|
|
||||||||
production and
transcription factor activation in macrophages
1 Health Effects Laboratory
Division and 2 Division of
Respiratory Disease Studies, Recent studies
have demonstrated that dielectrophoresis is an efficient method for the
separation of fibers according to fiber length. This method allows the
investigation of fiber-cell interactions with fiber samples of the same
composition but of different lengths. In the present study, we analyzed
the effects of length on the interaction between glass fibers and
macrophages by focusing on production of the inflammatory cytokine
tumor necrosis factor (TNF)-
nuclear factor- FIBROUS MATERIALS have various applications in both
residential and industrial settings. These materials offer, in varying degrees, reinforcement, thermal and electrical insulation, flexibility, and strength. Asbestos is one group of such materials that exhibits these properties. Animal experiments and epidemiologic studies have
concluded that asbestos exposure is associated with various lung
diseases including fibrosis and cancer (23). As a result of these
findings, the use of asbestos has been limited or prohibited in several
countries. Consequently, the development and use of new fibers are on
the increase. These include different types of man-made materials such
as fibrous glass, rock wool, and ceramic fibers. Although these fibers
are believed to be less toxic than asbestos, only limited studies (1,
9, 13, 14, 16, 21, 32, 34) of their toxic effects exist. The mechanisms of toxic and biological actions are not fully known. Two studies (14,
32) indicated that their chemical composition can affect the ability of
fibers to generate toxic oxidants, which can damage the lung cells. For
example, transition metals on the fiber surface can catalyze the
generation of reactive oxygen species (32). Recent studies (10, 17, 22)
also indicated that fiber length seems to be an important factor. For
example, when implanted in the pleural spaces of rats, long asbestos
fibers exhibited a higher carcinogenic activity than short fibers (30).
The amount of fibers deposited in the lung is dependent on the
concentration, size, shape, and other physical properties of the fibers
(14, 33). It has been postulated that alveolar deposition decreases with increasing fiber diameter and length (14). Once in the lung, the
biological activity of the inhaled fibers is dependent on the length,
the physical and chemical properties of the surface (14), and the
solubility of the fibers. Although the above studies point to an
important role for fiber length in toxicity, pertinent studies have not
been undertaken to support this hypothesis. This is likely due to the
difficulty of generating fibers with well-defined lengths in quantities
sufficient to carry out laboratory studies. Recently, a classifier has
been developed to separate fibers by length with dielectrophoresis that
involves the movement of neutral particles in a gradient electric field
(5). The development of this classifier makes it possible to study the
role of fiber length in toxicity. Exploring the ability of this
technique, Blake et al. (7) recently studied the toxicity
of JM-100 glass fibers and found that long fibers were more toxic than
short fibers when dose was expressed on a fiber-count basis.
The present study focuses on the length dependence of induction of
tumor necrosis factor (TNF)- Fibers. Bulk samples of Manville code
100 (JM-100) glass fibers supplied by the manufacturer were first
milled, aerosolized, and separated into two length categories by
dielectrophoresis (5). The dielectrophoretic classifier was operated in
a differential mode so that fibers with narrow length distributions
were extracted in an air suspension at the end of the classifier. These
size-selected fiber samples were collected on polycarbonate (Nuclepore)
filters at rates of up to 1 mg/day. Fibers were scraped off the filters for microscopic analysis and biological experiments.
We prepared samples of the length-classified fibers for size and count
analysis by adding weighed portions of the dusts to freshly filtered
water. These samples were then sonicated, diluted, and filtered through
polycarbonate filters. Measurements of length, width, and fiber count
per mass were made with a JEOL JSM-6400 scanning electron microscope.
Measurements at each magnification were referenced to a National
Institute of Standards and Technology electron microscopy standard rule.
In this study, glass fiber samples with lengths (means ± SD) of 7 (6.5 ± 2.7 µm) and 17 µm (16.7 ± 10.6 µm), respectively, were used to analyze the effects of fibers on macrophages.
Concentrations of the glass fibers used in these experiments were
determined as fiber counts per milliliter. The glass fiber
counts per milligram are 3.0 × 108 and 2.0 × 107 for 7- and 17-µm fiber
samples, respectively (7). The glass fiber samples were heat treated at
120°C for 2 h and stored under sterile conditions at room
temperature. Before each experiment, the glass fibers were suspended
and sonicated in the complete cell culture medium and then applied to cells.
The endotoxin content of the glass fiber samples was measured with the
Limulus amebocyte lysate assay (24).
Values ranged from 0.7 to 1.69 endotoxin units (EU)/mg. These values
are orders of magnitude lower than those found with cotton dust
(1,000-2,000 EU/mg) or agricultural dusts (46-4,000 EU/mg)
where endotoxin is thought to play a role. The maximum dose of glass
fiber used in this study is 700 µg/ml, in which the maximum endotoxin
concentration equals 0.118 ng/ml. This dose of endotoxin had no effect
on the RAW 264.7 cells because the minimum effective dose of endotoxin is 1 ng/ml (data not shown). Therefore, the fiber results reported here
cannot be attributed to endotoxin contamination.
Cells and reagents. The mouse
monocyte-macrophage cell line RAW 264.7 was purchased from the American
Type Culture Collection (Manassas, VA). The cells were maintained in
complete medium containing DMEM supplemented with 10% FCS, 2 mM
glutamine, and 100 U/ml of penicillin-streptomycin. A specific antibody
against the NF- TNF- Gel shift assay. An NF- Transfection assay. The reporter gene
vector used in this study was a gift from Dr. S. T. Fan (Scripps
Research Institute, La Jolla, CA) (35). The luciferase vector contains
a promoter fragment (bases Data analysis. Data that are reported
as means ± SD of three individual experiments were analyzed by
Student's t-test at a confidence
level of P < 0.05-0.001.
Time course of TNF-
![]()
ABSTRACT
Top
Abstract
Introduction
MATERIALS AND METHODS
RESULTS
DISCUSSION
References
in a mouse macrophage cell line (RAW
264.7). The underlying molecular mechanisms controlling TNF-
production were investigated at the gene transcription level. The
results show that glass fibers induced TNF-
production in
macrophages and that this induction was associated with activation of
the gene promoter. Activation of the transcription factor nuclear
factor (NF)-
B was responsible for this induced promoter activity.
The inhibition of both TNF-
production and NF-
B activation by
N-acetyl-L-cysteine,
an antioxidant, indicates that generation of oxidants may contribute to
the induction of this cytokine and activation of this transcription
factor by glass fibers. Long fibers (17 µm) were significantly more
potent than short fibers (7 µm) in inducing NF-
B activation, the
gene promoter activity, and the production of TNF-
. This fiber
length-dependent difference in the stimulatory potency correlated with
the fact that macrophages were able to completely engulf short glass
fibers, whereas phagocytosis of long glass fibers was incomplete. These results suggest that fiber length plays a critical role in the potential pathogenicity of glass fibers.
B; free radicals; tumor necrosis factor-
![]()
INTRODUCTION
Top
Abstract
Introduction
MATERIALS AND METHODS
RESULTS
DISCUSSION
References
production and nuclear transcription factor (NF)-
B activation in a macrophage cell line (RAW 264.7). TNF-
was chosen because this inflammatory and fibrogenic cytokine is
a macrophage-derived peptide that has been shown to play an important
role in the pathogenesis of pulmonary fibrosis (15, 25, 40). Several
fibrogenic agents, such as crystalline silica and asbestos, stimulate
TNF-
mRNA expression and protein synthesis in macrophages (25, 40).
Elevated TNF-
levels lead to fibrosis by stimulating proliferation
of fibroblasts and production of collagen matrix (8, 25, 40). Cytokine
gene expression can be regulated at both the transcriptional and
posttranscriptional levels. Transcription of TNF-
is controlled by
sequence-specific transcription factors, including NF-
B, that
interact with the gene promoter or enhancer regions. NF-
B, a widely
distributed multisubunit transcription factor, is involved in the
regulation of genes encoding for many cytokines (12). In the present
study, we attempted to answer the following questions.
1) Do glass fibers induce TNF-
production in vitro? 2) Do glass
fibers cause NF-
B activation in vitro?
3) Does fiber length play a critical
role in TNF-
production or NF-
B activation?
4) Does NF-
B regulate TNF-
production induced by glass fibers?
5) Are reactive oxygen species
involved in TNF-
production or NF-
B activation?
6) Do long fibers interact
differently with macrophages than short fibers?
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
MATERIALS AND METHODS
RESULTS
DISCUSSION
References
B p50 subunit was purchased from Santa
Cruz Biotechnology (Santa Cruz, CA) and used in the supershift assay.
N-acetyl-L-cysteine (NAC) was purchased from Sigma (St. Louis, MO). These reagents were
freshly prepared in a phosphate-buffered solution (PBS buffer) as a
20-fold stock solution and kept at 4°C. SN50 was purchased from
BIOMOL Research Laboratories (Plymouth Meeting, PA).
ELISA assay. The macrophage
cells (1 × 105/well) were
plated in 96-well plates for 4-16 h before stimulation. NAC or SN50 was preincubated with the cells for 30 min to inhibit
fiber-induced TNF-
production or NF-
B activation. Three wells
were used in each treatment. The cell culture supernatant was harvested
at the end of treatment, combined together from the three wells, and
used for the TNF-
assay. An ELISA kit from Genzyme (Cambridge, MA)
was used to determine TNF-
production according to the
manufacturer's instructions.
