AJP - Lung Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 276: L426-L434, 1999;
1040-0605/99 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ye, J.
Right arrow Articles by Castranova, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ye, J.
Right arrow Articles by Castranova, V.
Vol. 276, Issue 3, L426-L434, March 1999

Critical role of glass fiber length in TNF-alpha production and transcription factor activation in macrophages

Jianping Ye1, Xianglin Shi1, William Jones2, Yon Rojanasakul3, Ningli Cheng3, Diane Schwegler-Berry1, Paul Baron4, Gregory J. Deye4, Changhong Li4, and Vincent Castranova1

1 Health Effects Laboratory Division and 2 Division of Respiratory Disease Studies, National Institute for Occupational Safety and Health, Morgantown 26505; 3 Department of Basic Pharmaceutical Sciences, West Virginia University, Morgantown, West Virginia 26506; and 4 Division of Physical Sciences and Engineering, National Institute for Occupational Safety and Health, Cincinnati, Ohio 45226


    ABSTRACT
Top
Abstract
Introduction
MATERIALS AND METHODS
RESULTS
DISCUSSION
References

Recent studies have demonstrated that dielectrophoresis is an efficient method for the separation of fibers according to fiber length. This method allows the investigation of fiber-cell interactions with fiber samples of the same composition but of different lengths. In the present study, we analyzed the effects of length on the interaction between glass fibers and macrophages by focusing on production of the inflammatory cytokine tumor necrosis factor (TNF)-alpha in a mouse macrophage cell line (RAW 264.7). The underlying molecular mechanisms controlling TNF-alpha production were investigated at the gene transcription level. The results show that glass fibers induced TNF-alpha production in macrophages and that this induction was associated with activation of the gene promoter. Activation of the transcription factor nuclear factor (NF)-kappa B was responsible for this induced promoter activity. The inhibition of both TNF-alpha production and NF-kappa B activation by N-acetyl-L-cysteine, an antioxidant, indicates that generation of oxidants may contribute to the induction of this cytokine and activation of this transcription factor by glass fibers. Long fibers (17 µm) were significantly more potent than short fibers (7 µm) in inducing NF-kappa B activation, the gene promoter activity, and the production of TNF-alpha . This fiber length-dependent difference in the stimulatory potency correlated with the fact that macrophages were able to completely engulf short glass fibers, whereas phagocytosis of long glass fibers was incomplete. These results suggest that fiber length plays a critical role in the potential pathogenicity of glass fibers.

nuclear factor-kappa B; free radicals; tumor necrosis factor-alpha


    INTRODUCTION
Top
Abstract
Introduction
MATERIALS AND METHODS
RESULTS
DISCUSSION
References

FIBROUS MATERIALS have various applications in both residential and industrial settings. These materials offer, in varying degrees, reinforcement, thermal and electrical insulation, flexibility, and strength. Asbestos is one group of such materials that exhibits these properties. Animal experiments and epidemiologic studies have concluded that asbestos exposure is associated with various lung diseases including fibrosis and cancer (23). As a result of these findings, the use of asbestos has been limited or prohibited in several countries. Consequently, the development and use of new fibers are on the increase. These include different types of man-made materials such as fibrous glass, rock wool, and ceramic fibers. Although these fibers are believed to be less toxic than asbestos, only limited studies (1, 9, 13, 14, 16, 21, 32, 34) of their toxic effects exist. The mechanisms of toxic and biological actions are not fully known. Two studies (14, 32) indicated that their chemical composition can affect the ability of fibers to generate toxic oxidants, which can damage the lung cells. For example, transition metals on the fiber surface can catalyze the generation of reactive oxygen species (32). Recent studies (10, 17, 22) also indicated that fiber length seems to be an important factor. For example, when implanted in the pleural spaces of rats, long asbestos fibers exhibited a higher carcinogenic activity than short fibers (30). The amount of fibers deposited in the lung is dependent on the concentration, size, shape, and other physical properties of the fibers (14, 33). It has been postulated that alveolar deposition decreases with increasing fiber diameter and length (14). Once in the lung, the biological activity of the inhaled fibers is dependent on the length, the physical and chemical properties of the surface (14), and the solubility of the fibers. Although the above studies point to an important role for fiber length in toxicity, pertinent studies have not been undertaken to support this hypothesis. This is likely due to the difficulty of generating fibers with well-defined lengths in quantities sufficient to carry out laboratory studies. Recently, a classifier has been developed to separate fibers by length with dielectrophoresis that involves the movement of neutral particles in a gradient electric field (5). The development of this classifier makes it possible to study the role of fiber length in toxicity. Exploring the ability of this technique, Blake et al. (7) recently studied the toxicity of JM-100 glass fibers and found that long fibers were more toxic than short fibers when dose was expressed on a fiber-count basis.

The present study focuses on the length dependence of induction of tumor necrosis factor (TNF)-alpha production and nuclear transcription factor (NF)-kappa B activation in a macrophage cell line (RAW 264.7). TNF-alpha was chosen because this inflammatory and fibrogenic cytokine is a macrophage-derived peptide that has been shown to play an important role in the pathogenesis of pulmonary fibrosis (15, 25, 40). Several fibrogenic agents, such as crystalline silica and asbestos, stimulate TNF-alpha mRNA expression and protein synthesis in macrophages (25, 40). Elevated TNF-alpha levels lead to fibrosis by stimulating proliferation of fibroblasts and production of collagen matrix (8, 25, 40). Cytokine gene expression can be regulated at both the transcriptional and posttranscriptional levels. Transcription of TNF-alpha is controlled by sequence-specific transcription factors, including NF-kappa B, that interact with the gene promoter or enhancer regions. NF-kappa B, a widely distributed multisubunit transcription factor, is involved in the regulation of genes encoding for many cytokines (12). In the present study, we attempted to answer the following questions. 1) Do glass fibers induce TNF-alpha production in vitro? 2) Do glass fibers cause NF-kappa B activation in vitro? 3) Does fiber length play a critical role in TNF-alpha production or NF-kappa B activation? 4) Does NF-kappa B regulate TNF-alpha production induced by glass fibers? 5) Are reactive oxygen species involved in TNF-alpha production or NF-kappa B activation? 6) Do long fibers interact differently with macrophages than short fibers?


    MATERIALS AND METHODS
Top
Abstract
Introduction
MATERIALS AND METHODS
RESULTS
DISCUSSION
References

Fibers. Bulk samples of Manville code 100 (JM-100) glass fibers supplied by the manufacturer were first milled, aerosolized, and separated into two length categories by dielectrophoresis (5). The dielectrophoretic classifier was operated in a differential mode so that fibers with narrow length distributions were extracted in an air suspension at the end of the classifier. These size-selected fiber samples were collected on polycarbonate (Nuclepore) filters at rates of up to 1 mg/day. Fibers were scraped off the filters for microscopic analysis and biological experiments.

We prepared samples of the length-classified fibers for size and count analysis by adding weighed portions of the dusts to freshly filtered water. These samples were then sonicated, diluted, and filtered through polycarbonate filters. Measurements of length, width, and fiber count per mass were made with a JEOL JSM-6400 scanning electron microscope. Measurements at each magnification were referenced to a National Institute of Standards and Technology electron microscopy standard rule.

In this study, glass fiber samples with lengths (means ± SD) of 7 (6.5 ± 2.7 µm) and 17 µm (16.7 ± 10.6 µm), respectively, were used to analyze the effects of fibers on macrophages. Concentrations of the glass fibers used in these experiments were determined as fiber counts per milliliter. The glass fiber counts per milligram are 3.0 × 108 and 2.0 × 107 for 7- and 17-µm fiber samples, respectively (7). The glass fiber samples were heat treated at 120°C for 2 h and stored under sterile conditions at room temperature. Before each experiment, the glass fibers were suspended and sonicated in the complete cell culture medium and then applied to cells.

The endotoxin content of the glass fiber samples was measured with the Limulus amebocyte lysate assay (24). Values ranged from 0.7 to 1.69 endotoxin units (EU)/mg. These values are orders of magnitude lower than those found with cotton dust (1,000-2,000 EU/mg) or agricultural dusts (46-4,000 EU/mg) where endotoxin is thought to play a role. The maximum dose of glass fiber used in this study is 700 µg/ml, in which the maximum endotoxin concentration equals 0.118 ng/ml. This dose of endotoxin had no effect on the RAW 264.7 cells because the minimum effective dose of endotoxin is 1 ng/ml (data not shown). Therefore, the fiber results reported here cannot be attributed to endotoxin contamination.

Cells and reagents. The mouse monocyte-macrophage cell line RAW 264.7 was purchased from the American Type Culture Collection (Manassas, VA). The cells were maintained in complete medium containing DMEM supplemented with 10% FCS, 2 mM glutamine, and 100 U/ml of penicillin-streptomycin. A specific antibody against the NF-kappa B p50 subunit was purchased from Santa Cruz Biotechnology (Santa Cruz, CA) and used in the supershift assay. N-acetyl-L-cysteine (NAC) was purchased from Sigma (St. Louis, MO). These reagents were freshly prepared in a phosphate-buffered solution (PBS buffer) as a 20-fold stock solution and kept at 4°C. SN50 was purchased from BIOMOL Research Laboratories (Plymouth Meeting, PA).

TNF-alpha ELISA assay. The macrophage cells (1 × 105/well) were plated in 96-well plates for 4-16 h before stimulation. NAC or SN50 was preincubated with the cells for 30 min to inhibit fiber-induced TNF-alpha production or NF-kappa B activation. Three wells were used in each treatment. The cell culture supernatant was harvested at the end of treatment, combined together from the three wells, and used for the TNF-alpha assay. An ELISA kit from Genzyme (Cambridge, MA) was used to determine TNF-alpha production according to the manufacturer's instructions.

