AJP - Lung Columbus Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 279: L319-L325, 2000;
1040-0605/00 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (11)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hotta, K.
Right arrow Articles by Emala, C. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hotta, K.
Right arrow Articles by Emala, C. W.
Vol. 279, Issue 2, L319-L325, August 2000

TNF-alpha increases transcription of Galpha i-2 in human airway smooth muscle cells

Kunihisa Hotta, Carol A. Hirshman, and Charles W. Emala

Department of Anesthesiology, College of Physicians and Surgeons of Columbia University, New York, New York 10032


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Tumor necrosis factor-alpha (TNF-alpha ) is a proinflammatory cytokine that has an important role in the regulation of airway smooth muscle tone and reactivity. We have shown previously that TNF-alpha upregulates the expression of Galpha i-2 protein without significantly increasing Gsalpha protein and enhances adenylyl cyclase inhibition by carbachol in cultured human airway smooth muscle cells (Hotta K, Emala CW, and Hirshman CA. Am J Physiol Lung Cell Mol Physiol 276: L405-L411, 1999). The present study was designed to investigate the molecular mechanisms by which TNF-alpha upregulates Galpha i-2 protein in these cells. TNF-alpha pretreatment for 48 h increased the expression of Galpha i-2 protein without significantly altering the Galpha i-2 protein half-life (41.0 ± 8.2 h for control and 46.8 ± 5.2 h for TNF-alpha -treated cells). Inhibition of new protein synthesis by cycloheximide blocked the increase in Galpha i-2 protein induced by TNF-alpha . Furthermore, TNF-alpha treatment for 12-24 h increased the steady-state level of Galpha i-2 mRNA without significantly altering Galpha i-2 mRNA half-life (9.0 ± 0.75 h for control and 8.9 ± 1.1 h for TNF-alpha -treated cells). The transcription inhibitor actinomycin D blocked the increase in Galpha i-2 mRNA induced by TNF-alpha . These observations indicate that the increase in Galpha i-2 protein induced by TNF-alpha is due to an increased rate of Galpha i-2 protein synthesis, most likely as a consequence of the transcriptional increase in the steady-state levels of its mRNA.

trachea; G protein; messenger ribonucleic acid half-life; protein half-life; antinomycin D; cycloheximide


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

CHRONIC INFLAMMATION is a characteristic feature of asthma. Tumor necrosis factor-alpha (TNF-alpha ) is a proinflammatory cytokine that is produced locally in the lung, in close proximity to the airway smooth muscle, and found in increased amounts in the airways of symptomatic patients with asthma (4). This cytokine also has an important role in increasing airway smooth muscle tone and reactivity. TNF-alpha impairs beta -adrenoceptor-mediated airway smooth muscle relaxation in the guinea pig (23) and rabbit (9) and enhances thrombin- and bradykinin-induced intracellular Ca2+ release and inositol phosphate turnover in cultured human airway smooth muscle cells (1). Moreover, inhaled TNF-alpha increases airway responsiveness to serotonin in rodents (13) and to methacholine in normal volunteers (21). TNF-alpha modulates the transcription of many genes via the nuclear factor-kappa B (NF-kappa B) family of transcription factors (11), but little is known regarding TNF-alpha -mediated regulation of the transcription of G protein alpha -subunits.

Multiple studies have demonstrated that changes in the expression of the heterotrimeric guanine nucleotide binding proteins (G proteins) effect downstream second messenger concentrations and signaling pathway function (15-18). One such second messenger, cAMP, is synthesized by the enzyme adenylyl cyclase that is regulated by both stimulatory (Gs) and inhibitory (Gi) protein pathways. The intracellular concentration of cAMP is a major determinant of airway smooth muscle tone.

TNF-alpha is known to modulate the expression of G protein alpha -subunits at the protein level. Changes in the expression of Gi protein by TNF-alpha have been reported in rat cardiomyocytes (17) and in human polymorphonuclear leukocytes (19). Our laboratory has investigated previously the effect of TNF-alpha on the expression and function of G protein alpha -subunits in cultured human airway smooth muscle cells (10). We found that TNF-alpha upregulated the expression of Galpha i-2 and Gqalpha proteins and enhanced adenylyl cyclase inhibition by carbachol and increased inositol phosphate synthesis without significantly increasing Gsalpha protein and muscarinic receptor expression (10), all of which would lead to increases in airway smooth muscle tone and reactivity.

Several mechanisms could contribute to the regulation of G protein alpha -subunit expression by TNF-alpha . TNF-alpha could potentially modify the synthesis or half-life of the G protein alpha -subunit at the level of the protein and/or the mRNA. Therefore, we investigated the molecular mechanisms by which TNF-alpha upregulates Galpha i-2 protein expression in cultured human airway smooth muscle cells. We examined the effect of TNF-alpha on the steady-state level of the Galpha i-2 protein, the half-life of the Galpha i-2 protein, the steady-state level of Galpha i-2 mRNA, and the half-life of Galpha i-2 mRNA. Moreover, we investigated the effects of protein synthesis inhibition or transcription inhibition on the TNF-alpha -induced changes in protein and mRNA amounts, respectively.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Cell culture. Primary cultures of previously characterized (22) human tracheal smooth muscle cells were a gift from Dr. Ian Hall (Queens Medical Center, Nottingham, UK). The cells were assumed to be homogeneous with regard to their responses to TNF-alpha in these studies. The cells were grown in 75-cm2 cell culture flasks containing culture medium (medium 199, 100 U/ml penicillin G, 100 µg/ml streptomycin, 0.25 µg/ml amphotericin B, and 10% fetal bovine serum) at 37°C in 5% CO2-95% air. The cells were plated on 24-well plates or 6-well plates and incubated until they reached confluence. Serum deprivation was started at the same time as the start of TNF-alpha treatments because these cells have limited survival with prolonged serum deprivation.

Immunoblot analysis. The expression of Galpha i-2 protein was determined by immunoblot analysis. The cells in 24-well plates were washed three times with serum-free medium at the end of the treatment and were lysed in 100 µl of sample buffer (62.5 mM Tris, pH 6.8, 2% SDS, 10% glycerol, and 5% beta -mercaptoethanol). Parallel samples were harvested for cell count and viability determinations using trypan blue staining. Twenty microliters of each sample were electrophoresed through 11% polyacrylamide gels at 80 V for 4 h. The separated proteins were transferred to polyvinylidene difluoride (PVDF) membranes at 20 V at room temperature for 16 h in transfer buffer (192 mM glycine, 25 mM Tris, and 10% methanol). After transfer, nonspecific protein binding was blocked in Tris-buffered saline (TBS; 2.42 g/l Tris, pH 7.6, and 8 g/l NaCl) containing 5% nonfat dry milk. Galpha i-2 protein antiserum AS/7 at 1:500 dilution in TBS-0.1% Tween 20 (TBS-T) containing 1% nonfat dry milk and 0.02% sodium azide was added, and the PVDF membranes were incubated with gentle rocking at room temperature for 2 h. After incubation with the primary antibody, the PVDF membranes were washed once for 15 min and three times for 5 min each with TBS-T. The PVDF membranes were then incubated for 1 h at room temperature in donkey anti-rabbit Ig conjugated to horseradish peroxidase at 1:10,000 dilution in TBS-T containing 1% nonfat dry milk. After incubation with conjugated secondary antibody, the PVDF membranes were washed once for 15 min and three times for 5 min each with TBS-T. The Galpha i-2 protein was detected with enhanced chemiluminescence immunoblotting reagents according to the manufacturer's recommendations (ECLplus; Amersham, Arlington Heights, IL), with subsequent exposure to autoradiography film. The intensities of resulting bands were quantified using a scanner coupled to a personal computer using MacBas 2.2 software. We confirmed that all band intensities fell within the linear range of the autoradiographic film (10). To correct for TNF-alpha -induced alteration in cell growth and the amount of protein applied to each lane, band intensity measurements were corrected for cell number.

Trypan blue exclusion. Because treatment with TNF-alpha or cycloheximide may affect growth of the cells, the immunoblot measurements were corrected for cell number. Cells were washed with serum-free medium three times. After being washed, the cells were detached with trypsin, and cell culture medium containing 10% BSA was added. The cells were stained with trypan blue and counted in a hemocytometer.

Steady-state level of Galpha i-2 protein. Confluent cells in 24-well plates were incubated in serum-free medium in the presence or absence of 10 ng/ml of TNF-alpha for 48 h. After three washes with serum-free medium 199, cells were lysed in 100 µl of gel sample buffer. Parallel samples were harvested for cell count and viability determinations using trypan blue staining. Quantity of Galpha i-2 protein was determined as described above.

Galpha i-2 protein half-life. Half-life of Galpha i-2 protein was determined by adding the protein translation inhibitor cycloheximide (1 µg/ml) to the cell culture medium and measuring the immunoblot band intensity for Galpha i-2 serially over 48 h. Preliminary experiments indicated that the dose of cycloheximide used blocked greater than 90% of new protein synthesis. The effect of TNF-alpha was assessed by adding TNF-alpha (10 ng/ml) to serum-free medium 48 h before cycloheximide was added. The medium and TNF-alpha were replaced every 24 h. Control cells were serum starved for 48 h before cycloheximide was added. The amount of Galpha i-2 protein present after cycloheximide addition was measured by immunoblot analysis at 0, 10, 24, 34, and 48 h in control or TNF-alpha -treated cells. In separate experiments, to determine whether newly translated protein contributes to the upregulation of Galpha i-2 protein under TNF-alpha -exposed conditions, cycloheximide or vehicle was added at the beginning of the TNF-alpha treatment. The level of Galpha i-2 protein after the combined TNF-alpha plus cycloheximide treatment for 48 h was examined by immunoblot analysis.

RNA extraction. Total cellular RNA was isolated by the single-step guanidinium isothiocyanate method (5) using Trizol reagent (GIBCO BRL, Grand Island, NY). The cells were lysed in Trizol reagent, and the RNA was extracted by adding chloroform followed by centrifugation at 10,000 g for 15 min. The supernatant was precipitated with isopropanol and centrifuged at 10,000 g for 10 min. After centrifugation, the pellet was washed with 75% ethanol, centrifuged at 7,500 g for 5 min, and air-dried for 5 min at room temperature. The pelleted RNA was resuspended in diethyl pyrocarbonate-treated water, and the absorbance was spectrophotometrically measured at 260/280 nm.

Preparation of Galpha i-2 riboprobe. A 317-bp cDNA that corresponded to nucleotides 298-614 of the human Galpha i-2 protein (GenBank accession no. J03004) was generated from total human brain RNA by RT-PCR (5'-primer, acagcaacaccatccactcca; 3'-primer, gcgggtccgtagcacatctt), and was inserted in vector pCRII-TOPO (Invitrogen, Carlsbad, CA). Hind III-linearized plasmid DNA served as the template for the transcription of an antisense single-strand UTP-biotin-labeled riboprobe using T7 RNA polymerase and the Maxiscript kit (Ambion, Austin, TX). The transcribed riboprobes were gel purified by electrophoresis on a 5% acrylamide-8 M urea gel, identified by short wavelength ultraviolet shadowing, cut from the gel, and eluted in elution buffer (0.5 M ammonium acetate, 1 mM EDTA, and 0.2% SDS) overnight. The absorbance of the riboprobe at 260/280 nm was spectrophotometrically measured, divided into aliquots, and stored at -80°C until used in ribonuclease protection assays.

Ribonuclease protection assay. Ribonuclease protection assay (RPA) was performed according to the manufacturer's protocol using the HybSpeed RPA kit (Ambion). A biotin-labeled antisense riboprobe for Galpha i-2 protein (10 ng) and sample RNA (5-10 µg) were precipitated and hybridized in 10 µl of hybridization buffer at 68°C for 10 min. After hybridization, the samples were incubated at 37°C for 30 min in a 100-µl cocktail of RNase T1/A (5 U/ml RNase A and 200 U/ml RNase T1) to digest the unprotected single-strand region of double-strand RNA fragments. The protected double-strand fragments from RNase digestion were precipitated, separated on a 5% acrylamide-8 M urea denaturing gel, transferred to positively charged nylon membrane using semidry blotting system at 400 mA for 30 min in transfer buffer (45 mM Tris, pH 8.0, 45 mM boric acid, and 1 mM EDTA), and detected using streptavidin-chemiluminescence detection reagents according to the manufacturer's recommendations (Bright-Star BioDetect, Ambion), with subsequent quantitation with the Flour-S chemiluminescent imaging system (Bio-Rad, Hercules, CA) coupled to Quantity One software (Bio-Rad). The sensitivity of this imaging system is linear over three log orders of chemiluminescence signal intensity. Preliminary experiments showed that increased amounts of RNA resulted in a linear increase in chemiluminescent signal.

Steady-state level of Galpha i-2 mRNA. The cells in six-well plates were incubated in serum-free medium in the presence and absence of 10 ng/ml of TNF-alpha for 12 and 24 h. Subsequently, the RNA was extracted as described above, and the level of Galpha i-2 mRNA was quantitated by RPA.

Galpha i-2 mRNA half-life. The half-life of mRNA was determined by adding the transcription inhibitor actinomycin D (5 µg/ml) to the cell culture medium and measuring the level of Galpha i-2 mRNA by RPA 0, 4, 8, and 12 h after adding actinomycin D. The effect of TNF-alpha was assessed by adding 10 ng/ml TNF-alpha to the serum-free medium 24 h before adding actinomycin D and during the actinomycin D treatment. Control cells were serum starved for 24 h before adding actinomycin D and incubated with actinomycin D plus vehicle only. In separate experiments, to determine whether inhibition of new transcription blocked the TNF-alpha -induced increase in Galpha i-2 mRNA, actinomycin D or vehicle was added at the beginning of the TNF-alpha treatment. The level of Galpha i-2 mRNA after the combined TNF-alpha plus actinomycin D treatment was examined at 12 h.

Materials. Galpha i-2 protein antisera (AS/7) were obtained from NEN (Boston, MA). Donkey anti-rabbit Ig was obtained from Amersham. PVDF membranes were obtained from Millipore (Bedford, MA). Cell culture reagents were obtained from GIBCO BRL. Human recombinant TNF-alpha expressed in yeast and all other reagents were obtained from Sigma (St. Louis, MO).

Statistics. All data are presented as means ± SE. Each study represents a separate individual experiment. Data for protein and mRNA half-life experiments were analyzed by a two-tailed paired Student's t-test. Nonparametric data were analyzed by the Wilcoxon signed rank test. The null hypothesis was rejected when P < 0.05.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Steady-state level of Galpha i-2 protein. TNF-alpha treatment for 48 h significantly increased the expression of Galpha i-2 protein by 55% (Fig. 1; arbitrary intensities of immunoblots corrected for cell number = 25,487 ± 6,067 and 37,587 ± 7,810 for control and TNF-alpha -treated cells, respectively; P = 0.008, n = 9 independent experiments). Total cell numbers did not change during 48 h of TNF-alpha treatment (control, 20,400 ± 4,000 cells/well; TNF-alpha -treated, 17,400 ± 8,600 cells/well; n = 9, P > 0.05). A representative time-course experiment for TNF-alpha effects on Galpha i-2 protein is shown in Fig. 2. No changes in Galpha i-2 protein quantity were seen at 12 or 24 h of TNF-alpha treatment.


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 1.   The effect of tumor necrosis factor-alpha (TNF-alpha ) treatment for 48 h on the expression of Galpha i-2 protein in cultured human airway smooth muscle cells. A: representative immunoblot analysis of Galpha i-2 protein. Cells treated with and without 10 ng/ml TNF-alpha were subjected to SDS-PAGE, transferred to polyvinylidene difluoride (PVDF) membranes, and incubated with Galpha i-2 protein antiserum AS/7 and then with donkey anti-rabbit Ig. Bands for Galpha i-2 protein were detected on autoradiography films after development using enhanced chemiluminescence detection reagents. B: bar graph represents the level of Galpha i-2 protein expressed as percent of control. Data are means ± SE, n = 9 experiments. TNF-alpha treatment for 48 h significantly increased the Galpha i-2 protein level by 55%. * P < 0.05 compared with control.



View larger version (12K):
[in this window]
[in a new window]
 
Fig. 2.   Representative experiment of time-course effects of TNF-alpha treatment on Galpha i-2 mRNA (A) and protein expression (B). Increases in Galpha i-2 mRNA were detected before increases in Galpha i-2 protein.

Galpha i-2 protein half-life. To investigate the mechanisms by which TNF-alpha upregulated the expression of Galpha i-2 protein, the half-life of Galpha i-2 protein in control and TNF-alpha -treated cells was examined by measuring the Galpha i-2 protein level at 0, 10, 24, 34, and 48 h after the addition of cycloheximide. There was no significant difference in cell viability 48 h after the addition of cycloheximide between control and TNF-alpha -treated cells (data not shown). There was also no significant change in cell numbers in the presence or absence of cycloheximide for 48 h (control, 27,760 ± 7,640 cells/well; cycloheximide, 24,320 ± 6,520 cells/well; n = 5, P = 0.56). The half-life of Galpha i-2 protein was 41.0 ± 8.2 and 46.8 ± 5.2 h for control and TNF-alpha -treated cells, respectively (P = 0.15, n = 4 independent experiments; Fig. 3), indicating that the upregulation of Galpha i-2 protein induced by TNF-alpha was not caused by a longer protein half-life. Based on this observation, to test the hypothesis that increased synthesis of Galpha i-2 protein is responsible for the upregulation of Galpha i-2 protein induced by TNF-alpha , cycloheximide was added at the beginning of the 48-h treatment with TNF-alpha or vehicle, and the level of Galpha i-2 protein was measured. Coincubation of TNF-alpha -treated cells with cycloheximide blocked the increase in Galpha i-2 protein induced by TNF-alpha . The amount of Galpha i-2 protein in the control and TNF-alpha -treated cells was not significantly different when cycloheximide was included at the beginning of TNF-alpha treatment (Fig. 4; arbitrary intensities of immunoblots corrected for cell number = 7,632 ± 2,075 and 7,503 ± 2,491 for control and TNF-alpha -treated cells, respectively; P = 0.69, n = 5 independent experiments). These data support the finding that TNF-alpha -induced increases in Galpha i-2 protein were not due to a change in protein half-life but were occurring by a mechanism involving increased synthesis of new protein.


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 3.   The effect of TNF-alpha on the half-life of Galpha i-2 protein in cultured human airway smooth muscle cells. A: representative decay of Galpha i-2 protein. The half-life of the Galpha i-2 protein was determined by measuring the level of Galpha i-2 protein serially over 48 h after the addition of cycloheximide. Cells were treated with and without TNF-alpha for 48 h before and 48 h after cycloheximide. B: bar graph represents the half-life of Galpha i-2 protein. Data are means ± SE, n = 4 experiments. There was no significant difference in the half-life of Galpha i-2 protein between control and TNF-alpha -treated cells.



View larger version (8K):
[in this window]
[in a new window]
 
Fig. 4.   The effect of cycloheximide on the increase in the Galpha i-2 protein induced by TNF-alpha in cultured human airway smooth muscle cells. The level of Galpha i-2 protein was determined after the cells were treated with cycloheximide in the presence and absence of TNF-alpha for 48 h. Data expressed as percent of control are means ± SE, n = 5 experiments. There was no significant difference in the level of Galpha i-2 protein in control and TNF-alpha -treated cells when the cells were coincubated with cycloheximide, suggesting that new protein synthesis was necessary for the observed upregulation of Galpha i-2 protein by TNF-alpha .

Steady-state level of Galpha i-2 mRNA. Treatment with TNF-alpha for 12 and 24 h significantly increased the steady-state level of Galpha i-2 mRNA by 57% (arbitrary densities of bands = 15,979 ± 2,784 and 23,099 ± 3,314 for control and 12-h TNF-alpha -treated cells, respectively; P = 0.001, n = 14 independent experiments) and 73% (arbitrary densities of bands = 11,119 ± 2,586 and 16,549 ± 4,406 for control and 24-h TNF-alpha -treated cells, respectively; P = 0.046, n = 6 independent experiments; Fig. 5). This increase in Galpha i-2 mRNA occurred earlier than the detected increase in Galpha i-2 protein (Fig. 2).


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 5.   The effect of TNF-alpha on the steady-state level of Galpha i-2 mRNA in cultured human airway smooth muscle cells. A: representative RNase protection assay of Galpha i-2 mRNA. RNA extracted from the cells treated with and without TNF-alpha were hybridized with UTP-biotin- labeled riboprobe that is complementary to a part of Galpha i-2 mRNA, and the unprotected single-strand region of double-strand RNA fragments were digested with RNase T1/A. The protected fragments were separated on acrylamide-urea denaturing gel, transferred to positively charged nylon membranes, and detected using streptavidin-chemiluminescence detection reagents. Lane 1, control; lane 2, 12-h TNF-alpha ; lane 3, 24-h TNF-alpha ; lane 4, control ribonuclease protection assay (RPA; yeast control RNA) with RNase digestion; lane 5, control RPA (yeast control RNA) without RNase digestion showing the full-length riboprobe. B: bar graph represents the steady-state level of Galpha i-2 mRNA expressed as percent of control. Data are means ± SE, n = 14 experiments for the 12-h TNF-alpha group and 6 experiments for the 24-h TNF-alpha group. TNF-alpha treatment for 12 and 24 h significantly increased the steady-state level of Galpha i-2 mRNA by 57 and 73%, respectively. * P < 0.05 compared with control.

The amount of total RNA recovered from control and TNF-alpha -treated cells was not different at either 12 or 24 h (12 h: control, 16.5 ± 2.4 µg RNA/2 wells of a 6-well plate; TNF-alpha , 16.3 ± 2.0 µg RNA/2 wells of a 6-well plate; n = 10, P = 0.87; 24 h: control, 12.2 ± 2.6 µg RNA/2 wells of a 6-well plate; TNF-alpha , 12.3 ± 2.6 µg RNA/2 wells of a 6-well plate; n = 6, P = 0.95).

Galpha i-2 mRNA half-life. To investigate the mechanisms by which TNF-alpha upregulated the steady-state level of Galpha i-2 mRNA, the half-life of Galpha i-2 mRNA was determined by measuring the level of Galpha i-2 mRNA at 0, 4, 8, and 12 h after the addition of the transcription inhibitor actinomycin D. Actinomycin D for 12 h had no significant effect on the yield of total RNA (control, 22.8 ± 2.2 µg/2 wells of a 6-well plate; actinomycin D, 20.0 ± 1.8 µg/2 wells of a 6-well plate; n = 5, P = 0.37). The half-lives of Galpha i-2 mRNA were 9.0 ± 0.75 and 8.9 ± 1.1 h in control and TNF-alpha -treated cells, respectively (P = 0.87, n = 6 independent experiments; Fig. 6). These data indicate that the upregulation of Galpha i-2 mRNA was not due to a longer mRNA half-life. Based on this observation, we next tested the hypothesis that increased transcription of Galpha i-2 mRNA in cells exposed to TNF-alpha was responsible for the upregulation of Galpha i-2 mRNA. Actinomycin D was added at the beginning of the treatment with TNF-alpha or vehicle, and the level of Galpha i-2 mRNA was measured. Coincubation of cells with both TNF-alpha and actinomycin D blocked the increase in Galpha i-2 mRNA induced by TNF-alpha . The level of Galpha i-2 mRNA was not significantly different in control cells and TNF-alpha -treated cells when actinomycin D was included at the beginning of the TNF-alpha treatment (Fig. 7; arbitrary densities of bands = 1,804 ± 513 and 1,361 ± 399 for control and TNF-alpha -treated cells, respectively; P = 0.35, n = 5 independent experiments). These data suggest that the upregulated Galpha i-2 mRNA induced by TNF-alpha was due to increased transcription.


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 6.   The effect of TNF-alpha on the half-life of Galpha i-2 mRNA in cultured human airway smooth muscle cells. A: representative decay of Galpha i-2 mRNA. The half-life of the Galpha i-2 mRNA was determined by measuring the level of Galpha i-2 mRNA serially over 12 h after the addition of actinomycin D. Cells were treated with vehicle or TNF-alpha for 24 h before and 12 h after actinomycin D. B: bar graph represents the half-life of Galpha i-2 mRNA. Data are means ± SE, n = 6 experiments. There was no significant difference in the half-life of Galpha i-2 mRNA between control and TNF-alpha -treated cells.



View larger version (8K):
[in this window]
[in a new window]
 
Fig. 7.   The effect of actinomycin D on the increase in the Galpha i-2 mRNA induced by TNF-alpha in cultured human airway smooth muscle cells. The level of Galpha i-2 mRNA was determined after the cells were treated with actinomycin D in the presence and absence of TNF-alpha for 12 h. Data are expressed as percent of control and represent the means ± SE, n = 5 experiments. There was no significant difference in the level of Galpha i-2 mRNA in control and TNF-alpha -treated cells when the cells were coincubated with actinomycin D, suggesting new mRNA transcription was necessary for the observed increase in Galpha i-2 mRNA by TNF-alpha .


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

In the present study, TNF-alpha treatment increased the expression of Galpha i-2 protein and Galpha i-2 mRNA without a significant effect on the protein or mRNA half-life in cultured human airway smooth muscle cells. Inhibition of new protein synthesis by concurrent cycloheximide treatment blocked the increase in Galpha i-2 protein induced by TNF-alpha . Inhibition of new mRNA synthesis by concurrent actinomycin D treatment blocked the increase in Galpha i-2 mRNA induced by TNF-alpha . Taken together, these observations suggest that TNF-alpha upregulates the expression of Galpha i-2 protein secondary to an increase in the transcription of Galpha i-2 mRNA.

Many stimuli regulate the amount of Galpha i-2 protein and/or mRNA in cells. The time course appears to vary with the stimulus and with the cell type. In rat ventricular myocytes, thyroid hormone treatment for 48 h decreased the expression of Galpha i-2 protein (2). Twenty-four hours of forskolin or isoproterenol exposure increased both Galpha i-2 protein and mRNA expression in S49 mouse lymphoma cells (7). In contrast, in rat astrocytes, forskolin and isoproterenol increased Galpha i-2 protein and mRNA in only 6-9 h; this value returned to baseline values at 24 h of persistent forskolin or isoproterenol exposure (12). In rat Sertoli cells, 4 h of follicle-stimulating hormone decreased Galpha i-2 mRNA (14).

Three previous studies investigated the effects of TNF-alpha on Galpha i-2 protein or mRNA. In rat cardiomyocytes, 48 h of TNF-alpha increased Galpha i-2 protein (17), and we have shown previously an increase in Galpha i-2 protein after 72 h of TNF-alpha treatment in human airway smooth muscle cells (24). In contrast to these chronic effects of TNF-alpha , in human polymorphonuclear leukocytes, TNF-alpha , in a cycloheximide-sensitive manner, both upregulated Galpha i-2 protein and downregulated Galpha i-2 mRNA, with no change in transcription, after only 10 min of exposure (19). This suggests that the mechanism of acute regulation of Galpha i-2 in polymorphonuclear leukocytes occurs at the level of translation, resulting in both increased Galpha i-2 protein translation and decreased stability of Galpha i-2 mRNA. This is in contrast to the present study in which chronic (12-48 h) TNF-alpha treatment increased Galpha i-2 mRNA transcription. It is possible that the mechanisms by which TNF-alpha regulates Galpha i-2 protein and mRNA expression differ during acute and chronic TNF-alpha exposure and that different cell types have completely different mechanisms for regulating Galpha i-2 in response to TNF-alpha .

The half-life of Galpha i-2 protein found in human airway smooth muscle cells in the present study (45 h) is similar to that found in neonatal rat ventricular myocytes (46 h) (2) but differs from the half-life of Galpha i-2 protein measured in S49 mouse lymphoma cells (76 h) (7). The differences in the Galpha i-2 protein half-lives reported in different studies are likely due to the differences among cell types studied and/or the cell culture conditions employed. This is exemplified by studies of other G protein alpha -subunits. Different half-lives of the G protein Goalpha were reported in different cells from the same species (28 h in GH4 pituitary cells and 72 h in cardiomyocytes) (20).

The half-life of mRNA encoding G protein alpha -subunits also appears to be cell-type specific. The half-lives of Galpha i-2 mRNA in previous studies are variable [44 h in Sertoli cells (14), 48 h in cardiomyocytes (2), and ~0.7-3.5 h in astroglial cells (12)]. In the present study, the Galpha i-2 mRNA half-life was 9.3 and 9.4 h in the absence and presence of TNF-alpha , respectively. Taken together, these studies suggest a wide variation in Galpha i-2 mRNA half-life that like the Galpha i-2 protein half-life is cell-type specific and perhaps influenced by varying cell culture conditions used in different studies.

Both the Galpha i-2 protein and mRNA levels were upregulated by TNF-alpha in the present study. Preliminary experiments indicated that the increase in the level of Galpha i-2 protein induced by TNF-alpha was seen after 48 and 72 h but not after 24 h of pretreatment. However, the increase in Galpha i-2 mRNA induced by TNF-alpha occurred much earlier; it was seen after 12-24 h of TNF-alpha pretreatment. Thus we chose to measure Galpha i-2 protein levels after treatment with TNF-alpha for 48 h and to measure Galpha i-2 mRNA levels after treatment with TNF-alpha for 24 h. This delay in the measured increase in Galpha i-2 protein following an earlier increase in mRNA is consistent with the study of Hadcock et al. (7) in which forskolin-stimulated mRNA increases were measurable at 12 h, with sustained protein increases measured at 24 h. Barrett et al. (3) found that both the melatonin receptor mRNA and its protein were upregulated by forskolin in ovine pars tuberalis cells but that the upregulation of mRNA occurred earlier than that of protein. In studies in which mRNA levels have been related to the rate of protein synthesis, a good correlation has usually but not always been observed. Some studies have shown simultaneous regulation of both mRNA and protein levels (6, 8). It is possible that other mechanisms that regulate protein level, such as translational efficiency, mRNA splicing, or other intracellular signaling pathway(s) are involved in the TNF-alpha -induced upregulation of Galpha i-2 protein.

TNF-alpha is known to be a pleomorphic regulator of gene expression through activation of preexisting transcription factors of the NF-kappa B family. Thus the present study adds a G protein alpha -subunit to the long list of signaling proteins that are known to be regulated by TNF-alpha (11). TNF-alpha is produced locally in the lung, in close proximity to airway smooth muscle, and increased concentrations have been reported in the airways of symptomatic asthmatics (4). TNF-alpha impairs beta -adrenoceptor-mediated airway smooth muscle relaxation in animal models (23) and enhances methacholine airway responses in humans (13). Increased expression of Galpha i-2 protein is one cellular signaling mechanism that could account for these airway effects of TNF-alpha . Moreover, increased expression of Galpha i-2 in airway smooth muscle could contribute to an increase in airway smooth muscle tone by Galpha i-2-mediated inhibition of adenylyl cyclase, with resultant decreases in cellular cAMP levels. Thus the present study provides a possible mechanism to account for contribution of TNF-alpha to impaired airway smooth muscle relaxation in asthmatic airways.

In summary, TNF-alpha upregulated the level of Galpha i-2 protein and mRNA without significant effect on the half-life of Galpha i-2 protein and mRNA in cultured human airway smooth muscle cells. The increase in Galpha i-2 protein induced by TNF-alpha is due to increased rate of Galpha i-2 protein synthesis, most likely as a consequence of the transcriptional increase in the steady-state levels of its mRNA.


    ACKNOWLEDGEMENTS

We thank Dr. Ian Hall, Queens Medical Centre, Nottingham, UK, for kindly providing the primary cultures of human airway smooth muscle cells used in this study.


    FOOTNOTES

Address for reprint requests and other correspondence: C. W. Emala, Dept of Anesthesiology, College of Physicians and Surgeons of Columbia Univ., 630 W. 168th St. P&S Box 46, New York, New York 10032 (E-mail: cwe5{at}columbia.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Received 23 August 1999; accepted in final form 21 March 2000.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Amrani, Y, Krymskaya V, Maki C, and Panettieri RA. Mechanisms underlying TNF-alpha effects on agonist-mediated calcium homeostasis in human airway smooth muscle cells. Am J Physiol Lung Cell Mol Physiol 273: L1020-L1028, 1997[Abstract/Free Full Text].

2.   Bahouth, SW. Thyroid hormone regulation of transmembrane signaling in neonatal rat ventricular myocytes by selective alteration of the expression and coupling of G-protein alpha -subunits. Biochem J 307: 831-841, 1995.

3.   Barrett, P, Maclean A, Davidson G, and Morgan WKC Regulation of the Mel 1a melatonin receptor mRNA and protein levels in the ovine pars tuberalis: evidence for a cyclic adenosine 3',5'-monophosphate-independent Mel 1a receptor coupling and autoregulatory mechanism of expression. Mol Endocrinol 10: 892-902, 1996[Abstract/Free Full Text].

4.   Broide, DH, Lotz M, Cuomo AJ, Coburn DA, Federman EC, and Wasserman SI. Cytokines in symptomatic asthmatic airways. J Allergy Clin Immunol 89: 958-967, 1992[Web of Science][Medline].

5.   Chomczynski, P, and Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156-159, 1987[Web of Science][Medline].

6.   Eschenhagen, T, Diederich M, Kluge SH, Magnussen O, Mene U, Muller F, Schmitz W, Scholz H, Weil J, Sent U, Schaad A, Scholtysik G, Wuthrich A, and Gaillard C. Bovine hereditary cardiomyopathy: an animal model of human dilated cardiomyopathy. J Mol Cell Cardiol 27: 357-370, 1995[Web of Science][Medline].

7.   Hadcock, JR, Ros M, Watkins DC, and Malbon CC. Cross-regulation between G protein-mediated pathways. J Biol Chem 265: 14784-14790, 1990[Abstract/Free Full Text].

8.   Haddad, E-B, Rousell J, Linalsay MA, and Barnes PJ. Synergy between tumor necrosis factor alpha  and interleukin 1beta in inducing transcriptional down-regulation of muscarinic M2 receptor gene expression. J Biol Chem 271: 32586-32592, 1996[Abstract/Free Full Text].

9.   Hakonarson, H, Herrick DJ, Gonzales-Serrano P, and Grunstein MM. Mechanism of cytokine-induced modulation of beta -adrenoceptor responsiveness in airway smooth muscle. J Clin Invest 97: 2593-2600, 1996[Web of Science][Medline].

10.   Hotta, K, Emala CW, and Hirshman CA. TNF-alpha upregulates Gialpha and Gqalpha protein expression and function in human airway smooth muscle cells. Am J Physiol Lung Cell Mol Physiol 276: L405-L411, 1999[Abstract/Free Full Text].

11.   Jaattela, M. Biologic activities and mechanisms of action of tumor necrosis factor-alpha /cachectin. Lab Invest 64: 724-742, 1991[Web of Science][Medline].

12.   Jamali, AE, Rachdaoui N, Dib K, and Correze C. Cyclic AMP regulation of Gialpha (2) and Gialpha (3) mRNAs and proteins in astroglial cells. J Neurochem 71: 2271-2277, 1998[Medline].

13.   Kips, JC, Tavernier J, and Pauwels RA. Tumor necrosis factor causes bronchial hyperresponsiveness in rats. Am Rev Respir Dis 145: 332-336, 1992[Web of Science][Medline].

14.   Loganzo, F, Jr, and Fletcher PW. Follicle-stimulating hormone increases the turnover of G-protein alpha i-1- and alpha i-2-subunit messenger RNA in Sertoli cells by a mechanism that is independent of protein synthesis. Mol Endocrinol 7: 434-440, 1993[Abstract/Free Full Text].

15.   MacLeod, KG, and Milligan G. Biphasic regulation of adenylate cyclase by cholera toxin in neuroblastoma X glioma hybrid cells is due to the activation and subsequent loss of the alpha subunit of the stimulatory GTP binding protein (Gs). Cell Signal 2: 139-151, 1990[Web of Science][Medline].

16.   Paulssen, RH, Paulssen EJ, Gautvik KM, and Gordeladze JO. The thyroliberin receptor interacts directly with a stimulatory guanine-nucleotide-binding protein in the activation of adenylyl cyclase in GH3 rat pituitary tumor cells. Evidence obtained by the use of antisense RNA inhibition and immunoblocking of the stimulatory guanine-nucleotide-binding protein. Eur J Biochem 204: 413-418, 1992[Web of Science][Medline].

17.   Reithmann, C, Gierschik P, Werdan K, and Jakobs KH. Tumor necrosis factor alpha  up-regulates Gialpha and Gbeta proteins and adenylyl cyclase responsiveness in rat cardiomyocytes. Eur J Pharmacol 206: 53-60, 1991[Web of Science][Medline].

18.   Sawutz, DG, Singh SS, Tiberio L, Koszewski E, Johnson CG, and Johnson CL. The effect of TNFalpha on bradykinin receptor binding, phosphatidylinositol turnover and cell growth in human A431 epidermoid carcinoma cells. Immunopharmacology 24: 1-10, 1992[Web of Science][Medline].

19.   Scherzer, JA, Lin Y, McLeish KR, and Klein JB. TNF translationally modulates the expression of G protein alpha i2 subunits in human polymorphonuclear leukocytes. J Immunol 158: 913-918, 1997[Abstract].

20.   Silbert, S, Lee MR, and Neer EJ. Differential degradation rates of the G protein alpha o in cultured cardiac and pituitary cells. J Biol Chem 265: 3102-3195, 1990[Abstract/Free Full Text].

21.   Thomas, PS, Yates DH, and Barnes PJ. Tumor necrosis factor-alpha increases airway responsiveness and sputum neutrophilia in normal human subjects. Am J Respir Crit Care Med 152: 76-80, 1995[Abstract].

22.   Widdop, S, Daykin K, and Hall IP. Expression of muscarinic M2 receptors in cultured human airway smooth muscle cells. Am J Respir Cell Mol Biol 9: 541-546, 1993.

23.   Wills-Karp, M, Uchida Y, Lee JY, Jinot J, Hirata A, and Hirata F. Organ culture with proinflammatory cytokines reproduces impairment of the beta -adrenoceptor-mediated relaxation in tracheas of a guinea pig antigen model. Am J Respir Cell Mol Biol 8: 153-159, 1993.

24.   Yoshie, Y, Kunihiko I, and Nakazawa T. The inhibitory effect of a selective alpha 2-adrenergic receptor antagonist on moderate to severe asthma. J Allergy Clin Immunol 84: 747-752, 1989[Web of Science][Medline].


Am J Physiol Lung Cell Mol Physiol 279(2):L319-L325
1040-0605/00 $5.00 Copyright © 2000 the American Physiological Society



This article has been cited by other articles:


Home page
ThoraxHome page
P H Howarth, K S Babu, H S Arshad, L Lau, M Buckley, W McConnell, P Beckett, M Al Ali, A Chauhan, S J Wilson, et al.
Tumour necrosis factor (TNF{alpha}) as a novel therapeutic target in symptomatic corticosteroid dependent asthma
Thorax, December 1, 2005; 60(12): 1012 - 1018.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
D. A. Deshpande, T. A. White, S. Dogan, T. F. Walseth, R. A. Panettieri, and M. S. Kannan
CD38/cyclic ADP-ribose signaling: role in the regulation of calcium homeostasis in airway smooth muscle
Am J Physiol Lung Cell Mol Physiol, May 1, 2005; 288(5): L773 - L788.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
I. Hunter, H. J. Cobban, P. Vandenabeele, D. J. MacEwan, and G. F. Nixon
Tumor Necrosis Factor-alpha -Induced Activation of RhoA in Airway Smooth Muscle Cells: Role in the Ca2+ Sensitization of Myosin Light Chain20 Phosphorylation
Mol. Pharmacol., March 1, 2003; 63(3): 714 - 721.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
L. J. Janssen
Ionic mechanisms and Ca2+ regulation in airway smooth muscle contraction: do the data contradict dogma?
Am J Physiol Lung Cell Mol Physiol, June 1, 2002; 282(6): L1161 - L1178.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (11)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hotta, K.
Right arrow Articles by Emala, C. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hotta, K.
Right arrow Articles by Emala, C. W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online