B binding
sequence in the human interleukin (IL)-6 gene promoter (bases
74
to
54, TGGGATTTTCCCATGAGTCT) was used to synthesize
an oligonucleotide for the NF-
B binding probe (18). The
complementary single-stranded oligonucleotides were denatured at
80°C for 5 min and annealed at room temperature. An activator
protein (AP)-1 binding oligonucleotide derived from the AP-1 binding
sequence in the collagenase gene promoter was used as a nonspecific
competitor or as a probe to examine AP-1 binding activity (36, 39). The
double-stranded probe was labeled with
[32P]ATP (Amersham,
Arlington Heights, IL) with the T4 kinase (Bethesda Research
Laboratories, Gaithersburg, MD). The nuclear extracts were prepared
with a three-step procedure. First, the harvested cells were treated
with 500 µl of lysis buffer (50 mM KCl, 0.5% Nonidet P-40 (NP-40),
25 mM HEPES, pH 7.8, 1 mM phenylmethylsulfonyl fluoride, 10 µg/ml of
leupeptin, 20 µg/ml of aprotinin, and 100 µM 1,4-dithiothreitol) on
ice for 4 min. The cell lysate was centrifuged at 14,000 rpm for 1 min,
and the supernatant was discarded. Second, the collected nuclei were
washed once in a washing buffer that had the same composition as the
lysis buffer without NP-40. Third, the nuclei were treated with an
extraction buffer (500 mM KCl and 10% glycerol with the same
concentrations of HEPES, phenylmethylsulfonyl fluoride, leupeptin,
aprotinin, and 1,4-dithiothreitol as the lysis buffer) to
make the nuclear extract. After centrifugation at 14,000 rpm for 5 min,
the supernatant was harvested as the nuclear protein extract and stored
at
70°C. The protein concentration was determined with a
bicinchoninic acid protein assay reagent (Pierce, Rockford, IL). The
DNA-protein binding reaction was conducted in a 24-µl reaction
mixture including 1 µg of poly(dI-dC) (Sigma), 3 µg of nuclear
protein extract, 3 µg of BSA, 4 × 104 counts/min of
32P-labeled oligonucleotide probe,
and 12 µl of reaction buffer (24% glycerol, 24 mM HEPES, pH 7.9, 8 mM Tris · HCl, pH 7.9, 2 mM EDTA, and 2 mM
1,4-dithiothreitol) (37). In some cases, the indicated amount of
double-stranded oligomer was added as a cold competitor. The reaction
mixture was incubated on ice for 10 or 20 min (with antibody) in the
absence of radiolabeled probe. After the addition of the radiolabeled
probe, the mixture was incubated for 20 min at room temperature, then
resolved on a 5% acrylamide gel that had been prerun at 170 V for 30 min with 0.5× Tris-borate-EDTA buffer. The loaded
gel was run at 200 V for 90 min, then dried and placed on Kodak X-OMAT
film (Eastman Kodak, Rochester, NY). The film was developed after an
overnight exposure at
70°C.
615 to +15) of the human TNF-
gene. The murine macrophages (1 × 106/well) were plated in six-well
plates for 16 h before transfection. The reporter DNA (5 µg) was
delivered into the cells by the DEAE-dextran method (35). After
transfection, the cells were washed once in PBS solution and cultured
in 3 ml of the complete medium at 37°C for 24 h. After being
stimulated for an additional 16 h, the cells were harvested for the
reporter assay. The luciferase activity was determined with an assay
kit (Promega, Madison, WI), then normalized for the protein content.
![]()
RESULTS
Top
Abstract
Introduction
MATERIALS AND METHODS
RESULTS
DISCUSSION
References
production by
macrophages in response to glass fiber stimulation. The
murine RAW 264.7 cell line was used as a model to study TNF-
production by macrophages exposed to size-classified samples of glass
fibers. We examined the stimulatory activities of the glass fibers by
exposing macrophages to samples of short (7-µm) or long (17-µm)
glass fibers. The concentration of glass fibers is expressed as the
ratio of fiber count to cell count. These fiber concentrations did not
cause cytotoxicity as measured by trypan blue exclusion (data not
shown). TNF-
production by macrophages was determined by an ELISA
assay. We conducted the time-course study by stimulating cells with
glass fibers at a 5:1 ratio (fiber to cell) for 3, 6, or 16 h. The
glass fibers failed to induce TNF-
production after a 3-h exposure.
However, a significant induction of TNF-
was observed after exposure
for 6 or 16 h (Fig. 1). The short and long
fibers exhibited a significant difference in the ability to induce
TNF-
protein. The long-fiber samples (17-µm length)
exhibited a significantly stronger stimulation of TNF-
production
compared with the short-fiber samples (7-µm length) at both the 6- and 16-h incubation points.

View larger version (16K):
[in a new window]
Fig. 1.
Time course of tumor necrosis factor (TNF)-
production in RAW 264.7 cells exposed to glass fibers. Cells were treated with fibers at
fiber-to-cell ratio of 5:1 for different times. TNF-
production was
determined with an ELISA assay as stated in MATERIALS
AND METHODS. Data are means ± SE of 3 independent
experiments. * Significant increase in production of TNF-
induced by short fibers compared with untreated cells,
P < 0.001. + Significant increase in
TNF-
production induced by long fibers compared with short fibers,
P < 0.001.