Gel shift assay. An NF-kappa B binding sequence in the human interleukin (IL)-6 gene promoter (bases -74 to -54, TGGGATTTTCCCATGAGTCT) was used to synthesize an oligonucleotide for the NF-kappa B binding probe (18). The complementary single-stranded oligonucleotides were denatured at 80°C for 5 min and annealed at room temperature. An activator protein (AP)-1 binding oligonucleotide derived from the AP-1 binding sequence in the collagenase gene promoter was used as a nonspecific competitor or as a probe to examine AP-1 binding activity (36, 39). The double-stranded probe was labeled with [32P]ATP (Amersham, Arlington Heights, IL) with the T4 kinase (Bethesda Research Laboratories, Gaithersburg, MD). The nuclear extracts were prepared with a three-step procedure. First, the harvested cells were treated with 500 µl of lysis buffer (50 mM KCl, 0.5% Nonidet P-40 (NP-40), 25 mM HEPES, pH 7.8, 1 mM phenylmethylsulfonyl fluoride, 10 µg/ml of leupeptin, 20 µg/ml of aprotinin, and 100 µM 1,4-dithiothreitol) on ice for 4 min. The cell lysate was centrifuged at 14,000 rpm for 1 min, and the supernatant was discarded. Second, the collected nuclei were washed once in a washing buffer that had the same composition as the lysis buffer without NP-40. Third, the nuclei were treated with an extraction buffer (500 mM KCl and 10% glycerol with the same concentrations of HEPES, phenylmethylsulfonyl fluoride, leupeptin, aprotinin, and 1,4-dithiothreitol as the lysis buffer) to make the nuclear extract. After centrifugation at 14,000 rpm for 5 min, the supernatant was harvested as the nuclear protein extract and stored at -70°C. The protein concentration was determined with a bicinchoninic acid protein assay reagent (Pierce, Rockford, IL). The DNA-protein binding reaction was conducted in a 24-µl reaction mixture including 1 µg of poly(dI-dC) (Sigma), 3 µg of nuclear protein extract, 3 µg of BSA, 4 × 104 counts/min of 32P-labeled oligonucleotide probe, and 12 µl of reaction buffer (24% glycerol, 24 mM HEPES, pH 7.9, 8 mM Tris · HCl, pH 7.9, 2 mM EDTA, and 2 mM 1,4-dithiothreitol) (37). In some cases, the indicated amount of double-stranded oligomer was added as a cold competitor. The reaction mixture was incubated on ice for 10 or 20 min (with antibody) in the absence of radiolabeled probe. After the addition of the radiolabeled probe, the mixture was incubated for 20 min at room temperature, then resolved on a 5% acrylamide gel that had been prerun at 170 V for 30 min with 0.5× Tris-borate-EDTA buffer. The loaded gel was run at 200 V for 90 min, then dried and placed on Kodak X-OMAT film (Eastman Kodak, Rochester, NY). The film was developed after an overnight exposure at -70°C.

Transfection assay. The reporter gene vector used in this study was a gift from Dr. S. T. Fan (Scripps Research Institute, La Jolla, CA) (35). The luciferase vector contains a promoter fragment (bases -615 to +15) of the human TNF-alpha gene. The murine macrophages (1 × 106/well) were plated in six-well plates for 16 h before transfection. The reporter DNA (5 µg) was delivered into the cells by the DEAE-dextran method (35). After transfection, the cells were washed once in PBS solution and cultured in 3 ml of the complete medium at 37°C for 24 h. After being stimulated for an additional 16 h, the cells were harvested for the reporter assay. The luciferase activity was determined with an assay kit (Promega, Madison, WI), then normalized for the protein content.

Data analysis. Data that are reported as means ± SD of three individual experiments were analyzed by Student's t-test at a confidence level of P < 0.05-0.001.


    RESULTS
Top
Abstract
Introduction
MATERIALS AND METHODS
RESULTS
DISCUSSION
References

Time course of TNF-alpha production by macrophages in response to glass fiber stimulation. The murine RAW 264.7 cell line was used as a model to study TNF-alpha production by macrophages exposed to size-classified samples of glass fibers. We examined the stimulatory activities of the glass fibers by exposing macrophages to samples of short (7-µm) or long (17-µm) glass fibers. The concentration of glass fibers is expressed as the ratio of fiber count to cell count. These fiber concentrations did not cause cytotoxicity as measured by trypan blue exclusion (data not shown). TNF-alpha production by macrophages was determined by an ELISA assay. We conducted the time-course study by stimulating cells with glass fibers at a 5:1 ratio (fiber to cell) for 3, 6, or 16 h. The glass fibers failed to induce TNF-alpha production after a 3-h exposure. However, a significant induction of TNF-alpha was observed after exposure for 6 or 16 h (Fig. 1). The short and long fibers exhibited a significant difference in the ability to induce TNF-alpha protein. The long-fiber samples (17-µm length) exhibited a significantly stronger stimulation of TNF-alpha production compared with the short-fiber samples (7-µm length) at both the 6- and 16-h incubation points.


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 1.   Time course of tumor necrosis factor (TNF)-alpha production in RAW 264.7 cells exposed to glass fibers. Cells were treated with fibers at fiber-to-cell ratio of 5:1 for different times. TNF-alpha production was determined with an ELISA assay as stated in MATERIALS AND METHODS. Data are means ± SE of 3 independent experiments. * Significant increase in production of TNF-alpha induced by short fibers compared with untreated cells, P < 0.001. + Significant increase in TNF-alpha production induced by long fibers compared with short fibers, P < 0.001.

Dose-dependent stimulation of TNF-alpha production by glass fibers. According to the result of the time-course study, a 16-h exposure of macrophages to glass fibers caused the greatest stimulation of TNF-alpha production. Therefore, this exposure time was used to examine the dose dependence of glass fibers on TNF-alpha production. Macrophages were exposed to the short or long glass fibers at fiber-to-cell ratios over the range of 0 to 30 as indicated in Fig. 2. A significant induction of TNF-alpha production was observed at or above a fiber-to-cell ratio of 5:1 for both short and long glass fiber samples. However, long fibers generated a significantly greater stimulation than short fibers at ratios of 5:1 and above, exhibiting 2.5- to 3-fold higher TNF-alpha production at each exposure dose.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 2.   Dose-response relationship of glass fibers. Different fiber-to-cell ratios were used to treat cells in culture plate for 16 h. TNF-alpha production was determined by ELISA assay. * Significant increase in production of TNF-alpha induced by short fibers compared with untreated cells, P < 0.001. + Significant increase in TNF-alpha production induced by long fibers compared with short fibers, P < 0.001.

Activation of TNF-alpha gene promoter by glass fibers. Cytokine gene expression is controlled at multiple levels, including transcription, RNA stability, and translation. It is well known that transcriptional regulation is a key step in the control of TNF-alpha gene expression. The gene promoter activity of TNF-alpha was thus examined to investigate the mechanism of glass fiber activation of macrophages. A luciferase reporter vector that is controlled by a wild-type human TNF-alpha gene promoter was used to analyze the transcriptional activity under glass fiber stimulation. Macrophages were transfected by the plasmid vector and then exposed to size-selected glass fiber samples. The reporter assay indicates that the TNF-alpha gene promoter was activated after the transfected cells were exposed to either the short or long glass fibers (Fig. 3). However, compared with the short fibers, the long fibers exhibited a 100% increase in the stimulatory activity.


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 3.   Activation of TNF-alpha gene promoter by glass fibers. Transient transfection assay was used to study gene promoter activity of TNF-alpha . Luciferase reporter controlled by a TNF-alpha gene promoter was transfected into cells. Transfected cells were treated with fibers for 16 h at fiber-to-cell ratio of 5:1. Reporter activity in cell lysate was determined with a luminometer, and reading was normalized for amount of protein used in each reporter assay. Data are means ± SD of reporter activity from 3 independent assays. * Significant increase in induction of promoter activity by short fibers compared with untreated cells, P < 0.001. + Significant increase in induction of promoter activity induced by long fibers compared with short fibers, P < 0.001.

Induction of DNA binding activity of the transcription factor NF-kappa B by glass fibers. NF-kappa B is a ubiquitous transcription factor that plays an important role in the control of gene expression of many cytokines. The requirement of NF-kappa B activation in the induction of TNF-alpha gene promoter activity has been well established in the signaling pathway in macrophages (12). Because the TNF-alpha gene promoter is activated by the exposure of macrophages to glass fibers, NF-kappa B might be a mediator in the signaling pathway of glass fibers. The DNA binding activity of NF-kappa B was investigated in the nuclear extracts of macrophages with the gel shift assay. The results show that a significant induction of DNA binding was detected in the nuclear extract of macrophages treated with either short or long fibers (Fig. 4, A and B). The long fibers expressed stronger activity than the short fibers. The DNA-NF-kappa B complexes usually generated two bands in the gel. The upper band was formed by the p50/p65 heterodimer, and the lower band was formed by the p50/p50 homodimer. Because the upper and lower bands were both induced, it indicated that the p65 and p50 subunits of NF-kappa B were all activated. The RAW 264.7 cell nuclear protein formed a typical pattern of NF-kappa B bands with the radiolabeled probe. This was confirmed with oligonucleotide competition and antibody supershift studies, although only p50 antibody was used (Fig. 4C). Unlabeled NF-kappa B probe effectively competed with the radiolabeled probe in NF-kappa B protein binding, whereas unlabeled AP-1 probe had no effect. The antibody against the p50 subunit of NF-kappa B shifted the p50/p50 band and reduced the p50/p65 band, whereas antibodies for SP-1 or AP-1 had no effect. The results support the conclusion that NF-kappa B is involved in the signaling pathway after glass fiber exposure. DNA binding activity of AP-1 was also investigated, and it was induced by glass fibers (data not shown).


View larger version (37K):
[in this window]
[in a new window]
 


View larger version (60K):
[in this window]
[in a new window]
 


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 4.   Activation of DNA binding activity of nuclear factor (NF)-kappa B by glass fibers. A: NF-kappa B activity examined by gel shift assay after cells were exposed to fibers as described in MATERIALS AND METHODS. B: intensity of NF-kappa B bands in A quantitated with a phosphorimager. NF-kappa B count was divided by a nonspecific band count that served as a control for protein loading. C: characterization of NF-kappa B complexes by oligonucleotide competition assay and antibody supershift assay. Nuclear protein of cells treated with long fibers was used with NF-kappa B probe to form DNA-protein complexes. Lane 1, control for oligonucleotide competition assay; lane 2, unlabeled NF-kappa B probe (100 µg) used as specific competitor; lane 3, same amount of unlabeled activator protein (AP)-1 probe for nonspecific competition; lane 4, antibody (alpha ) against p50 subunit of NF-kappa B protein to confirm protein nature of DNA-protein complexes; lanes 5 and 6, 200 µg of antibody against SP-1 and c-Jun subunits of AP-1 protein, respectively, that served as nonspecific antibodies.

Inhibition of NF-kappa B and TNF-alpha gene promoter activities by NAC and SN50. The data in Induction of DNA binding activity of the transcription factor NF-kappa B by glass fibers indicate that NF-kappa B is activated in macrophages exposed to glass fibers, but its activation may not be necessary for the activation of TNF-alpha gene transcription because many transcription factors are involved in the regulation of this gene promoter. If the promoter requires the transcription factor, inhibition of NF-kappa B activity should result in a suppression of TNF-alpha gene promoter activity. NAC and SN50 were used to examine the role of NF-kappa B in the glass fiber-induced promoter activity. NAC is an established antioxidant that has been shown to block NF-kappa B activation induced by reactive oxygen species (4, 29). SN50 is a small peptide containing a cell membrane-permeable amino acid sequence and a translocation signal of the NF-kappa B p50 subunit (20). This agent can specifically block translocation of NF-kappa B from the cytoplasm into the nucleus. Both NAC and SN50 effectively inhibited NF-kappa B activation in macrophages exposed to long fibers (Fig. 5, A nd B). Under the same conditions, the TNF-alpha gene promoter was also significantly inhibited (Fig. 5C). Taken together, these results suggest that activation of NF-kappa B is required for the activation of the TNF-alpha gene promoter in macrophages exposed to glass fibers. The toxicity of both inhibitors was examined with the dose used in this study, and no significant change in cell viability was observed in all experiments.


View larger version (48K):
[in this window]
[in a new window]
 


View larger version (11K):
[in this window]
[in a new window]
 


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 5.   Inhibition of NF-kappa B binding activity and TNF-alpha gene promoter activity by N-acetyl-L-cysteine (NAC) and SN50. A: suppression of NF-kappa B binding activity by NAC (20 mM) and SN50 (100 µg/ml) in presence of long fibers. DNA binding activity of NF-kappa B was determined in gel shift assay. B: intensity of NF-kappa B bands in A quantitated with a phosphorimager. NF-kappa B count was divided by a nonspecific band count that served as a control for protein loading. C: inhibition of TNF-alpha gene promoter by NAC and SN50. Same concentrations of NAC and SN50 were used to treat cells transfected by plasmid reporter that contained TNF-alpha gene promoter. Long fibers were used to induce reporter activity. Data are means ± SD of reporter activity from 3 independent experiments. * Significant decrease compared with control (17-µm glass fibers alone), P < 0.001.

Suppression of glass fiber-induced TNF-alpha production by NAC and SN50. The results in Inhibition of NF-kappa B and TNF-alpha gene promoter activities by NAC and SN50 show that glass fibers activate TNF-alpha gene expression at the transcriptional level. Is this a major mechanism of glass fiber activity? If so, inhibition of this promoter activity should lead to a similar inhibition of TNF-alpha secretion. To examine this hypothesis further, TNF-alpha production by macrophages was monitored after addition of NAC or SN50. Figure 6 shows that these inhibitors dramatically block TNF-alpha production in response to both short and long glass fibers. This result supports the conclusion that transcriptional regulation is a major mechanism of gene expression and protein production induced by glass fibers.


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 6.   Inhibition of fiber-induced TNF-alpha production by NAC and SN50. NAC (20 mM) and SN50 (100 µg/ml) were used to treat cells in presence of short and long fibers. TNF-alpha production was determined after 16 h of combined treatment. Data are means ± SD of TNF-alpha levels from 3 independent experiments. * Significant suppression of TNF-alpha production, P < 0.001.

Engulfment of the glass fibers by macrophages. Interaction between glass fibers and macrophages is the cause of activation of NF-kappa B and the TNF-alpha gene. It is of interest to explore how macrophages respond morphologically to a challenge with glass fibers of different lengths. Therefore, macrophages were observed under light microscopy after exposure to short or long glass fibers for 16 h. The short and long fibers were handled differently by the cells. Short fibers (7 µm) were effectively engulfed by the macrophages (Fig. 7A). In contrast, long fibers (17 µm) were not completely phagocytized (Fig. 7B). Many long fibers remained extracellular. A common feature is that both short and long fibers induced cell fusion and formation of giant cells containing two or more nuclei in this macrophage cell line. This was observed after cellular staining (data not shown). Such cell fusion was not observed with primary rat alveolar macrophages (7).


View larger version (77K):
[in this window]
[in a new window]
 
Fig. 7.   Morphology of cells exposed to short (A) and long (B) glass fibers for 16 h.


    DISCUSSION
Top
Abstract
Introduction
MATERIALS AND METHODS
RESULTS
DISCUSSION
References

The present study examines TNF-alpha production and transcription factor activation in macrophages after exposure to glass fibers and investigates the critical role of fiber length. The results indicate that at subtoxic doses, glass fibers stimulate TNF-alpha production in a macrophage cell line (RAW 264.7). These fibers also cause NF-kappa B activation. Inhibition of NF-kappa B by NAC, an antioxidant that inhibits NF-kappa B activation induced by reactive oxygen species or SN50, a specific NF-kappa B inhibitor, suppressed the promoter function of the TNF-alpha gene and decreased TNF-alpha secretion by macrophages, demonstrating that TNF-alpha production was regulated by NF-kappa B. Inductions of NF-kappa B, promoter activity, and TNF-alpha protein do not have to have the same multiple of change. NF-kappa B signal may be amplified in the gene promoter, and the signal may be further amplified in the process of mRNA and protein synthesis. The amplification in the posttranscriptional part may not be dependent on the activation of NF-kappa B. A signal from NF-kappa B is required for the initiation of TNF-alpha gene transcription induced by glass fibers. Functions of the NF-kappa B complexes p50/p50 homodimer and p50/p65 heterodimer are different in the regulation of TNF-alpha gene promoter (2). The p50 subunit has no activation domain (3, 27); therefore, the p50/p50 homodimer inhibits transcription after binding to the TNF-alpha gene promoter. The p65 subunit has a transactivation domain (27), and the p50/p65 heterodimer has a much stronger binding affinity to the DNA than the p50/p50 homodimer (3, 27). This leads to the fact that the p50/p65 heterodimer is able to overcome the negative activity of the p50/p50 homodimer and transactivate the gene promoter after it binds to the DNA (27). This mechanism has been demonstrated in the transcriptional regulation of many genes, including IL-2 and interferon-gamma (38). The p50/p65 heterodimer was induced by the glass fiber (Fig. 4A) and contributed to activation of the TNF-alpha gene promoter (Figs. 3 and 5).

It may be noted that both clinical and experimental studies (40) indicate that proinflammatory cytokines are important mediators in asbestos-related lung diseases. Several studies (8, 15, 25) have also shown that TNF-alpha plays an important role in the pathogenesis of pulmonary fibrosis. Although it appears that TNF-alpha plays an important role in the pathogenesis of lung injury induced by silica and asbestos, there is little information regarding the role of TNF-alpha in the toxic action of glass fibers. The present data demonstrating TNF-alpha production stimulated by glass fibers suggest that these fibers may exhibit a degree of pathogenic activity by mechanisms similar to silica and asbestos.

The results obtained from the present study show that glass fibers are capable of causing NF-kappa B activation. Reactive oxygen species may play a key role in NF-kappa B activation induced by these fibers as demonstrated by the inhibitory effect of NAC. With regard to the generation of reactive oxygen species, it may be noted that the engulfment of foreign substances by macrophages is associated with initiation or enhancement of the respiratory burst in the cell. During the respiratory burst, macrophages and other cellular components generate large quantities of reactive oxygen species. In many cell types, reactive oxygen species have been shown to activate the nuclear translocation of NF-kappa B by activating reactions, leading to disassociation of an inhibitor (Ikappa B) from NF-kappa B in the cytoplasm (4, 29). NF-kappa B protein is found in many different cell types and is a focal point for understanding how extracellular signals induce the expression of specific sets of early-response genes in higher eukaryotes, such as those regulating the secretion of growth promoters (19, 26, 28, 31). It has been suggested that NF-kappa B activation is crucial to cytoplasmic and/or nuclear signaling when cells are exposed to injury-producing conditions (3). NF-kappa B serves as a second messenger to induce a series of cellular genes in response to an environmental perturbation. Among the cellular genes regulated by NF-kappa B are those cytokines regulating inflammation, including TNF-alpha , IL-6, IL-1, and granulocyte-macrophage colony-stimulating factor (12, 38). NF-kappa B activates these genes by binding to the NF-kappa B consensus sequence in their promoters. Through activation of NF-kappa B, glass fibers may cause expression of many genes, including oncogenes, to initiate inflammation or toxic reactions. Our preliminary study revealed that DNA binding activity of AP-1 was also induced by glass fibers. Because the DNA binding activity of AP-1 is mainly controlled by gene transcription, we expect that c-jun and c-fos genes are activated by glass fibers.

An important result obtained from the present study is that long fibers act differently from short fibers. The following three major findings should be specially emphasized. First, long fibers are more potent in the stimulation of TNF-alpha production in macrophages than short fibers. Second, long fibers exhibit a higher potency in causing NF-kappa B activation than short fibers. Third, macrophage engulfment proceeds differently for long and short fibers. Short fibers were effectively engulfed by macrophages, whereas long fibers were not. This is in agreement with earlier studies (6, 11) that concluded that long fibers are cleared from the deep regions of the lung less effectively than are short fibers. This may be the consequence of failure of macrophages to ingest long fibers completely or their difficulty in moving once they have engulfed a long fiber. The potential of long fibers in the lung to initiate repeated attempts of frustrated phagocytosis may be greater than that of shorter fibers. These frustrated phagocytic events would be expected to generate a greater concentration of reactive oxygen species, cause enhanced NF-kappa B activation, and stimulate greater production of the inflammatory and fibrogenic cytokine TNF-alpha . Thus the results obtained from the present study point out that fiber length is a critical factor in determining the toxicity of these asbestos substitutes. It may be noted that, in laboratory studies, fiber mass, but not fiber length, is frequently used in the design and execution of experiments. The present study indicates that fiber length should be taken into consideration in the future study of fiber toxicity and carcinogenicity, as well as in risk assessment activities.

On the basis of the above discussion, it may be postulated that when macrophages attempt to engulf glass fibers, reactive oxygen species are generated because of respiratory burst. Because macrophages cannot engulf the long glass fibers completely, the frustrated cells will generate a higher level of reactive oxygen species. These species, in turn, activate NF-kappa B. The activated NF-kappa B binds to the promoter of the TNF-alpha gene and turns on the transcription to produce TNF-alpha protein. The generation of reactive oxygen species, activation of NF-kappa B, and production of TNF-alpha are involved in the mechanism of toxicity and potential pathogenesis of glass fibers.

In conclusion, 1) glass fibers are able to stimulate TNF-alpha production in macrophages. 2) Glass fibers are also capable of causing NF-kappa B activation. 3) Reactive oxygen species are involved in NF-kappa B activation and in TNF-alpha production caused by these fibers. 4) Long fibers are more potent than short fibers for stimulation of TNF-alpha production and activation of NF-kappa B. 5) TNF-alpha production induced by fibers is regulated by NF-kappa B. 6) Short fibers (7 µm) were effectively engulfed by macrophages, whereas long fibers (17 µm) were not.


    FOOTNOTES

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Address for reprint requests: V. Castranova, Pathology and Physiology Research Branch, National Institute for Occupational Safety and Health, 1095 Willowdale Rd., Mail Stop L2015, Morgantown, WV 26505.

Received 2 September 1998; accepted in final form 16 November 1998.


    REFERENCES
Top
Abstract
Introduction
MATERIALS AND METHODS
RESULTS
DISCUSSION
References

1.   Adachi, S., K. Takemoto, and K. Kimura. Tumorigenicity of fine man-made fibers after intratracheal administration to hamsters. Environ. Res. 54: 52-73, 1991[Medline].

2.   Baer, M., A. Dillner, R. C. Schwartz, C. Sedon, S. Nedospasov, and P. F. Johnson. Tumor necrosis factor alpha transcription in macrophages is attenuated by an autocrine factor that preferentially induces NF-kappa B p50. Mol. Cell. Biol. 18: 5678-5689, 1998[Abstract/Free Full Text].

3.   Baeuerle, P. A. The inducible activator NF-kappa B: regulation of distinct protein subunits. Biochim. Biophys. Acta 1072: 63-80, 1991[Medline].

4.   Baeuerle, P. A., and T. Henkel. Function and activation of NF-kappa B in the immune system. Annu. Rev. Immunol. 12: 141-179, 1994[Medline].

5.   Baron, P., G. Deye, and J. Fernback. Length separation of fibers. Aerosol Sci. Technol. 21: 179-192, 1994.

6.   Bellman, B., H. Konig, H. Muhle, and F. Pott. Chemical durability of asbestos and man-made-mineral fibers in vitro. J. Aerosol. Sci. 17: 341-345, 1986.

7.   Blake, T., V. Castranova, D. Schwegler-Berry, P. Baron, G. J. Deye, C. Li, and W. Jones. Effects of fiber length on glass microfiber cytotoxicity. J. Toxicol. Environ. Health. 54: 243-259, 1998.

8.   Brown, G. P., M. Momick, and G. W. Hunninghake. Fibroblast proliferation induced by silica-exposed human alveolar macrophages. Am. Rev. Respir. Dis. 138: 85-89, 1988[Medline].

9.   Bun, W. B., III, J. R. Bender, T. W. Hesterberg, G. R. Chase, and J. L. Konzen. Recent studies of man-made vitreous fibers. J. Occup. Med. 35: 101-113, 1993[Medline].

10.   Castranova, V., W. Pailes, D. Judy, T. Blake, D. Schwegler-Berry, and W. Jones. In vitro effects of large and small glass fibers on rat alveolar macrophages. J. Toxicol. Environ. Health 49: 101-113, 1996.

11.   Coin, P. G., V. L. Roggli, and A. R. Brody. Deposition, clearance and translation of chrysotile asbestos from peripheral and central region of rat lung. Environ. Res. 58: 97-116, 1992[Medline].

12.   Collart, M. A., P. Baeuerle, and P. Vassali. Regulation of tumor necrosis factor alpha transcription in macrophages: involvement of four kappa-B-like motifs and of constitutive and inducible factor alpha gene in primary macrophages. J. Exp. Med. 171: 35-47, 1990[Abstract/Free Full Text].

13.   De Vuyst, P., P. Dumortier, G. M. H. Swaen, J. C. Parion, and P. Brochard. Respiratory health effects of man-made vitreous (mineral) fibers. Eur. Respir. J. 8: 2149-2173, 1995[Abstract].

14.   Donaldson, K., R. C. Brown, and G. M. Brown. Respirable industrial fibers: mechanisms of pathogenicity. Thorax 48: 390-395, 1993[Free Full Text].

15.   Driscoll, K. E., R. C. Linderschmidt, J. K. Maurer, J. M. Higgins, and G. Ridder. Pulmonary response to silica or titanium dioxide: inflammatory cells, alveolar macrophage-derived cytokines, and histopathology. Am. J. Respir. Cell Mol. Biol. 2: 381-390, 1990.

16.   Enterline, P. E. Carcinogenic effects of man-made vitreous fibers. Annu. Rev. Public Health 12: 459-480, 1991[Medline].

17.   Hesterberg, T. W., W. C. Miller, E. E. McConnel, J. Chevalier, J. G. Hadley, D. M. Bernstein, P. Thevenaz, and R. Anderson. Chronic inhalation toxicity of size-separated glass fibers in Fischer 344 rats. Fundam. Appl. Toxicol. 20: 464-467, 1993[Medline].

18.   Isshiki, H., S. Akira, O. Tanabe, T. Nakajima, T. Shimamoto, and T. Kishimoto. Constitutive and interleukin-1 (IL-1)-inducible factors interact with the IL-1-responsive element in the IL-6 gene. Mol. Cell. Biol. 10: 2757-2764, 1990[Abstract/Free Full Text].

19.   Kessler, D. J., M. P. Duyao, D. B. Spicer, E. Gail, and G. E. Sonenshein. NF-kappa B-like factors mediated interleukin 1 induction of c-myc gene transcription in fibroblasts. J. Exp. Med. 176: 787-792, 1992[Abstract/Free Full Text].

20.   Lin, Y. Z., S. Y. Yao, R. A. Veach, T. R. Torgerson, and J. Hawiger. Inhibition of nuclear translocation of transcription factor NF-kappa B by a synthetic peptide containing a cell membrane-permeable motif and nuclear localization sequence. J. Biol. Chem. 270: 14255-14258, 1995[Abstract/Free Full Text].

21.   Lippmann, M. Man-made mineral fibers (MMMF): human exposures and health assessment. Toxicol. Ind. Health 6: 225-246, 1990[Medline].

22.   Luoto, K., M. Holopainen, J. Kangas, P. Kalliokoski, and K. Savolainen. The effect of fiber length on the dissolution by macrophages of rockwool and glasswool fibers. Environ. Res. 70: 51-61, 1995[Medline].

23.   Mossman, B. T., and L. B. L. Gee. Asbestos-related diseases. N. Engl. J. Med. 320: 1712-1730, 1990.

24.   Olenchock, S. A., J. C. Mull, and W. G. Jones. Endotoxins in cotton: washing effects and size distribution. Am. J. Ind. Med. 4: 515-521, 1983[Medline].

25.   Piguet, P. F., M. A. Collart, G. E. Grau, A. P. Sappino, and P. Vassalli. Requirement of tumor necrosis factor for development of silica-induced pulmonary fibrosis. Nature 344: 245-247, 1990[Medline].

26.   Schmidt, K. N., P. Amstad, P. Cerutti, and P. A. Baeuerle. The role of hydrogen peroxide and superoxide as messengers in the activation of transcription factor NF-kappa B. Chem. Biol. 2: 13-22, 1995[Medline].

27.   Schmitz, M. L., and P. A. Baeuerle. The p65 subunit is responsible for the strong transcription activating potential of NF-kappa B. EMBO J. 10: 3805-3817, 1991[Medline].

28.   Schrect, R., B. Meier, D. M. Mannel, W. Droge, and P. A. Baeuerle. Dithiocarbamates as potent inhibitors of nuclear factor-kappa B activation in intact cells. J. Exp. Med. 175: 1181-1192, 1992[Abstract/Free Full Text].

29.   Siebenlist, U., G. Franzoso, and K. Brown. Structure, regulation and function of NF-kappa B. Annu. Rev. Cell Biol. 10: 405-455, 1994.

30.   Stanton, M. F., M. Layard, A. Tegeris, E. Miller, M. May, E. Morgan, and A. Smith. Relation of particle dimension to carcinogenicity in amphibole asbestos and other fibrous minerals. J. Natl. Cancer Inst. 6: 965-975, 1981.

31.   Sun, Y., and L. W. Oberly. Redox regulation of transcriptional activators. Free Radic. Biol. Med. 21: 335-348, 1996[Medline].

32.   Vallyathan, V., J. F. Mega, X. Shi, and N. S. Dalal. Enhanced generation of free radicals from phagocytes induced by mineral dusts. Am. J. Respir. Cell Mol. Biol. 6: 404-413, 1992.

33.   Wheeler, C. C. Exposure to man-made mineral fibers; a summary of current animal data. Toxicol. Ind. Health 6: 293-307, 1990[Medline].

34.   Wong, O., and R. P. Musselman. An epidemiological and toxicological evaluation of the carcinogenicity of man-made vitreous fiber, with a consideration of coexposure. J. Environ. Pathol. Toxicol. Oncol. 13: 169-180, 1994[Medline].

35.   Yao, J., N. Mackman, T. S. Edgington, and S. T. Fan. Lipolysaccharide induction of the tumor necrosis factor-alpha promoter in human monocytic cells. Regulation by Egr-1, c-jun, and NF-kappa B transcription factors. J. Biol. Chem. 272: 17795-17801, 1997[Abstract/Free Full Text].

36.   Ye, J., M. Cippitelli, L. Dorman, J. R. Ortaldo, and H. A. Young. The nuclear factor YY1 suppresses the human gamma interferon promoter through two mechanisms: inhibition of AP1 binding and activation of a silencer element. Mol. Cell. Biol. 16: 4744-4753, 1996[Abstract].

37.   Ye, J., P. Ghosh, M. Cippitelli, J. Subleski, K. J. Hardy, J. R. Ortaldo, and H. A. Young. Characterization of a silencer regulatory element in the human interferon-gamma promoter. J. Biol. Chem. 269: 25728-25734, 1994[Abstract/Free Full Text].

38.   Ye, J., and H. Young. Negative regulation of cytokine gene transcription. FASEB J. 11: 825-833, 1997[Abstract].

39.   Ye, J., X. Zhang, and Z. Dong. Characterization of the human granulocyte-macrophage colony-stimulating factor gene promoter: an AP1 complex and an Sp1-related complex transactivate the promoter activity that is suppressed by a YY1 complex. Mol. Cell. Biol. 16: 157-167, 1996[Abstract].

40.   Zhang, Y., T. C. Lee, B. Guillemin, M. C. Yu, and W. N. Rom. Enhanced IL-1 beta and tumor necrosis factor-alpha release and messenger RNA expression in macrophages from idiopathic pulmonary fibrosis or after asbestos exposure. J. Immunol. 150: 4188-4196, 1993[Abstract].


Am J Physiol Lung Cell Mol Physiol 276(3):L426-L434



This article has been cited by other articles:


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
C. Xie, A. Reusse, J. Dai, K. Zay, J. Harnett, and A. Churg
TNF-alpha increases tracheal epithelial asbestos and fiberglass binding via a NF-kappa B-dependent mechanism
Am J Physiol Lung Cell Mol Physiol, September 1, 2000; 279(3): L608 - L614.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Ye, P. Zeidler, S.-h. Young, A. Martinez, V. A Robinson, W. Jones, P. Baron, X. Shi, and V. Castranova
Activation of Mitogen-activated Protein Kinase p38 and Extracellular Signal-regulated Kinase Is Involved in Glass Fiber-induced Tumor Necrosis Factor-alpha Production in Macrophages
J. Biol. Chem., February 9, 2001; 276(7): 5360 - 5367.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Q. Ma and K. Kinneer
Chemoprotection by Phenolic Antioxidants. INHIBITION OF TUMOR NECROSIS FACTOR alpha INDUCTION IN MACROPHAGES
J. Biol. Chem., January 18, 2002; 277(4): 2477 - 2484.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ye, J.
Right arrow Articles by Castranova, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ye, J.
Right arrow Articles by Castranova, V.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online