AJP - Lung Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 276: L398-L404, 1999;
1040-0605/99 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ghaffari, M.
Right arrow Articles by Yan, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ghaffari, M.
Right arrow Articles by Yan, C.
Vol. 276, Issue 3, L398-L404, March 1999

Inhibition of hSP-B promoter in respiratory epithelial cells by a dominant negative retinoic acid receptor

Manely Ghaffari, Jeffrey A. Whitsett, and Cong Yan

Division of Pulmonary Biology, Children's Hospital Medical Center, Cincinnati, Ohio 45229-3039


    ABSTRACT
Top
Abstract
Introduction
METHODS AND MATERIALS
RESULTS
DISCUSSION
References

Retinoic acid (RA) receptors (RARs) belong to the nuclear hormone receptor superfamily and play important roles in lung differentiation, growth, and gene regulation. Surfactant protein (SP) B is a small hydrophobic protein synthesized and secreted by respiratory epithelial cells in the lung. Expression of the SP-B gene is modulated at the transcriptional and posttranscriptional levels. In the present work, immunohistochemical staining revealed that RAR-alpha is present on day 14.5 of gestation in the fetal mouse lung. To assess whether RAR is required for SP-B gene transcription, a dominant negative mutant human (h) RAR-alpha 403 was generated. The hRAR-alpha 403 mutant was transcribed and translated into the truncated protein product by reticulocyte lysate in vitro. The mutant retained DNA binding activity in the presence of retinoid X receptor-gamma to an RA response element in the hSP-B promoter. When transiently transfected into pulmonary adenocarcinoma epithelial cells (H441 cells), the mutant hRAR-alpha 403 was readily detected in the cell nucleus. Cotransfection of the mutant hRAR-alpha 403 repressed activity of the hSP-B promoter and inhibited RA-induced surfactant proprotein B production in H441 cells, supporting the concept that RAR is required for hSP-B gene transcription in vitro.

human surfactant protein B; lung development; nuclear receptors


    INTRODUCTION
Top
Abstract
Introduction
METHODS AND MATERIALS
RESULTS
DISCUSSION
References

SURFACTANT PROTEIN (SP) B is a 79-amino acid amphipathic peptide produced by the proteolytic cleavage of surfactant proprotein (proSP) B in type II epithelial cells in the alveoli of the lung. The SP-B peptide is stored in lamellar bodies and secreted with phospholipids into the airway lumen. The function of SP-B is to stabilize the surfactant membrane layer and facilitate the spreading of phospholipids, preventing collapse during the respiratory cycle. SP-B is an essential component of surfactant and is required for postnatal respiratory adaptation (43). Mutations in the SP-B gene in both humans and mice cause respiratory failure after birth (8, 29, 30).

It has been well established that retinoic acid (RA) receptors (RARs) play critical roles in proliferation, differentiation, and apoptosis in a variety of epithelial cells. Recently, RAR-alpha and -gamma and retinoid X receptor (RXR)-alpha were detected in the H441 cell line, which is derived from pulmonary adenocarcinoma epithelial cells. In H441 cells, RA and RARs stimulated SP-B promoter activity, mRNA accumulation, and protein production (12, 13, 45). Increases in SP-B mRNA and protein accumulation in fetal lung explants have also been observed (2, 28). RA stimulation of the human (h) SP-B gene is mediated through direct binding of the RAR/RXR heterodimer to the SP-B promoter (45). The region between -375 to -500 bp of the hSP-B promoter was identified as the responsible sequence for RAR binding and transactivation (45).

Lung development is dependent on expression of RARs (10, 26). RAR-alpha , -beta , and -gamma belong to the superfamily of nuclear receptors. They form heterodimers with the RXR, bind to the RA response element (RARE) on promoter regions of target genes, and exert stimulatory effects after binding to their ligand RAs (19, 21, 22). Expression of all three isotypes of RAR was previously detected in the developing lung by in situ hybridization or RT-PCR in the mouse and rat (10, 25). RAR-alpha and -beta null mutant mice died in utero and had severely hypoplastic lungs (26). Lung organogenesis is dependent on interactions between mesenchymal and epithelial cells. Several studies (3, 6, 28) in lung buds indicated that lung branching morphogenesis and differentiation were strongly influenced by RA in vitro. Recent studies (23, 24) demonstrated that RA also influences alveolarization. Treatment of rats with all trans-RA increased the number of alveoli and reversed an alveolar disorder caused by elastase-induced pulmonary emphysema in animals (23, 24).

RARs consist of a DNA binding domain that contains Zn2+ finger motifs, ligand binding and dimerization domains, a ligand-independent transcriptional activation (AF-1) domain, a ligand-dependent transcriptional activation (AF-2) domain, and an F region (19, 21, 22). Through these various domains, RARs interact with other transcriptional and signaling cofactors, including p160/SRC-I/TIF-II/Rac-III, CBP/p300, AP-1, TFIIH, and TAFII135 (7, 15, 16, 18, 27, 31, 35, 39, 42). Through structure-function studies, dominant negative mutants of RARs have been developed and characterized (9, 11). Removal of the COOH-terminal AF-2 domain of RARs yields dominant negative mutant receptors in cultured animal cells. The integrity of both the DNA binding and heterodimerization functions of RARs is required for the dominant negative effect. The dominant negative mutant of RAR-alpha blocks wild-type RAR function and has been successfully used in transgenic mice (17).