Dose-dependent stimulation of TNF-
production by glass fibers. According to the result of
the time-course study, a 16-h exposure of macrophages to glass fibers
caused the greatest stimulation of TNF-
production. Therefore, this
exposure time was used to examine the dose dependence of glass fibers
on TNF-
production. Macrophages were exposed to the short or long
glass fibers at fiber-to-cell ratios over the range of 0 to 30 as
indicated in Fig. 2. A significant
induction of TNF-
production was observed at or above a
fiber-to-cell ratio of 5:1 for both short and long glass fiber samples.
However, long fibers generated a significantly greater stimulation than
short fibers at ratios of 5:1 and above, exhibiting 2.5- to 3-fold
higher TNF-
production at each exposure dose.
|
Activation of TNF-
gene promoter by
glass fibers. Cytokine gene expression is controlled at
multiple levels, including transcription, RNA stability, and
translation. It is well known that transcriptional regulation is a key
step in the control of TNF-
gene expression. The gene promoter
activity of TNF-
was thus examined to investigate the mechanism of
glass fiber activation of macrophages. A luciferase reporter vector
that is controlled by a wild-type human TNF-
gene promoter was used
to analyze the transcriptional activity under glass fiber stimulation.
Macrophages were transfected by the plasmid vector and then exposed to
size-selected glass fiber samples. The reporter assay indicates that
the TNF-
gene promoter was activated after the transfected cells
were exposed to either the short or long glass fibers (Fig.
3). However, compared with the short
fibers, the long fibers exhibited a 100% increase in the stimulatory
activity.
|
Induction of DNA binding activity of the transcription
factor NF-
B by glass fibers. NF-
B is
a ubiquitous transcription factor that plays an important role in the
control of gene expression of many cytokines. The
requirement of NF-
B activation in the induction of TNF-
gene
promoter activity has been well established in the signaling pathway in
macrophages (12). Because the TNF-
gene promoter is activated by the
exposure of macrophages to glass fibers, NF-
B might be a mediator in
the signaling pathway of glass fibers. The DNA binding activity of
NF-
B was investigated in the nuclear extracts of macrophages with
the gel shift assay. The results show that a significant induction of
DNA binding was detected in the nuclear extract of macrophages treated
with either short or long fibers (Fig. 4,
A and
B). The long fibers expressed stronger activity than the short fibers. The DNA-NF-
B complexes usually generated two bands in the gel. The upper band was formed by
the p50/p65 heterodimer, and the lower band was formed by the p50/p50
homodimer. Because the upper and lower bands were both induced, it
indicated that the p65 and p50 subunits of NF-
B were all activated.
The RAW 264.7 cell nuclear protein formed a typical pattern of NF-
B
bands with the radiolabeled probe. This was confirmed with
oligonucleotide competition and antibody supershift studies, although
only p50 antibody was used (Fig.
4C). Unlabeled NF-
B probe
effectively competed with the radiolabeled probe in NF-
B protein
binding, whereas unlabeled AP-1 probe had no effect. The antibody
against the p50 subunit of NF-
B shifted the p50/p50 band and reduced
the p50/p65 band, whereas antibodies for SP-1 or AP-1 had
no effect. The results support the conclusion that NF-
B is involved
in the signaling pathway after glass fiber exposure. DNA binding
activity of AP-1 was also investigated, and it was induced by glass
fibers (data not shown).
|
Inhibition of NF-
B and
TNF-
gene promoter activities by NAC and SN50. The
data in Induction of DNA binding activity of the transcription
factor NF-
B by glass
fibers indicate that NF-
B is activated
in macrophages exposed to glass fibers, but its activation may not be
necessary for the activation of TNF-
gene transcription because many
transcription factors are involved in the regulation of this gene
promoter. If the promoter requires the transcription factor, inhibition
of NF-
B activity should result in a suppression of TNF-
gene
promoter activity. NAC and SN50 were used to examine the role of
NF-
B in the glass fiber-induced promoter activity. NAC is an
established antioxidant that has been shown to block NF-
B activation
induced by reactive oxygen species (4, 29). SN50 is a small peptide
containing a cell membrane-permeable amino acid sequence and a
translocation signal of the NF-
B p50 subunit (20). This agent can
specifically block translocation of NF-
B from the cytoplasm into the
nucleus. Both NAC and SN50 effectively inhibited NF-
B activation in
macrophages exposed to long fibers (Fig.
5,
A nd
B). Under the same conditions, the
TNF-
gene promoter was also significantly inhibited (Fig.
5C). Taken together, these results
suggest that activation of NF-
B is required for the activation of
the TNF-
gene promoter in macrophages exposed to glass fibers. The
toxicity of both inhibitors was examined with the dose used in this
study, and no significant change in cell viability was observed in all
experiments.
|
Suppression of glass fiber-induced
TNF-
production by NAC and SN50. The
results in Inhibition of NF-
B and
TNF-
gene promoter activities by NAC and
SN50 show that glass fibers activate TNF-
gene
expression at the transcriptional level. Is this a major mechanism of
glass fiber activity? If so, inhibition of this promoter activity
should lead to a similar inhibition of TNF-
secretion. To examine
this hypothesis further, TNF-
production by macrophages was
monitored after addition of NAC or SN50. Figure
6 shows that these inhibitors dramatically
block TNF-
production in response to both short and long glass
fibers. This result supports the conclusion that transcriptional
regulation is a major mechanism of gene expression and protein
production induced by glass fibers.
|
Engulfment of the glass fibers by
macrophages. Interaction between glass fibers and
macrophages is the cause of activation of NF-
B and the TNF-
gene.
It is of interest to explore how macrophages respond morphologically to
a challenge with glass fibers of different lengths. Therefore,
macrophages were observed under light microscopy after exposure to
short or long glass fibers for 16 h. The short and long fibers were
handled differently by the cells. Short fibers (7 µm) were
effectively engulfed by the macrophages (Fig.
7A). In
contrast, long fibers (17 µm) were not completely phagocytized (Fig.
7B). Many long fibers remained
extracellular. A common feature is that both short and long fibers
induced cell fusion and formation of giant cells containing two or more
nuclei in this macrophage cell line. This was observed after cellular staining (data not shown). Such cell fusion was not observed with primary rat alveolar macrophages (7).
|
| |
DISCUSSION |
|---|
|
|
|---|
The present study examines TNF-
production and transcription factor
activation in macrophages after exposure to glass fibers and
investigates the critical role of fiber length. The results indicate
that at subtoxic doses, glass fibers stimulate TNF-
production in a
macrophage cell line (RAW 264.7). These fibers also cause NF-
B
activation. Inhibition of NF-
B by NAC, an antioxidant that inhibits
NF-
B activation induced by reactive oxygen species or SN50, a
specific NF-
B inhibitor, suppressed the promoter function of the
TNF-
gene and decreased TNF-
secretion by macrophages, demonstrating that TNF-
production was regulated by NF-
B.
Inductions of NF-
B, promoter activity, and TNF-
protein do not
have to have the same multiple of change. NF-
B signal
may be amplified in the gene promoter, and the signal may be further
amplified in the process of mRNA and protein synthesis. The
amplification in the posttranscriptional part may not be dependent on
the activation of NF-
B. A signal from NF-
B is required for the
initiation of TNF-
gene transcription induced by glass fibers.
Functions of the NF-
B complexes p50/p50 homodimer and p50/p65
heterodimer are different in the regulation of TNF-
gene promoter
(2). The p50 subunit has no activation domain (3, 27); therefore, the
p50/p50 homodimer inhibits transcription after binding to the TNF-
gene promoter. The p65 subunit has a transactivation domain (27), and
the p50/p65 heterodimer has a much stronger binding affinity to the DNA
than the p50/p50 homodimer (3, 27). This leads to the fact that the
p50/p65 heterodimer is able to overcome the negative activity of the
p50/p50 homodimer and transactivate the gene promoter after it binds to
the DNA (27). This mechanism has been demonstrated in the
transcriptional regulation of many genes, including IL-2 and
interferon-
(38). The p50/p65 heterodimer was induced by the glass
fiber (Fig. 4A) and contributed to
activation of the TNF-
gene promoter (Figs. 3 and 5).
It may be noted that both clinical and experimental
studies (40) indicate that proinflammatory cytokines are
important mediators in asbestos-related lung diseases. Several studies
(8, 15, 25) have also shown that TNF-
plays an important role in the pathogenesis of pulmonary fibrosis. Although it appears that TNF-
plays an important role in the pathogenesis of lung injury induced by
silica and asbestos, there is little information regarding the role of
TNF-
in the toxic action of glass fibers. The present data
demonstrating TNF-
production stimulated by glass fibers suggest
that these fibers may exhibit a degree of pathogenic activity by
mechanisms similar to silica and asbestos.
The results obtained from the present study show that glass fibers are
capable of causing NF-
B activation. Reactive oxygen species may play
a key role in NF-
B activation induced by these fibers as
demonstrated by the inhibitory effect of NAC. With regard to the
generation of reactive oxygen species, it may be noted that the
engulfment of foreign substances by macrophages is associated with
initiation or enhancement of the respiratory burst in the cell. During
the respiratory burst, macrophages and other cellular components
generate large quantities of reactive oxygen species. In many cell
types, reactive oxygen species have been shown to activate the nuclear
translocation of NF-
B by activating reactions, leading to
disassociation of an inhibitor (I
B) from NF-
B in the cytoplasm
(4, 29). NF-
B protein is found in many different cell types and is a
focal point for understanding how extracellular signals induce the
expression of specific sets of early-response genes in higher
eukaryotes, such as those regulating the secretion of growth promoters
(19, 26, 28, 31). It has been suggested that NF-
B activation is
crucial to cytoplasmic and/or nuclear signaling
when cells are exposed to injury-producing conditions (3). NF-
B
serves as a second messenger to induce a series of cellular genes in
response to an environmental perturbation. Among the cellular genes
regulated by NF-
B are those cytokines regulating inflammation,
including TNF-
, IL-6, IL-1, and granulocyte-macrophage colony-stimulating factor (12, 38). NF-
B activates these genes by
binding to the NF-
B consensus sequence in their promoters. Through
activation of NF-
B, glass fibers may cause expression of many genes,
including oncogenes, to initiate inflammation or toxic reactions. Our
preliminary study revealed that DNA binding activity of AP-1 was also
induced by glass fibers. Because the DNA binding activity of AP-1 is
mainly controlled by gene transcription, we expect that
c-jun and
c-fos genes are activated by glass fibers.
