AJP - Lung AJP: Renal Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 280: L1030-L1039, 2001;
1040-0605/01 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (33)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shi, W.
Right arrow Articles by Warburton, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shi, W.
Right arrow Articles by Warburton, D.
Vol. 280, Issue 5, L1030-L1039, May 2001

Gremlin negatively modulates BMP-4 induction of embryonic mouse lung branching morphogenesis

Wei Shi1, Jingsong Zhao2, Kathryn D. Anderson1, and David Warburton1,2

1 Developmental Biology Program, Department of Surgery, Childrens Hospital Los Angeles Research Institute, and 2 Center for Craniofacial Molecular Biology, University of Southern California Keck School of Medicine and School of Dentistry, Los Angeles, California 90027


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Bone morphogenetic protein-4 (BMP-4) is a key morphogen for embryonic lung development that is expressed at high levels in the peripheral epithelium, but the mechanisms that modulate BMP-4 function in early mouse lung branching morphogenesis are unclear. Here, we studied the BMP-4 antagonist Gremlin, which is a member of the DAN family of BMP antagonists that can bind and block BMP-2/4 activity. The expression level of gremlin in embryonic mouse lungs is highest in the early embryonic pseudoglandular stage [embryonic days (E) 11.5-14.5] and is reduced during fetal lung maturation (E18.5 to postnatal day 1). In situ hybridization indicates that gremlin is diffusely expressed in peripheral lung mesenchyme and epithelium, but relatively high epithelial expression occurs in branching buds at E11.5 and in large airways after E16.5. In E11.5 lung organ culture, we found that exogenous BMP-4 dramatically enhanced peripheral lung epithelial branching morphogenesis, whereas reduction of endogenous gremlin expression with antisense oligonucleotides achieved the same gain-of-function phenotype as exogenous BMP-4, including increased epithelial cell proliferation and surfactant protein C expression. On the other hand, adenoviral overexpression of gremlin blocked the stimulatory effects of exogenous BMP-4. Therefore, our data support the hypothesis that Gremlin is a physiologically negative regulator of BMP-4 in lung branching morphogenesis.

bone morphogenetic protein; lung development; organogenesis


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

LUNG DEVELOPMENT IS INITIATED by the formation of a pair of primary buds that evaginate from the laryngotracheal groove located in the ventral foregut endoderm into the surrounding splanchnic mesenchyme (33). The respiratory tree then develops by branching morphogenesis in which reiterated outgrowth, elongation, and subdivision of epithelial buds occur (9). This stereotypical pattern of early lung budding and branching is retained even in chemically defined organ culture, which makes early embryonic lung organ culture a very useful model for studying the basic mechanisms of lung development (12). In mouse, lung branching morphogenesis begins at embryonic day (E) 10.5 and is regulated by transcription factors, peptide growth factors, and cell-cell and cell-extracellular matrix interactions (35, 36). Several gene families, including fibroblast growth factors (FGFs), bone morphogenetic proteins (BMPs), hedgehogs, Wnts, and epidermal growth factors are involved as key morphogens (9, 36).

BMPs are a subgroup of the transforming growth factor-beta superfamily that is involved in many embryonic patterning events (8). In the developing embryonic lung, expression of BMP-5 and BMP-7 has been detected in the mesenchyme and endoderm, respectively, whereas BMP-4 expression is restricted to the distal epithelial cells and the adjacent mesenchyme (3, 13). Overexpression of BMP-4, driven by the surfactant protein C (SP-C) promoter in the distal endoderm of transgenic mice, caused abnormal lung morphogenesis, with cystic terminal sacs and inhibition of epithelial proliferation (3). In contrast, SP-C promoter-driven overexpression of either the BMP antagonist Xnoggin or a dominant negative Alk6 BMP receptor (BMPR) to block BMP signaling exhibited severely reduced distal epithelial cell phenotypes and increased proximal cell phenotypes in the lungs of transgenic mice (38). Therefore, BMPs, particularly BMP-4, are considered to be one of the key growth factors essential for lung development. However, precisely how BMP-4 regulates embryonic lung morphogenesis is unclear. As a secreted ligand, BMPs bind to cognate transmembrane Ser/Thr kinase type II receptors (BMPRII), which complex with BMP type I receptors (BMPRI; Alk2, Alk3, and Alk6). BMPRII then phosphorylates the BMPRI, which in turn phosphorylates downstream cytoplasmic signal proteins including Smad1, Smad5, and Smad8. These phosphorylated Smads then form complexes with a common effector, Smad4, and translocate into the nucleus to regulate gene expression (19). This signal transduction pathway is fine tuned at several levels. For example, several groups of antagonists can bind BMP ligands and modulate their activities to activate BMP signaling (17, 26). Similarly, BMP and activin membrane-bound inhibitor (BAMBI) behaves as a dominant negative receptor to prevent the formation of a functional receptor complex (24). Downstream of the BMPR complex, two inhibitory Smads (Smad6 and Smad7) inhibit active Smad functions, feeding back for autotermination of initiated signals (11, 23). Moreover, at the level of the nucleus, transcription repressors, similar to Sno and Ski, may suppress or terminate the transcriptional activation of certain BMP target genes (30, 31).

It now appears that a crucial step in the regulation of BMP signaling occurs at the level of ligand availability. Many BMP antagonists have been discovered recently, including noggin, chordin, follistatin, and differential screening-selected gene aberrative in neuroblastoma (DAN) group proteins, which include DAN, Cerberus, Caronte, and Gremlin (17, 26).

gremlin was isolated by Xenopus expression cloning. Its mammalian homolog was also recently assigned as Cktsflbl in the Mammalian Genome Database. Gremlin is a secreted protein with a molecular mass of 25 kDa (10). Its carboxy-terminal cysteine-rich motif, spanning an ~85-amino acid region, is highly homologous to the protein domain shared by a group of secreted proteins such as DAN and Cerberus. Therefore, Gremlin is classified as one member of this DAN protein family (26). Gremlin binds to BMPs and prevents them from interacting with their receptors. Rat gremlin was also previously identified (34) as a gene that is downregulated in mos-transformed cells by a differential display approach. In situ hybridization analysis in adult rat tissues revealed high expression of gremlin in nondividing and terminally differentiated cells such as neurons, type I alveolar epithelial cells, and goblet cells (34).

Recently (5, 21, 45), Gremlin was found to be an important BMP regulator for limb development that acts in a complementary fashion with other BMP antagonists rather than being a redundant signal. Here, we have studied the role of Gremlin in mouse lung development. Dynamic gremlin gene expression occurs at different stages of embryonic lung development as detected by competitive RT-PCR and in situ hybridization. We used an antisense oligonucleotide approach to knock down gremlin mRNA expression in cultured embryonic lungs. Reduction of gremlin expression in the cultured lungs dramatically enhanced branching morphogenesis, epithelial cell proliferation, and cytodifferentiation marker gene SP-C expression of E11.5 embryonic mouse lung, a phenotype similar to that achieved by adding exogenous BMP-4 to the culture. On the other hand, overexpression of gremlin with the use of a recombinant adenovirus blocked the effects of BMP-4.


    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Mouse lung samples. Swiss-Webster mice were purchased from Harlan Sprague Dawley (St. Louis, MO). To study the embryonic lungs at different developmental stages, female mice were mated overnight, and if a vaginal plug was found on the second day, that day was counted as E0. The pregnant mice were killed at different gestational days, and the embryos were removed by cesarean section. The embryonic lung was excised en bloc and processed for either fixation or RNA extraction. Neonatal lungs were taken from postnatal day (P) 1 mice. Adult lungs were sampled from 2-mo-old mice.

Total RNA isolation and RT. Total RNA was isolated from the lungs with a QIAGEN RNeasy kit (QIAGEN, Santa Clarita, CA). The quality of isolated RNA was checked by formaldehyde agarose gel electrophoresis before the RT reaction. Two micrograms of total RNA were added to a 25-µl RT reaction mixture containing 1.25 µg of oligo(dT) (Pharmacia, Piscataway, NJ), 50 mM Tris · HCl, pH 8.3, 75 mM KCl, 3 mM MgCl2, 0.5 mM deoxyribonucleotide triphosphates, 10 mM dithiothreitol, 20 U of RNasin ribonuclease inhibitor and 200 U of Moloney murine leukemia virus reverse transcriptase (Promega, Madison, WI) and incubated at 37°C for 60 min. The product of the RT was diluted fivefold and applied to PCR analysis.

Primers and competitive RT-PCR. The competitive RT-PCR method has been described previously (28). For gremlin competitive RT-PCR, a 291-bp fragment of mouse cDNA was amplified with the specific primers 5'-GCAACAGCCGCACTATCA-3' and 5'-CCAAGTCGATGGATATGC-3'. In addition, a 344-bp competitor template fragment was constructed from v-erbB, with the specific gremlin primer sequences incorporated at the ends; these could be amplified by the same pair of gremlin primers. Similarly, a fragment of mouse BMP-4 cDNA was amplified with BMP-4 specific primers (5'-TCCATCACGAAGAACATC-3' and 5'-TAGTCGTGTGATGAGGTG-3'), and the 344-bp competitor was made as described above. Primers and competitor templates for beta -actin and SP-C genes were designed as published previously (42).

With a fixed amount of competitor, the competitive RT-PCR mixture contained 10 mM Tris · HCl, pH 9.4, 50 mM KCl, 2 mM MgCl2, 0.01% gelatin, 0.1% Triton X-100, 200 µM primer sets, 100 µM deoxyribonucleotide triphosphates, and 0.5 U of Advantage DNA polymerase (Clontech, Palo Alto, CA) in a total volume of 50 µl. Thirty-five cycles of denaturation at 94°C for 1 min, annealing at 56°C (62°C for beta -actin and SP-C) for 1 min, and extension at 72°C for 1 min were carried out in a Robocycler (Stratagene, La Jolla, CA). PCR products were separated on a 2% agarose gel (Life Technologies) and visualized by ethidium bromide staining. The intensity of each band was determined by densitometric analysis with ImageQuant band-analyzing software (Molecular Dynamics, Sunnyvale, CA). For each quantitation, a standard curve was always made with a series of cDNA standard dilutions as samples. beta -Actin competitive PCR was always performed on the same samples as an internal control. Triplicate competitive RT-PCRs were performed on each sample. All data are reported as means ± SD. Differences between the means were statistically tested by the Wilcoxon rank sum test (15). P values < 0.05 were considered significant.

In situ hybridization. The lungs were fixed in 4% paraformaldehyde-PBS for 4 h at 4°C. To prepare the nucleotide probe for in situ hybridization, a 228-bp fragment of cDNA was subcloned into pBluescript II KS by PCR with the use of the oligonucleotide primers 5'-GCAACAGCCGCACTATCA-3' and 5'-CCAAGTCGATGGATATGC-3'. Then, 2 µg of plasmid were linearized with the restriction enzymes BamHI or XhoI, and digoxigenin (Dig)-labeled riboprobe was generated with a Dig RNA labeling kit (Boehringer Mannheim) at 37°C for 2.5 h. The cDNA template was cleaved by adding 1 U of RNase-free DNase (Promega) at 37°C for 30 min. The Dig riboprobe was purified by ethanol precipitation in the presence of 0.4 M lithium chloride. The concentration of probe was estimated with the protocol recommended by the company, and the quality of the probe was verified by Northern blot.

For whole mount in situ hybridization, the tissues were treated with 5% hydrogen peroxide at room temperature for 10 min followed by incubation with 20 µg/ml of proteinase K at room temperature for 5 min. After postfixation in 4% paraformaldehyde and 0.2% glutaraldehyde, the tissues were further treated with 0.1% sodium borohydride for 20 min. The tissues were prehybridized at 65°C for 1 h in hybridization buffer (50% formamide, 0.75 M NaCl, 10 mM PIPES, pH 6.8, 1 mM EDTA, 100 µg/ml of tRNA, 0.05% heparin, 0.1% BSA, and 1% SDS). The lung tissues were then placed in the same hybridization buffer containing 0.25 µg/ml of Dig riboprobe and hybridized at 65°C overnight. After being washed in serial solutions, the hybridized Dig riboprobes were detected with alkaline phosphatase-conjugated anti-Dig antibody and visualized by 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium chromogen.

For section in situ hybridization, paraffin sections of 6 µm thickness were rehydrated and treated in 0.2 N HCl at room temperature for 20 min. Subsequently, the sections were dipped in 0.3% Triton X-100-PBS at room temperature for 5 min followed by incubation with 10 µg/ml of proteinase K at 37°C for 30 min. The treated sections were further fixed by dipping in 4% paraformaldehyde-PBS for 5 min and acetylated in 0.75% acetic anhydride in 0.1 M triethanolamine buffer, pH 8.0. After prehybridization in 1× saline-sodium citrate and 50% formamide at 37°C for 1 h, the sections were hybridized at 50°C overnight in the following mixture: 50% formamide, 4× saline-sodium citrate, 10% dextran sulfate, 625 µg/ml of single-strand DNA, 1 mg/ml of tRNA, 1× Denhardt's solution, and 400 ng/ml of Dig riboprobe. The hybridized Dig riboprobe was detected by alkaline phosphatase-conjugated anti-Dig antibody and visualized by 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium chromogen.

E11.5 embryonic lung culture. The procedure for lung organ culture was described previously (42). Briefly, timed-pregnant mice were killed at E11.5, and the lung primordia were isolated from the embryos under a dissecting microscope. Lung explants were placed on 0.80-µm MF-Millipore filters supported by a stainless steel grid in a Grobstein culture dish. An appropriate amount of BGjb serum-free medium (Life Technologies, Gaithersburg, MD) was added to each dish to establish an air-fluid interface at the level of the explants. The E11.5 embryonic lungs were first allowed to recover in BGjb culture medium for 1 h and then were exposed to the medium with added oligonucleotides or BMP-4 (R&D Systems, Minneapolis, MN) for 4 days in 100% humidity and 95% air-5% CO2. The medium was changed every 2 days. Branching morphogenesis was measured as the number of epithelial sacs visible around the periphery of the lung explants under the microscope. Cultured lungs were also processed for RNA isolation or fixation. Phosphothionated oligonucleotides (Univ. of Southern California Microchemical Facility) were used because of their stability in culture medium. The sequence for antisense oligonucleotide 5'-GCGGTGCGATTCATTCTA-3' was designed from the gremlin cDNA sequence 66-83 (GenBank accession no. NM011824). The sense oligonucleotide 5'-TAGAATGAATCGCACCGC-3' and scrambled sequence oligonucleotide 5'-TGCGAGTTTACCGTTAGC-3' were used as controls. At least 10 lung explants were used for each condition, and the individual experiment was repeated three times.

Immunostaining of lung tissue sections. Proliferating cell nuclear antigen (PCNA) staining was performed with a kit from Zymed Laboratories (South San Francisco, CA). The PCNA index was measured as the percentage of PCNA-positive epithelial cells out of the total counted epithelial cells. SP-C was detected with a polyclonal antibody from Santa Cruz Biotechnology (Santa Cruz, CA) diluted 1:50 and incubated overnight at 4°C. The hemagglutinin (HA) epitope tag in the recombinant Gremlin was detected with an anti-HA monoclonal antibody from Santa Cruz Biotechnology at a 1:50 dilution for 1 h at room temperature. Zymed Histostain-Plus and HistoMouse-SP kits were used for the immunostaining.

Production and administration of adenoviral vector. The cDNA for gremlin open reading frame was generated by RT-PCR with primer GRE-5' (GGTACCAGAATGAATCGCACCGCATAC) and primer GRE-HA (CGAATTCAAGCGTAGTCTGGGACGTCGTATGGGTAATCCAAGTCGATGGAT). The gremlin cDNA sequence of the subcloned PCR product was confirmed by DNA sequencing (Univ. of Southern California Microchemical Facility). The carboxy terminus of the translated protein from this cDNA construct contains a HA epitope tag. A replication-deficient recombinant adenovirus expressing full-length gremlin under control of the cytomegalovirus (CMV) promoter was made with a simplified system kindly provided by Dr. Bert Vogelstein (Johns Hopkins University, Baltimore, MD) (7). Briefly, the gremlin cDNA was first subcloned into pAd-Track-CMV vector, and the homologous recombination between pAd-Track-CMV-gremlin and adenoviral backbone pAd-Easy was carried out in bacteria BJ5183. The recombined pAd-Gremlin was used to transfect 293A cells, and the recombinant adenovirus-Gremlin (AdGRE) was then harvested from the cell lysate by repeated freezing and thawing. Gremlin production from the recombinant adenovirus was confirmed by Western blot with an anti-HA antibody.

To overexpress gremlin in the local airway epithelium of E11.5 lung explants, high-titer AdGRE (>1 × 1010 plaque-forming units/ml) was microinjected intratracheally to fill the embryonic lung airway as previously described (43). Injected lungs were then incubated for 1 h at room temperature for viral infection before culture. At least 10 lung explants were infected for each experiment, and the individual experiment was repeated three times.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Gremlin developmental expression profile in mouse embryonic lung. The number of gremlin transcripts in embryonic lungs at different developmental stages was measured by competitive RT-PCR (Fig. 1.). The relative level of gremlin transcript in embryonic lung tissues was highest in the earliest stage (E11.5) tested, then gradually decreased with gestational maturation and reached the lowest level at E18.5 and P1. The expression of gremlin then returned to a relatively high level in adulthood, similar to the level found at E16.5. In contrast to gremlin, the expression of DAN, another BMP antagonist, did not show any developmental changes in lung tissues (data not shown). The BMP-4 gene expression level in total lung tissue was slightly higher from E14.5 to E16.5 but did not change significantly during lung development as measured by competitive RT-PCR (Fig. 2).


View larger version (45K):
[in this window]
[in a new window]
 
Fig. 1.   Measurement of gremlin mRNA in embryonic lungs by competitive RT-PCR. A: different amounts of gremlin cDNA, with a constant amount of gremlin competitor, were amplified to build the standard curve for quantification. B: linear relationship between the amount of cDNA and the logarithm of PCR product intensities is shown. C: competitive RT-PCR products were separated by agarose gel and stained with ethidium bromide. D: relative expression levels of gremlin were compared and dynamic changes were observed. Highest level of expression was at embryonic day 11.5 (E11.5; 100 ± 6.1%), moderate to low levels were seen from E14.5 to E16.5 and in adults (32.6 ± 1.2 to 7.9 ± 3.8% and 10.3 ± 3.9%, respectively), and the lowest levels at E18.5 and postnatal day 1 (P1; 1.8 ± 0.4 and 1.9 ± 0.7%).



View larger version (42K):
[in this window]
[in a new window]
 
Fig. 2.   Competivitve RT-PCR measurement of bone morphogenetic protein (BMP)-4 mRNA in embryonic lungs. A: different amounts of BMP-4 cDNA, with a constant amount of BMP-4 competitor, were amplified to build the standard curve for quantification. B: linear relationship between the amount of cDNA and the logarithm of PCR product intensities is shown. C: competitive RT-PCR products were separated by agarose gel and stained with ethidium bromide. D: relative expression levels of BMP-4 were compared; only slight changes were observed. Expression was relatively high at E14.5 and E16.5 (169 ± 17 and 121 ± 8.4%), moderate at E11.5 and P1 (100 ± 1.3 and 104.7 ± 4.6%), and relatively low at E18.5 and in adults (86.9 ± 6.2 and 83 ± 12.9%).

Cellular expression of gremlin in lungs. To find the cellular location of gremlin gene expression, nonradioactive whole mount and section in situ hybridization were used to detect gremlin mRNA. As shown in Fig. 3, gremlin whole mount in situ hybridization of E11.5 embryonic lungs indicated that gremlin was expressed in the whole lung mesenchyme, but a relatively higher intensity of gremlin transcript was also detected in epithelium in airway tips at this stage. gremlin section in situ hybridization of the embryonic lung from E14.5 to P1 indicated that the expression pattern of gremlin was changed at different stages (Fig. 4). gremlin transcript was detectable in both epithelium and mesenchyme at E14.5, with stronger signals in some airway epithelial cells, a similar pattern to that seen at E11.5 by whole mount in situ hybridization. Interestingly, the positive signals in the apical region of the epithelial cells were much higher than those in the basal region of the cells. Consistent with the RT-PCR quantification result, the intensity of mRNA signal of gremlin was reduced at E16.5 in epithelial cells as well as in mesenchyme. In neonatal lung (P1), gremlin signal was barely detected in mesenchymal cells, but positive staining was observed in epithelial cells lining large airways. Moreover, expression of gremlin in adult mouse lung was clearly increased in epithelial cells lining the proximal large airways, although gremlin transcript was also detected in some alveolar epithelial cells.


View larger version (47K):
[in this window]
[in a new window]
 
Fig. 3.   gremlin whole mount in situ hybridization in E11.5 embryonic lungs. E11.5 embryonic lungs were hybridized with either gremlin sense (A) or antisense (B) digoxigenin riboprobe. gremlin expression was defined by a dark brown color. The mesenchyme at this stage was diffusely stained, with the signal being more intense close to the tips of the primitive segmental bronchi. Arrows, intense staining in the epithelium of the bud tips. Bar, 200 µm.



View larger version (129K):
[in this window]
[in a new window]
 
Fig. 4.   gremlin section in situ hybridization during embryonic lung development. Lung tissue sections from E14.5 (A, E, and I), E16.5 (B, F, and J), P1 (C, G, and K), and adult (D, H, and L) mice were hybridized with gremlin antisense (E-H) or sense (I-L) digoxigenin riboprobes. Arrowheads, positive signals visualized by dark brown color. The lung histological structures at each different stage are illustrated by hematoxylin and eosin (HE; A-D) staining. gremlin signal was highest in the small airway epithelium at E14.5 (E), although the mesenchyme was diffusely stained. gremlin signal was reduced at E16.5 in both epithelium and mesenchyme (F). However, gremlin signal was seen principally in the monolayer lining epithelium of large airways in postnatal lungs (G) and in multiple layer epithelium of proximal large airways in adult lungs (H). All sections were the same magnification. Bar, 50 µm.

Enhancement of branching morphogenesis by gremlin antisense oligonucleotides in embryonic lung organ culture. What is the function of gremlin expression in lung development, particularly at the time of its highest expression in early branching morphogenesis? To answer this question, we partially knocked down endogenous gremlin expression using antisense oligonucleotides in embryonic lung organ culture because DNA oligonucleotides can penetrate easily into the cultured embryonic lungs and distribute uniformly within the lung explants (41; Zhao and Warburton, unpublished observations). Compared with control lungs growing in control BGjb medium, the addition of 40 µM gremlin antisense oligonucleotide dramatically enhanced embryonic lung growth and branching (Fig. 5). The number of epithelial sacs was increased by up to 156 ± 16% (P < 0.01). However, addition of the same concentration of sense or scrambled oligonucleotides did not significantly change embryonic lung branching in the same culture system (Fig. 5). The reduction of gremlin expression by antisense oligonucleotide was confirmed by RT-PCR with a pair of primers flanking the protein translation initiation region (Fig. 5). Therefore, a relatively high level of gremlin expression in the early pseudoglandular stage was required to negatively modulate embryonic lung branching morphogenesis.


View larger version (44K):
[in this window]
[in a new window]
 
Fig. 5.   Increased branching morphogenesis of cultured lungs in the presence of gremlin antisense oligonucleotide or exogenous BMP-4 ligand. A: embryonic lung was obtained at E11.5 and cultured for 4 days in BGjb medium in the absence of oligonucleotides (medium control; MC), with 40 µM of gremlin sense (SE) or antisense (AS) oligonucleotides, or with 200 ng/ml of BMP-4 peptide ligand (BMP-4). Arrow, terminal epithelial sac. All pictures were the same magnification. Bar, 200 µm. B: measurement of the no. of peripheral epithelial sacs in cultured lung explants. In the presence of gremlin AS oligonucleotide, the no. of terminal branches increased by 156 ± 16% (P < 0.01), whereas the nos. in the presence of gremlin SE oligonucleotide (93 ± 15%) or gremlin scrambled oligonucleotide (SR; 101 ± 7%) were similar to those in MC (100 ± 9%). Also, addition of BMP-4 clearly increased the number of peripheral branches (150 ± 10%, P < 0.01). At least 10 cultured lungs were measured in each condition. Experiments were repeated at least 3 times. C: RT-PCR detected the levels of gremlin expression in lungs under different culture conditions. gremlin AS oligonucleotide, but not SE oligonucleotide, drastically reduced gremlin expression in cultured lung explants.

Enhancement of branching morphogenesis by exogenous BMP-4. Experiments from cell culture and Xenopus developmental assays indicate that Gremlin is an effective antagonist for BMP-4/2 ligand activities. Therefore, the enhancement of embryonic lung branching morphogenesis by the reduction of gremlin expression may be mediated by reducing antagonistic activity for BMPs, resulting in increased biological activity of BMP-4. To test this possibility, we added exogenous BMP-4 to the lung cultures; this should have overcome the endogenous inhibitory effect of Gremlin on lung branching morphogenesis. As expected, 200 ng/ml of exogenous BMP-4 strongly promoted lung branching, with a 150 ± 10% (P < 0.01) increase in the number of epithelial sacs, which is similar to the phenotype seen in the reduction of gremlin expression (Fig. 5).

Abrogation of BMP-4-stimulated lung branching morphogenesis by gremlin overexpression. Because Gremlin is an antagonist of BMP-4 in vitro, the question then arises as to whether increased early embryonic lung branching morphogenesis, either by reducing gremlin expression or by adding exogenous BMP-4, is related to the same signaling pathway. To provide an answer, we made a recombinant adenovirus that can overexpress gremlin in infected cells and infected the airway epithelium of E11.5 lungs by microinjecting the virus through the trachea. The overexpression of gremlin in these cultured lungs was confirmed by gremlin RT-PCR and by immunostaining of the HA epitope tag on the carboxy terminus of the recombinant Gremlin (Fig. 6, A and B). The number of terminal branches in the presence of exogenous BMP-4 (100 ng/ml) alone was significantly increased (146.8 ± 8.2%, P < 0.05) compared with cultures containing medium alone (control; 100 ± 5.8%). However, the number of terminal branches of the cultured lungs (103.9 ± 7.3%) in the presence of exogenous BMP-4 plus overexpression of gremlin was similar to that in the medium control cultures (Fig. 6C), which indicates that Gremlin blocks BMP-4-induced stimulation of mouse embryonic lung branching morphogenesis.


View larger version (44K):
[in this window]
[in a new window]
 
Fig. 6.   Overexpression of gremlin-blocking BMP-4-induced stimulation of mouse embryonic lung branching morphogenesis. A: overexpression of gremlin was measured on its mRNA level by competitive RT-PCR. The lung explants infected with the recombinant adenovirus (AdGRE) had much higher levels of gremlin mRNA than the lungs without viral infection (MC); BMP-4, treated with BMP-4 only. B: overexpressed recombinant Gremlin protein was detected with anti-hemagglutinin (HA) epitope tag immunostaining. The expressed Gremlin by adenovirus was mainly located around airway epithelium (red staining). The relatively high background can be caused by the secretion of Gremlin into extracellular locations. No HA-tag signal was detected in MC. Bar, 50 µm. C: no. of peripheral epithelial sacs in cultured lung explants. Addition of BMP-4 (100 ng/ml) clearly increased the no. of peripheral branches (146.8 ± 8.2%, P < 0.01) compared with MC (100 ± 5.8%). However, adding the same concentration of BMP-4 to the lung explants overexpressing recombinant Gremlin (BMP-4+AdGRE) did not significantly increase the no. of lung terminal branches (103.9 ± 7.3%), indicating that Gremlin abrogates BMP-4-induced lung branching morphogenesis.

Increased epithelial cell proliferation and peripheral differentiation in cultured lung with reduced Gremlin expression or exogenous BMP-4. Epithelial cell proliferation and differentiation were compared between the cultured lungs under different conditions. The proliferating cells were detected by PCNA immunostaining. In the cultured lungs treated with gremlin antisense oligonucleotide to reduce gremlin expression, there were 46.47 ± 6.04% PCNA-positive epithelial cells, whereas only 31.89 ± 4.83% PCNA-positive epithelial cells were detected in the control lungs (P < 0.05; Fig. 7). Similarly, PCNA-positive epithelial cells in exogenous BMP-4-stimulated lungs were also increased to 52.88 ± 7.97% (P < 0.05; Fig. 7). To measure the peripheral differentiation of the cultured lungs, the mRNA level of SP-C, a marker for peripheral epithelial cells, was quantified by competitive RT-PCR. With the reduction of gremlin expression by antisense oligonucleotides or with exogenous BMP-4 stimulation, SP-C expression by the cultured lungs was increased by approximately threefold (Fig. 8A). More SP-C-positive cells and a higher protein level of SP-C were also observed with SP-C immunostaining (Fig. 8B), indicating that the epithelium has a more mature peripheral phenotype.


View larger version (86K):
[in this window]
[in a new window]
 
Fig. 7.   Increased epithelial cell proliferation of cultured lung in the presence of gremlin AS oligonucleotide (40 µM) or exogenous BMP-4 (200 ng/ml). A: proliferating cells were detected by proliferating cell nuclear antigen (PCNA) immunostaining. Arrows, positive epithelial cells in cultured lung sections from MC, gremlin AS oligonucleotide (GRE AS), and exogenous BMP-4 (BMP-4). All sections were the same magnification. Bar, 25 µm. B: PCNA index for epithelial cells was measured as 31.89 ± 4.83% in MC, 46.47 ± 6.04% in GRE AS (P < 0.05), and 52.88 ± 7.97% in BMP-4 (P < 0.05), which indicates that either reduction of gremlin expression or addition of BMP-4 in cultured lungs increased epithelial cell proliferation.



View larger version (59K):
[in this window]
[in a new window]
 
Fig. 8.   Increase of surfactant protein C (SP-C) expression in cultured lungs treated either with gremlin AS oligonucleotide or with exogenous BMP-4. A: SP-C mRNA was quantified by competitive RT-PCR. SP-C mRNA dramatically increased in cultured lungs in the presence of GRE AS oligonucleotide or exogenous BMP-4 (BMP-4) compared with that in MC and GRE SE. Equal amounts of total RNA template in each PCR were illustrated by beta -actin competitive RT-PCR. B: SP-C protein expression was detected by immunohistochemistry. Positive signals were visualized by a red color. More SP-C-positive cells and a higher intensity of SP-C staining were shown in the cultured lungs treated with either BMP-4 or GRE AS compared with MC. Normal goat serum instead of SP-C antibody was used as a negative control (NC) for SP-C immunostaining. Bar, 50 µm.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Several diverse proteins including noggin, chordin, follistatin, and DAN family members can act as BMP antagonists. Gremlin is a member of the DAN protein family, which also includes DAN, Cerberus, protein related to DAN and Cerberus (PRDC), Dante, and Caronte (4, 22, 25-27, 40). This protein family is classified based on a common carboxy-terminal cysteine motif (CX13-15C8-10CXGXCX15-23CX2CX11LXC). Most of these proteins have been confirmed to have antagonistic activity against BMP-2/4 and the ability to bind to BMP-2. Whether this conserved cysteine motif constitutes a common protein-binding domain that interacts with BMP molecules is still unclear. Many studies have suggested that these BMP antagonists are critical regulators for early embryonic and organ development. For example, Cerberus plays a key role in anterior patterning and left-right asymmetry of the embryonic head and heart (4, 44), whereas Caronte functions in left-right asymmetric axis formation (27, 40). The biological role of Gremlin in embryonic morphogenesis has recently been reported in limb development (5, 21, 45), in which gremlin is expressed in mesenchymal cells close to the apical ectodermal ridge. In the limb bud, Gremlin blocks BMP activity, and BMP in turn suppresses FGF signaling in the apical ectodermal ridge. Thus Gremlin indirectly enhances FGF-mediated limb outgrowth and inhibits chondrogenesis and cell death.

As morphogens, some BMP family members such as BMP-4, BMP-5, and BMP-7 are expressed during the development of embryonic lungs. The roles of BMP-5 and BMP-7 in lung development are still unknown because no abnormal lung phenotype was observed in their respective null mutants, although BMP-5 and BMP-7 are expressed in mesenchyme and endoderm, respectively, in embryonic lungs (6, 13, 14, 18). However, BMP-4 has been identified as a key morphogen during lung development (3, 38). BMP antagonists therefore should also be involved in this process. The question is which antagonists are endogenous regulators, and what do they do? Noggin and chordin were detected at very low levels in embryonic lungs, and the noggin transcript was only detectable in mesenchyme from E10.5 to E13.5 (38). Mice with a null mutation of noggin have no lung phenotype (20). The mouse homolog of Cerberus, Cer1, was only expressed in the epithelial lining of the bronchioles in embryonic lungs after E13.5 and in adult lungs (29). Lung morphogenesis appeared unaltered in Cer1-null mutants. Therefore, other BMP antagonists might be involved in lung morphogenesis. We decided to look for alternative BMP antagonists, particularly other DAN family proteins that might be involved in lung branching morphogenesis. By quantifying the levels of transcripts in whole embryonic lungs, the expression of gremlin exhibited a dynamic developmental change while DAN remained at the same level. This suggested that Gremlin might be a possible physiological regulator for BMP-4 activity, particularly because the relatively high expression of gremlin was observed in mouse embryonic lungs during the pseudoglandular stage (E11.5 to E16.5) when branching morphogenesis is proceeding. However, expression of gremlin was greatly reduced during the saccular stage (E18.5 to P1) when septal structures form to generate sufficient alveolar surface area for gas exchange. Therefore, we postulated that Gremlin might be a very important endogenous BMP antagonist in early lung branching morphogenesis.

The cellular location of gremlin expression was characterized by in situ hybridization. gremlin mRNA was diffusely detected in mesenchyme and epithelial cells at an early lung developmental stage (E11.5), but the expression in endoderm around terminal epithelial buds was definitely higher. Furthermore, BMP-4 was expressed at high levels in the distal endodermal tips and the adjacent mesenchyme and at low levels in the proximal airways (3, 38). Therefore, the partially overlapping expression patterns of BMP-4 and gremlin in the terminal epithelial buds where dichotomous branching happens indicated that Gremlin might be one of the endogenous BMP-4-negative regulators that controls the number of branching epithelial sacs during early lung branching morphogenesis. Furthermore, we speculated that the expression of gremlin in mesenchyme may elevate the threshold concentration of BMP-4 that is required to trigger BMP signaling, thereby restricting the function of BMP-4 to the loci of its highest expression in the distal tips, although it is also possible that Gremlin may inhibit other BMPs. Moreover, the developmental reduction of gremlin expression in the mesenchyme and the increase of gremlin expression in large proximal airway epithelium in later embryonic and neonatal lungs may also contribute to BMP-4-mediated distal-proximal axis formation during later lung developmental stages (38). In addition, the expression level of gremlin rises again in adulthood, with the most intense signals detected in large airway epithelium and some alveolar epithelial cells. gremlin expression has been reported in type I alveolar epithelial cells of the adult rat (34).

Most previously reported data on BMP involvement in embryonic lung development have been obtained from transgenic mouse models in which BMP-4 or various antagonists were misexpressed under the control of the SP-C promoter. The phenotypic analysis mainly has reflected relatively late stages of lung development because high transgenic SP-C promoter activity is only achieved after E15.5 (3, 38, 39). To study the early stages of embryonic lung branching morphogenesis, we used the well-established E11.5 lung organ culture system (41). This system allowed us to determine the function of individual genes in lung branching morphogenesis, either by knocking down specific endogenous gene expression or by adding exogenous morphogen. The addition of antisense oligonucleotides to cultures provides a useful approach for knocking down target gene expression in cultured embryonic lungs because oligonucleotides can penetrate easily and distribute evenly in the embryonic lung tissue.

We found that the addition of exogenous BMP-4 ligand significantly enhanced branching morphogenesis, which, for the first time, directly supports the concept that BMP-4 is a morphogen for lungs or at least stimulates early embryonic lung development in the whole organ culture system. Whether BMP-4 directly stimulates lung branching or induces other morphogens to indirectly enhance lung branching is unknown. However, it seems that mesenchyme is required for BMP-4 to achieve this stimulatory effect because the addition of exogenous BMP-4 inhibited FGF-10-induced outgrowth of isolated lung endodermal buds at E11.5 in a defined Matrigel culture system and reduced cell proliferation in the distal region (37). Therefore, the stimulatory effect of BMP-4 might be mediated by other factors in mesenchyme where its antagonist, gremlin, is diffusely expressed.

On the other hand, we report here that knocking down gremlin expression with antisense oligonucleotides achieved a similar positive morphogenetic phenotype to that of the addition of BMP-4. Moreover, the overexpression of gremlin in lung explants blocked the exogenous BMP-4 stimulation on embryonic lung branching, which directly supports the concept that gremlin modulates early embryonic branching morphogenesis by negatively regulating BMP-4 morphogenetic activity. This suggests that Gremlin must have a distinct biological function during lung branching morphogenesis rather than acting merely as a redundant BMP family peptide inhibitor. In addition, both reduced gremlin expression and exogenous BMP-4 in E11.5 mouse lung explants in culture increased epithelial cell proliferation and SP-C expression, respectively. However, in contrast, transgenic overexpression of BMP-4 driven by the SP-C promoter reduced epithelial cell proliferation at E16.5, increased total cell proliferation at E18.5, and reduced SP-C mRNA expression at late stages of embryonic lung development (3), suggesting that BMP-4 may have different biological effects on lung epithelial cell proliferation and differentiation at different developmental stages and at different levels of expression. Thus Gremlin and BMP-4 appear to play complementary roles during early lung development.

The molecular mechanism of lung branching morphogenesis involves finely balanced interactions between a number of inductive morphogenetic pathways such as Sonic hedgehog (Shh), BMP, and FGF. Shh and BMP-4 are highly expressed in distal bud epithelium, whereas FGF-10 is highly expressed in the mesenchyme adjacent to extending buds (1-3). All of these morphogens initiate specific signaling pathways. Each pathway itself is finely regulated at a number of levels and is also mutually regulated. For example, Shh upregulates its downstream receptor, Patched, and thus inhibits FGF-10 expression in the adjacent mesenchyme (1, 16). On the other hand, FGF-10 upregulates BMP-4 expression, whereas murine Sprouty 2 functions as an antagonist for FGF-10 (16, 32). Gremlin can now be included as a functional physiological antagonist that restricts BMP-4 activity to the distal bud, contributing to the fine regulation of the number of branching epithelial sacs. The coordinating mechanisms between these growth factor pathways in lung morphogenesis are as yet unclear, and the relationships between BMP-4-Gremlin and other morphogenetic factors are currently under investigation. However, it is interesting to compare them with the regulatory loop models now being advanced in limb development. In the limb model, Shh upregulates and maintains gremlin expression. Gremlin then relieves the repressive effect of BMP-4 on FGF-4 expression, which, in turn, positively feeds back to stimulate Shh (5, 21, 45). Whether a similar mechanism exists to coordinate these signaling pathways in early lung branching morphogenesis needs to be studied further.


    ACKNOWLEDGEMENTS

We thank Hui Chen and Stella Gukasyan at the Center for Craniofacial Molecular Biology (University of Southern California, Los Angeles, CA) for assistance with the surfactant protein C competitive RT-PCR assay and proliferating cell nuclear antigen immunostaining.


    FOOTNOTES

This study was supported by a Childrens Hospital Los Angeles Fellowship (to W. Shi), a grant from the American Lung Association of California Research Program (to W. Shi), and National Heart, Lung, and Blood Institute Grants HL-60231, HL-44060, and HL-44977 (to D. Warburton).

Address for reprint requests and other correspondence: D. Warburton, Developmental Biology Program, Childrens Hospital Los Angeles Research Institute, 4650 Sunset Blvd., MS 35, Los Angeles, CA 90027 (E-mail: dwarburton{at}chla.usc.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 3 August 2000; accepted in final form 30 November 2000.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1.   Bellusci, S, Furuta Y, Rush MG, Henderson R, Winnier G, and Hogan BL. Involvement of Sonic hedgehog (Shh) in mouse embryonic lung growth and morphogenesis. Development 124: 53-63, 1997[Abstract].

2.   Bellusci, S, Grindley J, Emoto H, Itoh N, and Hogan BL. Fibroblast growth factor 10 (FGF10) and branching morphogenesis in the embryonic mouse lung. Development 124: 4867-4878, 1997[Abstract].

3.   Bellusci, S, Henderson R, Winnier G, Oikawa T, and Hogan BL. Evidence from normal expression and targeted misexpression that bone morphogenetic protein (Bmp-4) plays a role in mouse embryonic lung morphogenesis. Development 122: 1693-1702, 1996[Abstract].

4.   Bouwmeester, T, Kim S, Sasai Y, Lu B, and De Robertis EM. Cerberus is a head-inducing secreted factor expressed in the anterior endoderm of Spemann's organizer. Nature 382: 595-601, 1996[Medline].

5.   Capdevila, J, Tsukui T, Rodriquez Esteban C, Zappavigna V, and Izpisua Belmonte JC. Control of vertebrate limb outgrowth by the proximal factor Meis2 and distal antagonism of BMPs by gremlin. Mol Cell 4: 839-849, 1999[ISI][Medline].

6.   Dudley, AT, Lyons KM, and Robertson EJ. A requirement for bone morphogenetic protein-7 during development of the mammalian kidney and eye. Genes Dev 9: 2795-2807, 1995[Abstract/Free Full Text].

7.   He, TC, Zhou S, da Costa LT, Yu J, Kinzler KW, and Vogelstein B. A simplified system for generating recombinant adenoviruses. Proc Natl Acad Sci USA 95: 2509-2514, 1998[Abstract/Free Full Text].

8.   Hogan, BL. Bone morphogenetic proteins: multifunctional regulators of vertebrate development. Genes Dev 10: 1580-1594, 1996[Free Full Text].

9.   Hogan, BL. Morphogenesis. Cell 96: 225-233, 1999[ISI][Medline].

10.   Hsu, DR, Economides AN, Wang X, Eimon PM, and Harland RM. The Xenopus dorsalizing factor gremlin identifies a novel family of secreted proteins that antagonize BMP activities. Mol Cell 1: 673-683, 1998[ISI][Medline].

11.   Imamura, T, Takase M, Nishihara A, Oeda E, Hanai J, Kawabata M, and Miyazono K. Smad6 inhibits signaling by the TGF-beta superfamily. Nature 389: 622-626, 1997[Medline].

12.   Jaskoll, TF, Don-Wheeler G, Johnson R, and Slavkin HC. Embryonic mouse lung morphogenesis and type II cytodifferentiation in serumless, chemically defined medium using prolonged in vitro cultures. Cell Differ 24: 105-117, 1988[ISI][Medline].

13.   King, JA, Marker PC, Seung KJ, and Kingsley DM. BMP5 and the molecular, skeletal, and soft-tissue alterations in short ear mice. Dev Biol 166: 112-122, 1994[ISI][Medline].

14.   Kingsley, DM, Bland AE, Grubber JM, Marker PC, Russell LB, Copeland NG, and Jenkins NA. The mouse short ear skeletal morphogenesis locus is associated with defects in a bone morphogenetic member of the TGF beta superfamily. Cell 71: 399-410, 1992[ISI][Medline].

15.   Kirkwood, B. Nonparametric methods. In: Medical Statistics Oxford, UK: Blackwell Scientific, 1988, p. 150-151.

16.   Lebeche, D, Malpel S, and Cardoso WV. Fibroblast growth factor interactions in the developing lung. Mech Dev 86: 125-136, 1999[ISI][Medline].

17.   Lemaire, P, and Yasuo H. Developmental signalling: a careful balancing act. Curr Biol 8: R228-R231, 1998[ISI][Medline].

18.   Luo, G, Hofmann C, Bronckers AL, Sohocki M, Bradley A, and Karsenty G. BMP-7 is an inducer of nephrogenesis and is also required for eye development and skeletal patterning. Genes Dev 9: 2808-2820, 1995[Abstract/Free Full Text].

19.   Massague, J. TGF-beta signal transduction. Annu Rev Biochem 67: 753-791, 1998[ISI][Medline].

20.   McMahon, JA, Takada S, Zimmerman LB, Fan CM, Harland RM, and McMahon AP. Noggin-mediated antagonism of BMP signaling is required for growth and patterning of the neural tube and somite. Genes Dev 12: 1438-1452, 1998[Abstract/Free Full Text].

21.   Merino, R, Rodriguez-Leon J, Macias D, Ganan Y, Economides AN, and Hurle JM. The BMP antagonist gremlin regulates outgrowth, chondrogenesis and programmed cell death in the developing limb. Development 126: 5515-5522, 1999[Abstract].

22.   Minabe-Saegusa, C, Saegusa H, Tsukahara M, and Noguchi S. Sequence and expression of a novel mouse gene PRDC (protein related to DAN and cerberus) identified by a gene trap approach. Dev Growth Differ 40: 343-353, 1998[ISI][Medline].

23.   Nakao, A, Afrakhte M, Moren A, Nakayama T, Christian JL, Heuchel R, Itoh S, Kawabata M, Heldin NE, Heldin CH, and Ten Dijke P. Identification of Smad7, a TGFbeta-inducible antagonist of TGF-beta signalling. Nature 389: 631-635, 1997[Medline].

24.   Onichtchouk, D, Chen YG, Dosch R, Gawantka V, Delius H, Massague J, and Niehrs C. Silencing of TGF-beta signalling by the pseudoreceptor BAMBI. Nature 401: 480-485, 1999[Medline].

25.   Ozaki, T, and Sakiyama S. Molecular cloning and characterization of a cDNA showing negative regulation in v-src-transformed 3Y1 rat fibroblasts. Proc Natl Acad Sci USA 90: 2593-2597, 1993[Abstract/Free Full Text].

26.   Pearce, JJ, Penny G, and Rossant J. A mouse cerberus/Dan-related gene family. Dev Biol 209: 98-110, 1999[ISI][Medline].

27.   Rodriguez Esteban, C, Capdevila J, Economides AN, Pascual J, Ortiz A, and Izpisua Belmonte JC. The novel Cer-like protein Caronte mediates the establishment of embryonic left-right asymmetry. Nature 401: 243-251, 1999[Medline].

28.   Shi, W, Heisterkamp N, Groffen J, Zhao J, Warburton D, and Kaartinen V. TGF-beta 3-null mutation does not abrogate fetal lung maturation in vivo by glucocorticoids. Am J Physiol Lung Cell Mol Physiol 277: L1205-L1213, 1999[Abstract/Free Full Text].

29.   Stanley, EG, Biben C, Allison J, Hartley L, Wicks IP, Campbell IK, McKinley M, Barnett L, Koentgen F, Robb L, and Harvey RP. Targeted insertion of a lacZ reporter gene into the mouse Cer1 locus reveals complex and dynamic expression during embryogenesis. Genesis 26: 259-264, 2000[ISI][Medline].

30.   Stroschein, SL, Wang W, Zhou S, Zhou Q, and Luo K. Negative feedback regulation of TGF-beta signaling by the SnoN oncoprotein. Science 286: 771-774, 1999[Abstract/Free Full Text].

31.   Sun, Y, Liu X, Eaton EN, Lane WS, Lodish HF, and Weinberg RA. Interaction of the Ski oncoprotein with Smad3 regulates TGF-beta signaling. Mol Cell 4: 499-509, 1999[ISI][Medline].

32.   Tefft, JD, Lee M, Smith S, Leinwand M, Zhao J, Bringas P, Jr., Crowe DL, and Warburton D. Conserved function of mSpry-2, a murine homolog of Drosophila sprouty, which negatively modulates respiratory organogenesis. Curr Biol 9: 219-222, 1999[ISI][Medline].

33.   Ten Have-Opbroek, A. Lung development in the mouse embryo. Exp Lung Res 17: 111-130, 1991[ISI][Medline].

34.   Topol, LZ, Marx M, Laugier D, Bogdanova NN, Boubnov NV, Clausen PA, Calothy G, and Blair DG. Identification of drm, a novel gene whose expression is suppressed in transformed cells and which can inhibit growth of normal but not transformed cells in culture. Mol Cell Biol 17: 4801-4810, 1997[Abstract].

35.   Warburton, D, and Olver BE. Coordination of genetic, epigenetic, and environmental factors in lung development, injury, and repair. Chest 111: 119S-122S, 1997[Free Full Text].

36.   Warburton, D, Schwarz M, Tefft D, Flores-Delgado G, Anderson KD, and Cardoso WV. The molecular basis of lung morphogenesis. Mech Dev 92: 55-81, 2000[ISI][Medline].

37.   Weaver, M, Dunn NR, and Hogan BL. Bmp4 and Fgf10 play opposing roles during lung bud morphogenesis. Development 127: 2695-2704, 2000[Abstract].

38.   Weaver, M, Yingling JM, Dunn NR, Bellusci S, and Hogan BL. Bmp signaling regulates proximal-distal differentiation of endoderm in mouse lung development. Development 126: 4005-4015, 1999[Abstract].

39.   Wert, SE, Glasser SW, Korfhagen TR, and Whitsett JA. Transcriptional elements from the human SP-C gene direct expression in the primordial respiratory epithelium of transgenic mice. Dev Biol 156: 426-443, 1993[ISI][Medline].

40.   Yokouchi, Y, Vogan KJ, Pearse RV, II, and Tabin CJ. Antagonistic signaling by Caronte, a novel Cerberus-related gene, establishes left-right asymmetric gene expression. Cell 98: 573-583, 1999[ISI][Medline].

41.   Zhang, J, O'Shea S, Liu J, and Schuger L. Bronchial smooth muscle hypoplasia in mouse embryonic lungs exposed to a laminin beta1 chain antisense oligonucleotide. Mech Dev 89: 15-23, 1999[ISI][Medline].

42.   Zhao, J, Bu D, Lee M, Slavkin HC, Hall FL, and Warburton D. Abrogation of transforming growth factor-beta type II receptor stimulates embryonic mouse lung branching morphogenesis in culture. Dev Biol 180: 242-257, 1996[ISI][Medline].

43.   Zhao, J, Sime PJ, Bringas P, Jr, Gauldie J, and Warburton D. Epithelium-specific adenoviral transfer of a dominant negative mutant TGF-beta type II receptor stimulates embryonic lung branching morphogenesis in culture and potentiates EGF and PDGF-AA. Mech Dev 72: 89-100, 1998[ISI][Medline].

44.   Zhu, L, Marvin MJ, Gardiner A, Lassar AB, Mercola M, Stern CD, and Levin M. Cerberus regulates left-right asymmetry of the embryonic head and heart. Curr Biol 9: 931-938, 1999[ISI][Medline].

45.   Zuniga, A, Haramis AP, McMahon AP, and Zeller R. Signal relay by BMP antagonism controls the SHH/FGF4 feedback loop in vertebrate limb buds. Nature 401: 598-602, 1999[Medline].


Am J Physiol Lung Cell Mol Physiol 280(5):L1030-L1039
1040-0605/01 $5.00 Copyright © 2001 the American Physiological Society



This article has been cited by other articles:


Home page
DevelopmentHome page
J. R. Hens, P. Dann, J.-P. Zhang, S. Harris, G. W. Robinson, and J. Wysolmerski
BMP4 and PTHrP interact to stimulate ductal outgrowth during embryonic mammary development and to inhibit hair follicle induction
Development, March 15, 2007; 134(6): 1221 - 1230.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
H. Dickinson, D. W. Walker, E. M. Wintour, and K. Moritz
Maternal dexamethasone treatment at midgestation reduces nephron number and alters renal gene expression in the fetal spiny mouse
Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2007; 292(1): R453 - R461.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
M. van Tuyl, J. Liu, F. Groenman, R. Ridsdale, R. N. N. Han, V. Venkatesh, D. Tibboel, and M. Post
Iroquois genes influence proximo-distal morphogenesis during rat lung development
Am J Physiol Lung Cell Mol Physiol, April 1, 2006; 290(4): L777 - L789.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
C. Chen, H. Chen, J. Sun, P. Bringas Jr., Y. Chen, D. Warburton, and W. Shi
Smad1 expression and function during mouse embryonic lung branching morphogenesis
Am J Physiol Lung Cell Mol Physiol, June 1, 2005; 288(6): L1033 - L1039.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
S. Li, Y. Li, W. Du, L. Zhang, S. Yu, Y. Dai, C. Zhao, and N. Li
Aberrant Gene Expression in Organs of Bovine Clones That Die Within Two Days after Birth
Biol Reprod, February 1, 2005; 72(2): 258 - 265.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
B. A. Hyatt, X. Shangguan, and J. M. Shannon
FGF-10 induces SP-C and Bmp4 and regulates proximal-distal patterning in embryonic tracheal epithelium
Am J Physiol Lung Cell Mol Physiol, December 1, 2004; 287(6): L1116 - L1126.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
O. Michos, L. Panman, K. Vintersten, K. Beier, R. Zeller, and A. Zuniga
Gremlin-mediated BMP antagonism induces the epithelial-mesenchymal feedback signaling controlling metanephric kidney and limb organogenesis
Development, July 15, 2004; 131(14): 3401 - 3410.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
K. A. Gilbert and S. R. Rannels
Matrix GLA protein modulates branching morphogenesis in fetal rat lung
Am J Physiol Lung Cell Mol Physiol, June 1, 2004; 286(6): L1179 - L1187.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
W. Shi, H. Chen, J. Sun, C. Chen, J. Zhao, Y.-L. Wang, K. D. Anderson, and D. Warburton
Overexpression of Smurf1 negatively regulates mouse embryonic lung branching morphogenesis by specifically reducing Smad1 and Smad5 proteins
Am J Physiol Lung Cell Mol Physiol, February 1, 2004; 286(2): L293 - L300.
[Abstract] [Full Text] [PDF]

</

Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
J. M. Shannon, K. McCormick-Shannon, M. S. Burhans, X. Shangguan, K. Srivastava, and B. A. Hyatt
Chondroitin sulfate proteoglycans are required for lung growth and morphogenesis in vitro
Am J Physiol Lung Cell Mol Physiol, December 1, 2003; 285(6): L1323 - L1336.
[Abstract] [Full Text] [PDF]