To further elucidate the biological functions and mechanism of RAR-alpha in the regulation of hSP-B gene expression, a dominant negative mutant, hRAR-alpha 403, was generated and expressed in H441 cells with a mammalian cell expression vector. This was based on an observation that RAR-alpha was detected on day 14.5 of gestation in the fetal mouse lung. The mutant RAR-alpha protein was expressed in H441 cells and localized to the nucleus. The mutant hRAR-alpha 403 protein retained DNA binding activity on the RARE of the hSP-B promoter. Cotransfection of the mutant hRAR-alpha 403 strongly inhibited transcription of the hSP-B promoter by luciferase reporter assay and proSP-B production in H441 cells.


    METHODS AND MATERIALS
Top
Abstract
Introduction
METHODS AND MATERIALS
RESULTS
DISCUSSION
References

Cell culture. Human pulmonary adenocarcinoma (H441) cells were cultured in RPMI 1640 medium (GIBCO BRL, Grand Island, NY) supplemented with 10% fetal calf serum, glutamine, and penicillin-streptomycin. Cells were maintained at 37°C in 5% CO2-air and passaged weekly.

Plasmid constructs. The hSP-B 500-bp promoter (hSP-B-500) was made as previously described (46). hRAR-alpha 403-FLAG was generated by PCR with synthetic oligonucleotide primers, with an hRAR-alpha /pSG5 construct as a template (kindly provided by Dr. Pierre Chambon, Institut de Génétique et de Biologie Moléculaire et Cellulaire, Strassbourg, France). The upstream primer with the EcoR I site and the Kozak sequence was 5'-GCGGAATTCGCCACCATGGCCAGCAACAGCAGCTCC-3'. The downstream primer with the Xba I site and the FLAG sequence (underlined) was 5'-CTCGCTCTAGATTATCACTTGTCATCGTCGTCCTTGTAGTCCGGGATCTCCATCTTCAGCGT-3'. The PCR products were digested with EcoR I and Xba I restriction enzymes and ligated with EcoR I-Xba I-digested PCR3.0 luciferase reporter plasmid that contains the cytomegalovirus (CMV) promoter (Invitrogen, Carlsbad, CA). The correctness of hRAR-alpha 403-FLAG/PCR3.0 was confirmed by DNA sequencing. hRAR-alpha 462-FLAG/PCR was generated the same way except that the downstream primer was 5'-CTCGCTCTAGATTATCA<UNL>CTTGTCATCGTCGTCCTTGTA</UNL>-<UNL>GTC</UNL>CGGGGAGTGGGTGGCCGGGCT-3'. All primers were made by GIBCO BRL.

In vitro transcription, translation, and Western blot analysis. hRAR-alpha 403-FLAG/PCR3.0 and hRAR-alpha 462-FLAG/PCR3.0 were transcribed and translated with the TNT T7 Quick Coupled Transcription/Translation System (Promega, Madison, WI) at 30°C for 90 min. As a positive control, thyroid transcription factor (TTF)-1-FLAG/PCR3.0 was also transcribed and translated. The negative control was the PCR3.0 empty vector. The programmed products were separated on a 10% polyacrylamide gel and subsequently transferred to a nitrocellulose membrane. Western blot analysis with an anti-FLAG monoclonal antibody was performed as described previously (14).

Electrophoretic mobility shift assay. A previously described RARE oligo probe of the hSP-B promoter was used for an electrophoretic mobility shift assay (EMSA) study (45). In vitro transcribed and translated hRAR-alpha 403 and hRXR-gamma proteins were incubated with the radiolabeled probe and separated by 4% nondenaturing gel as described previously (46). Antibody recognizing RAR (5 µg; Santa Cruz Biotechnology, Santa Cruz, CA) was used for identifying the hRAR-alpha 403/hRXR-gamma complex in an EMSA study.

Transient transfection and luciferase assays. Cotransfection of hRAR-alpha 403-FLAG with hSP-B-500 and a luciferase assay were performed in H441 cells as previously described (45, 47). The pCMV-beta -Gal plasmid was cotransfected for normalizing transfection efficiency. Each experiment was repeated at least three times. Significance of the inhibitory effects of hRAR-alpha 403-FLAG was determined by one-way ANOVA with the SigmaStat program.

Immunohistochemistry and immunofluorescent staining. Immunohistochemical staining of H441 cells transfected with hRAR-alpha 403-FLAG/PCR3.0, hRAR-alpha 462-FLAG/PCR3.0, and TTF-1-FLAG/PCR3.0 with the anti-FLAG antibody (Kodak, New Haven, CT) was performed as previously described (45). In the control cells, no specific antibody was added. Immunofluorescent staining of H441 cells transfected without and with hRAR-alpha 403-FLAG/PCR3.0 was performed as previously described (14). Expression of hRAR-alpha 403-FLAG/PCR3.0 was detected with the anti-FLAG antibody and Texas Red-conjugated goat anti-rabbit secondary IgG (Jackson ImmunoResearch Laboratories, West Grove, PA). Expression of proSP-B was detected with a proSP-B polyclonal antibody and FITC-conjugated goat anti-mouse IgG secondary IgG (Jackson ImmunoResearch Laboratories). All trans-RA was purchased from Sigma (St. Louis, MO).


    RESULTS
Top
Abstract
Introduction
METHODS AND MATERIALS
RESULTS
DISCUSSION
References

Expression of RAR-alpha in developing lung. We previously detected RAR-alpha expression in respiratory epithelial H441 cells. To assess which isoforms of RAR are expressed in the developing lung, tissue sections from a fetal mouse lung on day 14.5 of gestation were immunohistochemically stained with an antibody recognizing RAR-alpha . Figure 1 shows staining of RAR-alpha in the epithelium of the developing mouse fetal lung by the anti-RAR-alpha polyclonal antibody. Based on this result, the alpha  isotype of RAR was chosen to make a dominant negative mutant for further study of the hSP-B promoter.