An important result obtained from the present study is that long fibers
act differently from short fibers. The following three major findings
should be specially emphasized. First, long fibers are more potent in
the stimulation of TNF-
production in macrophages than short fibers.
Second, long fibers exhibit a higher potency in causing NF-
B
activation than short fibers. Third, macrophage engulfment proceeds
differently for long and short fibers. Short fibers were effectively
engulfed by macrophages, whereas long fibers were not. This is in
agreement with earlier studies (6, 11) that concluded that long fibers
are cleared from the deep regions of the lung less effectively than are
short fibers. This may be the consequence of failure of macrophages to
ingest long fibers completely or their difficulty in moving once they
have engulfed a long fiber. The potential of long fibers in the lung to
initiate repeated attempts of frustrated phagocytosis may be greater
than that of shorter fibers. These frustrated phagocytic events would
be expected to generate a greater concentration of reactive oxygen
species, cause enhanced NF-
B activation, and stimulate greater
production of the inflammatory and fibrogenic cytokine TNF-
. Thus
the results obtained from the present study point out that fiber length
is a critical factor in determining the toxicity of these asbestos
substitutes. It may be noted that, in laboratory studies, fiber mass,
but not fiber length, is frequently used in the design and execution of
experiments. The present study indicates that fiber length should be
taken into consideration in the future study of fiber toxicity and
carcinogenicity, as well as in risk assessment activities.
On the basis of the above discussion, it may be postulated that when
macrophages attempt to engulf glass fibers, reactive oxygen species are
generated because of respiratory burst. Because macrophages cannot
engulf the long glass fibers completely, the frustrated cells will
generate a higher level of reactive oxygen species. These species, in
turn, activate NF-
B. The activated NF-
B binds to the promoter of
the TNF-
gene and turns on the transcription to produce TNF-
protein. The generation of reactive oxygen species, activation of
NF-
B, and production of TNF-
are involved in the mechanism of
toxicity and potential pathogenesis of glass fibers.
In conclusion, 1) glass fibers are
able to stimulate TNF-
production in macrophages.
2) Glass fibers are also capable of causing NF-
B activation. 3)
Reactive oxygen species are involved in NF-
B activation and in
TNF-
production caused by these fibers. 4) Long fibers are more potent than
short fibers for stimulation of TNF-
production and activation of
NF-
B. 5) TNF-
production induced by fibers is regulated by NF-
B.
6) Short fibers (7 µm) were
effectively engulfed by macrophages, whereas long fibers (17 µm) were not.
| |
FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Address for reprint requests: V. Castranova, Pathology and Physiology Research Branch, National Institute for Occupational Safety and Health, 1095 Willowdale Rd., Mail Stop L2015, Morgantown, WV 26505.
Received 2 September 1998; accepted in final form 16 November 1998.
| |
REFERENCES |
|---|
|
|
|---|
1.
Adachi, S.,
K. Takemoto,
and
K. Kimura.
Tumorigenicity of fine man-made fibers after intratracheal administration to hamsters.
Environ. Res.
54:
52-73,
1991[Medline].
2.
Baer, M.,
A. Dillner,
R. C. Schwartz,
C. Sedon,
S. Nedospasov,
and
P. F. Johnson.
Tumor necrosis factor alpha transcription in macrophages is attenuated by an autocrine factor that preferentially induces NF-
B p50.
Mol. Cell. Biol.
18:
5678-5689,
1998
3.
Baeuerle, P. A.
The inducible activator NF-
B: regulation of distinct protein subunits.
Biochim. Biophys. Acta
1072:
63-80,
1991[Medline].
4.
Baeuerle, P. A.,
and
T. Henkel.
Function and activation of NF-
B in the immune system.
Annu. Rev. Immunol.
12:
141-179,
1994[Medline].
5.
Baron, P.,
G. Deye,
and
J. Fernback.
Length separation of fibers.
Aerosol Sci. Technol.
21:
179-192,
1994.
6.
Bellman, B.,
H. Konig,
H. Muhle,
and
F. Pott.
Chemical durability of asbestos and man-made-mineral fibers in vitro.
J. Aerosol. Sci.
17:
341-345,
1986.
7.
Blake, T.,
V. Castranova,
D. Schwegler-Berry,
P. Baron,
G. J. Deye,
C. Li,
and
W. Jones.
Effects of fiber length on glass microfiber cytotoxicity.
J. Toxicol. Environ. Health.
54:
243-259,
1998.
8.
Brown, G. P.,
M. Momick,
and
G. W. Hunninghake.
Fibroblast proliferation induced by silica-exposed human alveolar macrophages.
Am. Rev. Respir. Dis.
138:
85-89,
1988[Medline].
9.
Bun, W. B., III,
J. R. Bender,
T. W. Hesterberg,
G. R. Chase,
and
J. L. Konzen.
Recent studies of man-made vitreous fibers.
J. Occup. Med.
35:
101-113,
1993[Medline].
10.
Castranova, V.,
W. Pailes,
D. Judy,
T. Blake,
D. Schwegler-Berry,
and
W. Jones.
In vitro effects of large and small glass fibers on rat alveolar macrophages.
J. Toxicol. Environ. Health
49:
101-113,
1996.
11.
Coin, P. G.,
V. L. Roggli,
and
A. R. Brody.
Deposition, clearance and translation of chrysotile asbestos from peripheral and central region of rat lung.
Environ. Res.
58:
97-116,
1992[Medline].
12.
Collart, M. A.,
P. Baeuerle,
and
P. Vassali.
Regulation of tumor necrosis factor alpha transcription in macrophages: involvement of four kappa-B-like motifs and of constitutive and inducible factor alpha gene in primary macrophages.
J. Exp. Med.
171:
35-47,
1990
13.
De Vuyst, P.,
P. Dumortier,
G. M. H. Swaen,
J. C. Parion,
and
P. Brochard.
Respiratory health effects of man-made vitreous (mineral) fibers.
Eur. Respir. J.
8:
2149-2173,
1995[Abstract].
14.
Donaldson, K.,
R. C. Brown,
and
G. M. Brown.
Respirable industrial fibers: mechanisms of pathogenicity.
Thorax
48:
390-395,
1993[Medline].
15.
Driscoll, K. E.,
R. C. Linderschmidt,
J. K. Maurer,
J. M. Higgins,
and
G. Ridder.
Pulmonary response to silica or titanium dioxide: inflammatory cells, alveolar macrophage-derived cytokines, and histopathology.
Am. J. Respir. Cell Mol. Biol.
2:
381-390,
1990.
16.
Enterline, P. E.
Carcinogenic effects of man-made vitreous fibers.
Annu. Rev. Public Health
12:
459-480,
1991[Medline].
17.
Hesterberg, T. W.,
W. C. Miller,
E. E. McConnel,
J. Chevalier,
J. G. Hadley,
D. M. Bernstein,
P. Thevenaz,
and
R. Anderson.
Chronic inhalation toxicity of size-separated glass fibers in Fischer 344 rats.
Fundam. Appl. Toxicol.
20:
464-467,
1993[Medline].
18.
Isshiki, H.,
S. Akira,
O. Tanabe,
T. Nakajima,
T. Shimamoto,
and
T. Kishimoto.
Constitutive and interleukin-1 (IL-1)-inducible factors interact with the IL-1-responsive element in the IL-6 gene.
Mol. Cell. Biol.
10:
2757-2764,
1990
19.
Kessler, D. J.,
M. P. Duyao,
D. B. Spicer,
E. Gail,
and
G. E. Sonenshein.
NF-
B-like factors mediated interleukin 1 induction of c-myc gene transcription in fibroblasts.
J. Exp. Med.
176:
787-792,
1992
20.
Lin, Y. Z.,
S. Y. Yao,
R. A. Veach,
T. R. Torgerson,
and
J. Hawiger.
Inhibition of nuclear translocation of transcription factor NF-kappa B by a synthetic peptide containing a cell membrane-permeable motif and nuclear localization sequence.
J. Biol. Chem.
270:
14255-14258,
1995
21.
Lippmann, M.
Man-made mineral fibers (MMMF): human exposures and health assessment.
Toxicol. Ind. Health
6:
225-246,
1990[Medline].
22.
Luoto, K.,
M. Holopainen,
J. Kangas,
P. Kalliokoski,
and
K. Savolainen.
The effect of fiber length on the dissolution by macrophages of rockwool and glasswool fibers.
Environ. Res.
70:
51-61,
1995[Medline].
23.
Mossman, B. T.,
and
L. B. L. Gee.
Asbestos-related diseases.
N. Engl. J. Med.
320:
1712-1730,
1990.
24.
Olenchock, S. A.,
J. C. Mull,
and
W. G. Jones.
Endotoxins in cotton: washing effects and size distribution.
Am. J. Ind. Med.
4:
515-521,
1983[Medline].
25.
Piguet, P. F.,
M. A. Collart,
G. E. Grau,
A. P. Sappino,
and
P. Vassalli.
Requirement of tumor necrosis factor for development of silica-induced pulmonary fibrosis.
Nature
344:
245-247,
1990[Medline].
26.
Schmidt, K. N.,
P. Amstad,
P. Cerutti,
and
P. A. Baeuerle.
The role of hydrogen peroxide and superoxide as messengers in the activation of transcription factor NF-
B.
Chem. Biol.
2:
13-22,
1995[Medline].
27.
Schmitz, M. L.,
and
P. A. Baeuerle.
The p65 subunit is responsible for the strong transcription activating potential of NF-
B.
EMBO J.
10:
3805-3817,
1991[Medline].
28.
Schrect, R.,
B. Meier,
D. M. Mannel,
W. Droge,
and
P. A. Baeuerle.
Dithiocarbamates as potent inhibitors of nuclear factor-
B activation in intact cells.
J. Exp. Med.
175:
1181-1192,
1992
29.
Siebenlist, U.,
G. Franzoso,
and
K. Brown.
Structure, regulation and function of NF-
B.
Annu. Rev. Cell Biol.
10:
405-455,
1994.
30.
Stanton, M. F.,
M. Layard,
A. Tegeris,
E. Miller,
M. May,
E. Morgan,
and
A. Smith.
Relation of particle dimension to carcinogenicity in amphibole asbestos and other fibrous minerals.
J. Natl. Cancer Inst.
6:
965-975,
1981.
31.
Sun, Y.,
and
L. W. Oberly.
Redox regulation of transcriptional activators.
Free Radic. Biol. Med.
21:
335-348,
1996[Medline].
32.
Vallyathan, V.,
J. F. Mega,
X. Shi,
and
N. S. Dalal.
Enhanced generation of free radicals from phagocytes induced by mineral dusts.
Am. J. Respir. Cell Mol. Biol.
6:
404-413,
1992.
33.
Wheeler, C. C.
Exposure to man-made mineral fibers; a summary of current animal data.
Toxicol. Ind. Health
6:
293-307,
1990[Medline].
34.
Wong, O.,
and
R. P. Musselman.
An epidemiological and toxicological evaluation of the carcinogenicity of man-made vitreous fiber, with a consideration of coexposure.
J. Environ. Pathol. Toxicol. Oncol.
13:
169-180,
1994[Medline].
35.
Yao, J.,
N. Mackman,
T. S. Edgington,
and
S. T. Fan.
Lipolysaccharide induction of the tumor necrosis factor-alpha promoter in human monocytic cells. Regulation by Egr-1, c-jun, and NF-
B transcription factors.
J. Biol. Chem.
272:
17795-17801,
1997
36.
Ye, J.,
M. Cippitelli,
L. Dorman,
J. R. Ortaldo,
and
H. A. Young.
The nuclear factor YY1 suppresses the human gamma interferon promoter through two mechanisms: inhibition of AP1 binding and activation of a silencer element.
Mol. Cell. Biol.
16:
4744-4753,
1996[Abstract].
37.
Ye, J.,
P. Ghosh,
M. Cippitelli,
J. Subleski,
K. J. Hardy,
J. R. Ortaldo,
and
H. A. Young.
Characterization of a silencer regulatory element in the human interferon-gamma promoter.
J. Biol. Chem.
269:
25728-25734,
1994
38.
Ye, J.,
and
H. Young.
Negative regulation of cytokine gene transcription.
FASEB J.
11:
825-833,
1997[Abstract].
39.
Ye, J.,
X. Zhang,
and
Z. Dong.
Characterization of the human granulocyte-macrophage colony-stimulating factor gene promoter: an AP1 complex and an Sp1-related complex transactivate the promoter activity that is suppressed by a YY1 complex.
Mol. Cell. Biol.
16:
157-167,
1996[Abstract].
40.
Zhang, Y.,
T. C. Lee,
B. Guillemin,
M. C. Yu,
and
W. N. Rom.
Enhanced IL-1 beta and tumor necrosis factor-alpha release and messenger RNA expression in macrophages from idiopathic pulmonary fibrosis or after asbestos exposure.
J. Immunol.
150:
4188-4196,
1993[Abstract].
This article has been cited by other articles:
![]() |
C. Xie, A. Reusse, J. Dai, K. Zay, J. Harnett, and A. Churg TNF-alpha increases tracheal epithelial asbestos and fiberglass binding via a NF-kappa B-dependent mechanism Am J Physiol Lung Cell Mol Physiol, September 1, 2000; 279(3): L608 - L614. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Ye, P. Zeidler, S.-h. Young, A. Martinez, V. A Robinson, W. Jones, P. Baron, X. Shi, and V. Castranova Activation of Mitogen-activated Protein Kinase p38 and Extracellular Signal-regulated Kinase Is Involved in Glass Fiber-induced Tumor Necrosis Factor-alpha Production in Macrophages J. Biol. Chem., February 9, 2001; 276(7): 5360 - 5367. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Ma and K. Kinneer Chemoprotection by Phenolic Antioxidants. INHIBITION OF TUMOR NECROSIS FACTOR alpha INDUCTION IN MACROPHAGES J. Biol. Chem., January 18, 2002; 277(4): 2477 - 2484. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |