|
|
||||||||
1 Cardiovascular Pulmonary Research Laboratory and 2 Department of Pediatrics, University of Colorado Health Sciences Center, Denver, Colorado 80262; and 3 Cardiovascular Research Center, Massachusetts General Hospital, Harvard Medical School, Charlestown, Massachusetts 02129
| |
ABSTRACT |
|---|
|
|
|---|
Endothelial nitric oxide (NO) synthase (eNOS) mRNA and protein and NO production are increased in hypoxia-induced hypertensive rat lungs, but it is uncertain whether eNOS gene expression and activity are increased in other forms of rat pulmonary hypertension. To investigate these questions, we measured eNOS mRNA and protein, eNOS immunohistochemical localization, perfusate NO product levels, and NO-mediated suppression of resting vascular tone in chronically hypoxic (3-4 wk at barometric pressure of 410 mmHg), monocrotaline-treated (4 wk after 60 mg/kg), and fawn-hooded (6-9 mo old) rats. eNOS mRNA levels (Northern blot) were greater in hypoxic and monocrotaline-treated lungs (130 and 125% of control lungs, respectively; P < 0.05) but not in fawn-hooded lungs. Western blotting indicated that eNOS protein levels increased to 300 ± 46% of control levels in hypoxic lungs (P < 0.05) but were decreased by 50 ± 5 and 60 ± 11%, respectively, in monocrotaline-treated and fawn-hooded lungs (P < 0.05). Immunostaining showed prominent eNOS expression in small neomuscularized arterioles in all groups, whereas perfusate NO product levels increased in chronically hypoxic lungs (3.4 ± 1.4 µM; P < 0.05) but not in either monocrotaline-treated (0.7 ± 0.3 µM) or fawn-hooded (0.45 ± 0.1 µM) lungs vs. normotensive lungs (0.12 ± 0.07 µM). All hypertensive lungs had increased baseline perfusion pressure in response to nitro-L-arginine but not to the inducible NOS inhibitor aminoguanidine. These results indicate that even though NO activity suppresses resting vascular tone in pulmonary hypertension, there are differences among the groups regarding eNOS gene expression and NO production. A better understanding of eNOS gene expression and activity in these models may provide insights into the regulation of this vasodilator system in various forms of human pulmonary hypertension.
hypoxia; pulmonary circulation; fawn-hooded rat; monocrotaline; nitric oxide
| |
INTRODUCTION |
|---|
|
|
|---|
THE PULMONARY VASCULAR ENDOTHELIUM is uniquely positioned to produce a variety of vasoactive mediators in response to changes in blood O2 and CO2 tensions, pressure, and flow. One such mediator, nitric oxide (NO), is synthesized by endothelial NO synthase (eNOS) and relaxes smooth muscle, inhibits neutrophil and platelet activation and adhesion, and attenuates smooth muscle cell proliferation (1). In the normotensive adult pulmonary circulation, NO mediates vasodilation to some stimuli and moderates vasoconstriction to others, but its overall importance in maintaining low basal vascular tone is unclear (1, 6, 8, 26). Similarly, there are conflicting reports of what happens to pulmonary vascular NO activity during development of pulmonary hypertension.
Some investigators have found increased NO production (10, 25), enhanced NO-dependent vasodilation (7, 25), and an NO-mediated attenuation of resting vascular tone in hypoxia-induced hypertensive rat lungs (5, 10, 26). Increased lung tissue and pulmonary vascular expression of eNOS mRNA and protein have also been observed (18, 29, 32, 38). However, others (2) have reported decreases in endothelium-dependent vasodilation in isolated hypertensive rat lungs and pulmonary arteries. In two other forms of rat pulmonary hypertension, i.e., monocrotaline induced and fawn-hooded idiopathic, isolated extralobar pulmonary arteries have blunted responses to endothelium-dependent vasodilators (4, 21), but intralobar arteries and perfused lungs showed NO-mediated attenuation of resting vascular tone (21, 40). A recent report (29) indicated that pulmonary arterial eNOS gene expression and NO activity are also increased in monocrotaline-induced hypertensive lungs, but similar measurements have not been reported for fawn-hooded rat lungs. Thus it remains unclear how the relationship between eNOS gene expression and NO production and activity is altered in different forms of pulmonary hypertension.
To further investigate the effects of pulmonary hypertension on eNOS gene expression, tissue localization, and NO production, we compared eNOS mRNA and protein levels and basal NO activity in the hypertensive lungs of chronically hypoxic, monocrotaline-treated, and fawn-hooded rats. Although these three different forms of pulmonary hypertension show similar characteristics of increases in resting pulmonary vascular tone, medial thickening of muscular pulmonary arteries, and neomuscularization of pulmonary arterioles (23, 24, 31), there are dissimilarities that may influence eNOS expression and NO activity. For example, in the hypoxic model, the pulmonary vascular endothelium is exposed to low O2 tensions and polycythemia, whereas these factors are not major components of the development of hypertension in the other two models (9, 29, 31). Also, although monocrotaline-induced pulmonary hypertension is preceded and accompanied by severe pulmonary microvascular endothelial injury and perivascular inflammation, these disorders do not generally occur in either hypoxic or fawn-hooded rats (2, 14, 31). Finally, fawn-hooded rats, which have a platelet storage pool disorder, spontaneously develop pulmonary hypertension of unknown etiology at sea level and an increased severity of the disease at the altitude of Denver (14, 31). Our experiments show that although NO activity apparently suppresses resting vascular tone in all three forms of pulmonary hypertension, there are significant differences among the groups in lung tissue eNOS gene expression and NO production.
| |
METHODS |
|---|
|
|
|---|
Animals. Adult male Sprague-Dawley rats (250-350 g) were exposed to either hypobaric hypoxia (17,000 ft, barometric pressure 410 mmHg) for 3-4 wk, a single subcutaneous injection of monocrotaline (60 mg/kg) and allowed 4 wk to develop pulmonary hypertension, or control conditions (altitude of Denver 5,280 ft, barometric pressure 630 mmHg). Adult male fawn-hooded rats, which are genetically predisposed to spontaneously develop pulmonary hypertension, were studied at 6-9 mo of age (250-300 g) when they had severe pulmonary hypertension at the altitude of Denver (31). All rats were exposed to a 12:12-h light-dark cycle and allowed free access to standard rat chow and water.
RNA blot hybridization. Control,
chronically hypoxic, monocrotaline-treated, and fawn-hooded rats
(n = 5 for each) were anesthetized with 30 mg of intraperitoneal pentobarbital sodium, the chest was
opened, and a lateral peripheral sample of lung tissue (~100 mg) was
removed and immediately homogenized in 1 ml of guanidine isothiocyanate. Homogenates were then frozen and stored
at
70°C until assayed. RNA was extracted by
ultracentrifugation through cesium chloride and measured by ultraviolet
light absorbance at 260 nm. Five micrograms of total cellular RNA were
fractionated in 1.3% agarose-formaldehyde gels containing ethidium
bromide, transferred to MagnaCharge membranes (Micron
Separations), and cross-linked by ultraviolet light. Membranes were
hybridized overnight at 42°C with a
32P-labeled
BamH I-EcoR
I restriction fragment of the rat eNOS cDNA (12), washed for 45 min at
65°C in 0.2× saline-sodium citrate (SSC; 1× SSC is 15 mM sodium citrate and 150 mM sodium chloride) plus 0.1% sodium dodecyl
sulfate (SDS), and then exposed to X-ray film. The membranes were
subsequently hybridized with a 10 M excess of
32P-labeled oligonucleotide
(ACGGTATCTGATCGTCTTCGAAC) complementary to rat 18S RNA, and the
autoradiograms were scanned and analyzed with a LaCie
SilverScanner II and the National Institutes of Health Image 1.44 software. The eNOS mRNA concentrations are expressed as
eNOS-to-18S absorbance ratios.
Western blotting. Samples of lung
tissue were isolated from the four groups of rats as described in
RNA blot hydridization and homogenized in an ice-cold extraction solution that contained 50 mM
Tris · HCl (pH 7.3), 0.1 mM EDTA, 0.1 mM EGTA, 1 M KCl, 20 mM
3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate, 10% glycerol, 0.1%
-mercaptoethanol, 100 µM phenylmethylsulfonyl fluoride, 2 µM leupeptin, 1 µM pepstatin A, and 5 µg/ml of
aprotinin. The homogenates were centrifuged at 14,000 g for 30 min at 4°C to remove cell
debris. Protein was measured with a Bio-Rad dye reagent and loaded at
10 µg/lane in the minigel or 75 µg/lane in the large gel
(SDS-polyacrylamide, 7.5% wt /vol) (17). Proteins were transferred
electrophoretically to nitrocellulose membranes (Optitran, Schleicher
and Schuell) and stained with Ponceau S (Sigma) to
visualize loading. The blot was incubated overnight at 4°C in
blocking solution [2% bovine serum albumin (BSA;
Sigma) in Tris-buffered saline-0.1% Tween 20 (TBS-T; pH
7.6)] and then for 2 h at room temperature with primary antibody
to eNOS (dilution 1:500 in 2% BSA-TBS-T; mouse monoclonal
IgG1; Transduction Laboratories). After the blot was washed in TBS-T at
room temperature, the blot was incubated with horseradish peroxidase
labeled with donkey anti-mouse secondary antibody (diluted 1:17,000 in
2% BSA-TBS-T; Jackson Immunochemicals) for 45 min at room temperature.
The blot was then washed in TBS with and without Tween
20. Positive protein bands were visualized by
chemiluminescence (enhanced chemiluminescence kit, Amersham) and
measured by densitometry (Silverscanner II, National Institutes of
Health Photoshop).
Immunohistochemical staining for eNOS and von Willebrand factor proteins. Lungs were perfusion fixed with buffered 1% paraformaldehyde, cut into 2- to 6-mm sections, placed in 10% buffered Formalin, and embedded in paraffin. Paraffin sections 5 µm thick were serially mounted onto Superfrost Plus slides (Fisher Scientific, Fair Lawn, NJ) and dewaxed in 100% xylene. Sections were rehydrated by immersion in 100% ethanol, 95% ethanol-5% water, 70% ethanol-30% water, and then 100% water. Antigen retrieval was performed by boiling the slides in 0.01 M citric acid, pH 6.0. Slides were washed in PBS (1× PBS is 2.7 mM KCl, 1.2 mM KH2PO4, 138 mM NaCl, and 8.1 mM NaHPO4). Endogenous biotin in the tissue sections was blocked by glucose-glucose oxidase treatment [0.2 M glucose and 1.5 U/ml glucose oxidase (Boehringer Mannheim) in 1× PBS]. The slides were washed in 1× PBS. Sections were blocked with Super Block (Sky Tek, Logan, UT) diluted 1:10 (vol/vol) in 1× PBS and were then incubated with anti-eNOS monoclonal antibody (Transduction Laboratories) diluted 1:10,000, anti-von Willebrand factor polyclonal antibody (DAKO) diluted 1:10,000, or an IgG1 negative control (Jackson Laboratories) diluted 1:10,000 in 1× PBS-2% NaN3 (wt /vol). The slides were washed again in 1× PBS and incubated in streptavidin-biotin-horseradish peroxide solution. They were then developed with diaminobenzidine and hydrogen peroxide with NiCl for enhancement (Vector). The NiCl enhancement-diaminobenzidine color development reaction was stopped by washing with water; the slides were dehydrated in 70% ethanol-30% water, 95% ethanol-5% water, and 100% ethanol; and dehydration was completed with 100% xylene before a coverslip was put on.
Isolated lungs. Lungs were isolated
from the control pulmonary normotensive rats and from three groups of
pulmonary hypertensive rats after intraperitoneal administration of 30 mg of pentobarbital sodium and an intracardiac injection of 200 IU of heparin. After cannulation of the pulmonary
artery and left ventricle, the lungs were flushed of blood with 20 ml
of physiological salt solution (PSS) and placed in a heated, humidified
chamber. They were ventilated at an inspiratory pressure of 9 cmH2O and end-expiratory pressure of 2.5 cmH2O with a humid mixture
of 21% O2-5%
CO2-74%
N2 at 60 breaths/min. Perfusion
was at a constant peristaltic pump flow of 0.04 ml · g body
wt
1 · min
1.
The PSS perfusate contained (in mM) 116.3 NaCl, 5.4 KCl, 0.83 MgSO4, 19.0 NaHCO3, 1.04 NaH2PO4,
1.8 CaCl2 · H2O,
and 5.5 D-glucose (Earle's
balanced salt solution; Sigma). Ficoll (4 g/100 ml, type 70; Sigma) was
included as a colloid, and meclofenamate (3.1 µM) was added to
inhibit prostaglandin synthesis. Effluent perfusate was drained from
the left ventricular cannula into a reservoir and was recirculated
(total volume 30 ml). Lung and perfusate temperatures were maintained
at 38°C, and perfusate pH was kept between 7.35 and 7.45. Mean
perfusion pressure was measured continuously with a transducer and pen
recorder, and changes in pressure were considered to reflect changes in
vascular resistance. The lungs were equilibrated for 20 min before
experiments were begun. To test for NO-mediated suppression of resting
normoxic vascular tone, the NOS inhibitors 100 µM
nitro-L-arginine (26) and 300 µM aminoguanidine (11) or their respective vehicles saline and DMSO were added to the perfusate, and the changes in
perfusion pressure were measured 30 min later.
Measurement of perfusate NO products.
An NO chemiluminescence analyzer (Sievers Research) was used to measure
levels of NO products
(NOx; NO,
NO
2, NO
3, and
nitrosothiols) in the normoxic PSS perfusates of
control normotensive and chronically hypoxic, monocrotaline-treated, and fawn-hooded hypertensive lungs. After 65 min of recirculating perfusion, 2-ml samples of effluent perfusate were drawn into N2-flushed syringes and stored at
20°C for up to 2 wk. The samples were then thawed, and a
10-µl aliquot was injected into the vacuum chamber of the NO analyzer
that contained 2 ml of 0.1 M vanadium chloride (type III; Aldrich)
dissolved in 1 N HCl and heated to 90°C to convert back to NO any
NO
2,
NO
3, and nitrosothiols
that may have been formed. The liberated NO was driven into the gas
phase of the vacuum chamber by bubbling the reaction
mixture with argon. Linear calibration curves were generated by
measuring NO produced by 10-100 pM sodium nitrate solutions. A
small background signal produced by the PSS plus Ficoll solution was
subtracted from the lung perfusate signal.
| |
RESULTS |
|---|
|
|
|---|
Right ventricular hypertrophy. The existence of pulmonary hypertension in the chronically hypoxic, monocrotaline-treated, and fawn-hooded rats was reflected in the increased right ventricular-to-left ventricular plus septal weight ratios that were, respectively, 0.55 ± 0.03 (n = 6), 0.53 ± 0.04 (n = 9), and 0.76 ± 0.08 (n = 13) vs. 0.30 ± 0.01 (n = 6; P < 0.05) in normotensive control animals. Although pulmonary arterial pressures were not measured, these results suggested that the fawn-hooded rats had more severe pulmonary hypertension than the other two hypertensive groups.
eNOS mRNA. Northern blot analysis of
peripheral lung tissue showed similar increases in eNOS mRNA in
chronically hypoxic and monocrotaline-treated hypertensive lungs (130 and 125% of normotensive control lungs, respectively;
P < 0.05) but not in fawn-hooded hypertensive lungs (Fig. 1). Northern blot
probing for expression of inducible NOS (iNOS) mRNA
with a rat cDNA (genomic fragment containing exon 23 of the iNOS gene)
in the above groups was negative (data not shown).
|
eNOS protein. Western blot analysis of
lung homogenates showed increased eNOS protein levels in chronically
hypoxic hypertensive lungs but decreased levels in
monocrotaline-treated and fawn-hooded hypertensive lungs (Fig.
2).
|
eNOS localization. Immunohistochemical
staining of lung sections from all three forms of pulmonary
hypertension showed prominent expression of eNOS protein in
small, medium, and large arteries (Fig. 3).
In contrast, there was little eNOS staining in the small peripheral
vessels of normotensive lungs (Fig. 3). There was also eNOS staining of
airway epithelial cells in both normotensive and hypertensive lungs.
Monocrotaline-treated lungs had thickened alveolar walls, whereas the
fawn-hooded lungs showed an emphysematous pattern of alveolar
wall breakdown and an apparent rarification of small
vessels as judged by the paucity of von Willebrand
immunostaining (Fig. 4).
|
|
Vasoreactivity. Addition of the
nonselective NOS inhibitor
nitro-L-arginine to the
perfusate of chronically hypoxic, monocrotaline-treated, and
fawn-hooded hypertensive lungs during normoxic (21%
O2) ventilation caused marked
increases in baseline vascular tone in each group (Fig.
5). In contrast, aminoguanidine, a
preferential inhibitor of iNOS, did not cause vasoconstriction in any
group of hypertensive lungs. Previous studies (5, 10, 26) have shown
that NOS inhibitors elicit little or no vasoconstriction in normoxic
normotensive rat lungs.
|
NOx levels.
NOx accumulation in perfusate of
isolated lungs was significantly elevated only in the chronically
hypoxic hypertensive lungs (Fig. 6).
|
| |
DISCUSSION |
|---|
|
|
|---|
This study compared levels of eNOS mRNA and protein, localization of eNOS protein, NO-mediated suppression of resting (normoxic) vascular tone, and basal NO production in the hypertensive lungs of chronically hypoxic, monocrotaline-treated, and fawn-hooded rats. Measurement of right ventricular hypertrophy showed that all three groups of rats had developed pulmonary hypertension. The fawn-hooded rats apparently had the most severe hypertension, which may have been due to the longer duration of the disease process (28 vs. 3-4 wk) (31), elevated endothelin (ET)-1 levels (34), or other unidentified vasoactive factors. Northern and Western blot analyses of lung tissue and chemiluminescence assay of perfusate NOx showed significant differences among the hypertensive groups in lung eNOS gene expression and normoxic NO production. The chronically hypoxic and monocrotaline-treated groups had increased eNOS mRNA, whereas the fawn-hooded rat lungs were similar to control lungs. Total eNOS protein levels were elevated in the chronically hypoxic but reduced in the monocrotaline-treated and fawn-hooded hypertensive lungs compared with normotensive lungs. In contrast, a similar pattern of prominent eNOS protein expression was observed in small pulmonary arteries of all three hypertensive groups, which would appear to be linked to the NO-dependent attenuation of resting vascular tone in the perfused hypertensive lungs. However, only the hypoxia-induced hypertensive lungs had elevated NOx levels in the lung perfusate.
Our observations agree with previous reports (18, 29, 32, 38) that eNOS mRNA and protein are increased in hypoxia-induced hypertensive rat lungs. Le Cras et al. (18) found that at least part of the increase in lung tissue eNOS is due to increased expression of the enzyme in the endothelium of hypertensive muscular pulmonary arteries and de novo expression in small resistance vessels. Resta et al. (29) reported that eNOS immunostaining is increased in the endothelium of hypertensive medium-sized pulmonary arteries but not in veins of chronically hypoxic rats. These increases in hypertensive pulmonary arterial eNOS levels coincide with pharmacological evidence of increased responsiveness to endothelium-dependent vasodilators (5, 10, 26, 30), increased NO-mediated suppression of resting vascular tone (5, 10, 26), and increased capacity for normoxic NO production as measured by an accumulation of NOx in the lung perfusate (10, 25).
Although hypoxic pulmonary hypertension in rats is clearly associated with upregulation of lung and pulmonary arterial eNOS, it is unclear whether the upregulation is caused by the hypertension or some other, nonhemodynamic effect of the hypoxic exposure. Because eNOS upregulation is limited to the hypertensive arteries, Resta et al. (29) suggested that hemodynamic factors rather than hypoxia are responsible, and studies (28, 35) of cultured endothelial cells showed that eNOS gene expression is increased by shear stress. The direct effect of hypoxia on eNOS mRNA levels in cultured endothelial cells is variable, with several reports (16, 20, 22, 27) showing a decrease and one showing an increase (3). However, Le Cras et al. (17) recently found that left pulmonary arterial stenosis in chronically hypoxic rats does not prevent eNOS upregulation in the hypoxic but hypoperfused and hypotensive left lung. This suggests that nonhemodynamic effects of the hypoxic exposure play a significant role in increasing eNOS gene expression.
In contrast to the observations of Xue et al. (38) and Le Cras et al. (18) in chronically hypoxic hypertensive rat lungs, we detected no lung tissue expression of iNOS in either chronically hypoxic, monocrotaline-treated, or fawn-hooded hypertensive rat lungs. In addition, the lack of effect of the iNOS inhibitor aminoguanidine on resting vascular tone of the perfused lungs indicated that even if iNOS was being expressed at some low level that was not detected by Northern blot analysis, it was not producing enough NO to affect pulmonary vascular resistance.
Although eNOS mRNA levels in the monocrotaline-treated hypertensive lungs were increased similarly to those in the chronically hypoxic lungs, there was a marked decrease in levels of eNOS protein as measured by Western blotting. This disparity raises the possibility that even though there was stimulation of eNOS transcription in this inflammatory model of pulmonary hypertension, there were also factors that interfered with translation of the eNOS message and/or augmented degradation of the enzyme. However, our immunostaining results agreed with those of Resta et al. (29), which showed increased eNOS levels in the hypertensive pulmonary arteries of monocrotaline-treated rats. Thus the decreased eNOS protein in monocrotaline-treated lung homogenates might be related to a localized upregulation of eNOS in the hypertensive arteries combined with decreased expression in other cells, e.g., in airway epithelial cells (37). Although this possibility is supported by prominent eNOS immunostaining in small arterioles and the increased NO-mediated suppression of resting vascular tone that was not accompanied by increased perfusate accumulation of NOx, there was no obvious difference in the eNOS immunostaining of airway epithelium between the monocrotaline-treated and hypoxic hypertensive lungs. An alternative explanation of decreased eNOS protein in Western blots of monocrotaline-treated lungs is that a marked increase in other lung proteins (15) diluted the eNOS signal.
Hypertensive fawn-hooded rat lungs show NO-mediated suppression of resting vascular tone and increased responsiveness to endothelium-dependent vasodilators (36, 40), and we observed prominent immunostaining of eNOS in the hypertensive pulmonary resistance arteries. However, similar to the situation in the monocrotaline-treated rat lungs, there was a decrease in lung tissue expression of eNOS and low levels of NOx in the lung perfusate. In contrast to the chronically hypoxic and monocrotaline-treated hypertensive lungs, which appear to have a normal number of blood vessels (13), the von Willebrand immunostaining and emphysematous appearance of the fawn-hooded lungs suggest that there may be a decrease in vessel density in this model. Whether this or some other factor accounts for the decreased levels in lung tissue eNOS protein is unclear.
One feature common to all three forms of rat pulmonary hypertension is neomuscularization of the peripheral pulmonary arterioles (23, 24, 31). Because these muscularized arterioles are likely the primary site of increased vascular resistance in hypertensive lungs (5, 23) and because there appears to be increased expression of eNOS in these vessels in chronically hypoxic (18), monocrotaline-treated (29), and fawn-hooded lungs, it is possible that a localized increase in NO production in this vascular segment accounts for the NO-mediated suppression of resting vascular tone in all three forms of pulmonary hypertension. Alternatively, there may not be an increase in NO production in the muscularized arterioles of the monocrotaline-treated and fawn-hooded lungs but, instead, an increased sensitivity of the vascular smooth muscle to NO vasodilation. We have recently found that the high normoxic NOx production in hypoxia-induced hypertensive lungs is due to inherent ETB-receptor activation; i.e., the high NOx production is prevented by the ETB-receptor antagonist BQ-788 (McMurtry, unpublished data), and it may be that ETB receptors are not upregulated in monocrotaline-treated and fawn-hooded hypertensive lungs as they are in chronically hypoxic hypertensive lungs (19, 33). In fact, one report (39) suggested that ETB receptors may be downregulated in monocrotaline-treated rat lungs.
In summary, this study indicates that although there is increased eNOS in the neomuscularized resistance arterioles and basal NO activity attenuates resting pulmonary vascular tone in each of three different forms of rat pulmonary hypertension, there are marked differences in total lung tissue expression of eNOS mRNA and protein and in release of NOx into the lung perfusate. The factors accounting for these differences among chronically hypoxic, monocrotaline-treated, and fawn-hooded hypertensive rat lungs are unknown. A better understanding of the factors regulating eNOS gene expression and NO production in these animal models may provide insights into the regulation of this vasodilator system in various forms of human pulmonary hypertension.
| |
ACKNOWLEDGEMENTS |
|---|
This study was supported by National Heart, Lung, and Blood Institute (NHLBI) Program Project Grant HL-14985.
| |
FOOTNOTES |
|---|
R. C. Tyler was supported by NHLBI National Research Service Award HL-07670. M. Muramatsu was supported partly by Juntendo University School of Medicine (Tokyo, Japan), and D. M. Rodman was supported by a Clinical Scientist Award from the American Heart Association.
Address for reprint requests: R. C. Tyler, CVP Research Laboratory, B-133, Univ. of Colorado Health Sciences Center, 4200 East Ninth Ave., Denver, CO 80262.
Received 24 June 1997; accepted in final form 3 November 1998.
| |
REFERENCES |
|---|
|
|
|---|
1.
Adnot, S.,
B. Raffestin,
and
S. Eddahibi.
NO in the lung.
Respir. Physiol.
101:
109-120,
1995[Medline].
2.
Adnot, S.,
B. Raffestin,
S. Eddahibi,
P. Braquet,
and
P.-E. Chabrier.
Loss of endothelium-dependent relaxant activity in the pulmonary circulation of rats exposed to chronic hypoxia.
J. Clin. Invest.
87:
155-162,
1991.
3.
Arnet, U. A.,
A. McMillan,
J. L. Dinerman,
B. Ballermann,
and
C. J. Lowenstein.
Regulation of endothelial nitric oxide synthase during hypoxia.
J. Biol. Chem.
271:
15069-15073,
1996
4.
Ashmore, R. C.,
D. M. Rodman,
K. Sato,
S. A. Webb,
R. F. O'Brien,
I. F. McMurtry,
and
T. J. Stelzner.
Paradoxical constriction to platelets by arteries from rats with pulmonary hypertension.
Am. J. Physiol.
260 (Heart Circ. Physiol. 29):
H1929-H1934,
1991
5.
Barer, G.,
C. Emery,
A. Stewart,
D. Bee,
and
P. Howard.
Endothelial control of the pulmonary circulation in normal and chronically hypoxic rats.
J. Physiol. (Lond.)
463:
1-16,
1993
6.
Cremona, G.,
A. M. Wood,
L. W. Hall,
E. A. Bower,
and
T. Higenbottam.
Effect of inhibitors of nitric oxide release and action on vascular tone in isolated lungs of pig, sheep, dog and man.
J. Physiol. (Lond.)
481:
185-195,
1994
7.
Eichinger, M. R.,
and
B. R. Walker.
Enhanced pulmonary arterial dilation to arginine vasopressin in chronically hypoxic rats.
Am. J. Physiol.
267 (Heart Circ. Physiol. 36):
H2413-H2419,
1994
8.
Hasunuma, K.,
T. Yamaguchi,
D. M. Rodman,
R. F. O'Brien,
and
I. F. McMurtry.
Effects of inhibitors of EDRF and EDHF on vasoreactivity of perfused rat lungs.
Am. J. Physiol.
260 (Lung Cell. Mol. Physiol. 4):
L97-L104,
1991
9.
Hilliker, K. S.,
and
R. A. Roth.
Increased vascular responsiveness in lungs of rats with pulmonary hypertension induced by monocrotaline pyrrole.
Am. Rev. Respir. Dis.
131:
46-50,
1985[Medline].
10.
Isaacson, T. C.,
V. Hampl,
E. K. Weir,
D. P. Nelson,
and
S. L. Archer.
Increased endothelium-derived NO in hypertensive pulmonary circulation of chronically hypoxic rats.
J. Appl. Physiol.
76:
933-940,
1994
11.
Joshi, P. C.,
J. B. Grogan,
and
K. R. Thomae.
Effect of aminoguanidine on in vivo expression of cytokines and inducible nitric oxide synthase in the lungs of endotoxemic rats.
Res. Commun. Mol. Pathol. Pharmacol.
91:
339-346,
1996[Medline].
12.
Kawai, N.,
D. B. Bloch,
G. Filippov,
D. Rabkina,
H. C. Suen,
P. D. Losty,
S. P. Janssens,
W. M. Zapol,
S. De La Monte,
and
K. D. Bloch.
Constitutive endothelial nitric oxide synthase gene expression is regulated during lung development.
Am. J. Physiol.
268 (Lung Cell. Mol. Physiol. 12):
L589-L595,
1995
13.
Kay, J. M.,
K. L. Suyama,
and
P. M. Keane.
Failure to show decrease in small pulmonary blood vessels in rats with experimental pulmonary hypertension.
Thorax
37:
927-930,
1982
14.
Kentera, D.,
D. Susic,
V. Veljkovic,
G. Tucakovic,
and
V. Koko.
Pulmonary artery pressure in rats with hereditary platelet function defect.
Respiration
54:
110-114,
1988[Medline].
15.
Lafranconi, W. M.,
and
R. J. Huxtable.
Changes in angiotensin-converting enzyme activity in lungs damaged by the pyrrolizidine alkaloid monocrotaline.
Thorax
38:
307-309,
1983
16.
Laufs, U.,
V. L. Fata,
and
J. K. Liao.
Inhibition of 3-hydroxy-3-methylglutaryl (HMG)-CoA reductase blocks hypoxia-mediated down-regulation of endothelial nitric oxide synthase.
J. Biol. Chem.
272:
31725-31729,
1997
17.
Le Cras, T. D.,
R. C. Tyler,
M. P. Horan,
K. G. Morris,
R. M. Tuder,
I. F. McMurtry,
R. A. Johns,
and
S. H. Abman.
Effects of chronic hypoxia and altered hemodynamics on endothelial nitric oxide synthse expression in the adult rat lung.
J. Clin. Invest.
101:
795-801,
1998[Medline].
18.
Le Cras, T. D.,
C. Xue,
A. Rengasamy,
and
R. A. Johns.
Chronic hypoxia upregulates endothelial and inducible NO synthase gene and protein expression in rat lung.
Am. J. Physiol.
270 (Lung Cell. Mol. Physiol. 14):
L164-L170,
1996
19.
Li, H.,
S.-J. Chen,
Y.-F. Chen,
Q. C. Meng,
J. Durand,
S. Oparil,
and
T. S. Elton.
Enhanced endothelin-1 and endothelin receptor gene expression in chronic hypoxia.
J. Appl. Physiol.
77:
1451-1459,
1994
20.
Liao, J. K.,
J. J. Zulueta,
F., S. Yu,
H. B. Peng,
C. G. Cote,
and
P. M. Hassoun.
Regulation of bovine endothelial constitutive nitric oxide synthase by oxygen.
J. Clin. Invest.
96:
2661-2666,
1995.
21.
Madden, J. A.,
P. A. Keller,
J. S. Choy,
T. A. Alvarez,
and
A. D. Hacker.
L-Arginine-related responses to pressure and vasoactive agents in monocrotaline-treated rat pulmonary arteries.
J. Appl. Physiol.
79:
589-593,
1995
22.
McQuillan, L. P.,
G. K. Leung,
P. A. Marsden,
S. K. Kostyk,
and
S. Kourembanas.
Hypoxia inhibits expression of eNOS via transcriptional and posttranscriptional mechanisms.
Am. J. Physiol.
267 (Heart Circ. Physiol. 36):
H1921-H1927,
1994
23.
Meyrick, B.,
W. Gamble,
and
L. Reid.
Development of Crotalaria pulmonary hypertension: hemodynamic and structural study.
Am. J. Physiol.
239 (Heart Circ. Physiol. 8):
H692-H702,
1980.
24.
Meyrick, B.,
and
L. Reid.
Hypoxia-induced structural changes in the media and adventitia of rat hilar pulmonary artery and their regression.
Am. J. Pathol.
100:
151-169,
1980[Abstract].
25.
Muramatsu, M.,
R. C. Tyler,
D. M. Rodman,
and
I. F. McMurtry.
Thapsigargin stimulates increased NO activity in hypoxic hypertensive rat lungs and pulmonary arteries.
J. Appl. Physiol.
80:
1336-1344,
1996
26.
Oka, M.,
K. Hasunuma,
S. A. Webb,
T. J. Stelzner,
D. M. Rodman,
and
I. F. McMurtry.
EDRF suppresses an unidentified vasoconstrictor mechanism in hypertensive rat lungs.
Am. J. Physiol.
264 (Lung Cell. Mol. Physiol. 8):
L587-L597,
1993
27.
Phelan, M. W.,
and
D. V. Faller.
Hypoxia decreases constitutive nitric oxide synthase transcript and protein in cultured endothelial cells.
J. Cell. Physiol.
167:
469-476,
1996[Medline].
28.
Ranjan, V.,
Z. Xiao,
and
S. L. Diamond.
Constitutive NOS expression in cultured endothelial cells is elevated by fluid shear stress.
Am. J. Physiol.
269 (Heart Circ. Physiol. 38):
H550-H555,
1995
29.
Resta, T. C.,
R. J. Gonzales,
W. G. Dail,
T. C. Sanders,
and
B. R. Walker.
Selective upregulation of arterial endothelial nitric oxide synthase in pulmonary hypertension.
Am. J. Physiol.
272 (Heart Circ. Physiol. 41):
H806-H813,
1997
30.
Resta, T. C.,
and
B. R. Walker.
Chronic hypoxia selectively augments endothelium-dependent pulmonary arterial vasodilation.
Am. J. Physiol.
270 (Heart Circ. Physiol. 39):
H888-H896,
1996
31.
Sato, K.,
S. Webb,
A. Tucker,
M. Rabinovitch,
R. F. O'Brien,
I. F. McMurtry,
and
T. J. Stelzner.
Factors influencing the idiopathic development of pulmonary hypertension in the fawn-hooded rat.
Am. Rev. Respir. Dis.
145:
793-797,
1992[Medline].
32.
Shaul, P. W.,
A. J. North,
T. S. Brannon,
K. Ujiie,
L. B. Wells,
P. A. Nisen,
C. J. Lowenstein,
S. H. Snyder,
and
R. A. Star.
Prolonged in vivo hypoxia enhances nitric oxide synthase type I and type III gene expression in adult rat lung.
Am. J. Respir. Cell Mol. Biol.
13:
167-174,
1995[Abstract].
33.
Soma, S.,
H. Takahashi,
M. Muramatsu,
M. Oka,
and
Y. Fukuchi.
Localization and distribution of ETA and ETB receptors in rat pulmonary vasculature, and change of their expression after exposure to hypobaric hypoxia (Abstract).
Am. J. Respir. Crit. Care Med.
157:
A725,
1998.
34.
Stelzner, T. J.,
R. F. O'Brien,
M. Yanagisawa,
T. Sakurai,
K. Sato,
S. Webb,
M. Zamora,
I. F. McMurtry,
and
J. H. Fisher.
Increased lung endothelin-1 production in rats with idiopathic pulmonary hypertension.
Am. J. Physiol.
262 (Lung Cell. Mol. Physiol. 6):
L614-L620,
1992
35.
Uematsu, M.,
Y. Ohara,
J. P. Navas,
K. Nishida,
T. J. Murphy,
R. W. Alexander,
R. M. Nerem,
and
D. G. Harrison.
Regulation of endothelial cell nitric oxide synthase mRNA expression by shear stress.
Am. J. Physiol.
269 (Cell Physiol. 38):
C1371-C1378,
1995
36.
Webb, S.,
R. Ashmore,
I. F. McMurtry,
and
T. J. Stelzner.
Perfused lung responses to platelets, ADP and serotonin (5-HT) in pulmonary hypertensive rats (Abstract).
FASEB J.
5:
A1429,
1991.
37.
Xue, C.,
S. J. Botkin,
and
J. A. Johns.
Localization of endothelial NOS at the basal microtubule membrane in ciliated epithelium of rat lung.
J. Histochem. Cytochem.
44:
463-471,
1996[Abstract].
38.
Xue, C.,
A. Rengasamy,
T. D. Le Cras,
P. A. Koberna,
G. C. Dailey,
and
R. A. Johns.
Distribution of NOS in normoxic vs. hypoxic rat lung: upregulation of NOS by chronic hypoxia.
Am. J. Physiol.
267 (Lung Cell. Mol. Physiol. 11):
L667-L678,
1994
39.
Yorikane, R., T. Miyauchi, S. Sakai, T. Sakurai, I. Yamaguchi, Y. Sugishita, and K. Goto. Altered expression of
ETB-receptor mRNA in the lung of
rats with pulmonary hypertension. J. Cardiovasc.
Pharmacol. 22, Suppl.
8: S336-S338, 1993.
40.
Zamora, M. R.,
M. Oka,
R. C. Tyler,
K. G. Morris,
I. F. McMurtry,
and
T. J. Stelzner.
Inhibition of endothelium-derived relaxing factor exacerbates pulmonary hypertension in fawn-hooded rats (Abstract).
Am. J. Crit. Care Med.
149:
A22,
1994.
This article has been cited by other articles:
![]() |
J. Lee, R. Reich, F. Xu, and P. B. Sehgal Golgi, trafficking, and mitosis dysfunctions in pulmonary arterial endothelial cells exposed to monocrotaline pyrrole and NO scavenging Am J Physiol Lung Cell Mol Physiol, October 1, 2009; 297(4): L715 - L728. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. G. DeMarco, J. Habibi, A. T. Whaley-Connell, R. I. Schneider, J. R. Sowers, B. T. Andresen, A. A. Gutweiler, L. Ma, M. S. Johnson, C. M. Ferrario, et al. Rosuvastatin ameliorates the development of pulmonary arterial hypertension in the transgenic (mRen2)27 rat Am J Physiol Heart Circ Physiol, September 1, 2009; 297(3): H1128 - H1139. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. T. Demchenko, D. N. Atochin, D. R. Gutsaeva, R. R. Godfrey, P. L. Huang, C. A. Piantadosi, and B. W. Allen Contributions of nitric oxide synthase isoforms to pulmonary oxygen toxicity, local vs. mediated effects Am J Physiol Lung Cell Mol Physiol, May 1, 2008; 294(5): L984 - L990. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. Snow, V. Kitzis, C. E. Norton, S. N. Torres, K. D. Johnson, N. L. Kanagy, B. R. Walker, and T. C. Resta Differential effects of chronic hypoxia and intermittent hypocapnic and eucapnic hypoxia on pulmonary vasoreactivity J Appl Physiol, January 1, 2008; 104(1): 110 - 118. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. B. Sehgal and S. Mukhopadhyay Pulmonary arterial hypertension: a disease of tethers, SNAREs and SNAPs? Am J Physiol Heart Circ Physiol, July 1, 2007; 293(1): H77 - H85. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Sasaki, S. Doi, S. Mizutani, and H. Azuma Roles of accumulated endogenous nitric oxide synthase inhibitors, enhanced arginase activity, and attenuated nitric oxide synthase activity in endothelial cells for pulmonary hypertension in rats Am J Physiol Lung Cell Mol Physiol, June 1, 2007; 292(6): L1480 - L1487. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mukhopadhyay, F. Xu, and P. B. Sehgal Aberrant cytoplasmic sequestration of eNOS in endothelial cells after monocrotaline, hypoxia, and senescence: live-cell caveolar and cytoplasmic NO imaging Am J Physiol Heart Circ Physiol, March 1, 2007; 292(3): H1373 - H1389. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Nagaoka, S. A. Gebb, V. Karoor, N. Homma, K. G. Morris, I. F. McMurtry, and M. Oka Involvement of RhoA/Rho kinase signaling in pulmonary hypertension of the fawn-hooded rat J Appl Physiol, March 1, 2006; 100(3): 996 - 1002. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. L. Jernigan, B. R. S. Broughton, B. R. Walker, and T. C. Resta Impaired NO-dependent inhibition of store- and receptor-operated calcium entry in pulmonary vascular smooth muscle after chronic hypoxia Am J Physiol Lung Cell Mol Physiol, March 1, 2006; 290(3): L517 - L525. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Hampl, J. Bibova, A. Banasova, J. Uhlik, D. Mikova, O. Hnilickova, V. Lachmanova, and J. Herget Pulmonary vascular iNOS induction participates in the onset of chronic hypoxic pulmonary hypertension Am J Physiol Lung Cell Mol Physiol, January 1, 2006; 290(1): L11 - L20. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. L. Jernigan, B. R. Walker, and T. C. Resta Chronic hypoxia augments protein kinase G-mediated Ca2+ desensitization in pulmonary vascular smooth muscle through inhibition of RhoA/Rho kinase signaling Am J Physiol Lung Cell Mol Physiol, December 1, 2004; 287(6): L1220 - L1229. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. L. Jernigan, B. R. Walker, and T. C. Resta Endothelium-derived reactive oxygen species and endothelin-1 attenuate NO-dependent pulmonary vasodilation following chronic hypoxia Am J Physiol Lung Cell Mol Physiol, October 1, 2004; 287(4): L801 - L808. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. D. Fike, J. L. Aschner, Y. Zhang, and M. R. Kaplowitz Impaired NO signaling in small pulmonary arteries of chronically hypoxic newborn piglets Am J Physiol Lung Cell Mol Physiol, June 1, 2004; 286(6): L1244 - L1254. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. L. Jernigan, T. C. Resta, and B. R. Walker Contribution of oxygen radicals to altered NO-dependent pulmonary vasodilation in acute and chronic hypoxia Am J Physiol Lung Cell Mol Physiol, May 1, 2004; 286(5): L947 - L955. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Barman, S. Zhu, and R. E. White Protein kinase C inhibits BKCa channel activity in pulmonary arterial smooth muscle Am J Physiol Lung Cell Mol Physiol, January 1, 2004; 286(1): L149 - L155. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. L. Jernigan, B. R. Walker, and T. C. Resta Pulmonary PKG-1 is upregulated following chronic hypoxia Am J Physiol Lung Cell Mol Physiol, September 1, 2003; 285(3): L634 - L642. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Barman, S. Zhu, G. Han, and R. E. White cAMP activates BKCa channels in pulmonary arterial smooth muscle via cGMP-dependent protein kinase Am J Physiol Lung Cell Mol Physiol, June 1, 2003; 284(6): L1004 - L1011. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. C. Blumberg, K. Wolf, M. Arzt, C. Lorenz, G. A. J. Riegger, and M. Pfeifer Effects of ET-A receptor blockade on eNOS gene expression in chronic hypoxic rat lungs J Appl Physiol, February 1, 2003; 94(2): 446 - 452. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Li, V. E. Laubach, and R. A. Johns Upregulation of lung soluble guanylate cyclase during chronic hypoxia is prevented by deletion of eNOS Am J Physiol Lung Cell Mol Physiol, August 1, 2001; 281(2): L369 - L376. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Fagan Physiological and Genomic Consequences of Intermittent Hypoxia: Selected Contribution: Pulmonary hypertension in mice following intermittent hypoxia J Appl Physiol, June 1, 2001; 90(6): 2502 - 2507. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. KHARITONOV and P. J. BARNES Exhaled Markers of Pulmonary Disease Am. J. Respir. Crit. Care Med., June 1, 2001; 163(7): 1693 - 1722. [Full Text] [PDF] |
||||
![]() |
C. Partovian, S. Adnot, B. Raffestin, V. Louzier, M. Levame, I. M. Mavier, P. Lemarchand, and S. Eddahibi Adenovirus-Mediated Lung Vascular Endothelial Growth Factor Overexpression Protects against Hypoxic Pulmonary Hypertension in Rats Am. J. Respir. Cell Mol. Biol., December 1, 2000; 23(6): 762 - 771. [Abstract] [Full Text] |
||||
![]() |
B. R. Walker, T. C. Resta, and L. D. Nelin Nitric oxide-dependent pulmonary vasodilation in polycythemic rats Am J Physiol Heart Circ Physiol, November 1, 2000; 279(5): H2382 - H2389. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Hampl and J. Herget Role of Nitric Oxide in the Pathogenesis of Chronic Pulmonary Hypertension Physiol Rev, October 1, 2000; 80(4): 1337 - 1372. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. D. Le Cras, D.-H. Kim, N. E. Markham, and A. S. H. Abman Early abnormalities of pulmonary vascular development in the Fawn-Hooded rat raised at Denver's altitude Am J Physiol Lung Cell Mol Physiol, August 1, 2000; 279(2): L283 - L291. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Aikio, K. Vuopala, M.-L. Pokela, and M. Hallman Diminished Inducible Nitric Oxide Synthase Expression in Fulminant Early-Onset Neonatal Pneumonia Pediatrics, May 1, 2000; 105(5): 1013 - 1019. [Abstract] [Full Text] |
||||
![]() |
T. D. le Cras, N. E. Markham, K. G. Morris, C. R. Ahrens, I. F. McMurtry, and S. H. Abman Neonatal dexamethasone treatment increases the risk for pulmonary hypertension in adult rats Am J Physiol Lung Cell Mol Physiol, April 1, 2000; 278(4): L822 - L829. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ooi, E. Cadogan, M. Sweeney, K. Howell, R. G. O'Regan, and P. McLoughlin Chronic hypercapnia inhibits hypoxic pulmonary vascular remodeling Am J Physiol Heart Circ Physiol, February 1, 2000; 278(2): H331 - H338. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Sato, D. M. Rodman, and I. F. McMurtry Hypoxia inhibits increased ETB receptor-mediated NO synthesis in hypertensive rat lungs Am J Physiol Lung Cell Mol Physiol, April 1, 1999; 276(4): L571 - L581. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. L. Jernigan and T. C. Resta Chronic hypoxia attenuates cGMP-dependent pulmonary vasodilation Am J Physiol Lung Cell Mol Physiol, June 1, 2002; 282(6): L1366 - L1375. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |