|
|
||||||||
increases transcription of
G
i-2 in human airway smooth muscle
cells
Department of Anesthesiology, College of Physicians and Surgeons of Columbia University, New York, New York 10032
| |
ABSTRACT |
|---|
|
|
|---|
Tumor necrosis factor-
(TNF-
) is a
proinflammatory cytokine that has an important role in the regulation
of airway smooth muscle tone and reactivity. We have shown previously
that TNF-
upregulates the expression of G
i-2 protein
without significantly increasing Gs
protein and enhances
adenylyl cyclase inhibition by carbachol in cultured human airway
smooth muscle cells (Hotta K, Emala CW, and Hirshman CA. Am
J Physiol Lung Cell Mol Physiol 276: L405-L411, 1999). The
present study was designed to investigate the molecular mechanisms by
which TNF-
upregulates G
i-2 protein in these cells.
TNF-
pretreatment for 48 h increased the expression of
G
i-2 protein without significantly altering the
G
i-2 protein half-life (41.0 ± 8.2 h for
control and 46.8 ± 5.2 h for TNF-
-treated cells).
Inhibition of new protein synthesis by cycloheximide blocked the
increase in G
i-2 protein induced by TNF-
.
Furthermore, TNF-
treatment for 12-24 h increased the
steady-state level of G
i-2 mRNA without significantly
altering G
i-2 mRNA half-life (9.0 ± 0.75 h
for control and 8.9 ± 1.1 h for TNF-
-treated cells). The
transcription inhibitor actinomycin D blocked the increase in
G
i-2 mRNA induced by TNF-
. These observations
indicate that the increase in G
i-2 protein induced by
TNF-
is due to an increased rate of G
i-2 protein
synthesis, most likely as a consequence of the transcriptional increase
in the steady-state levels of its mRNA.
trachea; G protein; messenger ribonucleic acid half-life; protein half-life; antinomycin D; cycloheximide
| |
INTRODUCTION |
|---|
|
|
|---|
CHRONIC INFLAMMATION
is a characteristic feature of asthma. Tumor necrosis factor-
(TNF-
) is a proinflammatory cytokine that is produced locally in the
lung, in close proximity to the airway smooth muscle, and found in
increased amounts in the airways of symptomatic patients with asthma
(4). This cytokine also has an important role in
increasing airway smooth muscle tone and reactivity. TNF-
impairs
-adrenoceptor-mediated airway smooth muscle relaxation in the guinea
pig (23) and rabbit (9) and enhances
thrombin- and bradykinin-induced intracellular Ca2+ release
and inositol phosphate turnover in cultured human airway smooth muscle
cells (1). Moreover, inhaled TNF-
increases airway
responsiveness to serotonin in rodents (13) and to
methacholine in normal volunteers (21). TNF-
modulates
the transcription of many genes via the nuclear factor-
B (NF-
B)
family of transcription factors (11), but little is known
regarding TNF-
-mediated regulation of the transcription of G protein
-subunits.
Multiple studies have demonstrated that changes in the expression of the heterotrimeric guanine nucleotide binding proteins (G proteins) effect downstream second messenger concentrations and signaling pathway function (15-18). One such second messenger, cAMP, is synthesized by the enzyme adenylyl cyclase that is regulated by both stimulatory (Gs) and inhibitory (Gi) protein pathways. The intracellular concentration of cAMP is a major determinant of airway smooth muscle tone.
TNF-
is known to modulate the expression of G protein
-subunits at the protein level. Changes in the expression of
Gi protein by TNF-
have been reported in rat
cardiomyocytes (17) and in human polymorphonuclear
leukocytes (19). Our laboratory has investigated
previously the effect of TNF-
on the expression and function of G
protein
-subunits in cultured human airway smooth muscle cells
(10). We found that TNF-
upregulated the expression of
G
i-2 and Gq
proteins and
enhanced adenylyl cyclase inhibition by carbachol and increased
inositol phosphate synthesis without significantly increasing
Gs
protein and muscarinic receptor expression
(10), all of which would lead to increases in airway smooth muscle tone and reactivity.
Several mechanisms could contribute to the regulation of G protein
-subunit expression by TNF-
. TNF-
could potentially modify the
synthesis or half-life of the G protein
-subunit at the level of the
protein and/or the mRNA. Therefore, we investigated the molecular
mechanisms by which TNF-
upregulates G
i-2 protein expression in cultured human airway smooth muscle cells. We examined the effect of TNF-
on the steady-state level of the
G
i-2 protein, the half-life of the G
i-2
protein, the steady-state level of G
i-2 mRNA, and the
half-life of G
i-2 mRNA. Moreover, we investigated the
effects of protein synthesis inhibition or transcription inhibition on
the TNF-
-induced changes in protein and mRNA amounts, respectively.
| |
METHODS |
|---|
|
|
|---|
Cell culture.
Primary cultures of previously characterized (22) human
tracheal smooth muscle cells were a gift from Dr. Ian Hall (Queens Medical Center, Nottingham, UK). The cells were assumed to be homogeneous with regard to their responses to TNF-
in these studies. The cells were grown in 75-cm2 cell culture flasks
containing culture medium (medium 199, 100 U/ml penicillin G, 100 µg/ml streptomycin, 0.25 µg/ml amphotericin B, and 10% fetal
bovine serum) at 37°C in 5% CO2-95% air. The cells were
plated on 24-well plates or 6-well plates and incubated until they
reached confluence. Serum deprivation was started at the same time as
the start of TNF-
treatments because these cells have limited
survival with prolonged serum deprivation.
Immunoblot analysis.
The expression of G
i-2 protein was determined by
immunoblot analysis. The cells in 24-well plates were washed three
times with serum-free medium at the end of the treatment and were lysed in 100 µl of sample buffer (62.5 mM Tris, pH 6.8, 2% SDS, 10% glycerol, and 5%
-mercaptoethanol). Parallel samples were harvested for cell count and viability determinations using trypan blue staining.
Twenty microliters of each sample were electrophoresed through 11%
polyacrylamide gels at 80 V for 4 h. The separated proteins were
transferred to polyvinylidene difluoride (PVDF) membranes at 20 V at
room temperature for 16 h in transfer buffer (192 mM glycine, 25 mM Tris, and 10% methanol). After transfer, nonspecific protein
binding was blocked in Tris-buffered saline (TBS; 2.42 g/l Tris, pH
7.6, and 8 g/l NaCl) containing 5% nonfat dry milk.
G
i-2 protein antiserum AS/7 at 1:500 dilution in
TBS-0.1% Tween 20 (TBS-T) containing 1% nonfat dry milk and 0.02%
sodium azide was added, and the PVDF membranes were incubated with
gentle rocking at room temperature for 2 h. After incubation with
the primary antibody, the PVDF membranes were washed once for 15 min and three times for 5 min each with TBS-T. The PVDF membranes were then
incubated for 1 h at room temperature in donkey anti-rabbit Ig
conjugated to horseradish peroxidase at 1:10,000 dilution in TBS-T
containing 1% nonfat dry milk. After incubation with conjugated secondary antibody, the PVDF membranes were washed once for 15 min and
three times for 5 min each with TBS-T. The G
i-2 protein was detected with enhanced chemiluminescence immunoblotting reagents according to the manufacturer's recommendations (ECLplus;
Amersham, Arlington Heights, IL), with subsequent exposure to
autoradiography film. The intensities of resulting bands were
quantified using a scanner coupled to a personal computer using MacBas
2.2 software. We confirmed that all band intensities fell within the
linear range of the autoradiographic film (10). To correct
for TNF-
-induced alteration in cell growth and the amount of protein
applied to each lane, band intensity measurements were corrected for
cell number.
Trypan blue exclusion.
Because treatment with TNF-
or cycloheximide may affect growth of
the cells, the immunoblot measurements were corrected for cell number.
Cells were washed with serum-free medium three times. After being
washed, the cells were detached with trypsin, and cell culture medium
containing 10% BSA was added. The cells were stained with trypan blue
and counted in a hemocytometer.
Steady-state level of G
i-2 protein.
Confluent cells in 24-well plates were incubated in serum-free medium
in the presence or absence of 10 ng/ml of TNF-
for 48 h. After
three washes with serum-free medium 199, cells were lysed in 100 µl
of gel sample buffer. Parallel samples were harvested for cell count
and viability determinations using trypan blue staining. Quantity of
G
i-2 protein was determined as described above.
G
i-2 protein half-life.
Half-life of G
i-2 protein was determined by adding the
protein translation inhibitor cycloheximide (1 µg/ml) to the cell culture medium and measuring the immunoblot band intensity for G
i-2 serially over 48 h. Preliminary experiments
indicated that the dose of cycloheximide used blocked greater than 90%
of new protein synthesis. The effect of TNF-
was assessed by adding TNF-
(10 ng/ml) to serum-free medium 48 h before cycloheximide was added. The medium and TNF-
were replaced every 24 h.
Control cells were serum starved for 48 h before cycloheximide was
added. The amount of G
i-2 protein present after
cycloheximide addition was measured by immunoblot analysis at 0, 10, 24, 34, and 48 h in control or TNF-
-treated cells. In separate
experiments, to determine whether newly translated protein contributes
to the upregulation of G
i-2 protein under
TNF-
-exposed conditions, cycloheximide or vehicle was added at the
beginning of the TNF-
treatment. The level of G
i-2
protein after the combined TNF-
plus cycloheximide treatment for
48 h was examined by immunoblot analysis.
RNA extraction. Total cellular RNA was isolated by the single-step guanidinium isothiocyanate method (5) using Trizol reagent (GIBCO BRL, Grand Island, NY). The cells were lysed in Trizol reagent, and the RNA was extracted by adding chloroform followed by centrifugation at 10,000 g for 15 min. The supernatant was precipitated with isopropanol and centrifuged at 10,000 g for 10 min. After centrifugation, the pellet was washed with 75% ethanol, centrifuged at 7,500 g for 5 min, and air-dried for 5 min at room temperature. The pelleted RNA was resuspended in diethyl pyrocarbonate-treated water, and the absorbance was spectrophotometrically measured at 260/280 nm.
Preparation of G
i-2 riboprobe.
A 317-bp cDNA that corresponded to nucleotides 298-614 of the
human G
i-2 protein (GenBank accession no. J03004) was
generated from total human brain RNA by RT-PCR (5'-primer,
acagcaacaccatccactcca; 3'-primer, gcgggtccgtagcacatctt), and was
inserted in vector pCRII-TOPO (Invitrogen, Carlsbad, CA).
Hind III-linearized plasmid DNA served as the template for
the transcription of an antisense single-strand UTP-biotin-labeled
riboprobe using T7 RNA polymerase and the Maxiscript kit (Ambion,
Austin, TX). The transcribed riboprobes were gel purified by
electrophoresis on a 5% acrylamide-8 M urea gel, identified by short
wavelength ultraviolet shadowing, cut from the gel, and eluted in
elution buffer (0.5 M ammonium acetate, 1 mM EDTA, and 0.2% SDS)
overnight. The absorbance of the riboprobe at 260/280 nm was
spectrophotometrically measured, divided into aliquots, and stored at
80°C until used in ribonuclease protection assays.
Ribonuclease protection assay.
Ribonuclease protection assay (RPA) was performed according to the
manufacturer's protocol using the HybSpeed RPA kit (Ambion). A
biotin-labeled antisense riboprobe for G
i-2 protein (10 ng) and sample RNA (5-10 µg) were precipitated and hybridized in
10 µl of hybridization buffer at 68°C for 10 min. After
hybridization, the samples were incubated at 37°C for 30 min in a
100-µl cocktail of RNase T1/A (5 U/ml RNase A and 200 U/ml RNase T1)
to digest the unprotected single-strand region of double-strand RNA
fragments. The protected double-strand fragments from RNase
digestion were precipitated, separated on a 5% acrylamide-8 M urea
denaturing gel, transferred to positively charged nylon membrane using
semidry blotting system at 400 mA for 30 min in transfer buffer (45 mM Tris, pH 8.0, 45 mM boric acid, and 1 mM EDTA), and detected using streptavidin-chemiluminescence detection reagents according to the
manufacturer's recommendations (Bright-Star BioDetect, Ambion), with
subsequent quantitation with the Flour-S chemiluminescent imaging
system (Bio-Rad, Hercules, CA) coupled to Quantity One software
(Bio-Rad). The sensitivity of this imaging system is linear over three
log orders of chemiluminescence signal intensity. Preliminary
experiments showed that increased amounts of RNA resulted in a linear
increase in chemiluminescent signal.
Steady-state level of G
i-2 mRNA.
The cells in six-well plates were incubated in serum-free medium in the
presence and absence of 10 ng/ml of TNF-
for 12 and 24 h.
Subsequently, the RNA was extracted as described above, and the level
of G
i-2 mRNA was quantitated by RPA.
G
i-2 mRNA half-life.
The half-life of mRNA was determined by adding the transcription
inhibitor actinomycin D (5 µg/ml) to the cell culture medium and
measuring the level of G
i-2 mRNA by RPA 0, 4, 8, and
12 h after adding actinomycin D. The effect of TNF-
was
assessed by adding 10 ng/ml TNF-
to the serum-free medium 24 h
before adding actinomycin D and during the actinomycin D treatment.
Control cells were serum starved for 24 h before adding
actinomycin D and incubated with actinomycin D plus vehicle only. In
separate experiments, to determine whether inhibition of new
transcription blocked the TNF-
-induced increase in
G
i-2 mRNA, actinomycin D or vehicle was added at the
beginning of the TNF-
treatment. The level of G
i-2
mRNA after the combined TNF-
plus actinomycin D treatment was
examined at 12 h.
Materials.
G
i-2 protein antisera (AS/7) were obtained from NEN
(Boston, MA). Donkey anti-rabbit Ig was obtained from Amersham. PVDF membranes were obtained from Millipore (Bedford, MA). Cell culture reagents were obtained from GIBCO BRL. Human recombinant TNF-
expressed in yeast and all other reagents were obtained from Sigma (St.
Louis, MO).
Statistics. All data are presented as means ± SE. Each study represents a separate individual experiment. Data for protein and mRNA half-life experiments were analyzed by a two-tailed paired Student's t-test. Nonparametric data were analyzed by the Wilcoxon signed rank test. The null hypothesis was rejected when P < 0.05.
| |
RESULTS |
|---|
|
|
|---|
Steady-state level of G
i-2 protein.
TNF-
treatment for 48 h significantly increased the expression
of G
i-2 protein by 55% (Fig.
1; arbitrary intensities of immunoblots
corrected for cell number = 25,487 ± 6,067 and 37,587 ± 7,810 for control and TNF-
-treated cells, respectively;
P = 0.008, n = 9 independent
experiments). Total cell numbers did not change during 48 h of
TNF-
treatment (control, 20,400 ± 4,000 cells/well;
TNF-
-treated, 17,400 ± 8,600 cells/well; n = 9, P > 0.05). A representative time-course experiment
for TNF-
effects on G
i-2 protein is shown in Fig.
2. No changes in G
i-2
protein quantity were seen at 12 or 24 h of TNF-
treatment.
|
|
G
i-2 protein half-life.
To investigate the mechanisms by which TNF-
upregulated the
expression of G
i-2 protein, the half-life of
G
i-2 protein in control and TNF-
-treated cells was
examined by measuring the G
i-2 protein level at 0, 10, 24, 34, and 48 h after the addition of cycloheximide. There was no
significant difference in cell viability 48 h after the addition
of cycloheximide between control and TNF-
-treated cells (data not
shown). There was also no significant change in cell numbers in the
presence or absence of cycloheximide for 48 h (control,
27,760 ± 7,640 cells/well; cycloheximide, 24,320 ± 6,520 cells/well; n = 5, P = 0.56). The
half-life of G
i-2 protein was 41.0 ± 8.2 and
46.8 ± 5.2 h for control and TNF-
-treated cells,
respectively (P = 0.15, n = 4 independent experiments; Fig. 3),
indicating that the upregulation of G
i-2 protein induced by TNF-
was not caused by a longer protein half-life. Based on this
observation, to test the hypothesis that increased synthesis of
G
i-2 protein is responsible for the upregulation of
G
i-2 protein induced by TNF-
, cycloheximide was added
at the beginning of the 48-h treatment with TNF-
or vehicle, and the
level of G
i-2 protein was measured. Coincubation of
TNF-
-treated cells with cycloheximide blocked the increase in
G
i-2 protein induced by TNF-
. The amount of
G
i-2 protein in the control and TNF-
-treated cells
was not significantly different when cycloheximide was included at the
beginning of TNF-
treatment (Fig. 4;
arbitrary intensities of immunoblots corrected for cell number = 7,632 ± 2,075 and 7,503 ± 2,491 for control and
TNF-
-treated cells, respectively; P = 0.69, n = 5 independent experiments). These data support the
finding that TNF-
-induced increases in G
i-2 protein
were not due to a change in protein half-life but were occurring by a
mechanism involving increased synthesis of new protein.
|
|
Steady-state level of G
i-2 mRNA.
Treatment with TNF-
for 12 and 24 h significantly
increased the steady-state level of G
i-2 mRNA by 57%
(arbitrary densities of bands = 15,979 ± 2,784 and
23,099 ± 3,314 for control and 12-h TNF-
-treated cells,
respectively; P = 0.001, n = 14 independent experiments) and 73% (arbitrary densities of bands = 11,119 ± 2,586 and 16,549 ± 4,406 for control and 24-h
TNF-
-treated cells, respectively; P = 0.046, n = 6 independent experiments; Fig.
5). This increase in G
i-2
mRNA occurred earlier than the detected increase in G
i-2
protein (Fig. 2).
|
-treated
cells was not different at either 12 or 24 h (12 h: control, 16.5 ± 2.4 µg RNA/2 wells of a 6-well plate; TNF-
, 16.3 ± 2.0 µg RNA/2 wells of a 6-well plate; n = 10, P = 0.87; 24 h: control, 12.2 ± 2.6 µg
RNA/2 wells of a 6-well plate; TNF-
, 12.3 ± 2.6 µg RNA/2
wells of a 6-well plate; n = 6, P = 0.95).
G
i-2 mRNA half-life.
To investigate the mechanisms by which TNF-
upregulated the
steady-state level of G
i-2 mRNA, the half-life of
G
i-2 mRNA was determined by measuring the level of
G
i-2 mRNA at 0, 4, 8, and 12 h after the addition
of the transcription inhibitor actinomycin D. Actinomycin D for 12 h had no significant effect on the yield of total RNA (control,
22.8 ± 2.2 µg/2 wells of a 6-well plate; actinomycin D,
20.0 ± 1.8 µg/2 wells of a 6-well plate; n = 5, P = 0.37). The half-lives of G
i-2 mRNA
were 9.0 ± 0.75 and 8.9 ± 1.1 h in control and
TNF-
-treated cells, respectively (P = 0.87, n = 6 independent experiments; Fig.
6). These data indicate that the
upregulation of G
i-2 mRNA was not due to a longer mRNA half-life. Based on this observation, we next tested the hypothesis that increased transcription of G
i-2 mRNA in cells
exposed to TNF-
was responsible for the upregulation of
G
i-2 mRNA. Actinomycin D was added at the beginning of
the treatment with TNF-
or vehicle, and the level of
G
i-2 mRNA was measured. Coincubation of cells with both
TNF-
and actinomycin D blocked the increase in G
i-2 mRNA induced by TNF-
. The level of G
i-2 mRNA was not
significantly different in control cells and TNF-
-treated cells when
actinomycin D was included at the beginning of the TNF-
treatment
(Fig. 7; arbitrary densities of
bands = 1,804 ± 513 and 1,361 ± 399 for control and
TNF-
-treated cells, respectively; P = 0.35, n = 5 independent experiments). These data suggest that
the upregulated G
i-2 mRNA induced by TNF-
was due to
increased transcription.
|
|
| |
DISCUSSION |
|---|
|
|
|---|
In the present study, TNF-
treatment increased the expression
of G
i-2 protein and G
i-2 mRNA without a
significant effect on the protein or mRNA half-life in cultured human
airway smooth muscle cells. Inhibition of new protein synthesis by
concurrent cycloheximide treatment blocked the increase in
G
i-2 protein induced by TNF-
. Inhibition of new mRNA
synthesis by concurrent actinomycin D treatment blocked the increase in
G
i-2 mRNA induced by TNF-
. Taken together, these
observations suggest that TNF-
upregulates the expression of
G
i-2 protein secondary to an increase in the
transcription of G
i-2 mRNA.
Many stimuli regulate the amount of G
i-2 protein and/or
mRNA in cells. The time course appears to vary with the stimulus and
with the cell type. In rat ventricular myocytes, thyroid hormone treatment for 48 h decreased the expression of G
i-2
protein (2). Twenty-four hours of forskolin or
isoproterenol exposure increased both G
i-2 protein and
mRNA expression in S49 mouse lymphoma cells (7). In
contrast, in rat astrocytes, forskolin and isoproterenol increased
G
i-2 protein and mRNA in only 6-9 h; this value
returned to baseline values at 24 h of persistent forskolin or
isoproterenol exposure (12). In rat Sertoli cells, 4 h of follicle-stimulating hormone decreased G
i-2
mRNA (14).
Three previous studies investigated the effects of TNF-
on
G
i-2 protein or mRNA. In rat cardiomyocytes, 48 h
of TNF-
increased G
i-2 protein (17), and
we have shown previously an increase in G
i-2 protein
after 72 h of TNF-
treatment in human airway smooth muscle
cells (24). In contrast to these chronic effects of
TNF-
, in human polymorphonuclear leukocytes, TNF-
, in a
cycloheximide-sensitive manner, both upregulated G
i-2
protein and downregulated G
i-2 mRNA, with no change in
transcription, after only 10 min of exposure (19). This
suggests that the mechanism of acute regulation of G
i-2
in polymorphonuclear leukocytes occurs at the level of translation, resulting in both increased G
i-2 protein translation and
decreased stability of G
i-2 mRNA. This is in contrast to
the present study in which chronic (12-48 h) TNF-
treatment
increased G
i-2 mRNA transcription. It is possible that
the mechanisms by which TNF-
regulates G
i-2 protein
and mRNA expression differ during acute and chronic TNF-
exposure
and that different cell types have completely different mechanisms for
regulating G
i-2 in response to TNF-
.
The half-life of G
i-2 protein found in human airway
smooth muscle cells in the present study (45 h) is similar to that
found in neonatal rat ventricular myocytes (46 h) (2) but
differs from the half-life of G
i-2 protein measured in
S49 mouse lymphoma cells (76 h) (7). The differences in
the G
i-2 protein half-lives reported in different
studies are likely due to the differences among cell types studied
and/or the cell culture conditions employed. This is exemplified by
studies of other G protein
-subunits. Different half-lives of the G
protein Go
were reported in different cells from the
same species (28 h in GH4 pituitary cells and 72 h in
cardiomyocytes) (20).
The half-life of mRNA encoding G protein
-subunits also appears to
be cell-type specific. The half-lives of G
i-2 mRNA in previous studies are variable [44 h in Sertoli cells
(14), 48 h in cardiomyocytes (2), and
~0.7-3.5 h in astroglial cells (12)]. In the
present study, the G
i-2 mRNA half-life was 9.3 and
9.4 h in the absence and presence of TNF-
, respectively. Taken
together, these studies suggest a wide variation in G
i-2 mRNA half-life that like the G
i-2 protein half-life is
cell-type specific and perhaps influenced by varying cell culture
conditions used in different studies.
Both the G
i-2 protein and mRNA levels were upregulated
by TNF-
in the present study. Preliminary experiments indicated that the increase in the level of G
i-2 protein induced by
TNF-
was seen after 48 and 72 h but not after 24 h of
pretreatment. However, the increase in G
i-2 mRNA induced
by TNF-
occurred much earlier; it was seen after 12-24 h
of TNF-
pretreatment. Thus we chose to measure G
i-2
protein levels after treatment with TNF-
for 48 h and to
measure G
i-2 mRNA levels after treatment with TNF-
for 24 h. This delay in the measured increase in
G
i-2 protein following an earlier increase in mRNA is
consistent with the study of Hadcock et al. (7) in which
forskolin-stimulated mRNA increases were measurable at 12 h, with
sustained protein increases measured at 24 h. Barrett et al.
(3) found that both the melatonin receptor mRNA and its
protein were upregulated by forskolin in ovine pars tuberalis cells but
that the upregulation of mRNA occurred earlier than that of protein. In
studies in which mRNA levels have been related to the rate of protein
synthesis, a good correlation has usually but not always been observed.
Some studies have shown simultaneous regulation of both mRNA and
protein levels (6, 8). It is possible that
other mechanisms that regulate protein level, such as translational
efficiency, mRNA splicing, or other intracellular signaling pathway(s)
are involved in the TNF-
-induced upregulation of G
i-2 protein.
TNF-
is known to be a pleomorphic regulator of gene expression
through activation of preexisting transcription factors of the NF-
B
family. Thus the present study adds a G protein
-subunit to the long
list of signaling proteins that are known to be regulated by TNF-
(11). TNF-
is produced locally in the lung, in close proximity to airway smooth muscle, and increased concentrations have
been reported in the airways of symptomatic asthmatics
(4). TNF-
impairs
-adrenoceptor-mediated airway
smooth muscle relaxation in animal models (23) and
enhances methacholine airway responses in humans (13).
Increased expression of G
i-2 protein is one cellular
signaling mechanism that could account for these airway effects of
TNF-
. Moreover, increased expression of G
i-2 in
airway smooth muscle could contribute to an increase in airway smooth muscle tone by G
i-2-mediated inhibition of adenylyl
cyclase, with resultant decreases in cellular cAMP levels. Thus the
present study provides a possible mechanism to account for contribution of TNF-
to impaired airway smooth muscle relaxation in asthmatic airways.
In summary, TNF-
upregulated the level of G
i-2
protein and mRNA without significant effect on the half-life of
G
i-2 protein and mRNA in cultured human airway smooth
muscle cells. The increase in G
i-2 protein induced by
TNF-
is due to increased rate of G
i-2 protein
synthesis, most likely as a consequence of the transcriptional increase
in the steady-state levels of its mRNA.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Dr. Ian Hall, Queens Medical Centre, Nottingham, UK, for kindly providing the primary cultures of human airway smooth muscle cells used in this study.
| |
FOOTNOTES |
|---|
Address for reprint requests and other correspondence: C. W. Emala, Dept of Anesthesiology, College of Physicians and Surgeons of Columbia Univ., 630 W. 168th St. P&S Box 46, New York, New York 10032 (E-mail: cwe5{at}columbia.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Received 23 August 1999; accepted in final form 21 March 2000.
| |
REFERENCES |
|---|
|
|
|---|
1.
Amrani, Y,
Krymskaya V,
Maki C,
and
Panettieri RA.
Mechanisms underlying TNF-
effects on agonist-mediated calcium homeostasis in human airway smooth muscle cells.
Am J Physiol Lung Cell Mol Physiol
273:
L1020-L1028,
1997
2.
Bahouth, SW.
Thyroid hormone regulation of transmembrane signaling in neonatal rat ventricular myocytes by selective alteration of the expression and coupling of G-protein
-subunits.
Biochem J
307:
831-841,
1995.
3.
Barrett, P,
Maclean A,
Davidson G,
and
Morgan WKC
Regulation of the Mel 1a melatonin receptor mRNA and protein levels in the ovine pars tuberalis: evidence for a cyclic adenosine 3',5'-monophosphate-independent Mel 1a receptor coupling and autoregulatory mechanism of expression.
Mol Endocrinol
10:
892-902,
1996
4.
Broide, DH,
Lotz M,
Cuomo AJ,
Coburn DA,
Federman EC,
and
Wasserman SI.
Cytokines in symptomatic asthmatic airways.
J Allergy Clin Immunol
89:
958-967,
1992[Web of Science][Medline].
5.
Chomczynski, P,
and
Sacchi N.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:
156-159,
1987[Web of Science][Medline].
6.
Eschenhagen, T,
Diederich M,
Kluge SH,
Magnussen O,
Mene U,
Muller F,
Schmitz W,
Scholz H,
Weil J,
Sent U,
Schaad A,
Scholtysik G,
Wuthrich A,
and
Gaillard C.
Bovine hereditary cardiomyopathy: an animal model of human dilated cardiomyopathy.
J Mol Cell Cardiol
27:
357-370,
1995[Web of Science][Medline].
7.
Hadcock, JR,
Ros M,
Watkins DC,
and
Malbon CC.
Cross-regulation between G protein-mediated pathways.
J Biol Chem
265:
14784-14790,
1990
8.
Haddad, E-B,
Rousell J,
Linalsay MA,
and
Barnes PJ.
Synergy between tumor necrosis factor
and interleukin 1
in inducing transcriptional down-regulation of muscarinic M2 receptor gene expression.
J Biol Chem
271:
32586-32592,
1996
9.
Hakonarson, H,
Herrick DJ,
Gonzales-Serrano P,
and
Grunstein MM.
Mechanism of cytokine-induced modulation of
-adrenoceptor responsiveness in airway smooth muscle.
J Clin Invest
97:
2593-2600,
1996[Web of Science][Medline].
10.
Hotta, K,
Emala CW,
and
Hirshman CA.
TNF-
upregulates Gi
and Gq
protein expression and function in human airway smooth muscle cells.
Am J Physiol Lung Cell Mol Physiol
276:
L405-L411,
1999
11.
Jaattela, M.
Biologic activities and mechanisms of action of tumor necrosis factor-
/cachectin.
Lab Invest
64:
724-742,
1991[Web of Science][Medline].
12.
Jamali, AE,
Rachdaoui N,
Dib K,
and
Correze C.
Cyclic AMP regulation of Gi
(2) and Gi
(3) mRNAs and proteins in astroglial cells.
J Neurochem
71:
2271-2277,
1998[Medline].
13.
Kips, JC,
Tavernier J,
and
Pauwels RA.
Tumor necrosis factor causes bronchial hyperresponsiveness in rats.
Am Rev Respir Dis
145:
332-336,
1992[Web of Science][Medline].
14.
Loganzo, F, Jr,
and
Fletcher PW.
Follicle-stimulating hormone increases the turnover of G-protein
i-1- and
i-2-subunit messenger RNA in Sertoli cells by a mechanism that is independent of protein synthesis.
