|
|
||||||||
Pediatric Heart Lung Center and Divisions of 1 Neonatology and 2 Pulmonary and Critical Care Medicine, Department of Pediatrics, University of Colorado School of Medicine, Denver, Colorado 80262
| |
ABSTRACT |
|---|
|
|
|---|
Endothelial nitric oxide (NO) synthase (eNOS) produces NO, which contributes to vascular reactivity in the fetal lung. Pulmonary vasoreactivity develops during late gestation in the ovine fetal lung, during the period of rapid capillary and alveolar growth. Although eNOS expression peaks near birth in the fetal rat, lung capillary and distal air space development occur much later than in the fetal lamb. To determine whether lung eNOS expression in the lamb differs from the timing and pattern reported in the rat, we measured eNOS mRNA and protein by Northern and Western blot analyses and NOS activity by the arginine-to-citrulline conversion assay in lung tissue from fetal, newborn, and maternal sheep. Cellular localization of eNOS expression was determined by immunohistochemistry. eNOS mRNA, protein, and activity were detected in samples from all ages, and eNOS was expressed predominantly in the vascular endothelium. Lung eNOS mRNA expression increases from low levels at 70 days gestation to peak at 113 days and remains high for the rest of fetal life. Newborn eNOS mRNA expression does not change from fetal levels but is lower in the adult ewe. Lung eNOS protein expression in the fetus rises and peaks at 118 days gestation but decreases before birth. eNOS protein expression rises in the newborn period but is lower in the adult. Lung NOS activity also peaks at 118 days gestation in the fetus before falling in late gestation and remaining low in the newborn and adult. We conclude that the pattern of lung eNOS expression in the sheep differs from that in the rat and may reflect species-related differences in lung development. We speculate that the rise in fetal lung eNOS may contribute to the marked lung growth and angiogenesis that occurs during the same period of time.
lung development; pulmonary vasculature; angiogenesis; pulmonary vasoreactivity
| |
INTRODUCTION |
|---|
|
|
|---|
THE IMMATURE FETAL pulmonary circulation is characterized by high pulmonary vascular resistance and reduced responsiveness to endothelium-dependent vasodilators (2, 29). At ~120 days gestation (term 147 days), the fetal lamb lung begins to develop the capacity to vasodilate in response to acetylcholine and increased oxygen tension (20, 24). Acetylcholine and oxygen act in part by stimulating the release of NO from endothelial nitric oxide synthase (eNOS) (22), which is one of three NOS isoforms expressed in the fetal lung (33). Whether the onset of endothelium-dependent vasodilator capacity reflects developmental changes in eNOS expression in the fetal lung is unknown. In the fetal and neonatal rat, lung eNOS expression increases during late gestation and peaks at or immediately after birth (25, 36). However, the functional implications of these findings are unclear because there are no parallel data on vasoreactivity in the fetal and newborn rat. The pattern and timing of expression of eNOS in the ovine fetal lung are unknown.
The progressive rise of eNOS with advancing gestational age and the perinatal peak in eNOS expression in the fetal rat lung correlate with the perinatal transition from the saccular to the alveolar stage of lung development (8, 9). Whether increased eNOS expression reflects increased NO activity or is merely a marker for perinatal lung and vascular development is not currently known. However, the onset of alveolarization and lung vascular growth several weeks before term gestation in the lamb (4, 11) suggests that lung eNOS expression may also rise and peak earlier in the sheep than in the rat. In addition, because endothelium-dependent vasodilator capacity develops prior to term, we hypothesized that substantial eNOS is expressed before 120 days gestation in the ovine fetal lung. Understanding the pattern and timing of eNOS expression in the ovine fetal lung is important because much of our understanding of fetal and perinatal pulmonary blood flow is based on extensive physiological studies in this species (1, 3, 20, 24, 31). Similar studies of pulmonary blood flow and vasoreactivity are not technically possible in the fetal rat. Nonetheless, no previous studies have examined the developmental pattern of eNOS expression in the ovine fetal lung.
Based on the accelerated development of the fetal lung in the lamb compared with that in the rat and on the onset of endothelium-dependent pulmonary vasodilation in late gestation, we hypothesized that eNOS expression would peak before birth in the ovine fetal lung. To study this hypothesis, we measured eNOS mRNA, protein, and activity in lung tissue from sheep at multiple fetal ages and compared them with measurements from neonatal and postpartum maternal lungs. In addition, immunohistochemistry (IHC) was performed to localize the site of eNOS expression. We report that the timing of eNOS expression in the ovine fetal lung differs from that in the rat, with eNOS markedly increasing at the same time as the onset of alveolarization and pulmonary vascular development.
| |
METHODS |
|---|
|
|
|---|
Harvesting and processing of tissue samples.