View larger version (138K):
[in this window]
[in a new window]
 
Fig. 1.   Retinoic acid (RA) receptor (RAR)-alpha protein expression in day 14.5 developing lung. Tissue sections from a fetal mouse lung on day 14.5 of gestation were immunohistochemically stained with an antibody recognizing RAR-alpha (A). Arrows, stained cells in developing fetal lung epithelium. Control tissue section was stained without RAR-alpha antibody (B).

Construction of dominant negative hRAR-alpha 403-FLAG. To test whether expression of a dominant negative mutant of RAR-alpha inhibited the hSP-B promoter, the mutant hRAR-alpha 403-FLAG and the wild-type hRARa462-FLAG were inserted into the mammalian expression vector PCR3.0 as illustrated in Fig. 2. The mutant contains the AF-1, DNA binding domain, and ligand binding and dimerization domains of hRAR-alpha but lacks the AF-2 and F domains. A Kozak sequence (ACCATGTCG) was included at the NH2 terminus of hRAR-alpha 403 and hRAR-alpha 462 to enhance the efficiency of translation. A FLAG sequence was included at the COOH terminus of hRAR-alpha 403 and hRAR-alpha 462 and was used to distinguish the mutant receptor from endogenous RAR-alpha .


View larger version (10K):
[in this window]
[in a new window]
 
Fig. 2.   Construction of human (h) RAR-alpha 403-FLAG/PCR3.0 and hRAR-alpha 403-FLAG/PCR3.0. Full-length hRAR-alpha 462 and dominant negative hRAR-alpha 403 lacking ligand-dependent transcriptional activation domain (AF-2) were isolated by PCR and inserted into mammalian cell expression vector PCR3.0. A Kozak sequence was included at the NH2 terminus, and a FLAG sequence was included at the COOH terminus of hRAR-alpha 403 and hRAR-alpha 462. AF-1, ligand-independent transcriptional activation domain; DBD, DNA binding domain; LBD/dimerization, ligand binding and dimerization domains; F, F domain. Nos. above bars, no. of bp.

Expression of hRAR-alpha 403-FLAG and hRAR-alpha 462-FLAG in vitro. To test whether the hRAR-alpha 403-FLAG/PCR3.0 and the wild-type hRAR-alpha 462-FLAG/PCR3.0 vectors generated protein products of correct sizes, the constructs were transcribed and translated in vitro in the rabbit reticulocyte lysate system. The products of the programmed lysates were separated on a 10% polyacrylamide gel and analyzed by Western blot with the anti-FLAG antibody. Both the full-length hRAR-alpha 462-FLAG and the short-form hRAR-alpha 403-FLAG were produced in the reticulocyte lysate system (Fig. 3). Because TTF-1-FLAG/PCR3.0 was well characterized previously (14), it was also transcribed and translated in vitro as a positive control. In the negative control, the reticulocyte lysate revealed no FLAG fusion protein.


View larger version (43K):
[in this window]
[in a new window]
 
Fig. 3.   In vitro transcription and translation of hRAR-alpha 462-FLAG and hRAR-alpha 403-FLAG. Mammalian expression vectors hRAR-alpha 462-FLAG/PCR3.0 and hRAR-alpha 403-FLAG/PCR3.0 were transcribed and translated in vitro by rabbit reticulocyte lysate system. Synthesized products were electrophoresed and analyzed by Western blot with anti-FLAG antibody. Thyroid transcription factor (TTF)-1-FLAG/PCR3.0 was used as a positive control. Size of each synthesized protein was matched well to anticipated molecular mass (nos. at left × 10). Empty PCR3.0 was used as a negative control.

Expression of hRAR-alpha 403-FLAG in H441 cells. Expression of the hRAR-alpha 403-FLAG and hRAR-alpha 462-FLAG vectors in H441 cells was assessed. The constructs hRAR-alpha 403-FLAG/PCR3.0, hRAR-alpha 462-FLAG/PCR3.0, and TTF-1-FLAG/PCR3.0 (positive control) were transiently transfected into H441 cells. Immunohistochemical analysis with an anti-FLAG antibody revealed strong nuclear staining of the FLAG epitope for all three constructs (Fig. 4). Deletion of the AF-2 and F domains did not change hRAR-alpha 403 expression and nuclear localization in H441 cells. Untransfected H441 cells did not stain with the anti-FLAG antibody.


View larger version (154K):
[in this window]
[in a new window]
 
Fig. 4.   Immunohistochemical staining of hRAR-alpha 462 and hRAR-alpha 403 in H441 cells. H441 cells were transfected with empty plasmid PCR3.0 (A), TTF-1-FLAG/PCR3.0 (B), hRAR-alpha 462-FLAG/PCR3.0 (C), and hRAR-alpha 403-FLAG/PCR3.0 (D) for 48 h. Transfected cells were immunostained with anti-FLAG monoclonal antibody. Cells transfected with hRAR-alpha and TTF-1 FLAG fusion protein constructs were immunostained in the nucleus.

DNA binding activity of hRAR-alpha 403-FLAG on RARE of the hSP-B promoter. Next, in vitro transcribed and translated hRAR-alpha 462-FLAG and hRAR-alpha 403-FLAG fusion proteins were assessed for their DNA binding activities. As shown in Fig. 5, hRAR-alpha 462-FLAG, hRAR-alpha 403-FLAG, or hRXR-gamma -FLAG fusion protein alone did not form DNA-protein complexes with RARE of the hSP-B promoter. This is due to their low DNA binding affinity. Yan et al. (45) previously reported that when higher concentrations of purified bacteria-expressed hRAR-gamma -glutathione S-transferase (GST) fusion protein were used, interaction between hRAR-gamma -GST and RARE was observed. In contrast, formation of hRAR-alpha 462-FLAG/hRXR-gamma -FLAG and hRAR-alpha 403-FLAG/hRXR-gamma -FLAG heterodimers with high DNA binding affinity generated detectable DNA-protein complexes with RARE (Fig. 5). Binding of hRAR-alpha 462-FLAG/hRXR-gamma -FLAG and hRAR-alpha 403-FLAG/hRXR-gamma -FLAG complexes with RARE was blocked by the anti-RAR antibody. This is probably due to interference of the RAR antibody with either DNA binding or dimerization of the hRAR-alpha 403-FLAG/hRXR-gamma or hRAR-alpha 462-FLAG/hRXR-gamma heterodimer. Thus, like the wild-type hRAR-alpha in the presence of hRXR, the mutant hRAR-alpha 403 retained DNA binding activity on RARE of the hSP-B promoter. Nonspecific bands observed in EMSA, which did not contain the hRAR-alpha 462-FLAG and hRAR-alpha 403-FLAG fusion proteins, were also detected in the control samples (PCR3.0 empty vector). Nonspecific bands were not changed by the RAR antibody.


View larger version (34K):
[in this window]
[in a new window]
 
Fig. 5.   Electrophoretic mobility shift assay (EMSA) study of hRAR-alpha 403-FLAG with RA response element (RARE) of human surfactant protein (hSP)-B promoter. In vitro transcribed and translated hRAR-alpha 462-FLAG (A), hRAR-alpha 403-FLAG (B), and human retinoid X receptor (RXR)-gamma -FLAG fusion proteins were incubated with radiolabeled hSP-B RARE in absence (-) and presence (+) of RAR antibody (Ab). Controls include in vitro transcribed and translated proteins from parent PRC3.0 empty vector. There were several nonspecific bands present in all lanes including control (PCR3.0). Specific bands were detected in hRAR-alpha 462-FLAG/hRXR-gamma -FLAG and hRAR-alpha 403-FLAG/hRXRgamma -FLAG lanes, which were blocked by RAR Ab.

Inhibitory effect of hRAR-alpha 403-FLAG on the hSP-B promoter in H441 cells. Cotransfection of hRAR-alpha 403-FLAG/PCR3.0 with the hSP-B-500 luciferase reporter gene into H441 cells demonstrated that the mutant hRAR-alpha strongly inhibited luciferase reporter activity (Fig. 6). In contrast, the wild-type hRAR-alpha stimulated the hSP-B luciferase reporter gene (45). The inhibitory effects of the mutant hRAR-alpha 403 on all trans-RA-treated and untreated hSP-B-500 were dose dependent. Interestingly, the mutant hRAR-alpha did not completely abolish the hSP-B-500 activity. The residual activity of the hSP-B-500 seen in the presence of the mutant hRAR-alpha was similar to that of the basal activity of the hSP-B 218-bp promoter luciferase reporter gene, suggesting that RAR is not required for basal transcription activity of the hSP-B promoter. Therefore, RAR stimulates the hSP-B promoter through RARE located in the upstream enhancer region as previously identified (46). All trans-RA significantly reversed some of the inhibitory effect of hRAR-alpha 403. This was probably due to the activation of endogenous RAR. Treatment with 9-cis-RA had the same reversal effect as all trans-RA (data not shown).


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 6.   hRAR-alpha 403-FLAG inhibitory effect on hSP-B 500-bp promoter fragment (hSP-B-500). H441 cells were cotransfected with various concentrations of hRAR-alpha 403-FLAG/PCR3.0 and 0.2 µg of hSP-B-500 luciferase reporter vector. Luciferase activity was measured 48 h after treatment. hSP-B-500 activity without hRAR-alpha 403-FLAG/PCR3.0 cotransfection was defined as 1. Activities were measured in light units/optical density of beta -galactosidase. Values are means ± SD; n = 3 experiments. ANOVA analysis showed significant inhibitory effect (P < 0.05). Significant difference from untreated samples: * r < 0.01; ** r < 0.025 (both by ANOVA).

Inhibitory effect of hRAR-alpha 403-FLAG on RA-induced proSP-B production in H441 cells. The effect of hRAR-alpha 403-FLAG on proSP-B was also examined in H441 cells with double immunofluorescence staining analysis. All trans-RA strongly stimulated proSP-B synthesis in H441 cells as detected by a proSP-B polyclonal antibody (Fig. 7A), in agreement with previous observations that 9-cis-RA stimulated proSP-B staining in H441 cells (45). This is also in agreement with the observation that both all trans-RA and 9-cis-RA significantly increased SP-B protein levels in human fetal lung explants (13). When cells were transfected with hRAR-alpha 403-FLAG as detected by a FLAG monoclonal antibody, no stimulation of proSP-B by all trans-RA was observed in transfected cells (Fig. 7, B and C).


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 7.   hRAR-alpha 403-FLAG inhibitory effects of all trans-RA on surfactant proprotein (proSP) B. A: H441 cells were treated with 10-5 M all trans-RA. Cells were stained with proSP-B polyclonal antibody and Texas Red-conjugated goat anti-rabbit secondary IgG. N, nuclei. B: H441 cells were transfected with hRAR-alpha 403-FLAG and treated with 10-5 M all trans-RA. Expression of hRAR-alpha 403-FLAG in the nuclei was detected with FLAG monoclonal antibody and FITC-conjugated goat anti-mouse IgG secondary IgG. C: cells in B were stained with proSP-B polyclonal antibody and Texas Red-conjugated goat anti-rabbit secondary IgG. No RA-induced proSP-B production was detected in cells expressing hRAR-alpha 403-FLAG protein.


    DISCUSSION
Top
Abstract
Introduction
METHODS AND MATERIALS
RESULTS
DISCUSSION
References

SP-B mRNA is expressed selectively in bronchiolar and alveolar cells, and its expression is influenced at both the transcriptional and posttranscriptional levels (1, 2, 4, 20, 32-34, 40, 41, 44, 46, 48). RA stimulates production of SP-B mRNA and increases transcriptional activity (3, 12, 13, 28, 45). Stimulatory effects of RA are mediated by direct DNA binding of liganded RAR/RXR to an RARE on the hSP-B promoter (45). One approach to elucidate the biochemical and physiological functions of RAR in the regulation of SP-B gene transcription and homeostasis is to utilize dominant negative RAR derivatives. To further support the notion that RAR is required for full activation of the SP-B promoter, a dominant negative hRAR-alpha 403-FLAG mutant was generated by deleting the RAR-alpha AF-2 domain (Fig. 2). The RAR-alpha dominant negative mutant was selected in the present study because immunohistochemical staining indicated expression of RAR-alpha in the fetal lung in vivo (Fig. 1) and in respiratory epithelial H441 cells in vitro (45). It is worthwhile to notice that only a certain population of progenitor epithelial cells was stained with the RAR-alpha antibody. This may imply that this group of progenitor cells will have a different fate during lung differentiation from cells without RAR-alpha expression.

The AF-2 domain of RAR is a ligand-dependent transactivation domain located in the COOH-terminal part of RAR. The AF-2 domain is highly conserved in many members of the nuclear receptor family and is indispensable for the ligand-mediated function. This conserved domain can be swapped between nuclear receptors without affecting the ligand dependency for transactivation (19, 21, 22). The COOH terminus of the domain (AF-2-AD) forms an amphipathic alpha -helical structure (5). It is proposed that hydrophobic residues of the AF-2-AD helix participate in ligand binding and that the charged residues of the AF-2-AD helix mediate protein-protein interactions with cofactors (see Ref. 16 for a review). Point mutagenesis of the hydrophobic or charged residues of this domain reduced its transactivation activity (11). After binding to RARE on the target genes, RARs interact with many coactivators (7, 15, 16, 18, 27, 31, 35, 39, 42). RARs and coactivators synergistically interact with each other to stimulate gene transcription. The AF-2 domain of RAR plays essential roles in mediating protein-protein interaction with coactivators. The present studies demonstrate that deletion of the AF-2 domain abrogated the hRAR-alpha stimulatory effect on the hSP-B promoter, suggesting that the AF-2 domain plays a critical role in activation of the hSP-B promoter in respiratory epithelial cells.

RAR-alpha , -beta , and -gamma can be converted into potent dominant negative transcriptional regulators that block the wild-type RAR function by deletion of the AF-2 domain and actively repress the basal transcription level of target promoters (9). Although deletion of AF-2 domain abrogated RAR transactivation activity of the hSP-B promoter (Fig. 6), it did not alter DNA binding of RAR to RARE of the hSP-B promoter (Fig. 5). hRAR-alpha 403 forms an inactive hRAR-alpha 403/hRXR heterodimer that blocks formation of an active hRAR-alpha /hRXR heterodimer to directly inhibit hSP-B gene expression. The inhibitory effect of hRAR-alpha 403 on the hSP-B promoter might also result from indirect effects. This is evidenced by the observation that all trans-RA significantly reversed the inhibitory effect of hRAR-alpha 403 on the hSP-B promoter. The mutant RAR-alpha protein was readily detected after transient transfection into H441 cells by immunohistochemical staining (Fig. 4), suggesting its stability and appropriate translocation to the nucleus.

The finding that the SP-B gene is a downstream target of RAR in pulmonary respiratory epithelial cells is important for understanding the metabolism and homeostasis of SP-B in prenatal and postnatal development of the lung. The function of the newborn lung is dependent on the differentiation of respiratory epithelial cells and the synthesis and secretion of surfactant lipids and proteins into the air space. Pulmonary surfactant is composed of lipids and proteins that reduce surface tension at the air-liquid interface in the alveoli. SPs, including SP-A, SP-B, SP-C, and SP-D, are synthesized primarily by type II or bronchiolar epithelial cells and play critical roles in maintaining stability of the surfactant layer. Lack of pulmonary surfactant leads to alveolar collapse and epithelial cell lysis in respiratory distress syndrome, a major cause of morbidity and mortality in preterm infants. Bronchopulmonary dysplasia (BPD) is a chronic lung disease that often occurs in preterm infants as a result of prolonged and high inspired oxygen concentrations, barotrauma from mechanical ventilation, hyaline membrane disease, and secondary infection with prolonged tracheal intubation. Studies (36-38) have shown that vitamin A supplementation from the early postnatal period could reduce the morbidity associated with BPD in preterm infants. Studies (45; present study) showed that the vitamin A derivatives RA and RAR stimulate SP-B gene and protein expression in pulmonary epithelial respiratory cells, supporting the recent findings (23, 24) that RA plays a critical role in postnatal alveolarization in vivo.


    ACKNOWLEDGEMENTS

We thank Angela Naltner for critical reading of the manuscript. We thank Xin Zeng for providing fetal lung tissue sections and Dr. Jacquelyn A. Huffman Reed for helping with statistical analysis. We thank Dr. Pierre Chambon for providing the human retinoic acid receptor-alpha and human retinoid X receptor-gamma plasmids.


    FOOTNOTES

This work was supported by the American Lung Association (C. Yan) and National Heart, Lung, and Blood Institute Specialized Center of Research Grant HL-56387 (to J. A. Whitsett and C. Yan).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Address for reprint requests: C. Yan, Children's Hospital Medical Center, Division of Pulmonary Biology, TCHRF, 3333 Burnet Ave., Cincinnati, OH 45229-3039.

Received 18 May 1998; accepted in final form 11 November 1998.


    REFERENCES
Top
Abstract
Introduction
METHODS AND MATERIALS
RESULTS
DISCUSSION
References

1.   Ballard, P. L., R. Ertsey, L. W. Gonzales, and J. Gonzales. Transcriptional regulation of human pulmonary surfactant proteins SP-B and SP-C by glucocorticoids. Am. J. Respir. Cell Mol. Biol. 14: 599-607, 1996[Abstract].

2.   Beers, M. F., H. Shuman, H. G. Liley, J. Floros, L. W. Gonzales, N. Yue, and P. L. Ballard. Surfactant protein B in human fetal lung: developmental and glucocorticoid regulation. Pediatr. Res. 38: 668-675, 1995[Medline].

3.   Bogue, C. W., H. C. Jacobs, D. W. Dynia, C. M. Wilson, and I. Gross. Retinoic acid increases surfactant protein mRNA in fetal rat lung in culture. Am. J. Physiol. 271 (Lung Cell. Mol. Physiol. 15): L862-L868, 1996[Abstract/Free Full Text].

4.   Bohinski, R., R. Di Lauro, and J. A. Whitsett. The lung-specific surfactant protein B gene promoter is a target for thyroid transcription factor 1 and hepatocyte nuclear factor 3, indicating common factors for organ-specific gene expression along the foregut axis. Mol. Cell. Biol. 14: 5671-5681, 1994[Abstract/Free Full Text].

5.   Bourguet, W., M. Ruff, P. Chambon, H. Cronemeyer, and D. Moras. Crystal structure of the ligand-binding domain of the human nuclear receptor RXR-alpha. Nature 375: 377-382, 1995[Medline].

6.   Cardoso, W. V., M. C. Williams, S. A. Mitsialis, M. Joyce-Brady, A. K. Rishi, and J. J. Brady. Retinoic acid induces changes in the pattern of airway branching and alters epithelial cell differentiation in the developing lung in vivo. Am. J. Respir. Cell Mol. Biol. 12: 464-467, 1995[Abstract].

7.   Chen, H. W., R. J. Lin, R. L. Schiltz, D. Chakravarti, A. Nash, L. Nagy, M. L. Privalsky, Y. Nakatani, and R. M. Evans. Nuclear receptor coactivator ACTR is a novel histone acetyltransferase and forms a multimeric activation complex with P/CAF and CBP/p300. Cell 90: 569-580, 1997[Medline].

8.   Clark, J. C., S. E. Wert, C. J. Bachurski, M. T. Stahlman, B. R. Stripp, T. E. Weaver, and J. A. Whitsett. Targeted disruption of the surfactant protein B gene disrupts surfactant homeostasis, causing respiratory failure in newborn mice. Proc. Natl. Acad. Sci. USA 92: 7794-7798, 1995[Abstract/Free Full Text].

9.   Damm, K., R. A. Heyman, K. Umesono, and R. M. Evans. Functional inhibition of retinoic acid response by dominant negative retinoic acid receptor mutants. Proc. Natl. Acad. Sci. USA 90: 2989-2993, 1993[Abstract/Free Full Text].

10.   Dolle, P., E. Ruberte, P. Leroy, G. Morriss-Kay, and P. Chambon. Retinoic acid receptors and cellular retinoid binding proteins I. A systematic study of their differential pattern of transcription during mouse organogenesis. Development 110: 1133-1151, 1990[Abstract/Free Full Text].

11.   Durand, B., M. Saunders, C. Gaudon, B. Roy, R. Losson, and P. Chambon. Activation function 2 (AF-2) of retinoic acid receptor and 9-cis retinoic acid receptor: presence of a conserved autonomous constitutive activating domain and influence of the nature of the response element on AF-2 activity. EMBO J. 13: 5370-5382, 1994[Medline].

12.   George, T. N., O. L. Miakotina, K. L. Goss, and J. M. Snyder. Mechanism of all trans-retinoic acid and glucocorticoid regulation of surfactant protein mRNA. Am. J. Physiol. 274 (Lung Cell. Mol. Physiol. 18): L560-L566, 1998[Abstract/Free Full Text].

13.   George, T. N., and J. M. Snyder. Regulation of surfactant protein gene expression by retinoic acid metabolites. Pediatr. Res. 41: 693-701, 1997.

14.   Ghaffari, M., X. Zeng, J. A. Whitsett, and C. Yan. Nuclear localization domain of thyroid transcription factor-1 in respiratory epithelial cells. Biochem. J. 328: 757-761, 1997.

15.   Hong, H., K. Kohli, A. Trivedi, D. L. Johnson, and M. R. Stallcup. GRIP1, a novel mouse protein that serves as a transcriptional coactivator in yeast for the hormone binding domains of steroid receptors. Proc. Natl. Acad. Sci. USA 93: 4948-4952, 1996[Abstract/Free Full Text].

16.   Hui, L., P. J. Gomes, and J. D. Chen. RAC3, a steroid/nuclear receptor-associated coactivator that is related to SRC-1 and TIF2. Proc. Natl. Acad. Sci. USA 94: 8479-8484, 1997[Abstract/Free Full Text].

17.   Imakado, S., J. R. Bickenbach, D. S. Bundman, J. A. Rothnagel, P. S. Attar, X. J. Wang, V. R. Walczak, S. Wisniewski, J. Pote, J. S. Gordon, R. A. Heyman, R. M. Evans, and D. R. Roop. Targeting expression of a dominant-negative retinoic acid receptor mutant in the epidermis of transgenic mice results in loss of barrier function. Genes Dev. 9: 317-329, 1995[Abstract/Free Full Text].

18.   Kamei, Y., L. Xu, T. Heinzel, J. Torchia, R. Kurokawa, B. Gloss, S. C. Lin, R. A. Heyman, D. W. Rose, C. K. Glass, and M. G. Rosenfeld. A CBP integrator complex mediates transcriptional activation and AP-1 inhibition by nuclear receptors. Cell 85: 403-414, 1996[Medline].

19.   Kastner, P., M. Mark, and P. Chambon. Nonsteroid nuclear receptors: what are genetic studies telling us about their role in real life? Cell 83: 859-869, 1995[Medline].

20.   Kumar, A. S., V. C. Venkatesh, B. C. Planer, S. I. Feinstein, and P. L. Ballard. Phorbol ester down-regulation of lung surfactant protein B gene expression by cytoplasmic trapping of thyroid transcription factor-1 and hepatocyte nuclear factor 3. J. Biol. Chem. 272: 20764-20773, 1997[Abstract/Free Full Text].

21.   Mangelsdorf, D. J., and R. M. Evans. The RXR heterodimers and orphan receptors. Cell 83: 841-850, 1995[Medline].

22.   Mangelsdorf, D. J., C. Thummel, M. Beato, P. Herrlich, G. Schutz, K. Umesono, B. Blumberg, P. Kastner, M. Mark, P. Chambon, and R. M. Evans. The nuclear receptor superfamily: the second decade. Cell 83: 835-839, 1995[Medline].

23.   Massaro, G. D., and D. Massaro. Postnatal treatment with retinoic acid increases the number of pulmonary alveoli in rats. Am. J. Physiol. 270 (Lung Cell. Mol. Physiol. 14): L305-L310, 1996[Abstract/Free Full Text].

24.   Massaro, G. D., and D. Massaro. Retinoic acid treatment abrogates elastase-induced pulmonary emphysema in rats. Nat. Med. 3: 675-677, 1997[Medline].

25.   Masuyama, H., Y. Hiramatsu, and T. Kudo. Effect of retinoids on fetal lung development in the rat. Biol. Neonate 67: 264-273, 1995[Medline].

26.   Mendelsohn, C., D. Lohnes, D. Decimo, T. Lufkin, M. LeMeur, and P. Chambon. Function of the retinoic acid receptors (RARs) during development (II). Multiple abnormalities at various stages of organogenesis in RAR double mutants. Development 120: 2749-2771, 1994[Abstract].

27.   Mengus, G., M. May, L. Carre, P. Chambon, and I. Davidson. Human TAFII135 potentiates transcriptional activation by the AF-2s of the retinoic acid, vitamin D3, and thyroid hormone receptors in mammalian cells. Genes Dev. 11: 1381-1395, 1997[Abstract/Free Full Text].

28.   Metzler, M., and J. M. Snyder. Retinoic acid differentially regulates expression of surfactant-associated proteins in human fetal lung. Endocrinology 133: 1990-1998, 1993[Abstract/Free Full Text].

29.   Nogee, L. M., D. E. DeMello, L. P. Dehner, and H. R. Colten. Brief report: deficiency of pulmonary surfactant protein B in congenital alveolar proteinosis. N. Engl. J. Med. 328: 406-410, 1993[Free Full Text].

30.   Nogee, L. M., G. Garnier, H. C. Dietz, L. Singer, A. M. Murphy, D. E. DeMello, and H. R. Colter. A mutation in the surfactant protein B gene responsible for fatal neonatal respiratory disease in multiple kindreds. J. Clin. Invest. 93: 1860-1863, 1994.

31.   Onate, S. A., S. Y. Tsai, M. J. Tsai, and B. W. O'Malley. Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270: 1354-1357, 1995[Abstract/Free Full Text].

32.   O'Reilly, M. A., J. C. Clark, and J. A. Whitsett. Glucocorticoids enhance pulmonary surfactant protein B gene transcription. Am. J. Physiol. 260 (Lung Cell. Mol. Physiol. 4): L37-L43, 1991[Abstract/Free Full Text].

33.   Pryhuber, G. S., S. L. Church, T. Kroft, A. Panchal, and J. A. Whitsett. 3'-Untranslated region of SP-B mRNA mediates inhibitory effects of TPA and TNF-alpha on SP-B expression. Am. J. Physiol. 267 (Lung Cell. Mol. Physiol. 11): L16-L24, 1994[Abstract/Free Full Text].

34.   Pryhuber, G. S., M. A. O'Reilly, J. C. Clark, W. M. Hull, I. Fink, and J. A. Whitsett. Phorbol ester inhibits surfactant protein SP-A and SP-B expression. J. Biol. Chem. 265: 20822-20828, 1990[Abstract/Free Full Text].

35.   Salbert, G., A. Fanjul, F. J. Piedrafita, X. P. Lu, S. J. Kim, P. Tran, and M. Pfahl. Retinoic acid receptors and retinoid X receptor alpha  regulate the transforming growth factor-beta 1 promoter by antagonizing AP-1 activity. Mol. Endocrinol. 10: 1347-1356, 1993.

36.   Shenai, J. P., F. Chytil, A. Jhaveri, and M. T. Stahlman. Plasma vitamin A and retinol-binding protein in premature and term neonates. J. Pediatr. 99: 302-305, 1981[Medline].

37.   Shenai, J. P., F. Chytil, and M. T. Stahlman. Vitamin A status of neonates with bronchopulmonary dysplasia. Pediatr. Rev. 19: 185-188, 1985.

38.   Shenai, J. P., K. A. Kennedy, F. Chytil, and M. T. Stahlman. Clinical trial of vitamin A supplementation in infants susceptible to bronchopulmonary dysplasia. J. Pediatr. 111: 269-277, 1987[Medline].

39.   Torchia, J., D. W. Rose, J. Inostroza, Y. Kamei, S. Westin, C. K. Glass, and M. G. Rosenfeld. The transcriptional co-activator p/CIP binds CBP and mediates nuclear-receptor function. Nature 387: 677-684, 1997[Medline].

40.   Venkatesh, V. C., D. M. Iannuzzi, R. Ertsey, and P. L. Ballard. Differential glucocorticoid regulation of the pulmonary hydrophobic surfactant proteins SP-B and SP-C. Am. J. Respir. Cell Mol. Biol. 8: 222-228, 1993.

41.   Venkatesh, V. C., B. C. Planer, M. Schwartz, J. N. Vanderbilt, R. T. White, and P. L. Ballard. Characterization of the promoter of human pulmonary surfactant protein B gene. Am. J. Physiol. 268 (Lung Cell. Mol. Physiol. 12): L674-L682, 1995[Abstract/Free Full Text].

42.   Voegel, J. J., M. J. S. Heine, C. Zechel, P. Chambon, and H. Gronemeyer. TIF2, a 160 kDa transcriptional mediator for the ligand-dependent activation function AF-2 of nuclear receptors. EMBO J. 15: 3667-3675, 1996[Medline].

43.   Whitsett, J. A., L. M. Nogee, T. E. Weaver, and A. D. Horowitz. Human surfactant protein B: structure, function, regulation and genetic disease. Physiol. Rev. 75: 749-757, 1995[Abstract/Free Full Text].

44.   Wispe, J. R., J. C. Clark, B. B. Warner, D. Fajardo, W. E. Hull, R. B. Holtzman, and J. A. Whitsett. Tumor necrosis factor-alpha inhibits expression of pulmonary surfactant protein. J. Clin. Invest. 86: 1954-1960, 1990.

45.   Yan, C., M. Ghaffari, J. A. Whitsett, X. Zeng, Z. Sever, and S. Lin. Retinoic acid receptor activation of SP-B gene transcription in respiratory epithelial cells. Am. J. Physiol. 275 (Lung Cell. Mol. Physiol. 19): L239-L246, 1998[Abstract/Free Full Text].

46.   Yan, C., Z. Sever, and J. A. Whitsett. Upstream enhancer activity in the human surfactant protein B gene is mediated by thyroid transcription factor 1. J. Biol. Chem. 270: 24852-24857, 1995[Abstract/Free Full Text].

47.   Yan, C., and I. Tamm. Molecular cloning and characterization of additional factors that bind to the interferon-alpha /beta response element B of the murine (2'-5')oligoadenylate synthetase ME-12 gene. Proc. Natl. Acad. Sci. USA 89: 8859-8863, 1992[Abstract/Free Full Text].

48.   Yan, C., and J. A. Whitsett. Protein kinase A activation of the surfactant protein B gene is mediated by phosphorylation of thyroid transcription factor 1. J. Biol. Chem. 272: 17327-17332, 1997[Abstract/Free Full Text].


Am J Physiol Lung Cell Mol Physiol 276(3):L398-L404
0002-9513/99 $5.00 Copyright © 1999 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
Z. Yin, L. Gonzales, V. Kolla, N. Rath, Y. Zhang, M. M. Lu, S. Kimura, P. L. Ballard, M. F. Beers, J. A. Epstein, et al.
Hop functions downstream of Nkx2.1 and GATA6 to mediate HDAC-dependent negative regulation of pulmonary gene expression
Am J Physiol Lung Cell Mol Physiol, August 1, 2006; 291(2): L191 - L199.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
A. Naltner, S. Wert, J. A. Whitsett, and C. Yan
Temporal/spatial expression of nuclear receptor coactivators in the mouse lung
Am J Physiol Lung Cell Mol Physiol, December 1, 2000; 279(6): L1066 - L1074.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Naltner, M. Ghaffari, J. A. Whitsett, and C. Yan
Retinoic Acid Stimulation of the Human Surfactant Protein B Promoter Is Thyroid Transcription Factor 1 Site-dependent
J. Biol. Chem., January 7, 2000; 275(1): 56 - 62.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Yan, A. Naltner, J. Conkright, and M. Ghaffari
Protein-Protein Interaction of Retinoic Acid Receptor alpha and Thyroid Transcription Factor-1 in Respiratory Epithelial Cells
J. Biol. Chem., June 8, 2001; 276(24): 21686 - 21691.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ghaffari, M.
Right arrow Articles by Yan, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ghaffari, M.
Right arrow Articles by Yan, C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online