Mol Endocrinol
7:
434-440,
1993
15.
MacLeod, KG,
and
Milligan G.
Biphasic regulation of adenylate cyclase by cholera toxin in neuroblastoma X glioma hybrid cells is due to the activation and subsequent loss of the alpha subunit of the stimulatory GTP binding protein (Gs).
Cell Signal
2:
139-151,
1990[Web of Science][Medline].
16.
Paulssen, RH,
Paulssen EJ,
Gautvik KM,
and
Gordeladze JO.
The thyroliberin receptor interacts directly with a stimulatory guanine-nucleotide-binding protein in the activation of adenylyl cyclase in GH3 rat pituitary tumor cells. Evidence obtained by the use of antisense RNA inhibition and immunoblocking of the stimulatory guanine-nucleotide-binding protein.
Eur J Biochem
204:
413-418,
1992[Web of Science][Medline].
17.
Reithmann, C,
Gierschik P,
Werdan K,
and
Jakobs KH.
Tumor necrosis factor
up-regulates Gi
and G
proteins and adenylyl cyclase responsiveness in rat cardiomyocytes.
Eur J Pharmacol
206:
53-60,
1991[Web of Science][Medline].
18.
Sawutz, DG,
Singh SS,
Tiberio L,
Koszewski E,
Johnson CG,
and
Johnson CL.
The effect of TNF
on bradykinin receptor binding, phosphatidylinositol turnover and cell growth in human A431 epidermoid carcinoma cells.
Immunopharmacology
24:
1-10,
1992[Web of Science][Medline].
19.
Scherzer, JA,
Lin Y,
McLeish KR,
and
Klein JB.
TNF translationally modulates the expression of G protein
i2 subunits in human polymorphonuclear leukocytes.
J Immunol
158:
913-918,
1997[Abstract].
20.
Silbert, S,
Lee MR,
and
Neer EJ.
Differential degradation rates of the G protein
o in cultured cardiac and pituitary cells.
J Biol Chem
265:
3102-3195,
1990
21.
Thomas, PS,
Yates DH,
and
Barnes PJ.
Tumor necrosis factor-
increases airway responsiveness and sputum neutrophilia in normal human subjects.
Am J Respir Crit Care Med
152:
76-80,
1995[Abstract].
22.
Widdop, S,
Daykin K,
and
Hall IP.
Expression of muscarinic M2 receptors in cultured human airway smooth muscle cells.
Am J Respir Cell Mol Biol
9:
541-546,
1993.
23.
Wills-Karp, M,
Uchida Y,
Lee JY,
Jinot J,
Hirata A,
and
Hirata F.
Organ culture with proinflammatory cytokines reproduces impairment of the
-adrenoceptor-mediated relaxation in tracheas of a guinea pig antigen model.
Am J Respir Cell Mol Biol
8:
153-159,
1993.
24.
Yoshie, Y,
Kunihiko I,
and
Nakazawa T.
The inhibitory effect of a selective
2-adrenergic receptor antagonist on moderate to severe asthma.
J Allergy Clin Immunol
84:
747-752,
1989[Web of Science][Medline].
This article has been cited by other articles:
![]() |
P H Howarth, K S Babu, H S Arshad, L Lau, M Buckley, W McConnell, P Beckett, M Al Ali, A Chauhan, S J Wilson, et al. Tumour necrosis factor (TNF{alpha}) as a novel therapeutic target in symptomatic corticosteroid dependent asthma Thorax, December 1, 2005; 60(12): 1012 - 1018. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Deshpande, T. A. White, S. Dogan, T. F. Walseth, R. A. Panettieri, and M. S. Kannan CD38/cyclic ADP-ribose signaling: role in the regulation of calcium homeostasis in airway smooth muscle Am J Physiol Lung Cell Mol Physiol, May 1, 2005; 288(5): L773 - L788. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Hunter, H. J. Cobban, P. Vandenabeele, D. J. MacEwan, and G. F. Nixon Tumor Necrosis Factor-alpha -Induced Activation of RhoA in Airway Smooth Muscle Cells: Role in the Ca2+ Sensitization of Myosin Light Chain20 Phosphorylation Mol. Pharmacol., March 1, 2003; 63(3): 714 - 721. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J. Janssen Ionic mechanisms and Ca2+ regulation in airway smooth muscle contraction: do the data contradict dogma? Am J Physiol Lung Cell Mol Physiol, June 1, 2002; 282(6): L1161 - L1178. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |