|
|
||||||||
1 Biocenter Oulu, 2 Department of Pediatrics, and 3 Department of Pathology, University of Oulu, 90014 Oulu, Finland; and 4 Department of Biochemistry and Cell Biology, Faculty of Veterinary Medicine, Utrecht University, 3508 TD Utrecht, The Netherlands
| |
ABSTRACT |
|---|
|
|
|---|
Surfactant protein (SP) B is an essential component of the pulmonary surfactant complex, which participates in reducing the surface tension across the alveolar air-liquid interface. The Eustachian tube (ET) connects the upper respiratory tract to the middle ear, serving as an intermittent airway between the pharynx and the middle ear. Recently, we described the expression of SP-A and SP-D in the ET, suggesting their role in middle ear host defense. Our present aim was to detect whether the expression of SP-B is evident in the porcine ET. With Northern blot analysis, RT-PCR, and in situ hybridizations, SP-B mRNA was identified and localized in the ET epithelium. The cellular localization of SP-B was revealed with immunohistochemistry, electron microscopy, and immunoelectron microscopy. The protein was found in the secretory granules of epithelial cells and also attached to the microvilli at the luminal side of these cells. The SP-B immunoreactivity of aggregates isolated from ET lavage fluid was similar to that isolated from bronchoalveolar lavage fluid. We conclude that there are specialized cells in the ET epithelium expressing and secreting SP-B and propose that SP-B may facilitate normal opening of the tube and mucociliary transport.
in situ hybridization; immunoelectron microscopy; messenger ribonucleic acid
| |
INTRODUCTION |
|---|
|
|
|---|
PULMONARY SURFACTANT PREVENTS alveolar collapse by reducing the surface tension across the air-liquid interface of the alveoli. The pulmonary surfactant complex consists of ~90% lipid and 10% protein, including four surfactant proteins (SPs). SP-C is a highly hydrophobic alveolar type II epithelial cell-specific protein that contributes to the formation and maintenance of the surface-active monolayer, whereas SP-A and SP-D, being C-type lectins, participate in surfactant homeostasis and host defense. SP-B is an essential protein required for the normal processing of the surfactant components in alveolar type II epithelial cells (1). The primary translation product of human SP-B mRNA consists of 381 amino acids. Through a proprotein state of 42 kDa and further processing of a 23-kDa intermediate form, the mature hydrophobic peptide containing 79 amino acids is secreted into the alveolar lumen as a disulfide-linked dimer of 18 kDa (21). SP-B precursors are detected in the endoplasmic reticulum, the Golgi complex, and the multivesicular bodies in alveolar type II epithelial cells, whereas mature SP-B is found in multivesicular and lamellar bodies where it is stored and secreted into the alveolar space (28). Mature SP-B increases the surface adsorption and decreases the surface tension of surfactant phospholipids as required for normal lung function (3). Hereditary SP-B deficiency in human infants results in fatal respiratory failure after birth (20). Similarly, mice with deleted SP-B expression develop lethal respiratory failure at birth. Studies on transgenic mice have further indicated the critical role of SP-B in the maintenance of pulmonary surfactant homeostasis (6).
Apart from alveolar type II epithelial cells, SP-B is expressed in nonciliated bronchiolar epithelial (Clara) cells (23). So far, SP-B protein has not been localized in Clara cells in vivo, and only little is known about the processing of SP-B in these secretory cells. However, it seems that SP-B processing and function in Clara cells could differ from that in alveolar type II epithelial cells (17, 21).
The Eustachian tube (ET) embryonically develops from the first pharyngeal pouch, which connects the upper respiratory tract to the middle ear. The ET protects the middle ear from excessive deviations of atmospheric pressure, serves as the clearance tract, and may protect the middle ear against microbes from the airways. The upper ET compartment is closely sheltered by cartilage, and the lower compartment has an elongated lumen with numerous inferior mucosal folds. The assumed ventilatory function is accomplished by the pharyngeal muscles that pull apart the mucous surfaces of the cartilaginous ET (19). The ET epithelium includes cuboidal epithelial cells with microvilli, defined as dark or intermediary granulated cells, columnar ciliated cells, and goblet cells. Ciliated cells are responsible for mucociliary transport, whereas granulated cells are considered secretory (16).
Recently, the expression of SP-A and SP-D in porcine ET epithelium was described (22). Dutton et al. (8) have also described a PCR product with SP-B-specific primers from rabbit middle ear. Mira et al. (18) detected phospholipid-containing lamellar structures on the mucosa of the rabbit ET, and Karchev et al. (14) reported similar findings in the mouse ET. The tubal mucosa does not differ remarkably from the other mucosae of the respiratory system (12) morphologically, and several studies (4, 11, 15) have tentatively shown that ET lavage (ETL) fluid contains surface-active material. However, there have been no studies concerning the expression of SP-B in the ET or the morphology of porcine ET epithelium thus far. The present aim was to find out whether the expression of SP-B is evident in the porcine ET. Here, we describe the cellular and subcellular expression of SP-B in ET epithelium and demonstrate the presence of SP-B-containing aggregates in the lavage return from the ET.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Porcine ET preparation and bronchoalveolar lavage. The pharyngeal opening of the ET was prepared, and ~1 cm of the ET was dissected. The ET section was opened, and the cells were scraped with a scalpel. Total RNA was isolated with phenol-based RNA-STAT 60 (Tel-Test) and subsequently used for RT-PCR and Northern blot analysis. Total RNA from the porcine lung tissue was isolated as a control. For protein preparations, the ET was lavaged with 0.9% NaCl as previously described (22). Bronchoalveolar lavage (BAL) was performed as a control. Briefly, the trachea was cannulated, and the airways were filled with 0.9% NaCl at a pressure of 30 cmH2O. The fluid was collected from the airways with gentle suction. The procedure was repeated three times, and the lavage returns were combined.
Northern analysis of SP-B.
For Northern analysis, total RNA was isolated as described in
Porcine ET preparation and bronchoalveolar lavage.
As a control to hybridization, porcine lung RNA was isolated after
homogenization of the tissue at
80°C. Altogether, 0.5 µg of lung
RNA and 30 µg of ET RNA were run on formaldehyde gels. The samples
were transferred with 20× saline-sodium citrate (SSC; 1× SSC is 0.15 M NaCl and 0.015 M sodium citrate, pH 7.0) overnight onto a Biodyne B
membrane (Pall Gelman Laboratory), and the filter was baked at 80°C
for 2 h. For Northern hybridization, the SP-B cDNA fragment from
the porcine lung was labeled with [32P]dCTP.
Cloning of cDNA fragments for ET SP-B. Altogether, 2 µg of total RNA were used for the RT-PCR with porcine-specific SP-B primers. These primers were designed from the porcine lung cDNA sequence (GenBank accession number AJ290968) obtained with degenerative primers. The forward porcine-specific primer was chosen from a cDNA area coding for SP-B proprotein (CTTTCCGCTGGTCGTTGATCAC), and the reverse primer was from the area coding for mature SP-B (CCTGCAGAGCCAGCAGAAGGG), resulting in a fragment of 244 bp, corresponding to the area bp 357-600 in the sheep SP-B cDNA sequence (GenBank accession number AF107544). The RT-PCRs were performed with the Masteramp RT-PCR kit (Epicentre, Madison, WI) with a 1× enhancer in a one-tube reaction. A 45-cycle RT-PCR was carried out (60°C for 20 min, 94°C for 5 min, 94°C for 30 s, 62°C for 30 s, 72°C for 45 s, and 72°C for 10 min). The resulting fragments were purified with the GFX purification kit (Amersham Pharmacia Biotech) and ligated to the pGEM-T easy vector (Promega, Madison, WI). The clones obtained were identified by sequencing on both strands.
Antibodies. The monoclonal antibody against porcine SP-B was a kind gift from Dr. Y. Suzuki (Kyoto University, Kyoto, Japan) (26). The polyclonal antibody against sheep SP-B was a kind gift from Prof. S. Hawgood (University of California, San Francisco, CA).
