Vol. 278, Issue 6, L1118-L1128, June 2000
Characterization of mucins from cultured normal human
tracheobronchial epithelial cells
David J.
Thornton1,
Thomas
Gray2,
Paul
Nettesheim2,
Marj
Howard1,
Ja Seok
Koo2, and
John K.
Sheehan1
1 The Wellcome Trust Centre for Cell-Matrix
Research, Division of Biochemistry, School of Biological Sciences,
University of Manchester, Manchester M13 9PT, United Kingdom; and
2 Laboratory of Pulmonary Pathobiology, National
Institute of Environmental Health Sciences, Research Triangle Park,
North Carolina 27709
 |
ABSTRACT |
Early-passage normal human
tracheobronchial epithelial (NHTBE) cells grown in air-liquid interface
cultures in medium containing retinoids differentiate into a
mucociliary epithelium over a 2- to 3-wk period and express increasing
mRNA levels of the airway mucin genes MUC5AC and MUC5B
as the cultures age; the levels of MUC2 mRNA were very low
throughout the study. Using specific antibodies to MUC5AC and MUC5B
mucins, we noted a gradual increase in these two mucins in the
intracellular and apically secreted pools as a function of time. A low
level of MUC2 mucin was detected, which did not change with time. The
intracellular and apically secreted mucins isolated from day 14 and day 21 cultures by density gradient centrifugation were
similar in density to those previously isolated from human respiratory
mucus secretions. The sedimentation rate of the apically secreted
mucins indicated that they were highly oligomerized, polydisperse
macromolecules similar to those previously documented from in vivo
secretions. In contrast, the cell-associated mucins from the cultured
NHTBE cells were much smaller, possibly only monomers and dimers.
Anion-exchange chromatography detected no differences in charge density
between the reduced and carboxymethylated cell-associated and secreted
forms of the MUC5AC and MUC5B mucins. The MUC5AC mucin was of similar
charge density to its in vivo counterpart; however, MUC5B was more
homogeneous than that found in vivo. Finally, evidence is presented for
an intracellular NH2-terminal cleavage of the MUC5B mucins.
These studies indicate that the mucins produced by cultured NHTBE cells
are similar to those found in human airways, suggesting that this cell
culture model is suited for studies of respiratory mucin biosynthesis,
processing, and assembly.
MUC2; mucin oligomerization; amino-terminal cleavage of MUC5B
| |
INTRODUCTION |
MUCUS IS ESSENTIAL IN PROTECTING internal body surfaces
from injury. Respiratory tract mucus has the added function of trapping inhaled particles, which can then be moved out of the airways by the
beating action of the cilia. However, overproduction of mucus, which
occurs in diseases of the respiratory tract involving inflammation such
as chronic bronchitis, asthma, and cystic fibrosis, causes airway
narrowing or obstruction, thus impeding airflow. The rheological
properties of mucus are dictated by the large gel-forming mucins (26).
To understand how mucin synthesis and secretion are regulated under
physiological and pathological conditions and how they can be
controlled pharmacologically is therefore an important goal in
pulmonary medicine.
To date, nine mucin genes have been identified and (at least partially)
cloned and sequenced. Of these, eight mRNAs (MUC1, -2, -3, -4, -5AC, -5B, -7,
and -8) are expressed in human airways (see Ref. 25 for a
review), but it is not clear whether all of these messages are being
translated and whether the products are secreted. Three mucins,
MUC2, MUC5AC, and MUC5B, have been reported to be expressed by airway epithelium; however, only MUC5AC and
MUC5B have been convincingly demonstrated to be major components of
human airway secretions (17, 18, 21, 27, 29, 34, 39). The former
appears to be produced by the goblet cells in the tracheobronchial
surface epithelium, whereas the latter is secreted primarily by the
submucosal glands. However, it has been recently demonstrated that
MUC5B mucins are also synthesized in goblet cells (39).
It is difficult to study the production of human airway mucins in vivo,
and, therefore, we have developed a system to culture early-passage
normal human tracheobronchial epithelial (NHTBE) cells under conditions
that support growth and differentiation into a mucociliary epithelium.
Mucociliary differentiation, which is dependent on the presence of
retinol or retinoic acid in the culture medium, was shown to occur over
a period of 2-3 wk (2, 12, 14, 20, 40). The cells, which are
cultured on a porous membrane at the interface between medium and air,
form a confluent polarized epithelial cell sheet between day 10 and day 14 and progressively differentiate into a mucociliary
phenotype, secreting mucin onto the apical surface (11, 12). These
apical secretions can be readily collected and analyzed qualitatively
and quantitatively (12). This cell culture system is well suited for
detailed studies on the biosynthesis of human airway secretions and the
factors and mechanisms that regulate them (28).
The purposes of the studies presented here were to determine whether
the gel-forming mucins expressed in human airways, namely MUC2, MUC5AC,
and MUC5B, are present in the cell layer and apical secretions of these
cultures and to determine the physicochemical properties compared with
those of their counterparts from human airway secretions produced in vivo.
| |
EXPERIMENTAL PROCEDURES |
Air-liquid interface cell culture, collection of mucins, and
histology.
Passage 2 NHTBE cells were seeded at 105 cells onto
uncoated, 25-mm, semipermeable membranes (Transwell Clear, Costar).
The day of seeding was considered to be time 0 of the
experiment. The cells were cultured in serum-free, hormone-supplemented
medium containing retinoic acid (5 × 10
8 M) as
previously described (12). The cultures were maintained at 37°C in
5% CO2 in air. At indicated times, apical mucin secreted during a 24-h period was collected by washing the surfaces of the
cultures with PBS (termed apical washings; 20 ml for 30 cultures). The
wash was then diluted 1:1 with 8 M guanidinium hydrochloride (GuHCl),
and the cell layer was solubilized in 6 M GuHCl (15 ml for 30 cultures).
Histological specimens were prepared from intact day 21 cultures that were fixed in 10% neutral-buffered Formalin, embedded in
paraffin, sectioned, and stained with hematoxylin and eosin. A complete
description of the methods used for transmission electron microscopy
has been previously reported (12). Briefly, the cultures were fixed in
3% glutaraldehyde in 0.1 M cacodylate buffer, postfixed in 0.1%
osmium tetroxide, and stained with uranyl acetate. Samples were
dehydrated, embedded in epoxy resin, cut, and viewed.
Competitive RT-PCR.
Methods to detect and quantitate MUC2, MUC5AC, and
MUC5B mRNAs have been previously reported in detail (14, 20).
Briefly, from a separate set of triplicate cultures run concurrently
with those used for mucin collection, total RNA was isolated with TRI Reagent (Molecular Research Center, Cincinnati, OH) and reverse transcribed into cDNA with RNA PCR kits and protocols (Perkin-Elmer, Morrisville, NC). Oligonucleotide primers were designed according to
the published sequences for human MUC2 (13; GenBank accession no. L21998; 5'-primer, TGCCTGGCCCTGTCTTTG; 3'-primer,
CAGCTCCAGCATGAGTGC), human MUC5AC (21; GenBank accession no.
U06711; 5'-primer, TCCGGCCTCATCTTCTCC; 3'-primer,
ACTTGGGCACTGGTGCTG), and human MUC5B (8; GenBank accession no.
Y09788; 5'-primer, TGCAATCAGCACTGTGACATTGAC; 3'- primer,
TTCTCCAGGGTCCAGGTCTCATTC). PCRs were performed in the presence of
internal standards, so-called MIMICs (101
amol/reaction for MUC5AC and MUC5B and
104 amol/reaction for MUC2; Clontech PCR
MIMIC construction kit, Palo Alto, CA). PCR conditions were similar for
all three mucin genes except that both MUC5AC and MUC5B
went through 27 cycles of amplification, whereas MUC2 required
35 amplification cycles. Conditions were 1.5 mM MgCl2,
denaturation at 95°C for 1 min, annealing at 60°C for 1 min,
and extension at 72°C for 1 min. MUC2 oligonucleotides
generated, as predicted, a 438-bp cDNA product and a 360-bp MIMIC
product; MUC5AC oligonucleotides generated a 146-bp cDNA
fragment and a 340-bp MIMIC fragment, whereas oligonucleotides for
MUC5B generated a 348-bp cDNA fragment and a 486-bp MIMIC fragment. Oligonucleotides for 
2-microglobulin, which
was used as a control gene for the RT-PCR, were purchased (Clontech)
and generated a 335-bp PCR fragment. Specific amplification for
MUC2, MUC5AC, and MUC5B was confirmed by
sequencing (double-stranded DNA cycle-sequencing system; GIBCO BRL,
Life Technologies, Gaithersburg, MD) the PCR fragments. The
amplification efficiency for MUC2, MUC5AC, and
MUC5B cDNA and MIMICs (14, 19) was verified by determining the
amounts of cDNA and MIMIC produced after various numbers of PCR cycles,
and quantification of the assays was determined by titrating MIMIC
against a constant amount of cDNA.
To determine the levels of MUC2, MUC5AC, and
MUC5B mRNAs, PCRs were performed in the presence of known
amounts of MIMIC. PCR products were separated on 2% agarose gels
(containing 50 ng/ml of ethidium bromide), and the resulting bands were
analyzed with a digital imaging system (Alpha Innotech, San Eleandro,
CA). The ratio of the signal intensity of the target cDNA to that of
the MIMIC was determined.
Preparation of mucins.
Mucins were purified essentially as previously described (6). In brief,
the NHTBE cell layer extracts and apical washings were centrifuged at a
starting density of 1.40 g/ml in 4 M GuHCl-CsCl with a Beckman Ti70.1
rotor at 40,000 rpm for 68 h at 15°C. In addition, the
mucin-containing fractions from the 4 M GuHCl-CsCl gradient of the cell
layer extract were subjected to further purification in a 0.2 M
GuHCl-CsCl density gradient. Centrifugation was performed at a starting
density of 1.5 g/ml under the conditions described above. After each
centrifugation, the tubes were emptied from the top. The density of
each fraction was determined with a Hamilton syringe as a pycnometer.
Preparation of reduced and carboxymethylated mucin subunits.
Reduced and carboxymethylated mucin subunits were obtained by treatment
of the purified mucins in 6 M guanidinium chloride-0.1 M Tris, pH 8.0 (reduction buffer), with 10 mM dithiothreitol (DTT) for 5 h at
37°C. Iodoacetamide was then added to a final concentration of 25 mM, and the mixture was left in the dark overnight at room temperature
(5). Alternatively, the mucins were reduced and carboxymethylated on
nitrocellulose membranes after slot or Western blotting. Briefly, the
blotted membrane was washed in distilled water for a few minutes and
incubated in reduction buffer containing 10 mM DTT at room temperature
for 15 min. After the DTT solution was removed, the membrane was
incubated in the same buffer containing 25 mM iodoacetamide at room
temperature for 10 min and then washed twice (5 min) with distilled
water (1).
Anion-exchange chromatography.
Reduced and carboxymethylated mucins were chromatographed on a
Pharmacia Mono Q HR 5/5 column eluted with a linear gradient of
0-0.4 M lithium perchlorate-10 mM piperazine, pH 5.0, in 6 M urea
containing 0.02%
3-[(cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS) (29).
Agarose gel electrophoresis.
Agarose gel electrophoresis was performed as previously described (1,
33). After electrophoresis, the molecules were Western blotted onto
nitrocellulose membranes before detection of mucins with antibodies.
For analysis of the intact unreduced molecules, the gels were
washed for 10 min in transfer buffer at pH 8.0 and then treated
with 10 mM DTT for 15 min before vacuum transfer (1).
Polyclonal antisera.
Polyclonal antisera were raised in rabbits against synthetic peptides
coupled to keyhole limpet hemocyanin from specific sequences within the
mucins MUC2, MUC5AC, and MUC5B. The antisera used were MAN-5ACI, which
was raised against the same peptide sequence as LUM5-1 (RNQDQQGPFKMC;
29), MAN-5BI (ELGQVVECSLDFGLVCR), which has been previously described
(34), MAN-2I, and MAN-5BIII. MAN-2I is similar to the antiserum LUM2-3
(4) and was raised against a synthetic peptide, NGLQPVRVEDPDGC, in the
nontandem repeat region of MUC2 toward the COOH terminus. MAN-2I shows
a behavior similar to that reported for LUM2-3 with the precursor and
mature forms of MUC2 produced by the PC/AA cell line in culture (1).
MAN-5BIII was raised against a synthetic peptide, CSWYNGHRPEPGLG, found in Cys1 domain at the NH2 terminus of the
region encoded by the large central 10.7-kb exon of MUC5B (10). The
antisera were used at the following dilutions: 1:10,000 for MAN-2I and
MAN-5ACI and 1:2,000 for MAN-5BI and MAN-5BIII.
Determination of the levels of MUC2, MUC5AC, and MUC5B mucins with
time in culture.
Aliquots (10 µl) of the cell lysate extracts (15 ml) and apical
washings (30 ml) on days 10, 14, and 21 of
culture were reduced and carboxymethylated, slot blotted onto
nitrocellulose, and probed with mucin-specific antisera (for details of
antisera, see Polyclonal antisera). The antisera
were used at the dilutions given above, and the blots were visualized
with horseradish peroxidase-labeled secondary antibodies in conjunction
with an enhanced chemiluminescence Western detection kit. Band
intensities were measured with a Bio-Rad model GS 700 imaging densitometer.
Rate zonal centrifugation.
The samples were layered on preformed GuHCl gradients (6-8 M) as
previously described (31). Intact and reduced and carboxymethylated mucins isolated from the NHTBE cell lysates and apical washings were
centrifuged in a Beckman SW40 swing-out rotor at 40,000 rpm for 2.5 h
at 15°C. In addition, the reduced and carboxymethylated mucins from
the cell lysate (day 21) were centrifuged under the same
conditions except that they were centrifuged for 7 h. After centrifugation, the tubes were unloaded from the top.
Analytic methods.
Total carbohydrate was determined with a periodic acid-Schiff (PAS)
assay after slot blotting of mucins onto nitrocellulose (32).
Immunoassays were performed after slot blotting onto nitrocellulose as
previously described (33). Immunoblots and Western blots were
visualized with horseradish peroxidase-labeled secondary antibodies in
conjunction with an enhanced chemiluminescence Western detection kit.
Band intensities were measured with a Bio-Rad model GS 700 imaging densitometer.
| |
RESULTS |
Mucin gene expression and secretion by cultured NHTBE cells.
Early-passage NHTBE cells were cultured at the air-liquid interface in
serum-free retinoic acid-containing medium. The cells formed a
confluent monolayer within 7-8 days after being seeded and
progressively differentiated, forming a polarized mucociliary
epithelium between days 14 and 21 (Fig.
1A). Ultrastructural examination of
the day 21 cultures (Fig. 1B) revealed cells with
numerous small secretory granules of varying electron density, some
appearing to be exocytosed. Large confluent granules typical of goblet
cells in vivo were rare. The surface of these cells was covered with
microvilli. On days 10, 14, and 21, apical
washings and cell lysates were collected to measure secreted and
intracellular mucins with MUC2, MUC5AC, and MUC5B mucin-specific
antibodies. Total RNA was obtained from separate sets of simultaneously
grown cultures, and the levels of MUC2, MUC5AC, and
MUC5B mRNA expression were determined by competitive RT-PCR. As
shown in Fig. 2A, MUC5AC
and MUC5B mRNAs were low on day 10 but were clearly
increased on days 14 and 21. Low levels of MUC2
mRNA were expressed throughout the course of the study; they peaked
on day 14 and decreased by day 21 to the levels
observed on day 10. It should be noted that the level of MIMIC
used in the competitive PCR for MUC2 was 103
of that used for measuring MUC5AC and MUC5B message
levels, and thus the levels of MUC2 are very low compared with
the other two mucin genes.
View larger version (54133K):
[in this window]
[in a new window]
|
Fig. 1.
Morphological appearance of day 21 normal human
tracheobronchial epithelial (NHTBE) cell cultures. A:
histological examination reveals a columnar epithelium several cell
layers in thickness. Apical surface is covered by cilia (arrowheads).
B: electron micrograph shows cells containing numerous small
secretory granules (arrowheads), both electron lucent and electron
dense. Some of the granules appear to be in contact with apical
membrane, about to be exocytosed. Bar in B, 1 µm.
|
|
View larger version (4814K):
[in this window]
[in a new window]
|
Fig. 2.
Time course of MUC2, MUC5AC, and MUC5B mRNA and mucin protein levels in
NHTBE cultures. Apical-washing, cell lysate, and total cellular RNAs
were extracted on days 10, 14, and 21 of
culture. A: relative levels of mucin gene mRNAs were determined
by competitive RT-PCR. For MUC2 PCR, 104
amol of MIMIC (internal standard) and for MUC5AC and
MUC5B PCR, 101 amol of MIMIC were used (see
EXPERIMENTAL PROCEDURES). cDNA-to-MIMIC ratios, which are a
measure of relative mRNA levels, were 0.5, 0.7, and 0.5 for
MUC2; 0.5, 1.0, and 1.3 for MUC5AC, and 0.6, 1.0, and
1.1 for MUC5B for days 10, 14, and 21,
respectively. 2M, 2-Microglobin used as a control
gene. Levels of secreted (B) and cell-associated (C)
mucins were determined with mucin-specific antisera (see
EXPERIMENTAL PROCEDURES for details).
|
|
The levels of MUC2, MUC5AC, and MUC5B mucins in the apical washings and
cell lysates were determined by immunoreactivity with mucin-specific
antisera, and the data are shown in Fig. 2, B and C.
Over the 21 days of the experiment, there was an ~10-fold increase in
the amount of secreted and cell-associated MUC5AC and MUC5B mucins. It
should be noted that the MAN-5ACI antiserum is ~20 times more
sensitive than the MAN-5BIII antiserum (Kirkham S, Sheehan JK, and
Thornton DJ, unpublished observations), suggesting that
the MUC5B mucin is more abundant than the MUC5AC mucin. A low level of
the MUC2 mucin (close to the background signal) was detected throughout
the culture period, both in the apical-washing and cell-associated
mucins. This correlates with the low levels of MUC2 mRNA.
Mucin purification.
The cell-associated and secreted mucins from day 21 cultures
were purified by isopycnic density gradient centrifugation. The cell
lysate was subjected to 4 M GuHCl-CsCl density gradient centrifugation (Fig. 3A), and a carbohydrate-rich
peak was observed at a density of 1.35-1.45 g/ml, the density
range expected for mucins extracted from in vivo respiratory secretions
(18, 27, 31, 39). This material was separated from lower-buoyant
density proteins, as assessed by absorbance at 280 nm measurements,
toward the top of the gradient (Fig. 3A, fractions
1-6). An aliquot from each fraction was reduced and
carboxymethylated and subjected to agarose gel electrophoresis, and
Western blots of the gels were probed with the anti-mucin antibodies
MAN-5ACI (Fig. 3B) and MAN-5BIII (Fig. 3C). The data
show a clear separation of the "mature" glycosylated MUC5AC and
MUC5B mucins (fractions 10-16) from their
"putative" precursors found at lower-buoyant density
(fractions 1-5). A similar observation was
made recently for the cell-associated mature and precursor forms of the
MUC2 mucin synthesized by the intestinal cell line PC/AA in culture
(1).
View larger version (37K):
[in this window]
[in a new window]
|
Fig. 3.
Purification of mucins extracted from cell layer of 21-day NHTBE
cultures by isopycnic density gradient centrifugation. A: 4 M
GuHCl-CsCl density gradient centrifugation of NHTBE cell layer extract.
Aliquots from selected fractions were reduced and carboxymethylated and
subjected to agarose gel electrophoresis. Western blots of gels were
probed with MAN-5ACI (B) and MAN-5BIII (C). D:
0.2 M GuHCl-CsCl density gradient centrifugation of mucin-containing
fractions 9-16 from 4 M GuHCl-CsCl density
gradient. For details, see EXPERIMENTAL PROCEDURES.
Fractions (2.2 ml) were analyzed for absorbance at 280 nm (A280nm),
density, periodic acid-Schiff (PAS) reactivity, and reactivity with
MAN-5ACI and MAN-5BIII antisera.
|
|
Absorbance measurements at 280 nm suggested that DNA was present in the
mucin peak. Therefore, mucin-containing fractions were pooled and
subjected to 0.2 M GuHCl-CsCl isopycnic density gradient centrifugation
(Fig. 3D) to separate the mucins (1.45-1.55 g/ml) from the
DNA. Reactivity with the MAN-5ACI and MAN-5BIII antisera coincided with
the PAS-reactive material (corresponding to the mucins), and
fractions 4-12 were pooled for further analysis.
The secreted mucins were also purified by 4 M GuHCl-CsCl density
gradient centrifugation (Fig. 4). A
PAS-rich peak was present (1.35-1.45 g/ml) that was well separated
from the lower-buoyant density proteins. Unlike for the cell-associated
mucin extract, agarose electrophoresis did not identify any putative
precursor bands (data not shown), indicating that only mature
glycosylated forms of the mucins were secreted. No evidence of DNA
contamination was found, and, therefore, this preparation was not
subjected to further density gradient purification. The
mucin-containing fractions were reactive with the MAN-5ACI and
MAN-5BIII antisera, and fractions 11-16 were
pooled for further analysis.
View larger version (15K):
[in this window]
[in a new window]
|
Fig. 4.
Purification of mucins extracted from apical washings of 21-day NHTBE
cultures by 4 M GuHCl-CsCl isopycnic density gradient centrifugation.
For details, see EXPERIMENTAL PROCEDURES. Fractions (2.2 ml) were analyzed for density, PAS reactivity, and reactivity with
MAN-5ACI and MAN-5BIII antisera.
|
|
MUC5AC and MUC5B mucin characterization.
The pooled apical-washing and cell-associated mucin fractions before
and after reduction were separated by agarose gel electrophoresis, transferred to nitrocellulose membranes, and probed with the anti-mucin antibodies MAN-5ACI (Fig. 5A) and
MAN-5BIII (Fig. 5B). Also shown for comparison is an agarose
gel electrophoretic separation of the MUC5AC and MUC5B mucins present
in an in vivo respiratory secretion (Fig. 5C). The intact
high-molecular-mass MUC5AC and MUC5B mucins (average
molecular mass for total unfractionated preparation ~15 MDa) from the
in vivo secretion barely entered the gel, whereas their reduced and
carboxymethylated mucin subunits (average molecular mass 2.5 MDa) had a
much greater electrophoretic migration (Fig. 5C). After
reduction and carboxymethylation, the MUC5AC and MUC5B mucins isolated
from the cell lysates and the apical washings (Fig. 5, A and
B) exhibited an electrophoretic migration similar to that of
their in vivo counterparts. The intact secreted MUC5AC and MUC5B mucins
(Fig. 5, A and B) barely entered the gel, suggesting
that like the MUC5AC and MUC5B mucins in the in vivo secretion, these
mucins were high-molecular-mass, multimeric glycoproteins. In contrast,
the intact mucins from the cell lysate (Fig. 5, A and
B) exhibited a similar migration rate to the reduced and
carboxymethylated mucin monomers, suggesting that the unreduced cell-associated mucins are not highly oligomerized and are possibly mainly monomers and dimers. It is noteworthy that after reduction of
the MUC5B mucins, two bands were detected (Fig. 5B).
View larger version (52K):
[in this window]
[in a new window]
|
Fig. 5.
Agarose gel electrophoresis of MUC5AC and MUC5B mucins isolated from
21-day NHTBE cultures. Samples were electrophoresed on 0.7% (wt/vol)
agarose gels, and Western blots were probed with MAN-5ACI and MAN-5BIII
antisera (see EXPERIMENTAL PROCEDURES for details).
A: MAN-5ACI reactivity with mucins from cell layer. B:
MAN-5BIII reactivity with mucins from apical washings. U, unreduced; R,
reduced and carboxymethylated. Arrowhead, band corresponding to MUC5B
mucin reduced and carboxymethylated subunit;  ,
NH2-terminal fragment (see RESULTS for more
details). C: Western blot of mucins from an in vivo respiratory
secretion. Arrows, 2 charged glycoforms of MUC5B mucin previously
reported (34).
|
|
To analyze the size distribution of the isolated mucins in more detail,
the pooled, purified intact and reduced and carboxymethylated mucins
were subjected to rate zonal centrifugation on preformed 6-8 M
GuHCl gradients. Previously, it has been shown that this technique can
separate respiratory mucins with molecular masses between ~2.5 and 30 MDa (31, 35). The unreduced MUC5AC and MUC5B mucins isolated from the
secretions are characterized by a broad range of sedimentation rates
consistent with polydisperse, high-molecular-mass macromolecules,
which, after reduction, are found as a single less rapidly sedimenting
species (Fig. 6, A and C).
The unreduced cell-associated MUC5AC and MUC5B mucins are less
polydisperse and sediment only slightly faster than the reduced
monomeric mucins, indicating that they are much smaller than the
secreted forms (Fig. 6, B and D), in agreement with the electrophoretic data (Fig. 5).
View larger version (17K):
[in this window]
[in a new window]
|
Fig. 6.
Rate zonal centrifugation of MUC5AC and MUC5B mucins isolated from
21-day NHTBE cultures. Centrifugation was performed on 6-8 M GuHCl
gradients as described in EXPERIMENTAL PROCEDURES.
Fractions (0.5 ml) were analyzed for reactivity with MAN-5ACI
(A and B) and MAN-5BIII (C and D)
antisera. Data are presented for unreduced and reduced and
carboxymethylated mucins isolated from apical washings (A and
C) and for unreduced cell layer extract (B and
D).
|
|
The dramatic difference in apparent size between the cell-associated
mucins and those apically secreted on day 21 of culture prompted us to investigate the size distribution of the secreted mucins
at earlier days of culture. There was a marked increase in the average
sedimentation rate of the secreted MUC5AC mucins with increasing time
in culture (Fig. 7). However, this was not the case for the MUC5B mucins. On day 10, the MUC5B antiserum response was too low to measure, whereas on days 14 and
21, the mucins appeared as similar broad dispersions across the
gradient (Fig. 7).
View larger version (14K):
[in this window]
[in a new window]
|
Fig. 7.
Rate zonal centrifugation of MUC5AC and MUC5B mucins from apical
washings of 10-day (A), 14-day (B), and 21-day
(C) NHTBE cultures. Mucins isolated from apical washings of
NHTBE cultures were centrifuged on 6-8 M GuHCl gradients as
described in EXPERIMENTAL PROCEDURES. Fractions (0.5 ml)
were analyzed for reactivity with MAN-5ACI and MAN-5BIII antisera.
|
|
Our laboratory (27, 29) and others (39) have analyzed the reduced and
carboxymethylated MUC5AC and MUC5B mucins isolated from respiratory
secretions using anion-exchange chromatography on Mono Q column. These
studies have indicated that the charge density for the MUC5AC mucin is
distinct from two charged variants of the MUC5B mucin as illustrated in
Fig. 8A. This
contrasts with the situation with the cultured cells where, unlike the
in vivo secretions, the reduced and carboxymethylated mucins, whether cell associated or secreted (day 14 or 21), were
similar (Fig. 8, B-E). Although the charge density
of the MUC5AC mucin was similar to that observed in vivo, there was no
evidence for the different charged variants of the MUC5B mucin.
View larger version (15K):
[in this window]
[in a new window]
|
Fig. 8.
Anion-exchange chromatography of reduced and carboxymethylated MUC5AC
and MUC5B mucins from a human respiratory secretion (A) and
from apical washings (B and C) and cell layers
(D and E) from NHTBE cultures on days 14 (B and D) and 21 (C and E).
A, right axis, shows the salt gradient used to elute the
ion-exchange column, and the salt is lithium perchlorate. Samples were
chromatographed on a Mono Q HR 5/5 column as described in
EXPERIMENTAL PROCEDURES. Fractions (0.5 ml) were analyzed
for reactivity with MAN-5ACI and MAN-5BIII antisera.
|
|
As noted above (Fig. 5B), two populations of MAN-5BIII-reactive
molecules were observed after agarose gel electrophoresis of the
reduced and carboxymethylated cell-associated and secreted MUC5B
mucins: one with an electrophoretic migration expected for the reduced
and carboxymethylated MUC5B subunit and the other more rapidly
migrating. This suggested that a small fragment of the MUC5B mucin that
was released after reduction might have accounted for the faster
migrating band. To further investigate this, we performed rate zonal
centrifugation of the reduced and carboxymethylated mucin preparation
(Fig. 9). Again, two populations of
MAN-5BIII-reactive molecules were observed. The slow sedimenting
species had little PAS reactivity, suggesting that it had a low level
of glycosylation (Fig. 9), and did not react with the MAN-5BI
antiserum, consistent with it being a protein-rich fragment from the
NH2 terminus. The more rapidly sedimenting population,
which was reactive with MAN-5BI, was associated with the bulk of the
PAS reactivity (Fig. 9), as would be expected for the reduced and
carboxymethylated MUC5B subunit.
View larger version (15K):
[in this window]
[in a new window]
|
Fig. 9.
Rate zonal centrifugation of reduced and carboxymethylated mucins
isolated from apical washings of day 21 NHTBE cultures
centrifuged on a 6-8 M GuHCl gradient as described in
EXPERIMENTAL PROCEDURES. Fractions (0.5 ml) were analyzed
for PAS reactivity and reactivity with MAN-5BI and MAN-5BIII
antisera.
|
|
| |
DISCUSSION |
The MUC5AC and MUC5B mucins are the two major gel-forming glycoproteins
secreted in the airways (16-18, 27, 29, 34). Although MUC2
mRNA expression has been demonstrated in the respiratory tract (3, 28,
37), there is little biochemical evidence for any
significant amount of this mucin in airway mucus secretions (18, 29).
This pattern of mucin synthesis and secretion is mimicked in the NHTBE
cell cultures studied here. In vivo studies (17, 30) have demonstrated
that the MUC5AC mucin is produced mainly by mucous cells of the surface
epithelium and that MUC5B is mainly the product of cells in the
submucosal glands. However, it has been shown that MUC5B mucins are
also synthesized in the surface epithelium (39). Although NHTBE cells
in air-liquid interface culture do not form glandular structures, these
cells do make both serous and mucous products (11, 12). This is not
surprising because the surface epithelium and submucosal glandular epithelium have a common developmental origin (36). The maturation of
the cells from an undifferentiated phenotype to a complex phenotype embodying different cell types is associated with a major increase in
MUC5AC and MUC5B mucin storage and secretion (~10-fold), whereas MUC5AC and MUC5B mRNAs are only 2- to 3-fold more,
suggesting that they might be regulated at the translational or
posttranslational level. The low levels of MUC2 mRNA and
protein detected remained unchanged during the time of culture. It
should be stressed that we cannot say on the basis of our data that
MUC5AC and MUC5B mucins are the only two mucins present in the secretions.
The NHTBE cells in culture appear to secrete only the
mature forms of the MUC5AC and MUC5B mucins. We can find
no difference in density between the mature MUC5AC and MUC5B mucins in
the cell lysate and those secreted. Furthermore, there is no apparent
difference in the charge density and electrophoretic migration of their
reduced subunits. We assume, therefore, that the cell mucins are the
direct precursor of those in the apical washings. The distinction
between cell-associated (either intracellular or cell-bound) and
secreted mucins is not easy to make because some secreted mucin may
remain attached to the cell sheet. However, it is quite clear in this case that the secreted mucins are much more highly oligomerized than
the mature cell-associated mucins, which are smaller and appear to be
primarily but not exclusively dimeric. This conclusion can be drawn
from both the agarose electrophoresis and rate zonal centrifugation
data and suggests that in NHTBE cultures, mucin oligomerization is
directly coupled to the secretion process itself. Further
investigations are underway to determine if this is so. The increase in
the size of the secreted mucins with time in culture suggests a
maturation phenomenon in the process of mucin assembly that is not
understood. If oligomerization is coupled to secretion, then it is
possible that the extent of oligomerization is dependent on the buildup
of stored mature molecules within the cell or the rate of their production.
The differential reactivity of a proportion of the intracellular and
secreted MUC5B mucins with the two different polypeptide-directed antisera, MAN-5BI and MAN-5BIII, indicate that some of the MUC5B mucins
may undergo NH2-terminal cleavage. MAN-5BIII is directed against an epitope in the Cys1 domain toward the
NH2 terminus of the central portion of the MUC5B apomucin,
whereas MAN-5BI is against a repeated sequence in the R end domains in
the central portion of the polypeptide (9, 34). After reduction of the
intact mucins, a fragment is generated that is reactive with MAN-5BIII
but not with MAN-5BI and has a slower sedimentation rate than the
reduced MUC5B subunit, which is reactive with both antisera.
Furthermore, this material has a higher electrophoretic mobility and
lower PAS reactivity than the reduced subunit. These findings are
consistent with a protein-rich fragment generated by reduction and
suggest that a proportion of the MUC5B mucins have undergone an
NH2-terminal cleavage. There is evidence for COOH-terminal
cleavage of the MUC2 and MUC5B mucins isolated from in vivo mucus
secretions (15, 39, 41), but whether this is an intracellular event is
not clear. However, the data presented here indicate that
NH2-terminal processing of the MUC5B mucins is an
intracellular event, and, furthermore, the cleaved fragment remains
associated with the unreduced glycoprotein. The significance of this
finding is unknown; however, it should be noted that an
NH2-terminal cleavage is part of the processing of the
multimeric glycoprotein von Willebrand factor (vWF). The cleavage of
vWF takes place in a post-Golgi compartment, and the cleaved fragment,
as appears to be the case here, remains associated with the vWF polymer
(37). vWF contains cysteine-rich domains (D domains) that are
homologous with regions of the NH2 and COOH termini of the
MUC5AC and MUC5B mucins (25). Some of these cysteine residues are
believed to form the intermolecular disulfide bonds by which the mucins
oligomerize. Indeed, cysteine residues present within homologous
regions of porcine submaxilliary mucins have been shown to be involved
in the macromolecular assembly of this oligomeric mucin (22-24).
Overall, the macromolecular properties of the MUC5AC and MUC5B mucins
produced by NHTBE cultures are very similar to those we find for these
mucins isolated from in vivo respiratory secretions. However, agarose
gel electrophoresis and anion-exchange chromatography of the reduced
and carboxymethylated mucins produced by the NHTBE cells in culture
suggest that the glycosylation of the MUC5B mucins is not as complex.
The reduced and carboxymethylated subunits of the MUC5AC and MUC5B
mucins from the cultures elute almost identically from the
anion-exchange column, which suggests that the two populations of
molecules may be similarly glycosylated. However, in vivo, the MUC5B
mucin can occur in at least two distinct glycoforms (27, 34, 39). The
low-charge glycoform of this mucin appears to emanate from the glands,
and this form is not found in these cultures.
In summary, the cultured NHTBE cells make and secrete MUC5AC and MUC5B
mucins in significant quantities as the cultures mature and
differentiate, with the MUC5B mucin appearing to be more abundant. The
secreted mucins are polydisperse in size distribution and extend to
very highly oligomerized macromolecules, whereas their mature fully
glycosylated precursors stored in the cell are smaller and are possibly
dimers and monomers. The presence of smaller MUC5B fragment(s) detected
after reduction with an antiserum to the NH2 terminus but
not with an antiserum to other parts of the mucin polypeptide suggests
that processing occurs as part of the biosynthesis and/or
oligomerization process. The pattern of glycosylation is similar for
the two mucins but not identical to that seen in vivo.
| |
ACKNOWLEDGEMENTS |
D. J. Thornton and J. K. Sheehan thank the Wellcome Trust for
financial support.
| |
FOOTNOTES |
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement"
in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Address for reprint requests and other correspondence: D. J. Thornton,
The Wellcome Trust Centre for Cell-Matrix Research, Division of
Biochemistry, School of Biological Sciences, 2.205 Stopford Bldg.,
Univ. of Manchester, Manchester M13 9PT, UK (E-mail:
Dave.Thornton{at}man.ac.uk).
Received 12 August 1999; accepted in final form 31 January 2000.
| |
REFERENCES |
1.
Aksoy, N,
Thornton DJ,
Corfield A,
Paraskeva C,
and
Sheehan JK.
A study of the intracellular and secreted forms of the MUC2 mucin from the PC/AA intestinal cell line.
Glycobiology
9:
739-746,
1999[Abstract/Free Full Text].
2.
Bernacki, SH,
Nelson AL,
Abdullah L,
Sheehan JK,
Harris A,
Davis CW,
and
Randell SH.
Mucin gene expression during differentiation of human airway epithelia in vitro. MUC4 and MUC5B are strongly induced.
Am J Respir Cell Mol Biol
20:
595-604,
1999[Abstract/Free Full Text].
3.
Buisine, MP,
Devisme L,
Copin MC,
Durand-Reville M,
Gosselin B,
Aubert JP,
and
Porchet N.
Developmental mucin gene expression in the human respiratory tract.
Am J Respir Cell Mol Biol
20:
209-218,
1999[Abstract/Free Full Text].
4.
Carlstedt, I,
Herrmann A,
Hovenberg H,
Lindell G,
Nordman H,
Wickstrom C,
and
Davies JR.
`Soluble' and `insoluble' mucins
identification of distinct populations.
Biochem Soc Trans
23:
845-851,
1995[ISI][Medline].
5.
Carlstedt, I,
Lindgren H,
and
Sheehan JK.
The macromolecular structure of human cervical-mucus glycoproteins. Studies on fragments obtained after reduction of disulphide bridges and after subsequent trypsin digestion.
Biochem J
213:
427-435,
1983[ISI][Medline].
6.
Carlstedt, I,
Lindgren H,
Sheehan JK,
Ulmsten U,
and
Wingerup L.
Isolation and characterization of human cervical mucus glycoproteins.
Biochem J
211:
13-22,
1983[ISI][Medline].
7.
Chambers, JA,
Hollingsworth MA,
Trezise AE,
and
Harris A.
Developmental expression of mucin genes MUC1 and MUC2.
J Cell Sci
107:
413-424,
1994[Abstract].
8.
Desseyn, JL,
Aubert JP,
Van Seuningen I,
Porchet N,
and
Laine A.
Genomic organization of the 3' region of the human mucin gene MUC5B.
J Biol Chem
272:
16873-16883,
1997[Abstract/Free Full Text].
9.
Desseyn, JL,
Buisine MP,
Porchet N,
Aubert JP,
and
Laine A.
Genomic organization of the human mucin gene MUC5B cDNA and genomic sequences upstream of the large central exon.
J Biol Chem
273:
30157-30164,
1998[Abstract/Free Full Text].
10.
Desseyn, JL,
Guyonnet-Duperat V,
Porchet N,
Aubert JP,
and
Laine A.
Human mucin gene MUC5B, the 10.7-kb large central exon encodes various alternate subdomains resulting in a super-repeat. Structural evidence for a 11p155 gene family.
J Biol Chem
272:
3168-3178,
1997[Abstract/Free Full Text].
11.
Finkbeiner, WE,
Carrier SD,
and
Teresi CE.
Reverse transcription-polymerase chain reaction (RT-PCR) phenotypic analysis of cell cultures of human tracheal epithelium, tracheobronchial glands, and lung carcinomas.
Am J Respir Cell Mol Biol
9:
547-556,
1993.
12.
Gray, TE,
Guzman K,
Davis CW,
Abdullah LH,
and
Nettesheim P.
Mucociliary differentiation of serially passaged normal human tracheobronchial epithelial cells.
Am J Respir Cell Mol Biol
14:
104-112,
1996[Abstract].
13.
Gum, JR, Jr,
Hicks JW,
Toribara NW,
Siddiki B,
and
Kim YS.
Molecular cloning of human intestinal mucin (MUC2) cDNA. Identification of the amino terminus and overall sequence similarity to prepro-von Willebrand factor.
J Biol Chem
269:
2440-2446,
1994[Abstract/Free Full Text].
14.
Guzman, K,
Gray TE,
Yoon JH,
and
Nettesheim P.
Quantitation of mucin RNA by PCR reveals induction of both MUC2 and MUC5AC mRNA levels by retinoids.
Am J Physiol Lung Cell Mol Physiol
271:
L1023-L1028,
1996[Abstract/Free Full Text].
15.
Herrmann, A,
Davies JR,
Lindell G,
Martensson S,
Packer NH,
Swallow DM,
and
Carlstedt I.
Studies on the "insoluble" glycoprotein complex from human colon. Identification of reduction-insensitive MUC2 oligomers and C-terminal cleavage.
J Biol Chem
274:
15828-15836,
1999[Abstract/Free Full Text].
16.
Hovenberg, HW,
Davies JR,
and
Carlstedt I.
Human tracheal mucinsis MUC5 more prominent in the epithelial surface than in the submucosa? (Abstract).
Biochem Soc Trans
23:
534S,
1995[Medline].
17.
Hovenberg, HW,
Davies JR,
and
Carlstedt I.
Different mucins are produced by the surface epithelium and the submucosa in human trachea. Identification of MUC5AC as a major mucin from goblet cells.
Biochem J
318:
319-324,
1996.
18.
Hovenberg, HW,
Davies JR,
Herrmann A,
Linden CJ,
and
Carlstedt I.
MUC5AC, but not MUC2, is a prominent mucin in respiratory secretions.
Glycoconj J
13:
839-847,
1996[ISI][Medline].
19.
Koo, JS,
Jetten AM,
Belloni P,
Yoon JH,
Kim YD,
and
Nettesheim P.
Role of retinoid receptors in the regulation of mucin gene expression by retinoic acid in human tracheobronchial epithelial cells.
Biochem J
338:
351-357,
1999.
20.
Koo, JS,
Yoon JH,
Gray T,
Norford D,
Jetten AM,
and
Nettesheim P.
Restoration of the mucous phenotype by retinoic acid in retinoid-deficient human bronchial cell cultures. Changes in mucin gene expression.
Am J Respir Cell Mol Biol
20:
43-52,
1999[Abstract/Free Full Text].
21.
Meezaman, D,
Charles P,
Daskal E,
Polymeropoulos MH,
Martin BM,
and
Rose MC.
Cloning and analysis of cDNA encoding a major airway glycoprotein, human tracheobronchial mucin (MUC5).
J Biol Chem
269:
12932-12939,
1994[Abstract/Free Full Text].
22.
Perez-Villar, P,
Eckhardt AE,
DeLuca A,
and
Hill RL.
Porcine submaxillary mucin forms disulfide-linked multimers through its amino terminal D-domains.
J Biol Chem
273:
14442-14449,
1998[Abstract/Free Full Text].
23.
Perez-Villar, P,
Eckhardt AE,
and
Hill RL.
Porcine submaxillary mucin forms disulfide-bonded dimers between its carboxyl-terminal domains.
J Biol Chem
271:
9845-9850,
1996[Abstract/Free Full Text].
24.
Perez-Villar, P,
and
Hill RL.
The carboxyl-terminal 90 residues of porcine submaxillary mucin are sufficient for forming disulfide-bonded dimers.
J Biol Chem
273:
6982-6988,
1998[Abstract/Free Full Text].
25.
Rose, MC,
and
Gendler SJ.
Airway mucin genes and gene products.
In: Airway Mucus: Basic Mechanisms and Clinical Perspectives, edited by Rogers DF,
and Lethem MI.. Boston, MA: Birkhauser Verlag, 1997, p. 41-66.
26.
Rose, MC,
Lynn WS,
and
Kaufman B.
Resolution of the major components of human lung mucosal gel and their capabilities for reaggregation and gel formation.
Biochemistry
18:
4030-4037,
1979[Medline].
27.
Sheehan, JK,
Howard M,
Richardson PS,
Longwill T,
and
Thornton DJ.
Physical characterization of a low-charge glycoform of the MUC5B mucin comprising the gel-phase of an asthmatic respiratory mucous plug.
Biochem J
338:
507-513,
1999.
28.
Sheehan, JK,
Howard M,
Thornton D,
Gray T,
Koo JS,
and
Nettesheim P.
Early passage normal human tracheobronchial cells produce MUC5AC and MUC5B mucins (Abstract).
Am J Respir Crit Care Med
159:
474,
1999.
29.
Thornton, DJ,
Carlstedt I,
Howard M,
Devine PL,
Price MR,
and
Sheehan JK.
Respiratory mucins: identification of core proteins and glycoforms.
Biochem J
316:
967-975,
1996.
30.
Thornton, DJ,
Davies JR,
Carlstedt I,
and
Sheehan JK.
The structure and biochemistry of human respiratory mucins.
In: Airway Mucus: Basic Mechanisms and Clinical Perspectives, edited by Rogers DF,
and Letham MI.. Boston, MA: Birkhauser Verlag, 1997, p. 19-39.
31.
Thornton, DJ,
Davies JR,
Kraayenbrink M,
Richardson PS,
Sheehan JK,
and
Carlstedt I.
Mucus glycoproteins from `normal' human tracheobronchial secretion.
Biochem J
265:
179-186,
1990[ISI][Medline].
32.
Thornton, DJ,
Holmes DF,
Sheehan JK,
and
Carlstedt I.
Quantitation of mucus glycoproteins blotted onto nitrocellulose membranes.
Anal Biochem
182:
160-164,
1989[ISI][Medline].
33.
Thornton, DJ,
Howard M,
Devine PL,
and
Sheehan JK.
Methods for separation and deglycosylation of mucin subunits.
Anal Biochem
227:
162-167,
1995[ISI][Medline].
34.
Thornton, DJ,
Howard M,
Khan N,
and
Sheehan JK.
Identification of two glycoforms of the MUC5B mucin in human respiratory mucus. Evidence for a cysteine-rich sequence repeated within the molecule.
J Biol Chem
272:
9561-9566,
1997[Abstract/Free Full Text].
35.
Thornton, DJ,
Sheehan JK,
Lindgren H,
and
Carlstedt I.
Mucus glycoproteins from cystic fibrotic sputum; macromolecular properties and structural architecture.
Biochem J
276:
667-675,
1991.
36.
Tos, M.
Development of tracheal glands in man. Number, density, structure, shape, and distribution of mucous glands elucidated by quantitative studies of whole mounts.
Acta Pathol Microbiol Scand
68:
1-130,
1966[ISI][Medline].
37.
Vischer, UM,
and
Wagner DD.
Von Willebrand factor proteolytic processing and multimerization precede the formation of Weibel-Palade bodies.
Blood
83:
3536-3544,
1994[Abstract/Free Full Text].
38.
Voynow, JA,
Selby DM,
and
Rose MC.
Mucin gene expression (MUC1, MUC2, and MUC5/5AC) in nasal epithelial cells of cystic fibrosis, allergic rhinitis, and normal individuals.
Lung
176:
345-354,
1998[ISI][Medline].
39.
Wickstrom, C,
Davies JR,
Eriksen GV,
Veerman EC,
and
Carlstedt I.
MUC5B is a major gel-forming, oligomeric mucin from human salivary gland, respiratory tract and endocervix: identification of glycoforms and C-terminal cleavage.
Biochem J
334:
685-693,
1998.
40.
Wu, R,
Martin WR,
Robinson CB,
St George JA,
Plopper CG,
Kurland G,
Last JA,
Cross CE,
McDonald RJ,
and
Boucher R.
Expression of mucin synthesis and secretion in human tracheobronchial epithelial cells grown in culture.
Am J Respir Cell Mol Biol
3:
467-478,
1990.
41.
Xu, G,
Huan L,
Khatri I,
Sajjan US,
McCool D,
Wang D,
Jones C,
Forstner G,
and
Forstner J.
Human intestinal mucin-like protein (MLP) is homologous with rat MLP in the C-terminal region, and is encoded by a gene on chromosome 11 p 15.5.
Biochem Biophys Res Commun
183:
821-828,
1992[ISI][Medline].
Am J Physiol Lung Cell Mol Physiol 278(6):L1118-L1128
TOP
ABSTRACT
INTRODUCTION