Protocols were reviewed and approved by the Animal Care and Use
Committee of the University of Colorado Health Sciences Center. Lung
tissue was obtained from fetal, neonatal, and adult
Columbia-Rambouillet sheep at several ages. All animals were euthanized
with a rapid overdose of intravenous pentobarbital sodium during
continuous cardiorespiratory monitoring. The lung was exposed through a
midline sternotomy, and whole pieces of peripheral left lung were
removed and frozen rapidly in liquid nitrogen. Tissue was stored at
70°C until processing.
Northern blot analysis. Northern blot analysis was performed according to previously published methods (19, 34) with 20 µg of total RNA per sheep lung and a bovine cDNA probe for eNOS (a kind gift from Dr. William Sessa, Yale University School of Medicine, New Haven, CT). 18S rRNA levels were measured by hybridization with an oligonucleotide probe (ACGGTATCTGATCCGTCTTCGAACC). 32P-labeled mRNA signals were quantitated with a Storm 860 PhosphorImager (Molecular Dynamics). eNOS mRNA levels were normalized to the levels of 18S rRNA (to correct for loading and transfer efficiency).
Western blot analysis. Western blot analysis was performed using 25 µg of lung protein according to a previously published method (19, 34), with a monoclonal antibody to eNOS (Transduction Laboratories, Lexington, KY). Multiple blots were required to analyze the large number of animals studied. To ensure comparable transfer conditions between gels, three standard concentrations of an endothelial cell lysate standard were run on each gel as an internal control. Densitometry was performed with a scanner and National Institutes of Health Image software. eNOS signal from each study sample fell within the linear range of the endothelial cell standard curve, and eNOS signal was normalized to the standard curve on each gel. eNOS density is expressed relative to endothelial cell lysate concentration.
NOS activity assay. NOS activity in lung samples was determined by measuring the conversion of L-[14C]arginine to L-[14C]citrulline using previously described methods (7). Lung samples were homogenized in five volumes of 50 mM HEPES buffer (pH 7.4) containing 1.0 mM EDTA. After homogenization and centrifugation at 12,000 g for 20 min, the soluble fraction was retained for assay. Of the soluble fraction, 20 µl were assayed in 100 µl of a 50 mM HEPES buffer (pH 7.4) solution containing 60 mM L-valine, 1.2 mM L-citrulline, 2.25 µM L-arginine, 1.2 mM MgCl2, 1.0 mM CaCl2, excess cofactors flavin adenine dinucleotide, flavin mononucleotide, NADPH, BH4, and calmodulin, and 0.5 µCi/ml L-[14C]arginine (1.67 µM). Samples were incubated for 30 min at 37°C in triplicate. The reaction was stopped by addition of 50 mM HEPES buffer (4 ml, pH 5.5) with 2 mM EGTA and 5 mM EDTA. L-[14C]citrulline that was generated by this reaction was separated from L-[14C]arginine by elution using a preequilibrated column of Dowex (Sigma 50X8-400, Na+ form) and quantified by liquid scintillation spectroscopy. Background activity was determined by the quantity of L-[14C]citrulline generated in the presence of 1 mM EGTA and the NOS inhibitor NG-monomethyl-L-arginine (2 mM). Ca2+-dependent activity was determined by the difference between samples incubated with and without EGTA (1 mM).