Immunohistochemistry. Cross sections of the ET were deparaffinized in xylene, rehydrated in graded ethanol, and rinsed in 1× phosphate-buffered saline (PBS). Antigen retrieval was performed in 0.1% trypsin in 0.1% CaCl2, pH 7.8, at 37°C for 10 min. Endogenous peroxidase was blocked with aqueous 0.3% H2O2 for 15 min. An avidin-biotin-peroxidase method was applied. PBS was used at all washing steps, and the primary and secondary antibodies were diluted in PBS containing 0.1% bovine serum albumin (BSA). Briefly, the sections were incubated in 20% fetal calf serum followed by overnight incubation with the antibody to porcine SP-B (diluted 1:1,000). The sections were then incubated in biotinylated rabbit anti-mouse IgG (Dakopatts, Glostrup, Denmark) for 30 min. After addition of the secondary antibody, the sections were treated with the avidin-biotin-peroxidase complex (Dakopatts) for 30 min. Diaminobenzidine (Sigma, St. Louis, MO) was used as the chromogen, and the sections were slightly counterstained with Mayer's hematoxylin. PBS replaced the primary antibody as a negative control. Sections of porcine lung tissue served as positive controls.
Electron microscopy. For electron microscopy, tissue pieces from porcine ETs were fixed in 2.5% glutaraldehyde in 0.1 M phosphate buffer, pH 7.4. They were then postfixed in 1% osmium tetroxide in phosphate buffer, dehydrated in acetone, and embedded in Epon LX 112. Thin sections were cut with a Reichert Ultracut E microtome and examined under a Philips CM 100 transmission electron microscope with an acceleration voltage of 80 kV.
Immunoelectron microscopy. The procedure of immunoelectron microscopy was modified from the method described by Sormunen et al. (25). Fresh porcine ET and lung tissues were fixed in 4% paraformaldehyde in 0.1 M phosphate buffer, pH 7.4, for 2 h. Small tissue pieces were immersed in 2.3 M sucrose and frozen in liquid nitrogen. Thin cryosections were cut with a Leica Ultracut UCT microtome. For immunolabeling, the sections were first incubated in 5% BSA in PBS. Antibodies and gold conjugate were diluted in 0.1% BSA-c (Aurion, Wageningen, The Netherlands) in PBS. All washings were performed in 0.1% BSA-c in PBS. The sections were then incubated with the antibody to porcine SP-B for 60 min. After being washed, the sections were exposed to rabbit anti-mouse IgG (Zymed Laboratories, San Francisco, CA) for 30 min followed by a protein A-gold complex (size 10 nm) for 30 min, prepared as recommended by Slot and Geuze (24). The controls were prepared by carrying out the labeling procedure without the primary antibody. The sections were embedded in methylcellulose and examined as described in Electron microscopy.
In situ hybridization. In situ hybridization was carried out basically according to the instructions supplied by Boehringer Mannheim (Mannheim, Germany). Briefly, the 244-bp SP-B cDNA fragment from the porcine lung was subcloned into the pGEM-T Easy vector (Promega). The plasmid was linearized, and antisense and sense SP-B UTP-digoxigenin-labeled riboprobes were synthesized with 20 U of T3 RNA polymerase (Promega) or 20 U of Sp6 RNA polymerase (Promega). The transcription reaction contained 1.2 µg of linearized plasmid, 1× transcription buffer (Promega), 10 mM dithiothreitol, 1× digoxigenin reaction mix (Boehringer Mannheim), and the RNase inhibitor RNAguard (15 U; Amersham Pharmacia Biotech) for 2 h at 37°C. After DNase I digestion, the probes were purified with lithium chloride-ethanol precipitation and detected on agarose gels. The labeling was detected with the digoxigenin detection kit supplied by Boehringer Mannheim.
Four-micrometer paraffin sections were treated with proteinase K (5 µg/ml) at 37°C for 30 min and postfixed in 4% paraformaldehyde in PBS. The sections were acetylated with 0.25% acetic anhydride in triethanolamine buffer, washed with 4× SSC, and covered with 200 µl of prehybridization mix [50% (vol/vol) formamide, 4× SSC, and 40 µg/ml of single-strand DNA] for 2 h at 58°C followed by 200 µl of hybridization mixture (40% formamide, 10% dextran sulfate, 1× Denhardt's solution, 4× SSC, 10 mM dithiothreitol, 40 µg/ml of yeast tRNA, and 40 µg/ml of denatured salmon sperm DNA) containing 300 ng/ml of the digoxigenin-labeled riboprobe. A GelBond film (FMC Bioproducts, Rockland, ME) was applied. Hybridization was allowed to occur at 58°C for 42 h. After hybridization, the unbound probe was removed from the sections by treatment with RNase A followed by high-stringency washes. The hybridized probe was detected by incubating the sections with the anti-digoxigenin antibody conjugated with alkaline phosphatase. The color reaction took place overnight with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (Boehringer Mannheim) in Tris-NaCl, pH 9.5, with 5 mM levamisole. The reaction was stopped with Tris-EDTA buffer, pH 8.0, and the sections were counterstained with 0.02% fast green FCF (Sigma). As a positive control, sections from the porcine lung were hybridized with the same riboprobes. Negative controls consisted of the same tissue sections hybridized in an identical fashion with the digoxigenin-labeled sense riboprobe. As another negative control, tissue sections hybridized with the antisense riboprobe were subjected to a color reaction without anti-digoxigenin antibody incubation.Preparation of aggregate fraction and Western blot analysis of
SP-B.
The ETs from ~200 pigs from a local slaughterhouse were lavaged with
0.9% NaCl as previously described (22). As a control, porcine lungs were lavaged as described in Porcine ET preparation and bronchoalveolar lavage. After separation of the cells with centrifugation at 500 g for 10 min, the samples were
centrifuged for 2 h at 100,000 g to collect the
sedimentable lipid-protein complexes. The pellets obtained were brought
to suspension in 0.15 M NaCl-5 mM Tris-Cl buffer, pH 7.4, and
fractionated on a linear continuous sucrose density gradient as
described by Gil and Reiss (10). The sucrose densities
were 1.025, 1.045, 1.065, 1.085, and 1.105. The samples were
centrifuged at 35,000 rpm (165,000 g) for 16 h. The
fractions were collected, and the aggregate layer of BAL fluid and the
comparable layer of ETL fluid, density ~1.08, were collected and
diluted with 0.15 M NaCl. Then the samples were again centrifuged at
35,000 rpm for 16 h. The pellets were collected and diluted with
PBS. As a control, ET and lung NaCl lavage returns were centrifuged at
28,000 g for 1 h, and sedimentable fractions were
collected and analyzed similarly. Protein concentrations for the
Western blots were determined with the Bradford assay kit (Bio-Rad,
Hercules, CA) with BSA as a standard. The ET sample containing 6 µg
of protein from the sucrose gradient centrifugation and 0.2 µg of
protein from the surfactant fraction of the BAL fluid as well as 20 µg of protein from the ETL fluid and 3.9 µg of total protein from
the BAL fluid sedimentable fractions was solubilized with Laemmli
sample buffer without
-mercaptoethanol. The samples were separated
by 15% SDS-PAGE and, after electrophoresis, were blotted onto a
nitrocellulose membrane with a blotting apparatus (Bio-Rad). After
being blocked overnight in a mixture containing 5% nonfat milk and
0.05% Tween 20 in Tris-buffered saline, the nitrocellulose sheets were
incubated with porcine SP-B antibody diluted 1:10,000. A secondary
anti-mouse IgG antibody conjugated with horseradish peroxidase was
visualized by a chemiluminescent detection system (ECL Plus Western
blotting analysis system, Amersham). As a control, the same filter was
incubated with sheep polyclonal SP-B antibody after being washed.
| |
RESULTS |
|---|
|
|
|---|
RNA studies.
The total RNA preparation from porcine ETs showed mRNAs of two
different sizes when hybridized with a porcine-specific SP-B cDNA probe
(Fig. 1E). The other messenger
was of the same size, ~2.5 kb, which was detected from the RNA
preparation isolated from porcine lung tissue. The other band detected
was smaller, ~1.2 kb. The cDNA sequence obtained from ETs with RT-PCR
revealed 100% homology compared with the fragment obtained from
porcine lungs. To identify the cellular sites of SP-B mRNA expression in porcine ETs, a series of in situ hybridization studies with sections
of porcine ET was performed. With a specific RNA probe for SP-B,
intense labeling with the antisense probe was detected in different
parts of the ET but mostly close to the mucosal folds in the lower
compartment of the ET lumen. The expression was concentrated in the
cells between the mucosal folds and the narrow ET lumen within the
epithelial cell lining of the ET. The signal with the SP-B antisense
probe in ET is shown in Fig. 1A. There was no labeling in
either the sections hybridized with a sense SP-B probe (Fig. 1,
B and D) or the control sections not treated with
the anti-digoxigenin antibody (data not shown). The results were
confirmed with lung tissue as a positive control. Intense staining was
clearly detected in alveolar type II epithelial cells (Fig.
1C).
|
Localization of SP-B. The porcine ET is a curved tube. The dorsal part is closely sheltered by cartilage, and the lower segment has an elongated lumen with numerous inferior mucosal folds. Light-microscopic studies showed faint diffuse SP-B staining throughout the ET epithelium. In some cells, however, the apical parts showed a stronger, granular staining pattern (Fig. 1F). The porcine SP-B antibody also stained alveolar type II epithelial cells (Fig. 1H). Control sections without primary antibody did not show any positive reaction (Fig. 1, G and I). The pattern of SP-B immunostaining was similar throughout the ET from the pharyngeal orifice to the more distal parts and along the entire circumference of the structure. Immunostaining of the tympanic part of the ET was not studied.
Electron-microscopic studies of the ET epithelium revealed the SP-B label in small granules in cells with short apical microvilli (Fig. 2A). SP-B was also seen in association with electron-dense material at the periphery of large apical granules. In these cells, the label was similarly seen to be attached to microvilli (Fig. 2B). Some additional labeling was also seen in the extracellular spaces (data not shown). No typical tubular myelin figures were detected. Some lamellar structures were occasionally seen in extracellular spaces and rarely in epithelial cells (Fig. 2D). Lamellar bodies of alveolar type II epithelial cells showed specific SP-B labeling (Fig. 2C). Some label was also seen in the alveoli. To obtain better lipid preservation of immunoelectron microscopy samples, freeze-substitution with Lowicryl embedding was performed. However, cryosections showed similar lamellar bodies as in freeze-substituted samples. In the ET, clear lamellar structures were not detected by freeze-substitution or cryotechniques. Freeze-substitution studies showed similar localization of SP-B as in cryosections, but the labeling intensity was weaker (data not shown). No labeling was seen in control specimens (data not shown).
|
Western blot studies.
In Western blot analysis, immunoreactivity with SP-B antibody was
detected both in ETL fluid and in the aggregate fraction isolated from
ETL fluid with sucrose density gradient centrifugation. The size of the
protein recognized by the porcine SP-B antibody was ~24 kDa (Fig.
3), which is characteristic of the
unreduced SP-B dimer. A similar major immunoreactive protein was
detected in the specimens from BAL fluid. The 24-kDa band revealed the strongest intensity in the sedimentable fraction of both BAL and ETL
fluids. In addition, faint 22-, 40-, 8-, and 18-kDa bands were
detectable in the sedimentable fractions of ETL and BAL fluids. The
results were confirmed with sheep polyclonal SP-B antibody as the same
bands that showed positive reactions (data not shown). Reduction of the
samples with
-mercaptoethanol diminished the positive reaction but
revealed the major 15-kDa protein instead (data not shown).
|
| |
DISCUSSION |
|---|
|
|
|---|
With Northern blot analysis, RT-PCR, and in situ hybridization, we detected SP-B mRNA in the porcine ET. With immunohistochemistry and immunoelectron microscopy, SP-B was localized. In all experiments, lung tissue was used as positive control. SP-B mRNA expression concentrated in epithelial cells close to the mucosal folds in the narrow ET lumen. In the Northern blot, the SP-B signal was weak and divided into two mRNAs of different sizes. The larger one, 2.5 kb, was of the same size as that obtained from the lung. The smaller mRNA was ~1.2 kb. This may imply alternative splicing of the larger mRNA. Recently, Dutton et al. (8) reported a smaller PCR product from rabbit middle ear preparations than from the rabbit lung with SP-B-specific primers. Additionally, SP-B messengers of three different sizes were reported in the ovine lung (5).
In light-microscopic studies, faint SP-B protein staining was detected throughout the epithelium. However, more specific apical staining was confirmed by immunoelectron microscopy. The SP-B immunolabel was located in the apical granules and also attached to the microvilli of cuboidal epithelial cells. These granules had some similarities in size with the lamellar bodies of alveolar type II epithelial cells. Other groups (14, 16, 18) have reported the existence of lamellar bodies in ET epithelial cells similar to those seen in alveolar type II epithelial cells, but no such morphology in the porcine ET epithelial cells was detected with immunoelectron microscopy. Although no typical lamellar structures were found in the cryosections, a few concentric lamellar structures were detected in the apical cytoplasm of epithelial cells in the conventional Epon sections (Fig. 2D). The lack of lamellar structures may be due to the cryotechnique, which is not considered as good for preserving lipid structures as freeze-substitution (27). However, both techniques were used, and lamellar bodies could be found in alveolar type II epithelial cells but not in the ET. Based on the morphology of the apical granules, these epithelial cells could be defined as intermediate secretory cells according to Hussl and Lim (13). Indeed, SP-B immunoreactivity was also evident in the extracellular spaces between the individual epithelial cells of the transitional epithelium. This could be due to lateral transport of surfactant proteins through the ET epithelium (15).
Bronchiolar Clara cells contain electron-dense organelles that do not contain multilamellar structures. Although SP-B has been localized in Clara cells, the cells do not otherwise morphologically resemble the cuboidal granular ET cells. Studies with transgenic mice have shown a lack of processing of mature SP-B peptide in Clara cells, and the SP-B expressed by the Clara cell secretory protein promoter did not rescue the SP-B-null mice (17). In the case of transgenic mice, however, the expression pattern may have been incomplete due to the abnormal promoter. The size distribution of the ETL fluid protein recognized by the homologous SP-B antibody was very similar, if not identical, to the protein from the BAL fluid. In addition, the size distribution was identical to that observed by Suzuki et al. (26) under nonreducing conditions. The reduced porcine sample revealed a 15-kDa protein that was, however, considerably weaker than under nonreducing conditions. This was also evident in the present study. Our immunoreactive protein in ETL fluid strongly resembles the SP-B dimer described to be essential in surface tension reduction at the alveolar air-liquid interface (2). Similar to the alveolar surfactant (9), the aggregate fraction of ETL fluid additionally contained immunoreactivity for SP-A (data not shown). Previously, SP-A has been shown to improve the surface activity of phospholipids in the presence of SP-B.
We conclude that SP-B is expressed in specific cells in the ET epithelium and may have functional importance in the ET. However, its function could be somewhat different from that in the lung. In alveoli and terminal airways, collapse of the alveoli and the small airways is prevented by the surfactant phospholipids (7). Unlike in the lower respiratory tract, total closure is likely to take place in the ET. Intermittent swallowing rather than regular breathing movements accomplish the ventilatory function by pulling apart the mucous surfaces of the cartilaginous ET. We propose that the ET surfactant SP-B, secreted from granules of cuboidal epithelial cells to the air-liquid lining of the ET and the intercellular spaces of the pseudostratified epithelium, facilitates normal opening of the tube and improves mucociliary transport. On the basis of the sedimentation of the SP-B-rich aggregates recovered from ETL fluids as well as on the present and previous (11, 29) morphological observations, ET surfactant consists of phospholipid-rich aggregates that remain to be characterized.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Maarit Hännikäinen, Elsi Jokelainen, and Sirpa Kellokumpu for excellent technical assistance and Drs. Vesa Anttila, Jussi Rimpiläinen and Matti Pokela and Product Manager Masa Ala-Fossi from the Atria Food Company (Nurma, Finland) for supplying the research material.
| |
FOOTNOTES |
|---|
This research was supported by grants from the Biocenter Oulu (Oulu, Finland) and the Academy of Finland.
Address for reprint requests and other correspondence: R. Paananen, Dept. of Pediatrics and Biocenter Oulu, Univ. of Oulu, PO Box 5000, 90014 Oulu, Finland (E-mail: rpaanane{at}cc.oulu.fi).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 15 August 2000; accepted in final form 2 October 2000.
| |
REFERENCES |
|---|
|
|
|---|
1.
Batenburg, JJ,
and
Haagsman HP.
The lipids of pulmonary surfactant: dynamics and interactions with proteins.
Prog Lipid Res
37:
235-276,
1998[Web of Science][Medline].
2.
Beck, DC,
Ikegami M,
Na CL,
Zaltash S,
Johansson J,
Whitsett JA,
and
Weaver TE.
The role of homodimers in surfactant protein B function in vivo.
J Biol Chem
275:
3365-3370,
2000
3.
Beck, DC,
Na CL,
Whitsett JA,
and
Weaver TE.
Ablation of a critical surfactant protein B intramolecular disulfide bond in transgenic mice.
J Biol Chem
275:
3371-3376,
2000
4.
Birken, EA,
and
Brookler KH.
Surface tension lowering substance of the canine Eustachian tube.
Ann Otol Rhinol Laryngol
81:
268-271,
1972[Web of Science][Medline].
5.
Braems, GA,
Yao LJ,
Inchley K,
Brickenden A,
Han VK,
Grolla A,
Challis JR,
and
Possmayer F.
Ovine surfactant protein cDNAs: use in studies on fetal lung growth and maturation after prolonged hypoxemia.
Am J Physiol Lung Cell Mol Physiol
278:
L754-L764,
2000
6.
Clark, JC,
Wert SE,
Bachurski CJ,
Stahlman MT,
Stripp BR,
Weaver TE,
and
Whitsett JA.
Targeted disruption of the surfactant protein B gene disrupts surfactant homeostasis, causing respiratory failure in newborn mice.
Proc Natl Acad Sci USA
92:
7794-7798,
1995
7.
Clements, JA.
Functions of the alveolar lining.
Am Rev Respir Dis
115:
67-71,
1977[Web of Science][Medline].
8.
Dutton, JM,
Goss K,
Khubchandani KR,
Shah CD,
Smith RJ,
and
Snyder JM.
Surfactant protein A in rabbit sinus and middle ear mucosa.
Ann Otol Rhinol Laryngol
108:
915-924,
1999[Web of Science][Medline].
9.
Froh, D,
Ballard PL,
Williams MC,
Gonzales J,
Goerke J,
Odom MW,
and
Gonzales LW.
Lamellar bodies of cultured human fetal lung: content of surfactant protein A (SP-A), surface film formation and structural transformation in vitro.
Biochim Biophys Acta
1052:
78-89,
1990[Medline].
10.
Gil, J,
and
Reiss OK.
Isolation and characterization of lamellar bodies and tubular myelin from rat lung homogenates.
J Cell Biol
58:
152-171,
1973
11.
Hills, BA.
Analysis of eustachian surfactant and its function as a release agent.
Arch Otolaryngol
110:
3-9,
1984
12.
Hiraide, F,
and
Inouye T.
The fine surface view of the human adult eustachian tube.
J Laryngol Otol
97:
149-157,
1983[Web of Science][Medline].
13.
Hussl, B,
and
Lim DJ.
Secretory cells in the middle ear mucosa of the guinea pig. Cytochemical and ultrastructural study.
Arch Otolaryngol
89:
691-699,
1969
14.
Karchev, T,
Watanabe N,
Fujiyoshi T,
Mogi G,
and
Kato S.
Surfactant-producing epithelium in the dorsal part of the cartilaginous eustachian tube of mice. Light, transmission, and scanning electron microscopic observations.
Acta Otolaryngol
114:
64-69,
1994[Medline].
15.
Lim, DJ.
Functional morphology of the lining membrane of the middle ear and Eustachian tube: an overview.
Ann Otol Rhinol Laryngol
83:
5-26,
1974.
16.
Lim, DJ,
and
Shimada T.
Secretory activity of normal middle ear epithelium. Scanning and transmission electron microscopic observations.
Ann Otol Rhinol Laryngol
80:
319-329,
1971[Web of Science][Medline].
17.
Lin, S,
Na CL,
Akinbi HT,
Apsley KS,
Whitsett JA,
and
Weaver TE.
Surfactant protein B (SP-B) -/- mice are rescued by restoration of SP-B expression in alveolar type II cells but not Clara cells.
J Biol Chem
274:
19168-19174,
1999
18.
Mira, E,
Benazzo M,
Galioto P,
Calligaro A,
and
Casasco A.
Presence of phospholipidic lamellar bodies on the mucosa of rabbit eustachian tube. Ultrastructural aspects.
ORL J Otorhinolaryngol Relat Spec
50:
251-256,
1988[Medline].
19.
Mulder, JJ,
and
Kuijpers W.
The mucosal lining of the Eustachian tube of the rat.
Acta Otolaryngol
111:
342-348,
1991[Medline].
20.
Nogee, LM,
de Mello DE,
Dehner LP,
and
Colten HR.
Brief report: deficiency of pulmonary surfactant protein B in congenital alveolar proteinosis.
N Engl J Med
328:
406-410,
1993
21.
O'Reilly, MA,
Weaver TE,
Pilot-Matias TJ,
Sarin VK,
Gazdar AF,
and
Whitsett JA.
In vitro translation, post-translational processing and secretion of pulmonary surfactant protein B precursors.
Biochim Biophys Acta
1011:
140-148,
1989[Medline].
22.
Paananen, R,
Glumoff V,
and
Hallman M.
Surfactant protein A and D expression in the porcine Eustachian tube.
FEBS Lett
452:
141-144,
1999[Web of Science][Medline].
23.
Phelps, DS,
and
Floros J.
Localization of surfactant protein synthesis in human lung by in situ hybridization.
Am Rev Respir Dis
137:
939-942,
1988[Web of Science][Medline].
24.
Slot, JW,
and
Geuze HJ.
A new method of preparing gold probes for multiple-labeling cytochemistry.
Eur J Cell Biol
38:
87-93,
1985[Web of Science][Medline].
25.
Sormunen, R,
Paakko P,
Palovuori R,
Soini Y,
and
Lehto VP.
Fodrin and actin in the normal, metaplastic, and dysplastic respiratory epithelium and in lung carcinoma.
Am J Respir Cell Mol Biol
11:
75-84,
1994[Abstract].
26.
Suzuki, Y,
Kogishi K,
Fujita Y,
Kina T,
and
Nishikawa S.
A monoclonal antibody to the 15,000 dalton protein associated with porcine pulmonary surfactant.
Exp Lung Res
11:
61-73,
1986[Web of Science][Medline].
27.
Voorhout, W,
van Genderen I,
van Meer G,
and
Geuze H.
Preservation and immunogold localization of lipids by freeze-substitution and low temperature embedding.
Scanning Microsc Suppl
5:
S17-S24,
1991[Medline].
28.
Voorhout, WF,
Veenendaal T,
Haagsman HP,
Weaver TE,
Whitsett JA,
van Golde LM,
and
Geuze HJ.
Intracellular processing of pulmonary surfactant protein B in an endosomal/lysosomal compartment.
Am J Physiol Lung Cell Mol Physiol
263:
L479-L486,
1992
29.
Wheeler, SL,
Pool GL,
and
Lumb RH.
Rat eustachian tube synthesizes disaturated phosphatidylcholine.
Biochim Biophys Acta
794:
348-349,
1984[Medline].
This article has been cited by other articles:
![]() |
J. K. Kim, S.-S. Kim, K. W. Rha, C.-H. Kim, J. H. Cho, C.-H. Lee, J.-G. Lee, and J.-H. Yoon Expression and localization of surfactant proteins in human nasal epithelium Am J Physiol Lung Cell Mol Physiol, April 1, 2007; 292(4): L879 - L884. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Strayer, R. C. Savani, L. W. Gonzales, A. Zaman, Z. Cui, E. Veszelovszky, E. Wood, Y.-S. Ho, and P. L. Ballard Pre- and Postnatal Lung Development, Maturation, and Plasticity: Human surfactant protein B promoter in transgenic mice: temporal, spatial, and stimulus-responsive regulation Am J Physiol Lung Cell Mol Physiol, March 1, 2002; 282(3): L394 - L404. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Paananen, A. D. Postle, G. Clark, V. Glumoff, and M. Hallman Eustachian tube surfactant is different from alveolar surfactant: determination of phospholipid composition of porcine eustachian tube lavage fluid J. Lipid Res., January 1, 2002; 43(1): 99 - 106. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Paananen, R. Sormunen, V. Glumoff, M. van Eijk, and M. Hallman Surfactant proteins A and D in Eustachian tube epithelium Am J Physiol Lung Cell Mol Physiol, September 1, 2001; 281(3): L660 - L667. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |