas, R.,
S. Ogawa,
F. Cozzolino,
G. Torcia,
N. Braunstein,
C. Butura,
J. Brett,
H. B. Lieberman,
M. B. Furie,
J. Joseph-Silverstein,
and
D. Stern.
Macrovascular and microvascular endothelium during long-term hypoxia: alterations in cell growth, monolayer permeability, and cell surface coagulant properties.
J. Cell. Physiol.
146:
8-17,
1991[Medline].
39.
Smirnov, S.,
T. Robertson,
J. Ward,
and
P. Aaronson.
Chronic hypoxia is associated with reduced delayed rectifier K+ current in rat pulmonary artery muscle cells.
Am. J. Physiol.
266 (Heart Circ. Physiol. 35):
H365-H370,
1994
40.
Spiegel, D.,
P. D. Wilson,
and
B. A. Molitoris.
Epithelial polarity following ischemia: a requirement for normal cell function.
Am. J. Physiol.
257 (Renal Fluid Electrolyte Physiol. 26):
F430-F436,
1989.
41.
Stevens, T.,
D. N. Cornfield,
I. F. McMurtry,
and
D. M. Rodman.
Acute reductions in PO2 depolarize pulmonary artery endothelial cells and decrease [Ca2+]i.
Am. J. Physiol.
266 (Heart Circ. Physiol. 35):
H1416-H1421,
1994
42.
Sun, A. M.,
Y. Liu,
J. N. Centracchio,
E. M. Tolbert,
and
L D. Dworkin.
Sodium-proton exchanger isoform expression and function in the terminal inner medullary collecting duct (Abstract).
J. Am. Soc. Nephrol.
8:
11A,
1997.
43.
Tretyakov, A. V.,
and
H. W. Farber.
Endothelial cell tolerance to hypoxia: potential role of purine nucleotide phosphates.
J. Clin. Invest.
95:
738-744,
1995.
44.
Voelkel, N. F.,
and
R. M. Tuder.
Cellular and molecular mechanisms in the pathogenesis of severe pulmonary hypertension.
Eur. Respir. J.
8:
2129-2138,
1995[Abstract].
45.
Weir, E. K.,
and
S. L. Archer.
The mechanism of acute hypoxic pulmonary vasoconstriction: the tale of two channels.
FASEB J.
9:
183-189,
1995[Abstract].
46.
Woodard, M.,
W. A. Dunn,
R. O. Laine,
L. M. Malandro,
R. McMahon,
O. Simell,
E. R. Block,
and
M. S. Kilberg.
Plasma membrane clustering of system y+ (CAT-1) amino acid transporter as detected by immunohistochemistry.
Am. J. Physiol.
266 (Endocrinol. Metab. 29):
E817-E824,
1994
47.
Zhang, R.,
R. C. Carson,
H. Zhang,
G. Gibson,
and
H. M. Thomas.
Pulmonary artery smooth muscle cell [Ca2+] and contraction: responses to diphenyleneiodonium and hypoxia.
Am. J. Physiol.
273 (Lung Cell. Mol. Physiol. 17):
L603-L611,
1997
This article has been cited by other articles:
![]() |
S. Hom, M. A. Fleegal, R. D. Egleton, C. R. Campos, B. T. Hawkins, and T. P. Davis Comparative changes in the blood-brain barrier and cerebral infarction of SHR and WKY rats Am J Physiol Regulatory Integrative Comp Physiol, May 1, 2007; 292(5): R1881 - R1892. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Shimoda, M. Fallon, S. Pisarcik, J. Wang, and G. L. Semenza HIF-1 regulates hypoxic induction of NHE1 expression and alkalinization of intracellular pH in pulmonary arterial myocytes Am J Physiol Lung Cell Mol Physiol, November 1, 2006; 291(5): L941 - L949. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. J. Rios, M. Fallon, J. Wang, and L. A. Shimoda Chronic hypoxia elevates intracellular pH and activates Na+/H+ exchange in pulmonary arterial smooth muscle cells Am J Physiol Lung Cell Mol Physiol, November 1, 2005; 289(5): L867 - L874. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. H. Nemeth, E. A. Deitch, Q. Lu, C. Szabo, and G. Hasko NHE blockade inhibits chemokine production and NF-kappa B activation in immunostimulated endothelial cells Am J Physiol Cell Physiol, August 1, 2002; 283(2): C396 - C403. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Gumina, J. Moore, P. Schelling, N. Beier, and G. J. Gross Na+/H+ exchange inhibition prevents endothelial dysfunction after I/R injury Am J Physiol Heart Circ Physiol, September 1, 2001; 281(3): H1260 - H1266. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Madden, D. E. Ray, P. A. Keller, and J. G. Kleinman Ion exchange activity in pulmonary artery smooth muscle cells: the response to hypoxia Am J Physiol Lung Cell Mol Physiol, February 1, 2001; 280(2): L264 - L271. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Cutaia, K. Tollefson, J. Kroczynski, N. Parks, and S. Rounds Role of the Na/H antiport in pH-dependent cell death in pulmonary artery endothelial cells Am J Physiol Lung Cell Mol Physiol, March 1, 2000; 278(3): L536 - L544. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. D’Arcangelo, F. Facchiano, L. M. Barlucchi, G. Melillo, B. Illi, L. Testolin, C. Gaetano, and M. C. Capogrossi Acidosis Inhibits Endothelial Cell Apoptosis and Function and Induces Basic Fibroblast Growth Factor and Vascular Endothelial Growth Factor Expression Circ. Res., February 18, 2000; 86(3): 312 - 318. [Abstract] [Full Text] [PDF] |
||||
| ||||||