IHC staining for eNOS protein. Small pieces of lung (2-6 mm) were placed in 10% buffered Formalin and embedded in paraffin. Thin tissue sections (5 µm) were serially mounted onto Superfrost Plus slides (Fisher). IHC was performed on adjacent sections of lung tissue for animals of several selected ages (fetal ages 80, 90, 114, 130, 135 days, postnatal ages 1 and 14 days) according to previously published techniques with minor modifications (19). For immunostaining, slides were warmed at 65°C for 5 min and dewaxed in 100% xylene. Sections were rehydrated by immersion in decreasing concentrations of ethanol. Antigen retrieval was performed by boiling the slides in 0.01 M citric acid (pH 6.0) for 15 min. Slides were washed in PBS (in mM: 2.7 KCl, 1.2 KH2PO4, 138 NaCl, and 8.1 Na2HPO4). Endogenous biotin in the tissue sections was blocked by treatment with glucose (0.2 M) and glucose oxidase (1.5 U/ml, Boehringer Mannheim) in PBS. The slides were washed in PBS, and sections were blocked with "Super Block" (SkyTek, Logan, UT) diluted 1:10 (vol/vol) with PBS and then incubated overnight at 4°C with a 1:4,000 dilution of anti-eNOS monoclonal antibody (Transduction Laboratories) or a 1:4,000 dilution of IgG1 negative control (Jackson Laboratories) in PBS with BSA (2%) and NaN3 (0.1%). After incubation, a biotin-labeled anti-mouse secondary antibody (Vector Laboratories, Burlingame, CA) was applied at a dilution of 1:200 in PBS with 2% (wt/vol) BSA (2%) and NaN3 (0.1%) for 40 min at room temperature. The slides were washed in PBS, incubated in streptavidin-biotin-horseradish peroxide solution, and developed with diaminobenzidine and hydrogen peroxide, with NiCl for enhancement (Vector). Slides were developed under light microscopy for 4-6 min, and the NiCl enhanced diaminobenzidine color development reaction was stopped by washing with water. Sections were counterstained with nuclear fast red and dehydrated in increasing concentrations of ethanol and xylene before a coverslip was applied.
Statistical analysis. Groups were compared by ANOVA and Student-Newman-Keuls post hoc testing using the Statmost statistical analysis package (Statmost, Salt Lake City, UT). Reported values are means ± SE. Statistical significance was set at P < 0.05.
| |
RESULTS |
|---|
|
|
|---|
Northern blot analysis.
Northern blot analysis detected a single mRNA transcript for eNOS at
4.4 kb at all ages studied. Results are expressed as a percentage of
70-day fetal group levels (Fig. 1). Lung
eNOS mRNA expression rises ~2.5-fold from 70-day values to
peak in the 113-day group (P < 0.05). Expression remains high throughout the rest of fetal life,
except for a transient fall in the 130-day group. Postnatally, eNOS
mRNA expression does not increase and remains similar to values from
the late-gestation fetus. In comparison with the newborn lamb, lung
eNOS mRNA expression falls by 50% in adult ewes
(P < 0.05).
|
Western blot analysis.
Western blot analysis detected a single protein band for eNOS at 135 kDa at all ages studied. Results are expressed as a percentage of
70-day fetal group levels (Fig. 2). Fetal
eNOS protein expression rises steadily and peaks in the 118-day group
at levels 1.7-fold greater than in the 70-day group
(P < 0.05). Expression falls in late
fetal life to levels similar to those in the 70-day group. Newborn lung
eNOS protein content increases by 29% over fetal levels
(P < 0.05). Levels in the postpartum
maternal group are not changed from the newborn group and remain higher
than the earliest fetal groups.
|
NOS activity assay.
NOS activity measured by conversion of
L-[14C]arginine
to
L-[14C]citrulline
was detected at all ages studied and is expressed as a percentage of
70-day fetal group levels (Fig. 3).
Ca2+-independent activity,
measured in the presence of EGTA, was not detectable in any age group
tested. Fetal lung NOS activity rises gradually and peaks at 118 days
(P < 0.05). Fetal lung NOS activity falls progressively thereafter until 135 days. Postnatally, NOS activity remains unchanged from late fetal life. Activity in postpartum ewes is similar to late-gestation fetal ages.
|
IHC staining for eNOS protein.
eNOS protein was localized to the vascular endothelium in lung tissue
at each of the fetal and neonatal ages studied. Control immunostaining with IgG demonstrated a lack of nonspecific staining at
each age. IHC with eNOS for fetal (90 and 130 days gestation) and 1-day
newborn lungs are shown (Fig. 4). IgG
control staining is shown for 90-day fetal lung. The 90-day fetal lung
demonstrates less mature lung parenchyma compared with the 130-day
fetal and neonatal lungs, but immature vascular and bronchial
structures are present. The vascular endothelium of large and small
arteries and capillaries demonstrates intense staining for eNOS (Fig.
4, A-B). The 130-day fetal lung
demonstrates increased alveolarization and thinning of the vascular
endothelium. Staining for eNOS also localizes exclusively to the
vascular endothelium (Fig. 4C). The 1-day neonatal lamb lung is similar to that in the 130-day fetus, with
specific eNOS staining localized to the vascular endothelium (Fig.
4D).
|
| |
DISCUSSION |
|---|
|
|
|---|
We used Northern and Western blot analysis and the arginine-to-citrulline conversion assay to study developmental changes in eNOS expression in the lungs of mid- and late-gestation fetal and neonatal lambs. We found that lung eNOS expression rises rapidly at ~75-80% of term in the fetus, with a peak in mRNA expression immediately preceding peaks in protein and activity. eNOS mRNA remains high in late fetal life, but both protein and activity decrease before birth. Postnatally, eNOS protein increases slightly, although parallel increases in mRNA and activity are not evident. Although eNOS mRNA expression falls in the adult compared with the newborn, adult eNOS protein and activity do not change. IHC revealed localization of eNOS protein expression exclusively to the vascular endothelium in all ages tested.
These findings are of interest because they suggest that eNOS expression peaks in the fetal lamb lung considerably earlier in gestation than in the fetal rat. Previous studies of maturational changes in eNOS expression in fetal and neonatal rats suggest that lung eNOS increases during late gestation and peaks near term (18, 25). North et al. (25) reported that eNOS mRNA expression progressively increases and peaks before term in the fetal rat and that postnatal expression decreases. Kawai et al. (18) reported that fetal rat lung eNOS protein and mRNA levels rise in late gestation but peak postnatally within 24 h of birth, before falling in the adult. Differences in the timing of lung parenchymal and vascular development between rats and sheep may account for the differences in timing of eNOS expression. The transition to the alveolar phase of lung development, with the onset of rapid alveolar and vascular growth, occurs several weeks before birth in the lamb, at 112-120 days gestation (11). In contrast, the analogous transition from the saccular to the alveolar period takes place postnatally in the rat, starting at 3-4 days (8, 9). Therefore, if eNOS reflects or contributes to developmental changes in lung vascular development, the timing of lung eNOS expression may be more closely linked to the stage of lung development than to the gestational age of the fetus. As such, extrapolation of the pattern and timing of fetal lung eNOS expression from the rat to the lamb may be misleading. Understanding the particular pattern of eNOS expression in the ovine fetal lung is especially important because much of our understanding of the fetal and transitional circulation is based on previous studies in the lamb (1, 20, 24). Similar physiological studies in the rat are not possible because of technical limitations imposed by the size of the fetus and newborn.
Our study is the first to comprehensively examine the pattern of eNOS expression in the fetal and neonatal lamb model. The increase in eNOS expression that we observed at 113-118 days is consistent with several studies suggesting that endothelium-dependent or NO-mediated vasodilation begins to develop at approximately the same time. Morin et al. (24) suggested that pulmonary vasodilator responsiveness to ACh has begun to develop by 115-120 days gestation, with animals at those ages demonstrating intermediate vasodilator responses compared with lambs at 94-101 days (no response) and 132-146 days (marked vasodilation). Similarly, Lewis et al. (20) reported that the pulmonary vasodilator response to increased oxygen tension, which is in part mediated by NO release, develops at ~120 days gestation in the fetal lamb (20). Consistent with these in vivo findings, Shaul et al. (31) found that isolated fetal pulmonary artery segments from 110- to 115-day fetal lambs increase cGMP production by approximately twofold in response to ACh, suggesting that eNOS activity has started to develop by this age (31).
However, these and additional physiological studies indicate that the response to endothelium-dependent vasodilators continues to increase during late fetal and early neonatal life (1, 3, 20, 24, 27, 31). Our data suggest that these further changes in responsiveness occur independent of changes in eNOS expression. Mechanisms which might account for the continued increase in vasodilator capacity in late fetal and early neonatal life include developmental changes in expression of other vasoactive mediators, such as prostacyclin (30) and endothelin (16), or changes in expression of other NOS isoforms (28). In addition, alterations at other levels of the NO-cGMP cascade, including changes in eNOS cellular localization (32), developmental changes in phosphodiesterase activity (14), differences in NOS substrate and cofactor availability (22), and developmental changes in vascular smooth muscle cell responsiveness might increase the vasodilator effects of NO independent of changes in eNOS expression.
The association between the increase in lung eNOS expression and the onset of alveolarization in the fetal lamb may be particularly important. The temporal relationship between development of the airway and the pulmonary vasculature is firmly established (10, 15). In particular, there is abundant growth of intra-acinar capillaries with the development of alveoli (10). Recent work suggests that vascular endothelial growth factor (VEGF) may act as a paracrine mediator in the process of angiogenesis of endothelial cells in the developing lung (21). VEGF and its receptor, Flk-1, are expressed in fetal lungs during periods of abundant vascular growth (17, 21). Recent work from several studies suggests that NO release is critical to the proliferative effects of VEGF (23, 26, 37) and to the differentiation of developing pulmonary artery endothelial cells (5). Our findings that eNOS expression rises rapidly in the fetal lamb lung during the period of the most abundant lung growth and alveolarization supports the possibility that NO may play a critical role in fetal lung development, but extensive further studies are necessary to establish such a role.
The site of expression of eNOS in the lung has been a subject of considerable investigation over the last several years. In both the present study and in a previous report (13), we performed IHC for eNOS on lung sections from fetal and neonatal lambs of multiple ages. We detected intense staining of the vascular endothelium of vessels from every age tested and ranging in size from large arteries and veins to small alveolar capillaries. We did not detect staining of the bronchial epithelium at any level regardless of the fetal age tested. Similarly, Black et al. (6) recently reported that lung eNOS expression by in situ hybridization is confined to the vascular endothelium in fetal and newborn lambs. However, Sherman et al. (33) detected eNOS expression by IHC and RT-PCR in proximal but not in distal airway epithelium in fetal lambs. Studies by Xue et al. (36) of eNOS expression in the rat lung demonstrate that eNOS is not expressed in the airway epithelium of the fetus at any age tested in that species. However, Xue et al. (35) report the development of eNOS protein expression by IHC in lung epithelium of the neonatal rat within 2 h of birth. In our IHC studies of neonatal lambs, we did not detect eNOS in the airway epithelium at any age. Although detection of airway epithelial eNOS by other investigators indicates the possibility of additional sites of expression, our IHC staining studies suggest that the pattern of whole lung eNOS expression that we report results primarily from changes in vascular endothelial eNOS expression.
We conclude that eNOS expression rises early in the last third of gestation and peaks well before birth in the fetal lamb lung and that the vascular endothelium is the predominant site of eNOS expression. We speculate that the physiological increase in responsiveness to pulmonary vasodilators with increasing gestation in the fetal lamb does not result from increasing eNOS expression. We further speculate that the difference in the pattern of expression of eNOS in the lung of fetal lambs from that in fetal rats reflects differences in the timing of lung development and pulmonary angiogenesis between the two species.
| |
ACKNOWLEDGEMENTS |
|---|
This work was supported in part by a Professional Development Award from The Children's Hospital Research Institute (to T. A. Parker); National Heart, Lung, and Blood Institute Grants HL-41012 and HL-46481; and an Established Investigator Award from the American Heart Association (to S. H. Abman).
| |
FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Address for reprint requests and other correspondence: T. A. Parker, Div. of Neonatology, Box 070, Children's Hospital, 1056 E. Nineteenth Ave., Denver, CO 80218 (E-mail: parker.thomas{at}tchden.org).
Received 17 May 1999; accepted in final form 18 August 1999.
| |
REFERENCES |
|---|
|
|
|---|
1.
Abman, S. H.,
B. A. Chatfield,
S. A. Hall,
and
I. F. McMurtry.
Role of endothelium-derived relaxing factor activity during transition of pulmonary circulation at birth.
Am. J. Physiol. Heart Circ. Physiol.
259:
H1921-H1927,
1990
2.
Abman, S. H.,
B. A. Chatfield,
D. M. Rodman,
S. L. Hall,
and
I. F. McMurtry.
Maturational changes in endothelium-derived relaxing factor of the ovine pulmonary arteries in vitro.
Am. J. Physiol. Lung Cell. Mol. Physiol.
260:
L280-L285,
1991
3.
Accurso, F. J.,
B. Alpert,
R. B. Wilkening,
R. G. Petersen,
and
G. Meschia.
Time-dependent response of fetal pulmonary blood flow to an increase in fetal oxygen tension.
Respir. Physiol.
63:
43-52,
1986[Web of Science][Medline].
4.
Alcorn, D. G.,
T. M. Adamson,
J. E. Maloney,
and
P. M. Robinson.
A morphologic and morphometric analysis of fetal lung development in the sheep.
Anat. Rec.
201:
655-667,
1981[Medline].
5.
Babaei, B.,
K. Teichert-Kuliszewska,
J.-C. Monge,
F. Mohamed,
M. P. Bendeck,
and
D. J. Stewart.
Role of nitric oxide in the angiogenic response in vitro to basic fibroblast growth factor.
Circ. Res.
82:
1007-1015,
1998
6.
Black, S. M.,
M. J. Johengen,
Z. D. Ma,
J. Bristow,
and
S. J. Soifer.
Ventilation and oxygenation induce endothelial nitric oxide synthase gene expression in the lungs of fetal lambs.
J. Clin. Invest.
100:
1448-1458,
1997[Web of Science][Medline].
7.
Bredt, D. S.,
and
H. H. H. W. Schmidt.
Methods in Nitric Oxide Research. New York: Wiley, 1996, p. 249-255.
8.
Burri, P. H.
The postnatal growth of the rat lung. 3. Morphology.
Anat. Rec.
180:
77-98,
1974[Medline].
9.
Burri, P. H.,
J. Dbaly,
and
E. R. Weibel.
The postnatal growth of the rat lung. 1. Morphometry.
Anat. Rec.
178:
711-730,
1974[Medline].
10.
DeMello, D. E.,
and
L. M. Reid.
Arteries and veins.
In: The Lung: Scientific Foundations (2nd ed.), edited by R. G. Crystal,
J. B. West,
E. R. Weibel,
and P. J. Barnes. Philadelphia, PA: Lippincott-Raven, 1997.
11.
Docimo, S. G.,
R. K. Crone,
P. Davies,
L. Reid,
A. B. Retik,
and
J. Mandell.
Pulmonary development in the fetal lamb: morphometric study of the alveolar phase.
Anat. Rec.
229:
495-498,
1991[Medline].
12.
Halbower, A. C.,
R. J. Mason,
S. H. Abman,
and
R. M. Tuder.
Agarose infiltration improves morphology of cryostat sections of lung.
Lab. Invest.
71:
149-153,
1994[Web of Science][Medline].
13.
Halbower, A. C.,
R. M. Tuder,
W. A. Franklin,
J. S. Pollock,
U. Förstermann,
and
S. H. Abman.
Maturation-related changes in endothelial nitric oxide synthase immunolocalization in developing ovine lung.
Am. J. Physiol. Lung Cell. Mol. Physiol.
267:
L585-L591,
1994
14.
Hanson, K. A.,
F. Burns,
S. D. Rybalkin,
J. W. Miller,
J. Beavo,
and
W. R. Clarke.
Developmental changes in lung cGMP phosphodiesterase-5 activity, protein, and message.
Am. J. Respir. Crit. Care Med.
158:
278-288,
1998.
15.
Hislop, A.,
and
L. Reid.
Intrapulmonary arterial development in fetal life-branching pattern and structure.
J. Anat.
113:
35-48,
1972[Web of Science][Medline].
16.
Ivy, D. D.,
J. P. Kinsella,
and
S. H. Abman.
Endothelin blockade augments pulmonary vasodilation in the ovine fetus.
J. Appl. Physiol.
81:
2481-2487,
1996
17.
Kaipainen, A.,
J. Korhonen,
K. Pajusola,
O. Aprelikova,
M. G. Persico,
B. I. I. Terman,
and
K. Alitalo.
The related FLT4, FLT1, and KDR receptor tyrosine kinases show distinct expression patterns in human fetal endothelial cells.
J. Exp. Med.
178:
2077-2088,
1993
18.
Kawai, N.,
D. B. Bloch,
G. Filippov,
D. Rabkina,
H. C. Suen,
P. D. Losty,
S. P. Janssens,
W. M. Zapol,
S. de la Monte,
and
K. D. Bloch.
Constitutive endothelial nitric oxide synthase gene expression is regulated during lung development.
Am. J. Physiol. Lung Cell. Mol. Physiol.
268:
L589-L595,
1995
19.
Le Cras, T. D.,
R. C. Tyler,
M. P. Horan,
K. G. Morris,
R. M. Tuder,
I. F. McMurtry,
R. A. Johns,
and
S. H. Abman.
Effects of chronic hypoxia and altered hemodynamics on endothelial nitric oxide synthase expression in the adult rat lung.
J. Clin. Invest.
101:
795-801,
1998[Web of Science][Medline].
20.
Lewis, A. B.,
M. A. Heymann,
and
A. M. Rudolph.
Gestational changes in pulmonary vascular responses in fetal lambs in utero.
Circ. Res.
39:
536-541,
1976
21.
Millauer, B.,
S. Wizigmann-Voos,
H. Schnürch,
R. Martinez,
N. P. H. Moller,
W. Risau,
and
A. Ullrich.
High affinity VEGF binding and developmental expression suggest FLK-1 as a major regulator of vasculogenesis and angiogenesis.
Cell
72:
835-846,
1993[Web of Science][Medline].
22.
Moncada, S.,
R. M. J. Palmer,
and
E. A. Higgs.
Nitric oxide: physiology, pathophysiology, and pharmacology.
Pharmacol. Rev.
43:
109-142,
1991[Web of Science][Medline].
23.
Morbidelli, L.,
C.-H. Chang,
J. G. Douglas,
H. J. Granger,
F. Ledda,
and
M. Ziche.
Nitric oxide mediates mitogenic effect of VEGF on coronary venular endothelium.
Am. J. Physiol. Heart Circ. Physiol.
270:
H411-H415,
1996
24.
Morin, F. C., III,
E. A. Egan,
W. Ferguson,
and
C. E. G. Lundgren.
Development of pulmonary vascular response to oxygen.
Am. J. Physiol. Heart Circ. Physiol.
254:
H542-H546,
1988
25.
North, A. J.,
R. A. Star,
T. S. Brannon,
K. Ujiie,
L. B. Wells,
C. J. Lowenstein,
S. H. Snyder,
and
P. W. Shaul.
Nitric oxide synthase type I and type III gene expression are developmentally regulated in rat lung.
Am. J. Physiol. Lung Cell. Mol. Physiol.
266:
L635-L641,
1994
26.
Papapetropoulos, A.,
G. Garcia-Cardeña,
J. A. Madri,
and
W. C. Sessa.
Nitric oxide production contributes to the angiogenic properties of vascular endothelial growth factor in human endothelial cells.
J. Clin. Invest.
100:
3131-3139,
1997[Web of Science][Medline].
27.
Perreault, T.,
and
J. de Marte.
Maturational changes in endothelium-derived relaxations in newborn piglet pulmonary circulation.
Am. J. Physiol. Heart Circ. Physiol.
264:
H302-H309,
1993
28.
Rairigh, R. L.,
T. D. Le Cras,
D. D. Ivy,
J. P. Kinsella,
G. Richter,
M. Horan,
I. D. Fan,
and
S. H. Abman.
Role of inducible nitric oxide synthase in the regulation of pulmonary vascular tone in the late gestation ovine fetus.
J. Clin. Invest.
101:
15-21,
1998[Web of Science][Medline].
29.
Rudolph, A. M.,
and
M. A. Heymann.
Circulatory changes during growth in the fetal lamb.
Circ. Res.
26:
289-299,
1970
30.
Shaul, P. W.,
M. A. Farrar,
and
R. R. Magness.
Oxygen modulation of pulmonary arterial prostacyclin synthesis is developmentally regulated.
Am. J. Physiol. Heart Circ. Physiol.
265:
H621-H628,
1993
31.
Shaul, P. W.,
M. A. Farrar,
and
R. R. Magness.
Pulmonary endothelial nitric oxide production is developmentally regulated in the fetus and newborn.
Am. J. Physiol. Heart Circ. Physiol.
265:
H1056-H1063,
1993
32.
Shaul, P. W.,
E. J. Smart,
L. J. Robinson,
Z. German,
I. S. Yuhanna,
Y. Ying,
R. G. Anderson,
and
T. Michel.
Acylation targets endothelial nitric-oxide synthase to plasmalemmal caveolae.
J. Biol. Chem.
271:
6518-6522,
1996
33.
Sherman, T. S.,
Z. Chen,
I. S. Yuhanna,
K. S. Lau,
L. R. Margraf,
and
P. W. Shaul.
Nitric oxide synthase isoform expression in the developing lung epithelium.
Am. J. Physiol. Lung Cell. Mol. Physiol.
276:
L383-L390,
1999
34.
Villamor, E.,
T. D. Le Cras,
M. P. Horan,
A. C. Halbower,
R. M. Tuder,
and
S. H. Abman.
Chronic intrauterine pulmonary hypertension impairs endothelial nitric oxide synthase in the ovine fetus.
Am. J. Physiol. Lung Cell. Mol. Physiol.
272:
L1013-L1020,
1997
35.
Xue, C.,
S. J. Botkin,
and
R. A. Johns.
Localization of endothelial NOS at the basal microtubule membrane in ciliated epithelium of rat lung.
J. Histochem. Cytochem.
44:
463-471,
1996[Abstract].
36.
Xue, C.,
P. R. Reynolds,
and
R. A. Johns.
Developmental expression of NOS isoforms in fetal rat lung: implications for transitional circulation and pulmonary angiogenesis.
Am. J. Physiol. Lung Cell. Mol. Physiol.
270:
L88-L100,
1996
37.
Ziche, M.,
L. Morbidelli,
R. Choudhuri,
H.-T. Zhang,
S. Donnini,
H. J. Granger,
and
R. Bicknell.
Nitric oxide synthase lies downstream from vascular endothelial growth factor-induced but not basic fibroblast growth factor-induced angiogenesis.
J. Clin. Invest.
99:
2625-2634,
1997[Web of Science][Medline].
This article has been cited by other articles:
![]() |
J. L. Aschner, H. Zeng, M. R. Kaplowitz, Y. Zhang, J. C. Slaughter, and C. D. Fike Heat shock protein 90-eNOS interactions mature with postnatal age in the pulmonary circulation of the piglet Am J Physiol Lung Cell Mol Physiol, March 1, 2009; 296(3): L555 - L564. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Coggins and K. D. Bloch Nitric Oxide in the Pulmonary Vasculature Arterioscler Thromb Vasc Biol, September 1, 2007; 27(9): 1877 - 1885. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Aschner, S. L. Foster, M. Kaplowitz, Y. Zhang, H. Zeng, and C. D. Fike Heat shock protein 90 modulates endothelial nitric oxide synthase activity and vascular reactivity in the newborn piglet pulmonary circulation Am J Physiol Lung Cell Mol Physiol, June 1, 2007; 292(6): L1515 - L1525. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Munson, P. H. Grubb, J. D. Kerecman, D. C. McCurnin, B. A. Yoder, S. L. Hazen, P. W. Shaul, and H. Ischiropoulos Pulmonary and Systemic Nitric Oxide Metabolites in a Baboon Model of Neonatal Chronic Lung Disease Am. J. Respir. Cell Mol. Biol., December 1, 2005; 33(6): 582 - 588. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Bauer, R. J. Bauer, and O. C. Velazquez Angiogenesis, Vasculogenesis, and Induction of Healing in Chronic Wounds Vascular and Endovascular Surgery, July 1, 2005; 39(4): 293 - 306. [Abstract] [PDF] |
||||
![]() |
C. D. Fike, J. L. Aschner, Y. Zhang, and M. R. Kaplowitz Impaired NO signaling in small pulmonary arteries of chronically hypoxic newborn piglets Am J Physiol Lung Cell Mol Physiol, June 1, 2004; 286(6): L1244 - L1254. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Wedgwood, C. J. Mitchell, J. R. Fineman, and S. M. Black Developmental differences in the shear stress-induced expression of endothelial NO synthase: changing role of AP-1 Am J Physiol Lung Cell Mol Physiol, April 1, 2003; 284(4): L650 - L662. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Turley, L. D. Nelin, M. R. Kaplowitz, Y. Zhang, and C. D. Fike Exhaled NO is reduced at an early stage of hypoxia-induced pulmonary hypertension in newborn piglets Am J Physiol Lung Cell Mol Physiol, March 1, 2003; 284(3): L489 - L500. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. W. Shaul, S. Afshar, L. L. Gibson, T. S. Sherman, J. D. Kerecman, P. H. Grubb, B. A. Yoder, and D. C. McCurnin Developmental changes in nitric oxide synthase isoform expression and nitric oxide production in fetal baboon lung Am J Physiol Lung Cell Mol Physiol, December 1, 2002; 283(6): L1192 - L1199. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. N. MacRitchie, K. H. Albertine, J. Sun, P. S. Lei, S. C. Jensen, A. A. Freestone, P. M. Clair, M. J. Dahl, E. A. Godfrey, D. P. Carlton, et al. Reduced endothelial nitric oxide synthase in lungs of chronically ventilated preterm lambs Am J Physiol Lung Cell Mol Physiol, October 1, 2001; 281(4): L1011 - L1020. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Feletou, M. Lonchampt, F. Coge, J.-P. Galizzi, C. Bassoullet, C. Merial, P. Robineau, J. A. Boutin, P. L. Huang, P. M. Vanhoutte, et al. Regulation of murine airway responsiveness by endothelial nitric oxide synthase Am J Physiol Lung Cell Mol Physiol, July 1, 2001; 281(1): L258 - L267. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Mhanna, T. Ferkol, R. J. Martin, I. A. Dreshaj, A. M. van Heeckeren, T. J. Kelley, and M. A. Haxhiu Nitric Oxide Deficiency Contributes to Impairment of Airway Relaxation in Cystic Fibrosis Mice Am. J. Respir. Cell Mol. Biol., May 1, 2001; 24(5): 621 - 626. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |