|
|
||||||||
1 Center for Environmental Medicine and Lung Biology, University of North Carolina at Chapel Hill, Chapel Hill 27599; and 2 Human Studies Division, National Health Effects and Environmental Research Laboratory, United States Environmental Protection Agency, Research Triangle Park, North Carolina 27711
| |
ABSTRACT |
|---|
|
|
|---|
Exposure to ambient particulate matter (PM) in the Utah Valley has previously been associated with a variety of adverse health effects. To investigate intracellular signaling mechanisms for pulmonary responses to Utah Valley PM inhalation, human primary airway epithelial cells were exposed to aqueous extracts of PM collected from the year before (Y1), during (Y2), and after (Y3) the closure of a local steel mill located in the Utah Valley in this study. Transfection with kinase-deficient extracellular signal-regulated kinase (ERK) 1 constructs partially blocked Utah Valley PM-induced interleukin (IL)-8 promoter reporter activity. The mitogen-activated protein kinase/ERK kinase (MEK) activity inhibitor PD-98059 significantly abolished IL-8 released in response to Utah Valley PM, as did the epidermal growth factor (EGF) receptor kinase inhibitor AG-1478. Western blotting showed that Utah Valley PM induced phosphorylation of EGF receptor tyrosine, MEK1/2, and ERK1/2, which could be ablated with AG-1478 or PD-98059. For all findings, the potency of Utah Valley PM collected during Y2 was found to be lower relative to that of Y1 and Y3. These data demonstrate that Utah Valley PM can induce IL-8 expression partially through the activation of the EGF receptor signaling.
signal transduction; particulate matter; epidermal growth factor; mitogen-activated protein kinase; interleukin-8
| |
INTRODUCTION |
|---|
|
|
|---|
EPIDEMIOLOGICAL INVESTIGATIONS have associated increased respiratory-related morbidity and mortality with ambient levels of particulate matter (PM) air pollution with <10 µm in mean aerodynamic diameter (22). Between 1986 and 1988, the Utah Valley provided a unique opportunity for studying the effects of ambient PM. Because of a labor dispute and exchange of ownership, a local steel mill located near a populated corridor ceased operating for 13 mo and resumed operations thereafter. While operational, this plant contributed >80% of industrially related PM in the Utah Valley. Pope (16) has described an association between levels of PM in the Utah Valley, the status of operation in the steel mill, and respiratory health end points in the exposed population, including hospital admissions for pneumonia, pleurisy, bronchitis, and asthma. For example, PM levels and hospitalization among preschool children were increased two- and threefold during the winters of 1986 and 1988, respectively, while the steel mill was functioning compared with the winter of 1987 when the mill was closed. For the 3-yr period, hospital admissions for asthma and bronchitis were correlated with ambient levels of PM in the Utah Valley. These observations have raised important questions regarding the causative agent(s) in PM that is responsible for these effects and the mechanisms through which it occurs.
We obtained filters containing PM collected during this 3-yr period from the Utah Department of Environmental Quality. Aqueous extracts of PM were prepared from the time periods of January to March of 1986, 1987, and 1988. These corresponded to times when the still mill was open (Y1), closed (Y2), and reopened (Y3). Extracts from each of these years were instilled in the lungs of humans. Utah Valley PM from Y1 and Y3 caused an influx of polymorphonuclear neutrophils and production of interleukin (IL)-8. Extracts from Y2 caused minimal inflammation (6a).
These extracts have also been used to assess the production of IL-8 by human primary epithelial cells [normal human bronchial epithelial cells (NHBE)] in vitro. Similar to the in vivo study, Utah Valley PM from Y1 and Y3 induced significant production of IL-8, whereas Utah Valley PM from Y2 caused no effects (6). The coherence of in vivo and in vitro findings makes it possible to use molecular approaches to describe the mechanisms through which Utah Valley PM exerts its effects in NHBE. In this study, we examined the role of epidermal growth factor (EGF) receptor and the downstream mitogen-activated protein kinase (MAPK) in Utah Valley PM-induced IL-8 production.
Eukaryotic cells respond to extracellular stimuli by recruiting signal transduction pathways, including MAPK cascades (9). The extracellular signal-regulated kinase (ERK) pathway has been shown previously to respond to mitogenic stimuli such as growth factors and has been associated with cell proliferation, differentiation, or hypertrophy (5). ERK is phosphorylated by the MAPK/ERK kinase (MEK), which is, in turn, phosphorylated by the MAPK kinase kinase Raf (14). Raf may be activated by the EGF receptor tyrosine kinase through ill-defined mechanisms.
We have recently shown that metals such as Cu, Zn, and V are capable of activating this pathway (24). Because these metals are all found in Utah Valley PM, we examined here the effect of aqueous extracts of Utah Valley PM on elements of the EGF receptor signaling pathway in human airway epithelial cells. We report that Utah Valley PM collected during Y1, Y2, and Y3 of the steel mill shows different potencies in the activation of the EGF receptor signaling pathway in a pattern that is consistent with that demonstrated by the epidemiological observations and the previous in vitro study (6, 16).
| |
METHODS |
|---|
|
|
|---|
Reagents.
Tissue culture medium, supplements, and supplies were obtained from
Clonetics (San Diego, CA). SDS-PAGE supplies such as
molecular mass standards, polyacrylamide, ready gels, and buffers were
obtained from Bio-Rad (Richmond, CA). BSA,
-mercaptoethanol, and
other common laboratory chemicals were purchased from Sigma Chemical (St. Louis, MO). Protein levels were quantified using a Coomassie blue
reagent purchased from Bio-Rad. Guanidine isothiocyanate and cesium
chloride were purchased from Boehringer Mannheim (Indianapolis, IN).
Specific anti-phospho-MEK1/2 (Ser217/Ser221)
and horseradish peroxidase (HRP)-conjugated goat anti-rabbit secondary
antibodies were obtained from New England Biolabs (Boston, MA).
Agarose-conjugated anti-EGF receptor antibody, phosphotyrosine HRP-conjugated antibody, specific anti-phospho-ERK mouse monoclonal antibody, and anti-mouse IgG-HRP were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). PD-98059 was purchased from
Calbiochem-Novabiochem (La Jolla, CA). Tyrphostin AG-1478 was purchased
from BIOMOL Research Laboratories (Plymouth Meeting, PA).
Preparation of Utah Valley PM
extract.
PM < 10 µm in mean aerodynamic diameter (PM10) filters
were obtained from the Air Monitoring Center, Utah Division of Air Quality (Salt Lake City, UT). A total of 102 filters were
chosen to correspond with the timing of epidemiological studies
(16) and were classified into the following three
categories: 34 before closure of the steel mill (January to March 1986, Y1), 34 during closure of the steel mill (January to March 1987, Y2),
and 34 after reopening of the steel mill (January to March 1988, Y3). Each filter was agitated in a 50-ml conical polypropylene tube containing 40 ml of deionized water for 96 h. Filters were
removed, and the aqueous extract that contains ~25% of the material
originally in the filters was centrifuged at 2,500 g for 30 min to pellet the small amount of insoluble matter that remained
undissolved. The undissolved material was assumed to consist of metal
oxides and silicates. The supernatant fluid from all 34 filters from each year was pooled, lyophilized, weighed, and stored at
80°C. Stock suspensions of 2 mg/ml in bronchial epithelial cell basal medium
(BEBM; Clonetics) were prepared just before use and were diluted to a final concentration in BEBM medium.
Cell culture. NHBE cells were obtained from Clonetics or from brush scraping during bronchoscopy of volunteers. The cells (passages 2-4) were seeded on tissue culture-treated plates and grown to 90-100% confluence in bronchial epithelial growth medium (BEGM) supplemented with 0.5 ng/ml EGF, 5 mg/ml insulin, 0.5 ng/ml triiodothyronine, and 0.1 ng/ml retinoic acid. Cells were cultured with BEGM deprived of epidermal growth factor for 12-16 h before being used.
For transfection experiments, an immortalized human airway epithelial cell line was used. This cell line (BEAS-2B) was derived by transforming human bronchial cells with an ad12-SV40 adenovirus construct (18) and were obtained from Drs. Curtis Haris and John Lechner (National Institutes of Health). BEAS-2B cells (passages 70-80) were grown to 40-70% confluence on tissue culture-treated Costar 24-well plates in keratinocyte basal medium (KBM) supplemented with 30 µg/ml bovine pituitary extract, 5 ng/ml human EGF, 500 ng/ml hydrocortisone, 0.1 mM ethanolamine, 0.1 mM phosphoethanolamine, and 5 ng/ml insulin before transfection.Analysis of IL-8 protein and RNA expression. NHBE cells grown to confluence and pretreated with and without protein kinase inhibitors were incubated with 50, 100, or 200 µg/ml Utah Valley PM suspension for times as indicated. The supernatants were removed and centrifuged to pellet nonadherent cells. IL-8 protein content was measured in the supernatants with a Quantikine kit purchased from R&D Systems (Minneapolis, MN).
NHBE cells were lysed with buffer containing 4 M guanidine isothiocyanate, 25 mM sodium citrate (pH 7.0), 0.5% sarkosyl, and 10 mM dithiothreitol. The lysates were layered over an equal volume of 5.7 M CsCl and 0.1 M EDTA, and total RNA was pelleted by sedimentation at 80,000 rpm for 2 h at 15°C. First-strand cDNA was synthesized from 0.1 µg of total RNA, and PCR was performed on 2 µl of the cDNA template as described previously (17). Sequences for oligonucleotide primers were synthesized using an Applied Biosystems 391 DNA synthesizer (Foster City, CA) based on sequences published in the GenBank human DNA database. The sequences of oligonucleotide primers are as follows: glyceraldehyde-3-phosphate dehydrogenase (GAPDH) sense, CCATGGAGAAGGCTGGGG and antisense, CAAAGTTGTCATGGATGACC; IL-8 sense, TCTGCAGCTCTGTGTGAAGGTGCAGTT and antisense, AACCCTCTGCACCCAGTTTTCCTT. After amplification, products were separated by alkaline gel electrophoresis through 2% agarose gels in 1× Tris-borate-EDTA buffer. The gel was stained in 1 µg/ml ethidium bromide and photographed under ultraviolet illumination with Polaroid type 55 P/N film (Polaroid, Cambridge, MA). Specific bands were quantified using Kodak 1D image analysis software (Eastman Kodak, Rochester, NY), and optical densities for IL-8 mRNA bands were normalized to GAPDH band intensities (2).Analysis of protein kinase phosphorylation by Western blotting. NHBE cells grown to 90-100% confluence were cultured for 24 h to deplete EGF present in the culture medium. Cells pretreated with and without kinase inhibitors were incubated with Utah Valley PM suspension for 30 min and were lysed with RIPA lysis buffer (1% Nonidet P-40, 0.5% deoxycholate, and 0.1% SDS in PBS, pH 7.4) containing protease inhibitors (1 mM vanadyl sulfate, 20 mg/ml Pefabloc, 0.5 mg/ml aprotinin, 0.5 mg/ml E-64, 0.5 mg/ml pepstatin, 0.5 mg/ml bestatin, 10 mg/ml chymostatin, and 0.1 mg/ml leupeptin). After normalization for protein content, cell extracts were subjected to SDS-PAGE on 11% gradient PAGE gels with a Tris-glycine-SDS buffer (24). Proteins were then electroblotted onto nitrocellulose. The membranes were incubated with nonfat milk, washed briefly, and incubated with 1:1,000 phospho-specific MEK1/2 or ERK1/2 antibodies in 5% BSA overnight at 4°C followed by incubation with 1:2,000 HRP-conjugated secondary antibody for 1 h at room temperature (20). Bands were detected using enhanced chemiluminescence (ECL) detection reagents 1 and 2 and high-performance chemiluminescence ECL films (Amersham Pharmacia Biotech) with a model SRX-101 Konica medical film processor (Konica). Specific bands were quantified as described above.
Analysis of EGF receptor tyrosine phosphorylation by immunoprecipitation and Western blotting. Confluent NHBE cells were incubated for 24 h before Utah Valley PM exposure. Cells were then incubated with 100 µg/ml Utah Valley PM for 30 min and lysed in RIPA buffer, and the lysates were immunoprecipitated by incubation with 20 µl of agarose-conjugated anti-EGF receptor antibody for 2 h at 4°C. Immune complexes were collected by centrifugation at 10,000 rpm for 5 s, washed two times with RIPA lysis buffer and one time with cold PBS, finally resuspended in 30 µl of sample loading buffer, and boiled for 3 min before separation on 4-15% Tris · HCl ready gels (Bio-Rad). Proteins were transferred to nitrocellulose filters as described above, and tyrosine-phosphorylated EGF receptor was detected using HRP-conjugated specific anti-phosphotyrosine antibodies (24). Bands were detected and quantified using chemiluminescence reagents and films as described above.
Cotransfection of kinase-deficient ERK1 and
IL-8 promoter reporter constructs.
BEAS-2B cells were grown to 40-70% confluence in 24-well tissue
culture plates and cotransfected with a p1.5IL8wt-luc construct and
kinase-deficient ERK1 or ERK2 (pCEP4L-ERK1-K>R or pCEP4L-ERK2-K>R) constructs, respectively. The preparation of the p1.5IL8wt-luc construct has been described earlier (7). The
pCEP4L-ERK1-K>R or pCEP4L-ERK2-K>R constructs were obtained from Dr.
Malanie H. Cobb (Department of Pharmacology, University of Texas
Southwestern Medical Center). Cotransfection was conducted as described
earlier (24). Briefly, 250 ng of pCEP4L-ERK1-K>R or
pCEP4L-ERK2-K>R ERK1 plasmid, 250 ng of p1.5IL8wt-luc plasmid, and 25 ng of pSV-B-galactosidase were incubated with 1.5 µg of DOTAP
transfection reagent (Boehringer Mannheim) for 20 min
(24). Six hours after transfection, cultures were replaced
with supplemented KBM for 24 h. The cells were treated with 200 µg/ml Utah Valley PM from Y1 for 24 h before the cells were
lysed. Detection of luciferase and
-galactosidase was conducted using the Dual-Light chemiluminescent reporter gene assay system from
Tropix and an AutoLumat LB953 luminometer (Berthold Analytical Instruments, Nashua, NH). Promoter activity was estimated as specific luciferase activity (luciferase count/unit
-galactosidase count).
Image analysis and statistics. Data are presented as means ± SE. IL-8 protein, IL-8 mRNA, and cotransfection data were carried out using one-way ANOVA for multigroup comparison. A one-tailed unpaired Student's t-test was performed for pairwise comparisons.
| |
RESULTS |
|---|
|
|
|---|
Utah Valley PM induces
IL-8 mRNA and protein production in human
airway epithelial cells.
We have previously demonstrated that Utah Valley PM from Y1, Y2, and Y3
of the steel mill showed differential abilities to induce expression of
IL-6 and IL-8 in a human airway epithelial cell line (BEAS-2B) in a
dose-dependent fashion, with Y1 and Y3 but not Y2 PM inducing
expression of these cytokines (6). In this study, we
confirmed these findings using primary human bronchial epithelial cells
and Utah Valley PM collected from a different set of filters,
corresponding to the same periods but different days. Figure
1A shows that Utah Valley PM
collected during Y1 and Y3 caused a greater release of IL-8 than did
Utah Valley PM collected during Y2 at higher doses (100 or 200 µg/ml;
P < 0.05). The release induced by all the PM from Y1,
Y2, or Y3 was dose dependent (P < 0.05), and Y1 PM
appeared more potent than Y3 PM (P < 0.01). Exposure
of NHBE cells to Utah Valley PM from Y1 or Y3 for 6 h (Fig.
1B) also induced an increase in IL-8 mRNA expression, with a
pattern similar to that seen for IL-8 protein. IL-8 mRNA was induced in
a dose-dependent fashion by Y1 or Y3 PM. At 200 µg/ml, Utah Valley PM
from Y1 or Y3 induced a significant increase of IL-8 mRNA expression
compared with the PM from Y2. No cytotoxicity was observed at any of
the doses as determined by measuring lactate dehydrogenase activity and
by microscopy examination of the cells (6).
|
Utah Valley PM induces phosphorylation of
ERK1/2, MEK1/2, and the
EGF receptor tyrosine kinase.
Activation of MAPKs is associated with responses to some toxicant
stimuli (11). There were no significant increases in c-Jun NH2-terminal kinase (JNK) or p38 phosphorylation in human
airway epithelial cells exposed to Utah Valley PM. Therefore, we
assessed the effect of Utah Valley PM on ERK1/2 phosphorylation by
Western blotting using a phospho-specific ERK1/2 antibody. Utah Valley PM from Y1 or Y3 elicited an elevated phosphorylation of ERK1/2 relative to Utah Valley PM from Y2 (see Fig. 2A). Utah
Valley PM from Y2 induced a minimal ERK phosphorylation relative to
controls. Because phosphorylation of ERK1/2 implicates the involvement
of its upstream kinases, phosphorylation of MEK1/2 [MAPK kinase
(MAPKK) in ERK pathway] and the EGF receptor tyrosine was detected by means of phospho-specific antibodies. Figure
2B shows
that Utah Valley PM from Y1 or Y3 induced phosphorylation of MEK1/2,
whereas Utah Valley PM from Y2 had minimal effect on phosphorylation of MEK1/2 relative to an unexposed control. Similarly, Utah Valley PM from
Y1 and to a lesser degree Y3 caused phosphorylation of the EGF receptor
tyrosine kinase, whereas Y2 PM had minimal effect (Fig. 2C).
In both cases, EGF, a proven activator of the ERK signaling pathway
(15), induced a significant phosphorylation of MEK1/2 or
the EGF receptor tyrosine kinase. Overall, the changes in the cellular
content of ERK1/2, MEK1/2, and EGF receptor showed variability with
respect to rank order of potency between Y1 and Y3 PM. In the case of
EGF receptor phosphorylation, Y1 PM was only modestly more potent than
Y2 PM. Overall, however, the Y2 extract was less potent than the Y1 and
Y3 materials.
|
Inhibition of Utah Valley PM-induced
phosphorylation of MEK or ERK.
The EGF receptor tyrosine kinase, Raf-1 (MAPKK kinase), and MEK1/2
(MAPKK) are the upstream kinases in the ERK signaling pathway (15). However, recent studies have demonstrated that the
extent to which the ERK upstream kinases participate in ERK activation varies in different cell types in response to different stimuli (10). To determine whether MEK1/2 activation is necessary
for Utah Valley PM-induced phosphorylation of ERK,
PD-98059, a specific inhibitor of MEK activity, was used
(3). Western blotting showed that pretreatment of human
airway epithelial cells with PD-98059 almost completely blocked the
Utah Valley PM-induced phosphorylation of ERK1/2 (Fig.
3A), indicating that MEK
activity is required for ERK phosphorylation in NHBE cells. This
inhibitor also partially blocked EGF-induced phosphorylation of ERK1/2.
We then determined if MEK activation was dependent on activation of the
EGF receptor tyrosine kinase by using tyrphostin AG-1478, a selective
inhibitor of this kinase. Figure 3B shows that tyrphostin
AG-1478 almost completely blocked MEK1/2 phosphorylation in NHBE cells
treated with Utah Valley PM. As expected, tyrphostin AG-1478 was able to completely block EGF-induced phosphorylation of MEK1/2. Both AG-1478
and PD-98059 appeared to inhibit the baseline MEK and ERK
phosphorylations as evidenced by decreased band intensities in the
control (no extract treatment) lanes.
|
Activation of EGF receptor signaling pathway is
partly required for Utah Valley
PM-induced IL-8 expression.
The experiments described above demonstrated that Utah Valley PM is
able to activate the EGF receptor signaling pathway. To determine
whether activation of this signaling pathway is associated with Utah
Valley PM-induced IL-8 expression, inhibitors of the EGF receptor
signaling pathway were used. The EGF receptor tyrosine kinase inhibitor
tyrphostin AG-1478 significantly suppressed IL-8 production in NHBE
cells exposed to Utah Valley PM (Fig.
4A). PD-98059, the selective
inhibitor of MEK, also significantly inhibited Utah Valley PM-induced
IL-8 production, although to a lesser degree than tyrphostin AG-1478
(Fig. 4A). Cotransfection of BEAS-2B cells with an IL-8
promoter reporter construct and a kinase-deficient ERK1 resulted in a
small but significant reduction of IL-8 promoter reporter activity in
BEAS-2B cells treated with Utah Valley PM dusts from Y1 (Fig.
4B). These data suggest that Utah Valley PM-induced IL-8
expression in NHBE cells is at least partly mediated through the ERK
signaling pathway.
|
| |
DISCUSSION |
|---|
|
|
|---|
These studies demonstrate that Utah Valley PM collected while the steel mill was in operation (Y1 and Y3) induce elevated expression of IL-8 in human airway epithelial cells in an apparent dose-dependent fashion. In addition, Utah Valley PM collected from Y1 or Y3 also activated the EGF receptor tyrosine kinase, MEK1/2, and ERK1/2 with greater potency than Y2 PM. Although it is difficult to determine the physiological relevance of the difference in potencies shown by the Utah Valley PM extracts used in this study, the fact that the Y2 material is consistently less potent across all end points examined in this study and others (6, 6a) suggests that the transduction events that we report on here may mediate some of the adverse health effects of ambient PM inhalation. An inhibitor of the EGF receptor tyrosine kinase (tyrphostin AG-1478) or MEK (PD-98059) not only blocked EGF receptor-dependent MEK activation or MEK-dependent ERK phosphorylation but each also at least partially suppressed IL-8 production in NHBE cells exposed to Utah Valley PM. Moreover, use of a dominant negative ERK1 construct demonstrated partial inhibition of Utah Valley PM-induced IL-8 promoter reporter activity. Therefore, we conclude that activation of the EGF receptor signaling pathway is responsible for at least a portion of the increased IL-8 production in NHBE cells exposed to Utah Valley PM. Furthermore, this study also indicated that the physicochemical properties of PM play an important role in Utah Valley PM-induced EGF receptor signaling and IL-8 expression, since the same dose of Utah Valley PM from different sources shows different levels of effect. In addition to the effects observed using soluble aqueous extracts of Utah Valley PM, it is possible that the insoluble portion may also contain biological activity.
The mechanisms responsible for the Utah Valley PM-induced EGF receptor signaling pathway appear to be complex. In addition to the physiological ligand EGF, other exogenous stimuli have recently been shown to activate the EGF receptor signaling pathway. As is the case with all ambient PM, Utah Valley PM used in this study is a complex mixture of metallic salts, silicates, and other organic compositions (6). In our previous study, we showed that combustion-derived metals such as As, V, Cu, or Zn can initiate EGF receptor signaling in a human airway epithelial cell line. Inductively coupled plasma emission spectroscopy revealed that aqueous extracts of Utah Valley PM contain measurable concentrations of ionizable metals such as Zn, Fe, Mn, Cu, V, Ni, and Pb and that these metals are present in substantially higher concentrations in particles collected when the steel mill was in operation. Interestingly, the magnitude of the effects of the Utah Valley PM on signal transduction intermediate phosphorylation that we observed in these studies is similar to that induced by an acute challenge to a high dose of Cu in a previously published study (20). It is possible that this is a result of the Cu content of Utah Valley PM, which may drive the responses observed in this study. Evidence from this and a previous study on Utah Valley PM suggests that metal content may play a role in Utah Valley PM-induced EGF receptor signaling. First, the metal concentration in Utah Valley PM correlated with its potency in inducing phosphorylation of EGF receptor tyrosine kinase, MEK1/2, and ERK1/2; and second, Utah Valley PM-induced IL-8 expression could be blocked by metal chelators (1). However, whether these metals are the actual activators in Utah Valley PM-induced EGF receptor signaling is still unclear, since the metal concentration of particles from Y1 or Y3 was relatively low compared with doses of individual metals used in our previous studies. Thus it is possible that a synergistic effect of these metals within Utah Valley PM components is involved in EGF receptor activation.
Variability in the relative magnitude of the responses to the Y1 and Y3 extracts is apparent when the various mechanistic end points, i.e., potency in inducing EGF receptor, MEK, or ERK phosphorylations, and IL-8 expression are compared. This may be partly attributable to the apparently modest regulatory role of MAPK on IL-8 expression. In addition, the fact that the extracts collected from ambient PM in the Utah Valley at different times are complex mixtures may explain some of the variability in the levels of the responses that were observed. Thus, although it is expected that the relative effect on MEK1/2 induced by Y1 and Y3 exposure should predict a proportional response on ERK1/2, there may be unknown chemical constituents present in these extracts (phosphatase inhibitors, for instance) that differentially affect the magnitude of each response. Nonetheless, the Y2 material consistently exhibited the lowest potency compared with the Y1 and Y3 extracts.
The EGF receptor signaling pathway has been shown to be associated with
a variety of cellular responses mediated through multiple signaling
pathways. This study demonstrates the linkage between EGF receptor
signaling and IL-8 mRNA expression in NHBE cells exposed to Utah Valley
PM. The IL-8 gene is regulated primarily at the level of gene
transcription (19). The IL-8 promoter contains binding
sites for transcription factors such as activator protein (AP)-1,
nuclear factor (NF) IL-6, and NF-
B. Activated ERKs have been shown
to induce phosphorylation and the trans-activating functions
of a number of nuclear transcription factors, including the AP-1
complex (c-Jun, c-Fos, Fra-1, and Fra-2), the Ets family transcription
factor (Elk-1, SAP1a, Ets-1, and Ets-2), ATF-2, C/EBP, and Myc
(11, 21). Our previous studies demonstrate that
combustion-derived metals, including As, Cr, Cu, V, and Zn, are capable
of inducing the transactivation of transcription factors, including
Elk-1, c-Jun, and ATF-2, which we suggest induce a subsequent increase
in IL-8 protein expression in BEAS-2B cells (20).
Additionally, we recently observed that V was able to induce NF-
B
nuclear translocation through the EGF receptor/Ras signaling pathway
(unpublished observations). Residual oil fly ash, another
metal-containing particulate, induced IL-6 expression in human airway
epithelial cells via NF-
B activation (17). Asbestos
fibers have been shown to induce the phosphorylation of EGF receptor
and transcriptionally activate a number of early response genes,
including c-fos, c-jun, and c-myc,
which are accompanied by increases in AP-1 activity and NF-
B
(25). The fact that only a partial inhibition of IL-8
expression was found to be attributable to EGF receptor and ERK1/2
activation is consistent with previous studies showing that IL-8
transcriptional regulation is primarily determined by NF-
B in human
airway epithelial cells (7). Therefore, we hypothesize
that Utah Valley PM induces IL-8 mRNA expression through the
transactivation of similar transcriptional factors, which may be
mediated partly by the ERK signaling pathway. Unlike the ERK pathway,
the JNK and p38 pathways were not found to be activated by Utah Valley
PM since the metal content (maximally 4.5 µM) contained in 200 µg/ml Utah Valley PM extract was rather low compared with the dose
(500 µM) used in our previous studies (20). Furthermore,
these two pathways made no discernible contribution to Utah Valley
PM-induced IL-8 expression in human airway epithelial cells, since
kinase-deficient p38 kinase and JNK did not alter the increased IL-8
promoter reporter activity in BEAS-2B cells exposed to Utah Valley PM
from Y1 (Wu, unpublished observations).
Additionally, the physicochemical properties may play a crucial role in Utah Valley PM-induced IL-8 mRNA and protein expression. At the same doses, dusts from Y1, Y2, and Y3 activated the ERK pathway with different potencies, leading to differential IL-8 expression. These results are consistent with data showing increased IL-8 production in the lungs of humans instilled with Utah Valley PM from Y1 and Y3 but not from Y2 (6a). The general coherence between in vivo and in vitro studies suggests that molecular approaches such as those described in this study may be useful in the investigation of the mechanisms through which Utah Valley PM exerts its effects. Moreover, the discovery that the EGF receptor signaling pathway is associated with IL-8 expression in human airway epithelial cells, the primary initiators of the inflammatory response in the lungs, may provide clues for therapeutic application of kinase inhibitors to PM-related pulmonary inflammation.
| |
ACKNOWLEDGEMENTS |
|---|
We gratefully acknowledge the technical assistance of Lisa Dailey and Jacqueline D. Carter and advice from Drs. William Reed and Ilona Jaspers.
| |
FOOTNOTES |
|---|
The research described in this article has been reviewed by the National Health and Environmental Effects Research Laboratory, United States Environmental Protection Agency, and has been approved for publication. Approval does not signify that the contents necessarily reflect the views and policies of the Agency, nor does mention of trade names constitute endorsement or recommendation for use.
Address for reprint requests and other correspondence: R. B. Devlin, Human Studies Division, National Health and Environmental Effects Research Laboratory, US Environmental Protection Agency, Research Triangle Park, NC 27711 (E-mail: devlin.robert{at}epa.gov).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 1 November 2000; accepted in final form 23 March 2001.
| |
REFERENCES |
|---|
|
|
|---|
1.
Bernstein, LR,
Ferris DK,
Colburn NH,
and
Sobel ME.
A family of mitogen-activated protein kinase-related proteins interacts in vivo with activator protein-1 transcription factor.
J Biol Chem
269:
9401-9404,
1994
2.
Carter, JD,
Ghio AJ,
Samet JM,
and
Devlin RB.
Cytokine production by human airway epithelial cells after exposure to an air pollution particle is metal-dependent.
Toxicol Appl Pharmacol
146:
180-188,
1997[Web of Science][Medline].
3.
Daub, H,
Weiss FU,
Wallasch C,
and
Ullrich A.
Role of transactivation of the EGF receptor in signaling by G-protein-coupled receptors.
Nature
379:
557-560,
1996[Medline].
4.
Dudley, DT,
Pang L,
Decker SJ,
Bridges AJ,
and
Saltiel AR.
A synthetic inhibitor of the mitogen-activated protein kinase cascade.
Proc Natl Acad Sci USA
92:
7686-7689,
1995
5.
Force, T,
and
Bonventre JV.
Growth factors and mitogen-activated protein kinases.
Hypertension
31:
152-161,
1998
6.
Frampton, MW,
Ghio AJ,
Samet JM,
Carson JL,
Carter JD,
Devlin RB,
and
Pope CA.
Effects of aqueous extracts of PM10 filters from the Utah Valley on human airway epithelial cells.
Am J Physiol Lung Cell Mol Physiol
277:
L960-L967,
1999
6a.
Ghio AJ and Devlin RB. Inflammatory lung injury after bronchial
instillation of air pollution particles. Am J Respir Crit
Care Med. In press.
7.
Jaspers, I,
Samet JM,
and
Reed W.
Arsenite exposure of cultured airway epithelial cells activates B-dependent interleukin-8 gene expression in the absence of nuclear factor-B nuclear translocation.
J Biol Chem
274:
31025-31033,
1999
8.
Kowenz-Leutz, E,
Twamley G,
Ansieau S,
and
Leutz A.
Novel mechanism of C/EBP beta (NF-M) transcriptional control: activation through depression.
Genes Dev
8:
2781-2791,
1994
9.
Levin, DE,
and
Errede B.
The proliferation of MAP kinase signaling pathways in yeast.
Curr Opin Cell Biol
7:
197-202,
1995[Web of Science][Medline].
10.
Li, X,
Lee JW,
Graves LM,
and
Earp HS.
Angiotensin II stimulates ERK via two pathways in epithelial cells: protein kinase C suppresses a G-protein coupled receptor-EGF receptor transactivation pathway.
EMBO J
17:
2574-2583,
1998[Web of Science][Medline].
11.
Liu, Y,
Gorospe M,
Yang C,
and
Holbrook NJ.
Role of mitogen-activated protein kinase phosphatase during the cellular response to genotoxic stress. Inhibition of c-Jun N-terminal kinase activity and AP-1-dependent gene activation.
J Biol Chem
270:
8377-8380,
1995
12.
Liu, Y,
Guyton KZ,
Gorospe M,
Xu Q,
Lee JC,
and
Holbrook NJ.
Differential activation of ERK, JNK/SAPK and P38/CSBP/RK map kinase family members during the cellular response to arsenite.
Free Radic Biol Med
21:
771-781,
1996[Web of Science][Medline].
13.
Marais, R,
Wynne J,
and
Treisman R.
The SRF accessory protein Elk-1 contains a growth factor-regulated transcriptional activation domain.
Cell
73:
381-393,
1993[Web of Science][Medline].
14.
Minden, A,
and
Karin M.
Regulation and function of the JNK subgroup of MAP kinases.
Biochim Biophys Acta
1333:
F85-F104,
1997[Medline].
15.
Minden, A,
Lin A,
McMahon M,
Lange-Carter C,
Derijard B,
Davis RJ,
Johnson GL,
and
Karin M.
Differential activation of ERK and JNK mitogen-activated protein kinases by Raf-1 and MEKK.
Science
266:
1719-1723,
1994
16.
Pope, CAI
Respiratory hospital admissions associated with PM10 pollution in Utah, Salt Lake, and Cache Valleys.
Arch Environ Health
46:
90-97,
1991[Web of Science][Medline].
17.
Quay, JL,
Reed W,
Samet JM,
and
Devlin RB.
Air pollution particles induce IL-6 gene expression in human airway epithelial cells via NF-kappaB activation.
Am J Respir Cell Mol Biol
19:
98-106,
1998
18.
Reddel, RR,
Ke Y,
Gerwin BI,
McMenamin MG,
Lechner JF,
Su RT,
Brash DE,
Park JB,
Rhim JS,
and
Harris CC.
Transformation of human bronchial epithelial cells by infection with SV40 or adenovirus-12 SV40 hybrid virus, or transfection via strontium phosphate coprecipitation with a plasmid containing SV40 early region genes.
Cancer Res
48:
1904-1909,
1988
19.
Roebuck, KA.
Regulation of interleukin-8 gene expression.
J Interferon Cytokine Res
19:
429-438,
1999[Web of Science][Medline].
20.
Samet, JM,
Graves LM,
Quay J,
Dailey LA,
Devlin RB,
Ghio AJ,
Wu W,
Bromberg PA,
and
Reed W.
Activation of MAPKs in human bronchial epithelial cells exposed to metals.
Am J Physiol Lung Cell Mol Physiol
275:
L551-L558,
1998
21.
Seth, A,
Alvarez E,
Gupta S,
and
Davis RJ.
A phosphorylation site located in the NH2-terminal domain of c-Myc increases transactivation of gene expression.
J Biol Chem
266:
23521-23524,
1991
22.
US Environmental Protection Agency.
Air Quality Criteria for Particulate Matter. Research Triangle Park, NC: EPA, 1996, vol. 166, p. 111-119 (Publication No. EPA/600/P-95/1bF).
23.
Winston, BW,
Lange-Carter CA,
Gardner AM,
Johnson GL,
and
Riches DW.
Tumor necrosis factor alpha rapidly activates the mitogen-activated protein kinase (MAPK) cascade in a MAPK kinase kinase-dependent, c-Raf-1-independent fashion in mouse macrophages.
Proc Natl Acad Sci USA
92:
1614-1618,
1995
24.
Wu, W,
Graves LM,
Jaspers I,
Devlin RB,
Reed W,
and
Samet JM.
Activation of the EGF receptor signaling pathway in human airway epithelial cells exposed to metals.
Am J Physiol Lung Cell Mol Physiol
277:
L924-L931,
1999
25.
Zanella, CL,
Timblin CR,
Cummins A,
Jung M,
Goldberg J,
Raabe R,
Tritton TR,
and
Mossman BT.
Asbestos-induced phosphorylation of epidermal growth factor receptor is linked to c-fos and apoptosis.
Am J Physiol Lung Cell Mol Physiol
277:
L684-L693,
1999
This article has been cited by other articles:
![]() |
C. Jeulin, V. Seltzer, D. Bailbe, K. Andreau, and F. Marano EGF mediates calcium-activated chloride channel activation in the human bronchial epithelial cell line 16HBE14o-: involvement of tyrosine kinase p60c-src Am J Physiol Lung Cell Mol Physiol, September 1, 2008; 295(3): L489 - L496. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Rumelhard, K. Ramgolam, R. Hamel, F. Marano, and A. Baeza-Squiban Expression and role of EGFR ligands induced in airway cells by PM2.5 and its components Eur. Respir. J., December 1, 2007; 30(6): 1064 - 1073. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-M. Kim, W. Reed, W. Wu, P. A. Bromberg, L. M. Graves, and J. M. Samet Zn2+-induced IL-8 expression involves AP-1, JNK, and ERK activities in human airway epithelial cells Am J Physiol Lung Cell Mol Physiol, May 1, 2006; 290(5): L1028 - L1035. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-M. Kim, W. Reed, A. G. Lenz, I. Jaspers, R. Silbajoris, H. S. Nick, and J. M. Samet Ultrafine carbon particles induce interleukin-8 gene transcription and p38 MAPK activation in normal human bronchial epithelial cells Am J Physiol Lung Cell Mol Physiol, March 1, 2005; 288(3): L432 - L441. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Wu, J. M. Samet, R. Silbajoris, L. A. Dailey, D. Sheppard, P. A. Bromberg, and L. M. Graves Heparin-Binding Epidermal Growth Factor Cleavage Mediates Zinc-Induced Epidermal Growth Factor Receptor Phosphorylation Am. J. Respir. Cell Mol. Biol., April 1, 2004; 30(4): 540 - 547. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Blanchet, K. Ramgolam, A. Baulig, F. Marano, and A. Baeza-Squiban Fine Particulate Matter Induces Amphiregulin Secretion by Bronchial Epithelial Cells Am. J. Respir. Cell Mol. Biol., April 1, 2004; 30(4): 421 - 427. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. S. Tjabringa, J. Aarbiou, D. K. Ninaber, J. W. Drijfhout, O. E. Sorensen, N. Borregaard, K. F. Rabe, and P. S. Hiemstra The Antimicrobial Peptide LL-37 Activates Innate Immunity at the Airway Epithelial Surface by Transactivation of the Epidermal Growth Factor Receptor J. Immunol., December 15, 2003; 171(12): 6690 - 6696. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |