AJP - Lung Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 275: L442-L451, 1998;
1040-0605/98 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cutaia, M. V.
Right arrow Articles by Sun, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cutaia, M. V.
Right arrow Articles by Sun, A. M.
Vol. 275, Issue 3, L442-L451, September 1998

Effect of hypoxic exposure on Na+/H+ antiport activity, isoform expression, and localization in endothelial cells

M. V. Cutaia1, N. Parks2, J. Centracchio3, S. Rounds2, K. P. Yip4, and A. M. Sun3

1 Pulmonary Disease Division, Department of Medicine, Veterans Affairs Medical Center, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania 02908-9019; 2 Pulmonary and Critical Care Section, Department of Medicine, Veterans Affairs Medical Center and Brown University School of Medicine, Providence 02908; 3 Renal Division, Department of Medicine, Rhode Island Hospital, Providence 02903; and 4 Division of Biology and Medicine, Department of Physiology, Brown University, Providence, Rhode Island 02906

    ABSTRACT
Top
Abstract
Introduction
Methods
Results
Discussion
References

Little is known about the effects of prolonged hypoxic exposure on membrane ion transport activity. The Na+/H+ antiport is an ion transport site that regulates intracellular pH in mammalian cells. We determined the effect of prolonged hypoxic exposure on human pulmonary arterial endothelial cell antiport activity, gene expression, and localization. Monolayers were incubated under hypoxic or normoxic conditions for 72 h. Antiport activity was determined as the rate of recovery from intracellular acidosis. Antiport isoform identification and gene expression were determined with RT-PCR and Northern and Western blots. Antiport localization and F-actin cytoskeleton organization were defined with immunofluorescent staining. Prolonged hypoxic exposure decreased antiport activity, with no change in cell viability compared with normoxic control cells. One antiport isoform [Na+/H+ exchanger isoform (NHE) 1] that was localized to the basolateral cell surface was present in human pulmonary arterial endothelial cells. Hypoxic exposure had no effect on NHE1 mRNA transcript expression, but NHE1 protein expression was upregulated. Immunofluorescent staining demonstrated a significant alteration of the F-actin cytoskeleton after hypoxic exposure but no change in NHE1 localization. These results demonstrate that the decrease in NHE1 activity after prolonged hypoxic exposure is not related to altered gene expression. The change in NHE1 activity may have important consequences for vascular function.

chronic hypoxia; pulmonary arterial endothelial cells; intracellular pH; membrane ion transport

    INTRODUCTION
Top
Abstract
Introduction
Methods
Results
Discussion
References

THE PULMONARY ENDOTHELIUM is exposed to variations in oxygen tension during normal gas exchange and in disease states involving the lungs and cardiovascular system. The endothelial cell membrane is a key target of these changes in oxygen tension related to its unique location at the blood-tissue interface. Acute hypoxia alters the activity of membrane ion transport systems in many different cell types and organ systems (1, 2, 5, 19, 21-23, 41, 45, 47). Hypoxia-induced changes in ion transport or intracellular ion homeostasis in the endothelium have important functional consequences related to changes in vascular reactivity that can modify gas exchange in the lung (45).

Prior work concerning the relationship of oxygen tension to cell function and ion transport has focused on the effects of an acute change in oxygen tension lasting minutes to hours. Prolonged changes in oxygen tension (hours to days) may also modify ion transport, leading to changes in organ function (32, 34, 37, 39). The effects of a prolonged change in oxygen tension on endothelial cell membrane ion transport and cell function are poorly defined (21). One mechanism by which changes in oxygen tension can alter membrane function is the induction of changes in gene expression of specific receptors or ion channels (36, 37). These studies raise the interesting possibility that the endothelial cell membrane may be a specific target for vascular "remodeling" after hypoxic exposure in addition to other sites of the vascular wall (44).

Na+/H+ exchangers (NHEs) are integral transmembrane proteins found in all mammalian cells and play a role in the regulation of several processes including intracellular pH (pHi), cell volume, and vectorial ion transport (17). Regulation of these cellular processes is vital for maintaining optimal cell function and viability. In addition, these exchangers also play a key role in the regulation of mediator release from endothelial cells in response to external stimuli (3, 12, 13). These mediators (nitric oxide, platelet-activating factor, and eicosanoids) have a significant impact on vascular function (14). Thus involvement in basic cellular processes, including signal transduction pathways involved in mediator release, suggests that changes in antiport activity may modify vascular function.

Little is known about the effect of prolonged hypoxic exposure on the activity of the membrane ion transport sites, including NHEs, that regulate pHi. We hypothesized that prolonged hypoxic exposure alters Na+/H+ antiport [NHE isoform 1 (NHE1)] activity in human pulmonary arterial endothelial cells (HPAECs). Using cultured human endothelial cells, we defined the effect of prolonged hypoxic exposure on Na+/H+ antiport activity and determined whether the observed changes in ion transport activity were secondary to changes in antiport gene expression or subcellular localization. To our knowledge, this is the first study of the effect of a prolonged decrease in oxygen tension on the activity and gene expression of a specific endothelial cell membrane ion transport site that regulates pHi.

    METHODS
Top
Abstract
Introduction
Methods
Results
Discussion
References

Cell Culture and Reagents

HPAECs, both large vessel and microvascular (HPMEC), were obtained from a commercial vendor (Clonetics) and grown in endothelial cell growth medium (EGM) containing 2% FCS. The cells were incubated in a humidified atmosphere (95% O2-5% CO2, 37°C) until confluent (3-5 days). Cultures were fed twice a week with EGM-2% FCS. In preparation for the measurement of pHi and the rate of acid recovery, the cells were seeded onto glass coverslips coated with Cell Tak (4 µg/slide; Collaborative Biomedical Products) as previously described (8, 9). The coverslips were incubated in a humidified atmosphere of 95% O2-5% CO2 at 37°C until near confluence (~90%) was reached. All experiments were conducted with cells matched for cell line, passage number, time to confluence, and cell density between the control and experimental groups. No differences were observed in the results with different cell lines or passage numbers.

Experimental Design and Methods

The cell monolayers were incubated in EGM-2% FCS under either hypoxic (95% N2-5% CO2) or normoxic (21% O2-5% CO2-balance N2) conditions for 72 h. Hypoxic exposure (PO2 ~25-30 Torr) was achieved by incubation in an airtight chamber (Billups Rothenburg) for 72 h. Prior studies demonstrated the reliability of altering oxygen tensions with this method, with no significant changes in the osmolality, ionic content, or pH of the incubation medium (8, 32, 43). Monolayers were inspected with phase microscopy before the start of each experiment. We determined the effect of prolonged changes in ambient oxygen tension on endothelial cell Na+/H+ antiport activity, gene expression, and localization with the following protocols.

Na+/H+ antiport activity. Antiport activity, expressed as the rate of recovery from intracellular acidosis, in monolayers incubated under either normoxic or hypoxic conditions was determined with the fluoroprobe 2',7'-bis(carboxyethyl)-5,6-carboxyfluorescein (Molecular Probes) as previously described (9). Measurement of pHi with this probe is a dual excitation-to-single emission ratio technique in which the ratio of the pH-sensitive (490-nm) to the pH-insensitive (440-nm) fluorescent signal provides a measurement of pHi that is independent of fluoroprobe concentration or cell number. Na+/H+ antiport activity is determined from the kinetics of acid recovery after acidification of the monolayers in MEM (pH 6.5) containing 1 µM nigericin, in which choline chloride is substituted for NaCl on an equimolar basis. This maneuver acidifies the monolayers related to the ionophore-induced K+ exit from and H+ entry into the cell. Acid recovery is initiated by addition of normal Na+-containing MEM. Under these conditions, acid recovery is Na+ dependent and sensitive to blockade with amiloride analogs, which are specific Na+/H+ antiport inhibitors (9). Experiments are performed in nominally HCO-3-free, HEPES-buffered MEM to minimize the activity of other pHi-regulating systems. Antiport activity is measured as the rate of recovery from acidosis 10-20 s after the initiation of acid recovery over a well-defined pH range (6.5-6.7) and is expressed as the change in pHi per minute. The fluorescent signal is calibrated by the H+ equilibration method as previously described (4a, 9).

Determination of Na+/H+ antiport isoforms by RT-PCR. Total RNA was extracted with standard methods (7). Primers for the cDNA synthesis and PCR amplification of the four Na+/H+ antiport isoforms were chosen from the published rat sequences located near the 3'-end of the coding region where there are low sequence homologies between known antiport isoforms (4). cDNA was synthesized from RNA samples with 0.5 µg of oligo(dT) primer, 299 U of Moloney murine leukemia virus reverse transcriptase (GIBCO BRL), 0.5 mM deoxynucleotide 5'-triphosphate mix, 10 mM dithiothreitol in 22 µl of reaction buffer containing 100 mM Tris · HCl (pH 8.4), 50 mM KCl, and 2.5 mM MgCl2 for 1 h at 42°C. Each reaction was performed in parallel with an identical mixture without reverse transcriptase as a control. The reaction was terminated by heating to 95°C for 5 min.

For PCR, 10 µl of the cDNA solution were supplemented with a PCR mix to make a total volume of 100 µl. Each PCR reaction tube contained 10 mM Tris · HCl (pH 8.4), 50 mM KCl, 2.5 mM MgCl2, 0.5 mM deoxynucleotide 5'-triphosphate, 2.5 U Taq DNA polymerase (Promega)-7 µM anti-Taq polymerase antibody mixture, and 100 pmol of each NHE primer. Anti-Taq polymerase was used as an alternative to "hot start" PCR to optimize the reaction. A DNA thermal cycler (Perkin-Elmer GeneAmp PCR system 2400) executed the following protocol: 94°C for 4 min (initial melt); 35 cycles of 94°C for 1 min, 60°C for 1 min, and 72°C for 1.5 min; and then a final extension step of 72°C for 7 min.

NHE1-4 primers for the PCR reactions were designed from the published rat sequences specific for each isoform as previously described (4, 42). These primers (3' right-arrow 5') were NHE1 sense, TCTGCCGTCTCAACTGTCTCTA; NHE1 antisense, CCCTTCAACTCCTCATTCACCA; NHE2 sense, GCAGATGGTAATAGCAGCGA; NHE2 antisense, CCTTGGTGGGGGCTTGGGTG; NHE3 sense, GGAACAGAGGCGGAGGAGCAT; NHE3 antisense, GAAGTTGTGTGCCAGATTCTC; NHE4 sense, GGCTGGGATTGAAGATGTATGT; and NHE4 antisense, GCTGGCTGAGGATTCCTGTAA.

Na+/H+ antiport gene expression. Northern and Western blots were performed with probes for the NHE1 antiport isoform because this was the only isoform detected in both HPAECs and HPMECs.

NORTHERN BLOT. Poly(A)+ RNA was extracted from the monolayers with a commercially available kit (Ambion). Poly(A)+ RNA samples (5 µg/lane) were fractionated on a 1% agarose-formaldehyde gel and transferred to a nylon membrane. The membranes were prehybridized for 6 h at 65°C with 5× Denhardt's solution, 6× saline-sodium citrate (SSC; 1× SSC is 0.15 M NaCl and 0.015 M sodium citrate, pH 7.0), 1% SDS, 10% dextran sulfate, and 100 µg/ml of denatured salmon sperm DNA. The membranes were hybridized with the same solution containing 107 counts/min (cpm) of denatured 32P-labeled DNA probe at 65°C for 16 h. The membranes were washed two times in 2× SSC-0.5% SDS at room temperature for 10 min, followed by two washes in 0.1× SSC-0.5% SDS at 65°C for 20 min. Membranes were then exposed to Kodak XAR film at -70°C with the aid of an intensifying screen. Full-length cDNA of rat NHE1 was used as a specific probe in the Northern blot analysis. The cDNAs were labeled with [32P]deoxynucleotides with a random-primer labeling kit (Strategene). The NHE1 cDNAs were generous gifts from Drs. Gary Shull (University of Cincinnati, Cincinnati, OH) and John Orlowski (McGill University, Montreal, Canada). We also compared the level of beta -actin mRNA expression in hypoxic versus normoxic cells to determine whether hypoxic exposure altered endothelial cell transcript expression in a nonspecific manner.

WESTERN BLOT. We compared the level of NHE1 protein expression in normoxic versus hypoxic cells (72 h) with a Western analysis performed in the following manner. Monolayers were lysed in Tris buffer (10 mM Tris, 2 mM MgCl2, 2 mM EDTA, 2 mM EGTA, pH 7.4, 250 mM sucrose, 2 µg/ml of aprotonin, 2.5 µg/ml of leupeptin, 2 µg/ml of pepstatin, 1 mM o-phenanthroline, and 1 mM phenylmethylsulfonyl fluoride). Lysed cells were homogenized and centrifuged at 800 g for 15 min at 4°C. The supernatant was subjected to high-speed centrifugation for 1 h at 40,000 g at 4°C to obtain a crude membrane preparation that was resuspended in water for SDS-PAGE and Western analysis. Membrane preparations were resolved by 10% SDS-PAGE and electrotransferred to nitrocellulose membranes. An antiserum (1:500 dilution) against NHE1 was used, and immunodetection was enhanced with chemiluminescence with horseradish peroxidase-conjugated goat anti-rabbit antibody (Amersham). The NHE1 antiserum was provided by Dr. Eugene Chang (University of Chicago, Chicago, IL). This antibody to the cytoplasmic tail of NHE1 has been characterized in prior studies as a reliable probe for the recognition of the intact NHE1 protein (24).

Immunofluorescent staining for NHE1 and F-actin. NHE1 localization and F-actin cytoskeleton organization were determined with a double-label immunofluorescent staining technique as previously described (46). Monolayers were fixed with paraformaldehyde and incubated with rhodamine-phallodoin (1:20) or primary antiserum (1:50) for 2 h. The monolayers were then rinsed and incubated with the secondary antibody for 1 h, followed by mounting on permanent glass slides. The primary NHE1 antibody (polyclonal anti-rabbit IgG) was recognized by an FITC-conjugated anti-rabbit IgG secondary antibody. An inverted microscope (Zeiss Axiovert TV100) coupled to a confocal scanning unit (Bio-Rad MRC-1000) was used to determine NHE1 localization and F-actin cytoskeleton organization.

Assessment of Cell Injury

We utilized a standard 51Cr-release assay to assess the degree of injury to HPAEC monolayers after hypoxic exposure as previously described (8, 9). Monolayers seeded onto 24-well plates were incubated for 72 h under either hypoxic or normoxic conditions. The monolayers were labeled with 51Cr 24 h before the start of an experiment by incubating the plates overnight in MEM plus 10% FCS containing 3 µCi/ml of sodium chromate-51/well. On the day of an experiment, the monolayers were washed two times with 0.5 ml of PBS (pH 7.35), fresh medium was added, and the monolayers were incubated for 72 h under either hypoxic or normoxic conditions. At the end of the incubation period, the medium in each well was harvested and centrifuged, and the radioactivity in the supernatant and pellet was determined in a gamma counter. Cell-bound 51Cr was determined by lysing the cells with 0.5 ml of 1 N NaOH added to each well for 5-10 min. The contents of each well were aspirated into a counting tube, and each well was also washed with 0.5 ml of PBS added to the cell lysate. The percentage of 51Cr release over 72 h under each condition was derived from the ratio of counts per minute released into the culture supernatant to the total counts per minute incorporated during labeling (total cpm = supernatant cpm + cell lysate cpm). The percentage of 51Cr release was determined in triplicate per plate. In each experiment, the average of these triplicate determinations was considered an n of 1. Injury was also assessed by the phase-microscopic appearance of the each monolayer.

Determination of Buffering Capacity

Intracellular buffering capacity (beta ) was determined in standard fashion with the NH4Cl prepulse technique as previously described (4a). The monolayers were first acidified in nominally Na+- and HCO-3-free MEM and were then sequentially exposed to decreasing concentrations of NH4Cl (20, 10, 5, and 0 mM). These stepwise reductions in extracellular NH4Cl produce a fall in pHi over the range of ~7.1-6.75 in our cell line. Each stepwise reduction in NH4Cl leads to a new stable value of pHi in each monolayer. The change in extracellular NH+4 leads to a change in pHi because extracellular NH+4 rapidly dissociates to NH3, which diffuses into the cells and titrates protons. The magnitude of the change in pHi is related to the intrinsic buffering capacity. Buffering capacity was calculated as the amount of acid load divided by the observed change in pHi produced by this load according to the following equation: beta  (in mM/U pH) = Delta [NH4]i/Delta pHi, where Delta [NH4]i is the change in the internal NH+4 concentration and Delta pHi represents the change in pHi between successive doses of NH4Cl. The acid load is estimated as the [NH4]i if it is assumed that all NH+4 leaves the cell as NH3, releasing H+ in the process. [NH4]i is calculated from the pHi value in the presence of a given dose of NH4Cl, with a pKa value of 9.0 and the assumption of a complete equilibration of intracellular and extracellular NH3 at an external pH of 7.4. Buffering capacity was determined under conditions where the Na+/H+ antiport was inhibited (Na+-free MEM) to eliminate any contribution from this acid-extruding system. The values for buffering capacity are expressed as means ± SE over a specified pHi range as noted above.

Data Analysis

Results are presented as means ± SE. Differences between means for percent 51Cr release and rate of acid recovery were compared with an unpaired t-test. Differences between means were considered significant if P was <0.05.

    RESULTS
Top
Abstract
Introduction
Methods
Results
Discussion
References

Figure 1 illustrates the basic features of the pHi measurement protocol, including measurement of baseline pHi, acidification, acid recovery, and the results of a hypoxic exposure in an HPAEC monolayer. After measurement of baseline pHi, each monolayer was acidified and stabilized at an acidified value (pHi ~6.6), followed by the initiation of acid recovery with the addition of Na+-containing MEM as described in METHODS. A 72-h hypoxic exposure did not produce any significant change in baseline pHi compared with normoxic control monolayers incubated for a similar time period. In contrast, prolonged hypoxic exposure leads to a significant decrease in Na+/H+ antiport activity, measured as the initial rate of acid recovery, in large-vessel HPAEC monolayers compared with normoxic control cells incubated under identical conditions.


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 1.   Comparison of rate of acid recovery in intact monolayers of control normoxic cells vs. cells exposed to hypoxia for 72 h. Large-vessel human pulmonary arterial endothelial cell (HPAEC) monolayers were loaded with 2',7'-bis(2-carboxyethyl)-5(6)-carboxyfluorescein and prepared for measurement of intracellular pH (pHi) as described in METHODS. After a stable signal representing baseline pHi was obtained, monolayers were acidified in Na+-free MEM (left arrow) and allowed to undergo acid recovery in normal MEM (right arrow). Na+/H+ antiport activity was determined from rate of acid recovery as described in METHODS.

These data on the rate of acid recovery were confirmed by the averaged results for all the experiments illustrated in Fig. 2. In these experiments, we also determined if there was a significant difference in the rate of acid recovery in large-vessel HPAECs versus HPMECs after hypoxic exposure. Both cell types demonstrated a significant reduction in the rate of acid recovery under identical conditions. Thus there was no evidence of a heterogeneous response to a prolonged hypoxic exposure between pulmonary endothelial cells from different anatomic locations in the lung. In addition, there was no difference in baseline pHi in monolayers after prolonged hypoxic exposure versus normoxic control cells (data not shown). In separate experiments, we determined the buffering capacity of monolayers exposed to hypoxia for 72 h versus normoxic control monolayers under identical conditions. Buffering capacity was similar in both experimental groups (15.9 ± 2.0 and 11.9 ± 1.7 mM/pH for normoxic control and hypoxic monolayers, respectively, over a pHi range of 6.8-7.1). Thus an alteration in intrinsic buffering capacity cannot explain the diminished antiport activity after prolonged hypoxic exposure.


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 2.   Effect of a 72-h hypoxic exposure on sodium/hydrogen exchanger (antiport) isoform (NHE) 1 activity in intact monolayers. Values are means ± SE; n, no. of slides with confluent endothelial cell monolayers. HPMECs, human pulmonary arterial microvascular endothelial cells. Solid bars, cells incubated in 95% N2-5% CO2 for 72 h (hypoxia); open bars, control normoxic cells incubated in 21% O2-5% CO2-balance N2 for the same time period. * P compared with normoxic control cells.

We determined the relationship among hypoxic exposure, diminished Na+/H+ antiport activity, and cell viability with two standard indexes of overt cell injury. Hypoxic exposure for 72 h did not alter endothelial cell viability, measured as percent 51Cr release (45.5 ± 0.6 and 56.5 ± 0.8% 51Cr release in hypoxic and normoxic control monolayers, respectively; n = 6/experimental group). These findings were confirmed with phase-contrast microscopy that demonstrated that the appearance of the monolayers was unaltered after a 72-h hypoxic exposure compared with normoxic control monolayers (data not shown). In fact, the 51Cr-release assay demonstrated that hypoxic exposure was associated with a small preservation of cell viability under these experimental conditions. These results suggest that the decrease in Na+/H+ antiport activity after prolonged hypoxic exposure cannot be explained on the basis of overt cell injury.

As illustrated in Fig. 3A, we identified the antiport isoform subtype in large-vessel HPAECs with RT-PCR with PCR primers created from published rat sequences, which are specific for NHE1-4 as previously described (4, 42). We identified only one specific RT-PCR reaction product in these cells using the probe for NHE1. The specificity of this reaction product for NHE1 was confirmed with the following criteria. First, the size of this reaction product was comparable to the expected size for NHE1 (~422 bp). Second, reamplification of this product with a pair of nested primers for NHE1 produced PCR products with the expected size of 213 bp (Fig. 3B). Third, restriction analysis of the product obtained from the nested primers with the restriction enzyme Apa I produced fragments with the expected sizes of 61 and 152 bp (Fig. 3C). As a positive control, PCR products of the same size were also detected in the human kidney (data not shown). These results indicate that large-vessel HPAECs contain only the NHE1 mRNA transcript of the Na+/H+ antiport. No other PCR reaction products were identified with specific probes for NHE2-4 in these cells. No PCR products were obtained when reverse transcriptase was omitted from the reaction. Similar findings were obtained with HPMECs (data not shown).


View larger version (89K):
[in this window]
[in a new window]
 


View larger version (33K):
[in this window]
[in a new window]
 


View larger version (37K):
[in this window]
[in a new window]
 
Fig. 3.   Identification of Na+/H+ antiport isoforms in HPAECs with RT-PCR. A: ethidium bromide-stained agarose gel for beta -actin, NHE1, NHE2, NHE3, and NHE4 RT-PCR products in presence of reverse transcriptase. Each reaction was performed with 1 µg of RNA isolated from HPAECs. Expected size for NHE1 RT-PCR product was 422 bp. B: reamplification of NHE1 RT-PCR product from RNA of HPAECs with a pair of nested primers designed based on sequence encoded by NHE1 primers. Each reaction was performed with 10% of NHE1 PCR product. RT-PCR products were separated in 2% agarose gel and stained with ethidium bromide. Expected size for this reaction product was 213 bp. C: ethidium bromide-stained gel for RT-PCR product from a pair of nested NHE1 primers digested with restriction enzyme Apa I. Expected sizes were 61 and 152 bp.

These results set the stage for the investigation of the effect of prolonged hypoxic exposure on NHE1 gene expression. A representative Northern blot, illustrated in Fig. 4, demonstrates that a 72-h hypoxic exposure did not alter steady-state NHE1 mRNA transcript expression in large-vessel HPAECs compared with normoxic control cells. This experiment was repeated several times (n = 4) with similar results. There was a similar qualitative lack of change in beta -actin mRNA expression after hypoxic exposure compared with normoxic control cells. These results suggest that prolonged hypoxic exposure does not lead to a change in NHE1 gene transcription rate or mRNA stability.


View larger version (52K):
[in this window]
[in a new window]
 
Fig. 4.   Effect of hypoxic exposure (Hypo) on NHE1 mRNA transcript expression in HPAEC monolayers. This representative Northern blot illustrates effect of Hypo (72 h) on steady-state NHE1 mRNA expression compared with normoxic control cells (Norm). Poly(A)+ RNA samples (5 µg/lane) obtained from confluent cell monolayers were used for this analysis as described in METHODS. Expected NHE1 mRNA transcript (4.6 kb) was present in similar amounts in Norm and in monolayers exposed to hypoxia for 72 h. In addition, there was no change in level of expression of beta -actin mRNA, used as a control, in monolayers after a Hypo compared with Norm. This experiment was repeated several times (n = 4) with similar results.

In Fig. 5, a representative Western blot illustrates the effect of a 72-h hypoxic exposure on NHE1 protein expression in membrane preparations of large-vessel HPAECs compared with normoxic control cells. In contrast to the reduction in NHE1 activity after hypoxic exposure (Figs. 1 and 2), we observed a modest increase in NHE1 protein expression after hypoxic exposure in membrane preparations from these cells. This experiment was repeated several times (n = 4) with similar results. A densitometric analysis indicated that NHE1 protein expression was increased 22.5 ± 6.1% compared with control cells. Thus diminished protein expression cannot account for the observed decrease in NHE1 activity in intact endothelial cell monolayers.


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 5.   Effect of Hypo on NHE1 protein expression in endothelial cell membrane preparations. This representative Western blot illustrates effect of Hypo (72 h) on NHE1 protein expression compared with Norm. Each lane was loaded with 25 µg of protein. This experiment was repeated several times (n = 4) with similar results. A densitometric analysis was used to quantitate NHE1 protein expression in these experiments.

We determined the effect of hypoxic exposure on NHE localization and F-actin cytoskeletal organization with a double-label immunofluorescent staining technique in large-vessel HPAEC monolayers in which NHE1 was visualized with confocal microscopy. These experiments were performed at two time points after hypoxic exposure: 24 and 72 h. In normoxic control cells, NHE1 was almost exclusively localized to the surface of each monolayer that was in contact with the glass coverslip ("basolateral" surface). There was no visible NHE1 staining in these cells on the cell surface in contact with the environment ("apical" surface). A 24-h hypoxic exposure did not alter the appearance of the immunofluorescent staining or the normal basolateral location of NHE1 in these monolayers (data not shown). In contrast, a 24-h hypoxic exposure produced a significant change in F-actin cytoskeletal morphology, with a loss of central F-actin bands, compared with normoxic control cells. Hypoxic exposure for 72 h demonstrated similar findings, with no change in the normal basolateral NHE1 location and an even more prominent loss of central F-actin bands (Fig. 6).


View larger version (140K):
[in this window]
[in a new window]
 
Fig. 6.   Immunofluorescent staining for determination of NHE1 localization (B and D) and F-actin cytoskeleton organization (A and C) after a 72-h Hypo (C and D) compared with control monolayers (A and B) incubated under normoxic conditions for the same time as described in METHODS. NHE1 and F-actin were labeled with a double-label immunofluorescent staining technique and then visualized with an inverted microscope coupled to a confocal scanning unit to determine NHE1 localization and F-actin cytoskeleton organization. These images were magnified ×63.

    DISCUSSION
Top
Abstract
Introduction
Methods
Results
Discussion
References

The present results demonstrate that HPAECs in vitro possess the NHE1 of the Na+/H+ antiport. Prolonged hypoxic exposure decreases NHE1 activity, with no change in mRNA transcript expression and a modest increase in protein expression in membrane preparations from these cells. These findings were not associated with overt cell injury. These results indicate that prolonged hypoxic exposure changes the activity of a specific membrane ion transport site as part of a spectrum of altered membrane function. A similar decrease in NHE1 activity after prolonged hypoxic exposure was also observed in HPMECs, demonstrating the absence of a heterogeneous response to prolonged hypoxic exposure.

The pharmacological response to inhibition of the Na+/H+ antiport by amiloride analogs is an indicator of isoform subtype in a given cell or tissue (26). NHE1 is the amiloride analog-sensitive isoform of the Na+/H+ antiport. Prior work (4, 13) suggested the presence of this isoform in endothelial cells using this type of pharmacological characterization. Using a similar approach in prior work (8, 9), we predicted that pulmonary endothelial cells possess the amiloride-sensitive isoform (NHE1). In these studies, inhibition of Na+/H+ exchange with the amiloride analog methylisobutylamiloride (10 µmol/l) produced a >95% inhibition of acid recovery. Nevertheless, to our knowledge, the present work is the first direct demonstration of isoform subtype in any type of endothelial cell in vitro. As predicted, the present experiments demonstrate that HPAECs (and HPMECs) contain only the NHE1 located on the basolateral cell surface (Fig. 3, A-C). These results are compatible with findings in other cell types in vitro demonstrating that NHE1 is the ubiquitous antiport isoform found in all mammalian cells (17). NHE1 is involved in the regulation of pHi, cell volume, and growth and differentiation in selected cell types (17). NHE1 does not have any known role in vectorial ion transport as suggested for other antiport isoforms (NHE2-4) (4, 26). Therefore, the presence of this specific antiport isoform in pulmonary endothelial cells suggests that vectorial transport of Na+ in these cells does not involve the NHE. Extrapolation of these findings to the endothelium in vivo must await further study.

Acute hypoxia is associated with a decrease in membrane ion transport activity in a variety of cell types and organ systems. An acute change in oxygen tension inhibited K+-channel activity in chemoreceptor cells of the mammalian carotid body (23). In the liver, acute hypoxia decreased Na-K-ATPase activity in hepatocytes and sinusoidal endothelial cells, which was reversible within minutes of reperfusion with normoxic medium (3). Similar effects of acute hypoxic exposure on Na-K-ATPase activity were observed in the kidney and heart (19, 40). In the pulmonary vasculature, acute hypoxia leads to alterations of intracellular Ca2+ homeostasis and K+-channel activity, which have been implicated in the acute hypoxic pressor response in the whole lung (41, 45, 47).

In contrast, the effects of prolonged hypoxic exposure on membrane ion transport are poorly defined. Prolonged hypoxia decreased the amplitude of the action potential in the cardiac pacemaker cells related to reduced inward Ca2+ current (22). In brain capillary endothelial cells, prolonged hypoxic exposure produced opposite effects on the ion transport mechanisms regulating K+ uptake, leading to decreased Na-K-ATPase activity but a compensatory increase in Na+/K+/Cl- cotransport (21). A similar decrease in Na-K-ATPase activity was noted in alveolar epithelial cells after prolonged hypoxic exposure (32). In the pulmonary vasculature, prolonged hypoxic exposure augmented ion channel-dependent relaxation (34) and reduced the rectifier K+ current in pulmonary arterial smooth muscle cells (39). These complex, sometimes contrasting, effects on different ion transport systems highlight the difficulty of extrapolating the pattern of response from one cell type to another (2, 11). In one of the few studies of the effects of prolonged hypoxic exposure on lung cells, the modification of ion transport was cell specific (32), illustrating this point. Endothelial cells demonstrate heterogeneous responses to various stimuli (11). Therefore, one cannot safely assume the presence of the same response in similar cell types, even within the same organ system (2). Our results demonstrate that the effect of prolonged hypoxic exposure on NHE1 activity in HPAECs and HPMECs is uniform, with no evidence of a heterogeneous response between these cell types.

Little is known about the effects of oxygen deficits on pHi and the ion transport sites, such as the Na+/H+ antiport, that regulate this parameter. In general, changes in pHi and intracellular Na+ concentration stimulate ion transport systems as part of a compensatory response to maintain intracellular ion homeostasis (1, 10). Cell types differ in their specific responses. In cardiac Purkinje fibers and brain tissue, acute hypoxic exposure or inhibition of oxidative phosphorylation ("chemical hypoxia") decreases pHi and increases intracellular Na+ concentration, an effect that is not modified by Na+/H+ antiport inhibition (5, 31). In contrast, chemical hypoxia acutely decreases pHi in hepatocytes, which is modified by Na+/H+ antiport inhibition (15). The present study is the first report on the effect of prolonged hypoxic exposure on pHi in endothelial cell monolayers. We did not demonstrate a significant change in baseline pHi, overt cell injury, or buffering capacity after prolonged hypoxic exposure compared with normoxic control cells despite the observed decrease in NHE1 activity. Differences in response to prolonged hypoxic exposure among cell types are not surprising because the cellular response is a complex adaptation involving more than one ion transport site (21). We speculate that the overall response is probably cell-type specific, related to differences in regulatory pathways and/or the basal activity of the ion transport systems in a given cell type.

Among mammalian cells, endothelial cells are noted for their tolerance to hypoxia, with little or no loss of viability compared with other cell types (30, 43). We confirmed these findings in the present study; hypoxic cells demonstrated no loss of viability after prolonged hypoxic exposure compared with normoxic control cells. Pulmonary endothelial cells, in particular, have a large capacity to maintain cell function under oxygen-deficit conditions and maintain or even increase the levels of intracellular ATP after prolonged hypoxic exposure (43). Severe ATP depletion (<10% of normal value) is associated with diminished antiport activity in other cell types (16, 26). Therefore, collectively, these data suggest that the observed decrease in NHE1 activity in pulmonary endothelial cells cannot be explained on the basis of cytotoxicity and/or ATP depletion.

The absence of a change in pHi or cell viability after prolonged hypoxic exposure led us to consider whether altered gene expression was involved in the change in NHE1 activity. Membrane proteins, including receptors, channels, and ion transporters, are key targets for hypoxia-induced changes in gene expression (20, 28, 30, 32, 36, 37). Recent studies in lung cells illustrate how hypoxia-induced changes in gene expression of membrane proteins can modify cell function. The upregulation of Na+ channels in alveolar epithelial cells in response to a change from a hypoxic to a normoxic environment at birth facilitates fluid absorption from alveoli in fetal lungs (28). Other membrane proteins in cells of the vascular wall are substrates for chronic hypoxia-induced remodeling of the cell membrane (4a, 37). These hypoxia-induced changes in membrane protein gene expression have the potential to induce significant changes in vascular function. However, the effect of prolonged hypoxic exposure on vascular function has not been determined. Based on this emerging evidence of altered gene expression of membrane proteins (4a, 37), we postulated that prolonged hypoxic exposure would alter NHE1 gene expression in pulmonary endothelial cells.

Hypoxic exposure might cause translational arrest or a nonspecific global decrease in protein synthesis observed in some hypoxia-sensitive cells (20). This hypothesis was refuted based on the absence of any change in NHE1 mRNA transcript expression (Fig. 4) in conjunction with a moderate increase in NHE1 protein expression in membrane preparations (Fig. 5). Therefore, the decrease in NHE1 activity that we observed cannot be explained as part of a decrease in ion transport activity secondary to a global decrease in protein synthesis. Prior findings (21, 30, 36, 37) demonstrate that prolonged hypoxic exposure induces complex cell- and tissue-specific changes involving both upregulation and downregulation of different membrane receptors or ion transport activity. Thus the present results cannot be directly extrapolated to other cell types or organ systems as noted above.

Similarly, the decrease in NHE1 activity cannot be explained by a specific effect of prolonged hypoxic exposure on antiport gene expression. Normal NHE1 mRNA transcript expression suggests that there is no significant change in the NHE1 gene transcription rate or mRNA stability after hypoxic exposure. The increase in NHE1 membrane protein expression indicates that a decrease in the number of antiporter molecules in the cell membrane cannot account for diminished NHE1 activity. Additional mechanisms of diminished NHE1 activity can also be eliminated. Insertion of NHE1 protein into a different membrane domain or internalization of NHE1 sites might theoretically account for a change in antiport activity (26, 27). These possibilities are unlikely based on the immunofluorescent staining results that demonstrate that hypoxic exposure did not alter the normal basolateral location of the protein in endothelial cells (Fig. 6). We cannot exclude the possibility that immunofluorescent staining may overestimate functional NHE1 sites in the membrane by recognizing sites that may be immunoreactive but that do not possess full ion transport capability.

Concurrent changes in NHE1 activity and F-actin cytoskeletal morphology after prolonged hypoxic exposure (Fig. 6) suggest another mechanistic possibility. Several ion transport sites, including Na-K-ATPase, Na+ channels, and the Na+/H+ antiport, are integral membrane proteins with functional links to integrins and associated cytoskeletal elements (6, 16, 18, 25, 33). For example, the Na+/H+ antiport colocalizes with F-actin (18), suggesting an important physical interaction of cytoskeletal elements with membrane ion transport sites. Oxygen deficits and ATP depletion lead to cytoskeletal rearrangement or disruption (25, 29, 30, 38) that can modify membrane ion transport. For example, in renal tubule cells, ATP depletion leads to a redistribution of Na-K-ATPase from the basolateral into the apical membrane domain and cytoplasm and a reduction in ATPase activity, along with alteration of the actin cytoskeleton (25). Our immunofluorescent findings, consisting of a loss of central actin fibers after prolonged hypoxic exposure, are very similar to the findings in bovine aortic endothelial cells under similar conditions (38). We did not demonstrate a change in NHE1 localization after hypoxic exposure, unlike the effect of ATP depletion on Na-K-ATPase distribution in renal tubule cells (25). Nevertheless, changes in cytoskeletal architecture may modify ion transport activity in a more subtle manner because changes in F-actin morphology are linked to a range of functional abnormalities in endothelial cells that occur in the absence of altered cell viability (30, 38).

In conclusion, the results suggest that the hypoxia-induced decrease in NHE1 activity is not the result of cell injury, altered NHE1 gene expression, a decrease in the number of NHE1 molecules in the cell membrane, or altered NHE1 localization. Because NHE1 activity is linked to the F-actin cytoskeleton (16, 18), we speculate that the change in NHE1 activity may be related to the hypoxia-induced alteration of this cytoskeletal component. Future experiments will be needed to explore this possibility and determine whether hypoxia-induced changes in the signal transduction pathway leading to antiport activation may also involve changes in NHE1 calcium sensitivity, altered sensitivity to Na+, or the phosphorylation sites of the protein.

These findings have implications for "remodeling" of the pulmonary vasculature after chronic hypoxic exposure. Our results suggest that the endothelial cell membrane may also be an important site for vascular remodeling after hypoxic exposure. Thus the endothelial cell membrane may respond or adapt to pathophysiological conditions with changes in ion transport activity similar to the other cells of the vascular wall (36, 37). An unanswered question is whether the NHE1 "adaptation" that we observed is beneficial or has pathophysiological consequences. In addition to its role in the regulation of pHi and ion homeostasis, NHE1 activity is linked to other endothelial cell functions including release of vasoactive mediators such as nitric oxide, prostanoids, and platelet-activating factor (3, 12, 13). Therefore, we speculate that a decrease in endothelial cell NHE1 activity may have important consequences for pulmonary vascular reactivity, cell viability, or remodeling of the vascular wall after hypoxic exposure.

    ACKNOWLEDGEMENTS

We gratefully acknowledge the help of Dr. Eugene Chang for providing the sodium/hydrogen exchanger isoform 1 (NHE1) antiserum used in the Western analysis. The full-length complementary deoxyribonucleic acids of rat NHE1 used as a probe in the Northern analysis were generous gifts from Drs. Gary Shull (University of Cincinnati, Cincinnati, OH) and John Orlowski (McGill University, Montreal, Canada).

    FOOTNOTES

This study was supported by the Veterans Affairs Merit Review Program (S. Rounds), the Cystic Fibrosis Foundation (S. Rounds), a grant from the Dean of Brown University, Providence, Rhode Island (to S. Rounds), and National Institute of Diabetes and Digestive and Kidney Diseases Grant R29-DK-47403 (to S. Sun).

A preliminary report of this work was presented at the American Thoracic Society Meeting in May 1997 and published in abstract form.

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Address for reprint requests: M. Cutaia, VA Medical Center, Research Service, 3900 University and Woodland Ave., Philadelphia, PA 19104-9019.

Received 16 January 1998; accepted in final form 18 May 1998.

    REFERENCES
Top
Abstract
Introduction
Methods
Results
Discussion
References

1.   Anderson, S. E. I., E. Murphy, C. Steenberg, R. E. London, and P. M. Cala. Na+/H+ exchange in myocardium: effects of hypoxia and acidification on Na+ and Ca2+. Am. J. Physiol. 259 (Cell Physiol. 28): C940-C948, 1990[Abstract/Free Full Text].

2.   Angermuller, S., M. Schunk, K. Kusterer, T. Konrad, and K. H. Usadel. Alterations of Na/K ATPase activity after hypoxia and reoxygenation in the perfused rat liver: an electron microscopic cytochemical study. J. Hepatol. 22: 565-575, 1995[Medline].

3.   Ayajiki, K., M. Kindermann, M. Hecker, I. Fleming, and R. Busse. Intracellular pH and tyrosine phosphorylation but not calcium determine shear stress-induced nitric oxide production in native endothelial cells. Circ. Res. 78: 750-758, 1996[Abstract/Free Full Text].

4.   Borensztein, P., M. Froissart, K. Laghmani, M. Bichara, and M. Paillard. RT-PCR analysis of Na+/H+ exchanger mRNAs in rat medullary thick ascending limb. Am. J. Physiol. 268 (Renal Fluid Electrolyte Physiol. 37): F1224-F1228, 1995[Abstract/Free Full Text].

4a.   Boron, W. F. Control of intracellular pH. In: The Kidney: Physiology and Pathophysiology, edited by D. W. Seldin. New York: Raven, 1992, chapt. 9, p. 219-263.

5.   Bright, C. M., and D. Ellis. Intracellular pH changes induced by hypoxia and anoxia in isolated sheep heart Purkinje fibers. Exp. Physiol. 77: 165-175, 1992[Abstract].

6.   Cantiello, H. E. Role of the actin cytoskeleton on epithelial Na channel regulation. Kidney Int. 48: 970-984, 1995[Medline].

7.   Chomczynski, P., and N. Sacchi. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162: 156-159, 1987[Medline].

8.   Cutaia, M., and N. Parks. Oxidant stress decreases Na+/H+ antiport activity in bovine pulmonary artery endothelial cells. Am. J. Physiol. 267 (Lung Cell. Mol. Physiol. 11): L649-L659, 1994[Abstract/Free Full Text].

9.   Cutaia, M. V., and N. Parks. Effect of hyperoxia and exogenous oxidant stress on pulmonary artery endothelial cell Na+/H+ antiport activity. J. Lab. Clin. Med. 128: 154-164, 1996[Medline].

10.   Fukushima, T., T. K. Waddell, S. Grinstein, G. G. Goss, J. Orlowski, and G. P. Downey. Na+/H+ exchange activity during phagocytosis in human neutrophils: role of Fcgamma receptors and tyrosine kinases. J. Cell Biol. 132: 1037-1052, 1996[Abstract/Free Full Text].

11.   Gerritsen, M. E., and C. M. Bloor. Endothelial cell gene expression in response to injury. FASEB J. 7: 523-532, 1993[Abstract].

12.   Gerritsen, M. E., C. A. Perry, T. Moatter, E. J. Cragoe, and M. S. Medow. Agonist-specific role for Na+/H+ antiport in prostaglandin release from microvessel endothelium. Am. J. Physiol. 256 (Cell Physiol. 25): C831-C839, 1989[Abstract/Free Full Text].

13.   Ghigo, D., F. Bussolino, G. Gargarino, R. Heller, F. Turrini, G. Pescarmona, E. J. Cragoe, L. Pegoraro, and A. Bosia. Role of Na+/H+ exchange in thrombin-induced platelet-activating factor production by human endothelial cells. J. Biol. Chem. 263: 19437-19446, 1988[Abstract/Free Full Text].

14.   Giaid, A., and D. Saleh. Reduced expression of endothelial nitric oxide synthase in the lungs of patients with pulmonary hypertension. N. Engl. J. Med. 333: 214-221, 1995[Abstract/Free Full Text].

15.   Gores, G. J., A. L. Nieminen, B. E. Wray, B. Herman, and J. J. Lemasters. Intracellular pH during chemical hypoxia in cultured rat hepatocytes: protection by intracellular acidosis against the onset of cell death. J. Clin. Invest. 83: 386-396, 1989.

16.   Goss, G. G., M. Woodside, S. Wakabayashi, J. Pouyssegur, T. Waddell, G. P. Downey, and S. Grinstein. ATP dependence of NHE-1, the ubiquitous isoform of the Na+/H+ antiporter: analysis of phosphorylation and subcellular localization. J. Biol. Chem. 269: 8741-8748, 1994[Abstract/Free Full Text].

17.   Grinstein, S. Na+/H+ Exchange. Boca Raton, FL: CRC, 1988.

18.   Grinstein, S., M. Woodside, T. K. Waddell, G. P. Downey, J. Orlowski, J. Pouyssegur, D. C. P. Wong, and J. K. Foskett. Focal localization of the NHE-1 isoform of the Na+/H+ antiport: assessment of effects on intracellular pH. EMBO J. 12: 5209-5218, 1993[Medline].

19.   Grinwald, P. M. Sodium pump failure in hypoxia and reoxygenation. J. Mol. Cell. Cardiol. 24: 1393-1398, 1992[Medline].

20.   Hochachka, P. W., L. T. Buck, C. J. Doll, and S. C. Land. Unifying theory of hypoxia tolerance: molecular/metabolic defense and rescue mechanisms for surviving oxygen lack. Proc. Natl. Acad. Sci. USA 93: 9493-9498, 1996[Abstract/Free Full Text].

21.   Kawai, N., R. M. McCarron, and M. Spatz. Effect of hypoxia on Na/K/Cl cotransport in cultured brain capillary endothelial cells of the rat. J. Neurochem. 66: 2572-2579, 1996[Medline].

22.   Kohlhardt, M., Z. Mnich, and G. Maier. Alterations of the excitation process of the sinoatrial pacemaker cell in the presence of anoxia and metabolic inhibitors. J. Mol. Cell. Cardiol. 9: 477-488, 1977[Medline].

23.   Lopez-Lopez, J., C. Gonzalez, J. Urena, and J. Lopez-Barneo. Low PO2 selectively inhibits K+ channel activity in chemoreceptor cells of the mammalian carotid body. J. Gen. Physiol. 93: 1001-1015, 1989[Abstract/Free Full Text].

24.   McSwine, R. L., G. Babnigg, M. W. Musch, E. B. Chang, and M. L. Villereal. Expression and phosphorylation of NHE1 in wild-type and transformed human and rodent fibroblasts. J. Cell. Physiol. 161: 351-357, 1994[Medline].

25.   Molitoris, B. A., A. Geerdes, and J. R. McIntosh. Dissociation and redistribution of Na/K ATPase from its surface membrane actin cytoskeletal complex during cellular ATP depletion. J. Clin. Invest. 88: 462-469, 1991.

26.   Noel, J., and J. Pouyssegur. Hormonal regulation, pharmacology, and membrane sorting of vertebrate Na+/H+ exchanger isoforms. Am. J. Physiol. 268 (Cell Physiol. 37): C283-C296, 1995[Abstract/Free Full Text].

27.   Noel, J., D. Roux, and J. Pouyssegur. Differential localization of Na+/H+ exchanger isoform (NHE1 and NHE3) in polarized epithelial cell lines. J. Cell Sci. 109: 929-939, 1996[Abstract].

28.   Pitkanen, O., A. K. Transwell, G. Downey, and H. O'Brodovich. Increased PO2 alters the bioelectric properties of fetal distal lung epithelium. Am. J. Physiol. 270 (Lung Cell. Mol. Physiol. 14): L1060-L1066, 1996[Abstract/Free Full Text].

29.   Phillips, P. G., L. M. Birnby, and A. Narendram. Hypoxia induces capillary network formation in cultured bovine pulmonary microvessel endothelial cells. Am. J. Physiol. 268 (Lung Cell. Mol. Physiol. 12): L789-L800, 1995[Abstract/Free Full Text].

30.   Pinsky, D., and D. Stern. Hypoxia-induced modulation of endothelial cell function. In: Reperfusion Injuries and Clinical Capillary Leak Syndrome, edited by B. A. Zikria, M. O. Oz, and R. W. Carlson. Armonk, NY: Futura, 1994, chapt. 2, p. 31-55.

31.   Pirttila, T. R., and R. A. Kauppinen. Recovery of intracellular pH in cortical brain slices following anoxia studied by nuclear magnetic resonance spectroscopy: role of lactate removal, extracellular sodium and sodium/hydrogen exchange. Neuroscience 47: 155-164, 1992[Medline].

32.   Planes, C., G. Friedlander, A. Loiseau, C. Amiel, and C. Clerici. Inhibition of Na-K-ATPase activity after prolonged hypoxia in an alveolar epithelial cell line. Am. J. Physiol. 271 (Lung Cell. Mol. Physiol. 15): L70-L78, 1996[Abstract/Free Full Text].

33.   Prat, A. G., E. J. Holtzman, D. Brown, C. C. Cunningham, I. L. Reisin, T. R. Kleyman, M. McLaughlin, G. R. Jackson, J. Lydon, and H. R. Cantiello. Renal epithelial protein (Apx) is an actin cytoskeleton-regulated Na+ channel. J. Biol. Chem. 271: 18045-18053, 1996[Abstract/Free Full Text].

34.   Rodman, D. M. Chronic hypoxia selectively augments rat pulmonary artery Ca2+ and K+ channel-mediated relaxation. Am. J. Physiol. 263 (Lung Cell. Mol. Physiol. 7): L88-L94, 1992[Abstract/Free Full Text].

36.   Schmedtje, J. F., W. L. Liu, and Y. Chen. pH is critical to the regulation of expression of the beta2-adrenergic receptor gene in hypoxia. Biochim. Biophys. Acta 1314: 25-33, 1996[Medline].

37.   Shaul, P. W., K. H. Muntz, D. DeBeltz, and L. M. Buja. Effects of prolonged hypoxia on adenylate cyclase activity and beta-adrenergic receptors in pulmonary and systemic arteries of the rat. Circ. Res. 66: 1526-1534, 1990[Abstract/Free Full Text].

38.   Shreeniwas, R., S. Ogawa, F. Cozzolino, G. Torcia, N. Braunstein, C. Butura, J. Brett, H. B. Lieberman, M. B. Furie, J. Joseph-Silverstein, and D. Stern. Macrovascular and microvascular endothelium during long-term hypoxia: alterations in cell growth, monolayer permeability, and cell surface coagulant properties. J. Cell. Physiol. 146: 8-17, 1991[Medline].

39.   Smirnov, S., T. Robertson, J. Ward, and P. Aaronson. Chronic hypoxia is associated with reduced delayed rectifier K+ current in rat pulmonary artery muscle cells. Am. J. Physiol. 266 (Heart Circ. Physiol. 35): H365-H370, 1994[Abstract/Free Full Text].

40.   Spiegel, D., P. D. Wilson, and B. A. Molitoris. Epithelial polarity following ischemia: a requirement for normal cell function. Am. J. Physiol. 257 (Renal Fluid Electrolyte Physiol. 26): F430-F436, 1989.

41.   Stevens, T., D. N. Cornfield, I. F. McMurtry, and D. M. Rodman. Acute reductions in PO2 depolarize pulmonary artery endothelial cells and decrease [Ca2+]i. Am. J. Physiol. 266 (Heart Circ. Physiol. 35): H1416-H1421, 1994[Abstract/Free Full Text].

42.   Sun, A. M., Y. Liu, J. N. Centracchio, E. M. Tolbert, and L D. Dworkin. Sodium-proton exchanger isoform expression and function in the terminal inner medullary collecting duct (Abstract). J. Am. Soc. Nephrol. 8: 11A, 1997.

43.   Tretyakov, A. V., and H. W. Farber. Endothelial cell tolerance to hypoxia: potential role of purine nucleotide phosphates. J. Clin. Invest. 95: 738-744, 1995.

44.   Voelkel, N. F., and R. M. Tuder. Cellular and molecular mechanisms in the pathogenesis of severe pulmonary hypertension. Eur. Respir. J. 8: 2129-2138, 1995[Abstract].

45.   Weir, E. K., and S. L. Archer. The mechanism of acute hypoxic pulmonary vasoconstriction: the tale of two channels. FASEB J. 9: 183-189, 1995[Abstract].

46.   Woodard, M., W. A. Dunn, R. O. Laine, L. M. Malandro, R. McMahon, O. Simell, E. R. Block, and M. S. Kilberg. Plasma membrane clustering of system y+ (CAT-1) amino acid transporter as detected by immunohistochemistry. Am. J. Physiol. 266 (Endocrinol. Metab. 29): E817-E824, 1994[Abstract/Free Full Text].

47.   Zhang, R., R. C. Carson, H. Zhang, G. Gibson, and H. M. Thomas. Pulmonary artery smooth muscle cell [Ca2+] and contraction: responses to diphenyleneiodonium and hypoxia. Am. J. Physiol. 273 (Lung Cell. Mol. Physiol. 17): L603-L611, 1997[Abstract/Free Full Text].


Am J Physiol Lung Cell Mol Physiol 275(3):L442-L451



This article has been cited by other articles:


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
S. Hom, M. A. Fleegal, R. D. Egleton, C. R. Campos, B. T. Hawkins, and T. P. Davis
Comparative changes in the blood-brain barrier and cerebral infarction of SHR and WKY rats
Am J Physiol Regulatory Integrative Comp Physiol, May 1, 2007; 292(5): R1881 - R1892.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
L. A. Shimoda, M. Fallon, S. Pisarcik, J. Wang, and G. L. Semenza
HIF-1 regulates hypoxic induction of NHE1 expression and alkalinization of intracellular pH in pulmonary arterial myocytes
Am J Physiol Lung Cell Mol Physiol, November 1, 2006; 291(5): L941 - L949.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
E. J. Rios, M. Fallon, J. Wang, and L. A. Shimoda
Chronic hypoxia elevates intracellular pH and activates Na+/H+ exchange in pulmonary arterial smooth muscle cells
Am J Physiol Lung Cell Mol Physiol, November 1, 2005; 289(5): L867 - L874.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
Z. H. Nemeth, E. A. Deitch, Q. Lu, C. Szabo, and G. Hasko
NHE blockade inhibits chemokine production and NF-kappa B activation in immunostimulated endothelial cells
Am J Physiol Cell Physiol, August 1, 2002; 283(2): C396 - C403.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
R. J. Gumina, J. Moore, P. Schelling, N. Beier, and G. J. Gross
Na+/H+ exchange inhibition prevents endothelial dysfunction after I/R injury
Am J Physiol Heart Circ Physiol, September 1, 2001; 281(3): H1260 - H1266.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
J. A. Madden, D. E. Ray, P. A. Keller, and J. G. Kleinman
Ion exchange activity in pulmonary artery smooth muscle cells: the response to hypoxia
Am J Physiol Lung Cell Mol Physiol, February 1, 2001; 280(2): L264 - L271.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
M. Cutaia, K. Tollefson, J. Kroczynski, N. Parks, and S. Rounds
Role of the Na/H antiport in pH-dependent cell death in pulmonary artery endothelial cells
Am J Physiol Lung Cell Mol Physiol, March 1, 2000; 278(3): L536 - L544.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
D. D’Arcangelo, F. Facchiano, L. M. Barlucchi, G. Melillo, B. Illi, L. Testolin, C. Gaetano, and M. C. Capogrossi
Acidosis Inhibits Endothelial Cell Apoptosis and Function and Induces Basic Fibroblast Growth Factor and Vascular Endothelial Growth Factor Expression
Circ. Res., February 18, 2000; 86(3): 312 - 318.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available </