AJP - Lung Columbus Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 281: L483-L489, 2001;
1040-0605/01 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (27)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wu, W.
Right arrow Articles by Devlin, R. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wu, W.
Right arrow Articles by Devlin, R. B.
Vol. 281, Issue 2, L483-L489, August 2001

Activation of the EGF receptor signaling pathway in airway epithelial cells exposed to Utah Valley PM

Weidong Wu1, James M. Samet2, Andrew J. Ghio2, and Robert B. Devlin2

1 Center for Environmental Medicine and Lung Biology, University of North Carolina at Chapel Hill, Chapel Hill 27599; and 2 Human Studies Division, National Health Effects and Environmental Research Laboratory, United States Environmental Protection Agency, Research Triangle Park, North Carolina 27711


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Exposure to ambient particulate matter (PM) in the Utah Valley has previously been associated with a variety of adverse health effects. To investigate intracellular signaling mechanisms for pulmonary responses to Utah Valley PM inhalation, human primary airway epithelial cells were exposed to aqueous extracts of PM collected from the year before (Y1), during (Y2), and after (Y3) the closure of a local steel mill located in the Utah Valley in this study. Transfection with kinase-deficient extracellular signal-regulated kinase (ERK) 1 constructs partially blocked Utah Valley PM-induced interleukin (IL)-8 promoter reporter activity. The mitogen-activated protein kinase/ERK kinase (MEK) activity inhibitor PD-98059 significantly abolished IL-8 released in response to Utah Valley PM, as did the epidermal growth factor (EGF) receptor kinase inhibitor AG-1478. Western blotting showed that Utah Valley PM induced phosphorylation of EGF receptor tyrosine, MEK1/2, and ERK1/2, which could be ablated with AG-1478 or PD-98059. For all findings, the potency of Utah Valley PM collected during Y2 was found to be lower relative to that of Y1 and Y3. These data demonstrate that Utah Valley PM can induce IL-8 expression partially through the activation of the EGF receptor signaling.

signal transduction; particulate matter; epidermal growth factor; mitogen-activated protein kinase; interleukin-8


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

EPIDEMIOLOGICAL INVESTIGATIONS have associated increased respiratory-related morbidity and mortality with ambient levels of particulate matter (PM) air pollution with <10 µm in mean aerodynamic diameter (22). Between 1986 and 1988, the Utah Valley provided a unique opportunity for studying the effects of ambient PM. Because of a labor dispute and exchange of ownership, a local steel mill located near a populated corridor ceased operating for 13 mo and resumed operations thereafter. While operational, this plant contributed >80% of industrially related PM in the Utah Valley. Pope (16) has described an association between levels of PM in the Utah Valley, the status of operation in the steel mill, and respiratory health end points in the exposed population, including hospital admissions for pneumonia, pleurisy, bronchitis, and asthma. For example, PM levels and hospitalization among preschool children were increased two- and threefold during the winters of 1986 and 1988, respectively, while the steel mill was functioning compared with the winter of 1987 when the mill was closed. For the 3-yr period, hospital admissions for asthma and bronchitis were correlated with ambient levels of PM in the Utah Valley. These observations have raised important questions regarding the causative agent(s) in PM that is responsible for these effects and the mechanisms through which it occurs.

We obtained filters containing PM collected during this 3-yr period from the Utah Department of Environmental Quality. Aqueous extracts of PM were prepared from the time periods of January to March of 1986, 1987, and 1988. These corresponded to times when the still mill was open (Y1), closed (Y2), and reopened (Y3). Extracts from each of these years were instilled in the lungs of humans. Utah Valley PM from Y1 and Y3 caused an influx of polymorphonuclear neutrophils and production of interleukin (IL)-8. Extracts from Y2 caused minimal inflammation (6a).

These extracts have also been used to assess the production of IL-8 by human primary epithelial cells [normal human bronchial epithelial cells (NHBE)] in vitro. Similar to the in vivo study, Utah Valley PM from Y1 and Y3 induced significant production of IL-8, whereas Utah Valley PM from Y2 caused no effects (6). The coherence of in vivo and in vitro findings makes it possible to use molecular approaches to describe the mechanisms through which Utah Valley PM exerts its effects in NHBE. In this study, we examined the role of epidermal growth factor (EGF) receptor and the downstream mitogen-activated protein kinase (MAPK) in Utah Valley PM-induced IL-8 production.

Eukaryotic cells respond to extracellular stimuli by recruiting signal transduction pathways, including MAPK cascades (9). The extracellular signal-regulated kinase (ERK) pathway has been shown previously to respond to mitogenic stimuli such as growth factors and has been associated with cell proliferation, differentiation, or hypertrophy (5). ERK is phosphorylated by the MAPK/ERK kinase (MEK), which is, in turn, phosphorylated by the MAPK kinase kinase Raf (14). Raf may be activated by the EGF receptor tyrosine kinase through ill-defined mechanisms.

We have recently shown that metals such as Cu, Zn, and V are capable of activating this pathway (24). Because these metals are all found in Utah Valley PM, we examined here the effect of aqueous extracts of Utah Valley PM on elements of the EGF receptor signaling pathway in human airway epithelial cells. We report that Utah Valley PM collected during Y1, Y2, and Y3 of the steel mill shows different potencies in the activation of the EGF receptor signaling pathway in a pattern that is consistent with that demonstrated by the epidemiological observations and the previous in vitro study (6, 16).


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Reagents. Tissue culture medium, supplements, and supplies were obtained from Clonetics (San Diego, CA). SDS-PAGE supplies such as molecular mass standards, polyacrylamide, ready gels, and buffers were obtained from Bio-Rad (Richmond, CA). BSA, beta -mercaptoethanol, and other common laboratory chemicals were purchased from Sigma Chemical (St. Louis, MO). Protein levels were quantified using a Coomassie blue reagent purchased from Bio-Rad. Guanidine isothiocyanate and cesium chloride were purchased from Boehringer Mannheim (Indianapolis, IN). Specific anti-phospho-MEK1/2 (Ser217/Ser221) and horseradish peroxidase (HRP)-conjugated goat anti-rabbit secondary antibodies were obtained from New England Biolabs (Boston, MA). Agarose-conjugated anti-EGF receptor antibody, phosphotyrosine HRP-conjugated antibody, specific anti-phospho-ERK mouse monoclonal antibody, and anti-mouse IgG-HRP were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). PD-98059 was purchased from Calbiochem-Novabiochem (La Jolla, CA). Tyrphostin AG-1478 was purchased from BIOMOL Research Laboratories (Plymouth Meeting, PA).

Preparation of Utah Valley PM extract. PM < 10 µm in mean aerodynamic diameter (PM10) filters were obtained from the Air Monitoring Center, Utah Division of Air Quality (Salt Lake City, UT). A total of 102 filters were chosen to correspond with the timing of epidemiological studies (16) and were classified into the following three categories: 34 before closure of the steel mill (January to March 1986, Y1), 34 during closure of the steel mill (January to March 1987, Y2), and 34 after reopening of the steel mill (January to March 1988, Y3). Each filter was agitated in a 50-ml conical polypropylene tube containing 40 ml of deionized water for 96 h. Filters were removed, and the aqueous extract that contains ~25% of the material originally in the filters was centrifuged at 2,500 g for 30 min to pellet the small amount of insoluble matter that remained undissolved. The undissolved material was assumed to consist of metal oxides and silicates. The supernatant fluid from all 34 filters from each year was pooled, lyophilized, weighed, and stored at -80°C. Stock suspensions of 2 mg/ml in bronchial epithelial cell basal medium (BEBM; Clonetics) were prepared just before use and were diluted to a final concentration in BEBM medium.

Cell culture. NHBE cells were obtained from Clonetics or from brush scraping during bronchoscopy of volunteers. The cells (passages 2-4) were seeded on tissue culture-treated plates and grown to 90-100% confluence in bronchial epithelial growth medium (BEGM) supplemented with 0.5 ng/ml EGF, 5 mg/ml insulin, 0.5 ng/ml triiodothyronine, and 0.1 ng/ml retinoic acid. Cells were cultured with BEGM deprived of epidermal growth factor for 12-16 h before being used.

For transfection experiments, an immortalized human airway epithelial cell line was used. This cell line (BEAS-2B) was derived by transforming human bronchial cells with an ad12-SV40 adenovirus construct (18) and were obtained from Drs. Curtis Haris and John Lechner (National Institutes of Health). BEAS-2B cells (passages 70-80) were grown to 40-70% confluence on tissue culture-treated Costar 24-well plates in keratinocyte basal medium (KBM) supplemented with 30 µg/ml bovine pituitary extract, 5 ng/ml human EGF, 500 ng/ml hydrocortisone, 0.1 mM ethanolamine, 0.1 mM phosphoethanolamine, and 5 ng/ml insulin before transfection.

Analysis of IL-8 protein and RNA expression. NHBE cells grown to confluence and pretreated with and without protein kinase inhibitors were incubated with 50, 100, or 200 µg/ml Utah Valley PM suspension for times as indicated. The supernatants were removed and centrifuged to pellet nonadherent cells. IL-8 protein content was measured in the supernatants with a Quantikine kit purchased from R&D Systems (Minneapolis, MN).

NHBE cells were lysed with buffer containing 4 M guanidine isothiocyanate, 25 mM sodium citrate (pH 7.0), 0.5% sarkosyl, and 10 mM dithiothreitol. The lysates were layered over an equal volume of 5.7 M CsCl and 0.1 M EDTA, and total RNA was pelleted by sedimentation at 80,000 rpm for 2 h at 15°C. First-strand cDNA was synthesized from 0.1 µg of total RNA, and PCR was performed on 2 µl of the cDNA template as described previously (17). Sequences for oligonucleotide primers were synthesized using an Applied Biosystems 391 DNA synthesizer (Foster City, CA) based on sequences published in the GenBank human DNA database. The sequences of oligonucleotide primers are as follows: glyceraldehyde-3-phosphate dehydrogenase (GAPDH) sense, CCATGGAGAAGGCTGGGG and antisense, CAAAGTTGTCATGGATGACC; IL-8 sense, TCTGCAGCTCTGTGTGAAGGTGCAGTT and antisense, AACCCTCTGCACCCAGTTTTCCTT. After amplification, products were separated by alkaline gel electrophoresis through 2% agarose gels in 1× Tris-borate-EDTA buffer. The gel was stained in 1 µg/ml ethidium bromide and photographed under ultraviolet illumination with Polaroid type 55 P/N film (Polaroid, Cambridge, MA). Specific bands were quantified using Kodak 1D image analysis software (Eastman Kodak, Rochester, NY), and optical densities for IL-8 mRNA bands were normalized to GAPDH band intensities (2).

Analysis of protein kinase phosphorylation by Western blotting. NHBE cells grown to 90-100% confluence were cultured for 24 h to deplete EGF present in the culture medium. Cells pretreated with and without kinase inhibitors were incubated with Utah Valley PM suspension for 30 min and were lysed with RIPA lysis buffer (1% Nonidet P-40, 0.5% deoxycholate, and 0.1% SDS in PBS, pH 7.4) containing protease inhibitors (1 mM vanadyl sulfate, 20 mg/ml Pefabloc, 0.5 mg/ml aprotinin, 0.5 mg/ml E-64, 0.5 mg/ml pepstatin, 0.5 mg/ml bestatin, 10 mg/ml chymostatin, and 0.1 mg/ml leupeptin). After normalization for protein content, cell extracts were subjected to SDS-PAGE on 11% gradient PAGE gels with a Tris-glycine-SDS buffer (24). Proteins were then electroblotted onto nitrocellulose. The membranes were incubated with nonfat milk, washed briefly, and incubated with 1:1,000 phospho-specific MEK1/2 or ERK1/2 antibodies in 5% BSA overnight at 4°C followed by incubation with 1:2,000 HRP-conjugated secondary antibody for 1 h at room temperature (20). Bands were detected using enhanced chemiluminescence (ECL) detection reagents 1 and 2 and high-performance chemiluminescence ECL films (Amersham Pharmacia Biotech) with a model SRX-101 Konica medical film processor (Konica). Specific bands were quantified as described above.

Analysis of EGF receptor tyrosine phosphorylation by immunoprecipitation and Western blotting. Confluent NHBE cells were incubated for 24 h before Utah Valley PM exposure. Cells were then incubated with 100 µg/ml Utah Valley PM for 30 min and lysed in RIPA buffer, and the lysates were immunoprecipitated by incubation with 20 µl of agarose-conjugated anti-EGF receptor antibody for 2 h at 4°C. Immune complexes were collected by centrifugation at 10,000 rpm for 5 s, washed two times with RIPA lysis buffer and one time with cold PBS, finally resuspended in 30 µl of sample loading buffer, and boiled for 3 min before separation on 4-15% Tris · HCl ready gels (Bio-Rad). Proteins were transferred to nitrocellulose filters as described above, and tyrosine-phosphorylated EGF receptor was detected using HRP-conjugated specific anti-phosphotyrosine antibodies (24). Bands were detected and quantified using chemiluminescence reagents and films as described above.

Cotransfection of kinase-deficient ERK1 and IL-8 promoter reporter constructs. BEAS-2B cells were grown to 40-70% confluence in 24-well tissue culture plates and cotransfected with a p1.5IL8wt-luc construct and kinase-deficient ERK1 or ERK2 (pCEP4L-ERK1-K>R or pCEP4L-ERK2-K>R) constructs, respectively. The preparation of the p1.5IL8wt-luc construct has been described earlier (7). The pCEP4L-ERK1-K>R or pCEP4L-ERK2-K>R constructs were obtained from Dr. Malanie H. Cobb (Department of Pharmacology, University of Texas Southwestern Medical Center). Cotransfection was conducted as described earlier (24). Briefly, 250 ng of pCEP4L-ERK1-K>R or pCEP4L-ERK2-K>R ERK1 plasmid, 250 ng of p1.5IL8wt-luc plasmid, and 25 ng of pSV-B-galactosidase were incubated with 1.5 µg of DOTAP transfection reagent (Boehringer Mannheim) for 20 min (24). Six hours after transfection, cultures were replaced with supplemented KBM for 24 h. The cells were treated with 200 µg/ml Utah Valley PM from Y1 for 24 h before the cells were lysed. Detection of luciferase and beta -galactosidase was conducted using the Dual-Light chemiluminescent reporter gene assay system from Tropix and an AutoLumat LB953 luminometer (Berthold Analytical Instruments, Nashua, NH). Promoter activity was estimated as specific luciferase activity (luciferase count/unit beta -galactosidase count).

Image analysis and statistics. Data are presented as means ± SE. IL-8 protein, IL-8 mRNA, and cotransfection data were carried out using one-way ANOVA for multigroup comparison. A one-tailed unpaired Student's t-test was performed for pairwise comparisons.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Utah Valley PM induces IL-8 mRNA and protein production in human airway epithelial cells. We have previously demonstrated that Utah Valley PM from Y1, Y2, and Y3 of the steel mill showed differential abilities to induce expression of IL-6 and IL-8 in a human airway epithelial cell line (BEAS-2B) in a dose-dependent fashion, with Y1 and Y3 but not Y2 PM inducing expression of these cytokines (6). In this study, we confirmed these findings using primary human bronchial epithelial cells and Utah Valley PM collected from a different set of filters, corresponding to the same periods but different days. Figure 1A shows that Utah Valley PM collected during Y1 and Y3 caused a greater release of IL-8 than did Utah Valley PM collected during Y2 at higher doses (100 or 200 µg/ml; P < 0.05). The release induced by all the PM from Y1, Y2, or Y3 was dose dependent (P < 0.05), and Y1 PM appeared more potent than Y3 PM (P < 0.01). Exposure of NHBE cells to Utah Valley PM from Y1 or Y3 for 6 h (Fig. 1B) also induced an increase in IL-8 mRNA expression, with a pattern similar to that seen for IL-8 protein. IL-8 mRNA was induced in a dose-dependent fashion by Y1 or Y3 PM. At 200 µg/ml, Utah Valley PM from Y1 or Y3 induced a significant increase of IL-8 mRNA expression compared with the PM from Y2. No cytotoxicity was observed at any of the doses as determined by measuring lactate dehydrogenase activity and by microscopy examination of the cells (6).


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 1.   Utah Valley particulate matter (PM; in µg/ml)-induced interleukin (IL)-8 expression in normal human airway epithelial (NHBE) cells. NHBE cells were incubated with Utah Valley PM from before (Y1), during (Y2), and after (Y3) the closure of the steel mill. A: culture supernatant was analyzed after 24 h of exposure by a commercially available ELISA kit for IL-8. IL-8 protein content is expressed as the mean degree of increase over control in cells exposed to medium (n = 6 experiments). B: total RNA was isolated 6 h after exposure. RT-PCR was performed with primers specific for IL-8 and the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The optical densities of IL-8 cDNA bands were quantified and normalized to that of GAPDH (n = 3). *P < 0.05 compared with the same dose of Y2.

Utah Valley PM induces phosphorylation of ERK1/2, MEK1/2, and the EGF receptor tyrosine kinase. Activation of MAPKs is associated with responses to some toxicant stimuli (11). There were no significant increases in c-Jun NH2-terminal kinase (JNK) or p38 phosphorylation in human airway epithelial cells exposed to Utah Valley PM. Therefore, we assessed the effect of Utah Valley PM on ERK1/2 phosphorylation by Western blotting using a phospho-specific ERK1/2 antibody. Utah Valley PM from Y1 or Y3 elicited an elevated phosphorylation of ERK1/2 relative to Utah Valley PM from Y2 (see Fig. 2A). Utah Valley PM from Y2 induced a minimal ERK phosphorylation relative to controls. Because phosphorylation of ERK1/2 implicates the involvement of its upstream kinases, phosphorylation of MEK1/2 [MAPK kinase (MAPKK) in ERK pathway] and the EGF receptor tyrosine was detected by means of phospho-specific antibodies. Figure 2B shows that Utah Valley PM from Y1 or Y3 induced phosphorylation of MEK1/2, whereas Utah Valley PM from Y2 had minimal effect on phosphorylation of MEK1/2 relative to an unexposed control. Similarly, Utah Valley PM from Y1 and to a lesser degree Y3 caused phosphorylation of the EGF receptor tyrosine kinase, whereas Y2 PM had minimal effect (Fig. 2C). In both cases, EGF, a proven activator of the ERK signaling pathway (15), induced a significant phosphorylation of MEK1/2 or the EGF receptor tyrosine kinase. Overall, the changes in the cellular content of ERK1/2, MEK1/2, and EGF receptor showed variability with respect to rank order of potency between Y1 and Y3 PM. In the case of EGF receptor phosphorylation, Y1 PM was only modestly more potent than Y2 PM. Overall, however, the Y2 extract was less potent than the Y1 and Y3 materials.


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 2.   Utah Valley PM induces phosphorylation of extracellular signal-regulated kinase (ERK) 1/2, mitogen-activated protein kinase (MAPK)/ERK kinase (MEK) 1/2, and the epidermal growth factor (EGF) receptor (EGFR) tyrosine kinase in NHBE cells. NHBE cells were treated with varying concentrations of Utah Valley PM from Y1, Y2, and Y3 for 30 min. The cells were lysed, and lysate proteins were subjected to Western blot analysis using phospho-specific (p) antibodies. A: dose-dependent ERK1/2 phosphorylation and total ERK1/2. Ct, control. B: phosphorylation of MEK1/2 and corresponding total MEK1/2. C: phosphorylation of the EGFR tyrosine kinase and the corresponding total EGFR tyrosine kinase. Bar graphs summarize 3 independent experiments. Nos. are relative optical densities of phosphoform kinases normalized to control.

Inhibition of Utah Valley PM-induced phosphorylation of MEK or ERK. The EGF receptor tyrosine kinase, Raf-1 (MAPKK kinase), and MEK1/2 (MAPKK) are the upstream kinases in the ERK signaling pathway (15). However, recent studies have demonstrated that the extent to which the ERK upstream kinases participate in ERK activation varies in different cell types in response to different stimuli (10). To determine whether MEK1/2 activation is necessary for Utah Valley PM-induced phosphorylation of ERK, PD-98059, a specific inhibitor of MEK activity, was used (3). Western blotting showed that pretreatment of human airway epithelial cells with PD-98059 almost completely blocked the Utah Valley PM-induced phosphorylation of ERK1/2 (Fig. 3A), indicating that MEK activity is required for ERK phosphorylation in NHBE cells. This inhibitor also partially blocked EGF-induced phosphorylation of ERK1/2. We then determined if MEK activation was dependent on activation of the EGF receptor tyrosine kinase by using tyrphostin AG-1478, a selective inhibitor of this kinase. Figure 3B shows that tyrphostin AG-1478 almost completely blocked MEK1/2 phosphorylation in NHBE cells treated with Utah Valley PM. As expected, tyrphostin AG-1478 was able to completely block EGF-induced phosphorylation of MEK1/2. Both AG-1478 and PD-98059 appeared to inhibit the baseline MEK and ERK phosphorylations as evidenced by decreased band intensities in the control (no extract treatment) lanes.


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 3.   Inhibition of Utah Valley PM-induced phosphorylation of MEK1/2 and ERK1/2. NHBE cells were pretreated with 50 µM tyrphostin AG-1478 or PD-98059 for 30 min and then were exposed to 100 µg/ml Utah Valley PM from Y1, Y2, and Y3. Cell lysates were prepared and assayed by Western blotting using phospho-specific antibodies for MEK1/2 (A) and ERK1/2 (B). Data shown are representative of 3 independent experiments.

Activation of EGF receptor signaling pathway is partly required for Utah Valley PM-induced IL-8 expression. The experiments described above demonstrated that Utah Valley PM is able to activate the EGF receptor signaling pathway. To determine whether activation of this signaling pathway is associated with Utah Valley PM-induced IL-8 expression, inhibitors of the EGF receptor signaling pathway were used. The EGF receptor tyrosine kinase inhibitor tyrphostin AG-1478 significantly suppressed IL-8 production in NHBE cells exposed to Utah Valley PM (Fig. 4A). PD-98059, the selective inhibitor of MEK, also significantly inhibited Utah Valley PM-induced IL-8 production, although to a lesser degree than tyrphostin AG-1478 (Fig. 4A). Cotransfection of BEAS-2B cells with an IL-8 promoter reporter construct and a kinase-deficient ERK1 resulted in a small but significant reduction of IL-8 promoter reporter activity in BEAS-2B cells treated with Utah Valley PM dusts from Y1 (Fig. 4B). These data suggest that Utah Valley PM-induced IL-8 expression in NHBE cells is at least partly mediated through the ERK signaling pathway.


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 4.   Suppression of Utah Valley PM-induced IL-8 protein production by inhibition of EGFR signaling pathway kinases. A: NHBE cells pretreated with 50 µM tyrphostin AG-1478 or PD-98059 for 30 min were incubated with 100 µg/ml Utah Valley PM from Y1, Y2, and Y3 for 24 h. IL-8 protein in the medium was quantified by ELISA. Data are shown as degree of increase over control (vehicle; means ± SE, P < 0.01, n = 4~12). B: expression of a kinase-deficient ERK1 construct blocks Utah Valley PM-induced IL-8 promoter reporter activity in BEAS-2B cells. BEAS-2B cells grown to 70% confluence were cotransfected with kinase-deficient ERK1 and IL-8 promoter reporter constructs. The cells were incubated with 200 µg/ml Utah Valley PM from Y1 for 24 h before lysis. Luciferase and beta -galactosidase were quantified using a chemiluminescent reporter gene assay system. IL-8 promoter reporter activity is expressed as the mean degree of increase over vehicle (mean ± SE, P < 0.05, n = 4).


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

These studies demonstrate that Utah Valley PM collected while the steel mill was in operation (Y1 and Y3) induce elevated expression of IL-8 in human airway epithelial cells in an apparent dose-dependent fashion. In addition, Utah Valley PM collected from Y1 or Y3 also activated the EGF receptor tyrosine kinase, MEK1/2, and ERK1/2 with greater potency than Y2 PM. Although it is difficult to determine the physiological relevance of the difference in potencies shown by the Utah Valley PM extracts used in this study, the fact that the Y2 material is consistently less potent across all end points examined in this study and others (6, 6a) suggests that the transduction events that we report on here may mediate some of the adverse health effects of ambient PM inhalation. An inhibitor of the EGF receptor tyrosine kinase (tyrphostin AG-1478) or MEK (PD-98059) not only blocked EGF receptor-dependent MEK activation or MEK-dependent ERK phosphorylation but each also at least partially suppressed IL-8 production in NHBE cells exposed to Utah Valley PM. Moreover, use of a dominant negative ERK1 construct demonstrated partial inhibition of Utah Valley PM-induced IL-8 promoter reporter activity. Therefore, we conclude that activation of the EGF receptor signaling pathway is responsible for at least a portion of the increased IL-8 production in NHBE cells exposed to Utah Valley PM. Furthermore, this study also indicated that the physicochemical properties of PM play an important role in Utah Valley PM-induced EGF receptor signaling and IL-8 expression, since the same dose of Utah Valley PM from different sources shows different levels of effect. In addition to the effects observed using soluble aqueous extracts of Utah Valley PM, it is possible that the insoluble portion may also contain biological activity.

The mechanisms responsible for the Utah Valley PM-induced EGF receptor signaling pathway appear to be complex. In addition to the physiological ligand EGF, other exogenous stimuli have recently been shown to activate the EGF receptor signaling pathway. As is the case with all ambient PM, Utah Valley PM used in this study is a complex mixture of metallic salts, silicates, and other organic compositions (6). In our previous study, we showed that combustion-derived metals such as As, V, Cu, or Zn can initiate EGF receptor signaling in a human airway epithelial cell line. Inductively coupled plasma emission spectroscopy revealed that aqueous extracts of Utah Valley PM contain measurable concentrations of ionizable metals such as Zn, Fe, Mn, Cu, V, Ni, and Pb and that these metals are present in substantially higher concentrations in particles collected when the steel mill was in operation. Interestingly, the magnitude of the effects of the Utah Valley PM on signal transduction intermediate phosphorylation that we observed in these studies is similar to that induced by an acute challenge to a high dose of Cu in a previously published study (20). It is possible that this is a result of the Cu content of Utah Valley PM, which may drive the responses observed in this study. Evidence from this and a previous study on Utah Valley PM suggests that metal content may play a role in Utah Valley PM-induced EGF receptor signaling. First, the metal concentration in Utah Valley PM correlated with its potency in inducing phosphorylation of EGF receptor tyrosine kinase, MEK1/2, and ERK1/2; and second, Utah Valley PM-induced IL-8 expression could be blocked by metal chelators (1). However, whether these metals are the actual activators in Utah Valley PM-induced EGF receptor signaling is still unclear, since the metal concentration of particles from Y1 or Y3 was relatively low compared with doses of individual metals used in our previous studies. Thus it is possible that a synergistic effect of these metals within Utah Valley PM components is involved in EGF receptor activation.

Variability in the relative magnitude of the responses to the Y1 and Y3 extracts is apparent when the various mechanistic end points, i.e., potency in inducing EGF receptor, MEK, or ERK phosphorylations, and IL-8 expression are compared. This may be partly attributable to the apparently modest regulatory role of MAPK on IL-8 expression. In addition, the fact that the extracts collected from ambient PM in the Utah Valley at different times are complex mixtures may explain some of the variability in the levels of the responses that were observed. Thus, although it is expected that the relative effect on MEK1/2 induced by Y1 and Y3 exposure should predict a proportional response on ERK1/2, there may be unknown chemical constituents present in these extracts (phosphatase inhibitors, for instance) that differentially affect the magnitude of each response. Nonetheless, the Y2 material consistently exhibited the lowest potency compared with the Y1 and Y3 extracts.

The EGF receptor signaling pathway has been shown to be associated with a variety of cellular responses mediated through multiple signaling pathways. This study demonstrates the linkage between EGF receptor signaling and IL-8 mRNA expression in NHBE cells exposed to Utah Valley PM. The IL-8 gene is regulated primarily at the level of gene transcription (19). The IL-8 promoter contains binding sites for transcription factors such as activator protein (AP)-1, nuclear factor (NF) IL-6, and NF-kappa B. Activated ERKs have been shown to induce phosphorylation and the trans-activating functions of a number of nuclear transcription factors, including the AP-1 complex (c-Jun, c-Fos, Fra-1, and Fra-2), the Ets family transcription factor (Elk-1, SAP1a, Ets-1, and Ets-2), ATF-2, C/EBP, and Myc (11, 21). Our previous studies demonstrate that combustion-derived metals, including As, Cr, Cu, V, and Zn, are capable of inducing the transactivation of transcription factors, including Elk-1, c-Jun, and ATF-2, which we suggest induce a subsequent increase in IL-8 protein expression in BEAS-2B cells (20). Additionally, we recently observed that V was able to induce NF-kappa B nuclear translocation through the EGF receptor/Ras signaling pathway (unpublished observations). Residual oil fly ash, another metal-containing particulate, induced IL-6 expression in human airway epithelial cells via NF-kappa B activation (17). Asbestos fibers have been shown to induce the phosphorylation of EGF receptor and transcriptionally activate a number of early response genes, including c-fos, c-jun, and c-myc, which are accompanied by increases in AP-1 activity and NF-kappa B (25). The fact that only a partial inhibition of IL-8 expression was found to be attributable to EGF receptor and ERK1/2 activation is consistent with previous studies showing that IL-8 transcriptional regulation is primarily determined by NF-kappa B in human airway epithelial cells (7). Therefore, we hypothesize that Utah Valley PM induces IL-8 mRNA expression through the transactivation of similar transcriptional factors, which may be mediated partly by the ERK signaling pathway. Unlike the ERK pathway, the JNK and p38 pathways were not found to be activated by Utah Valley PM since the metal content (maximally 4.5 µM) contained in 200 µg/ml Utah Valley PM extract was rather low compared with the dose (500 µM) used in our previous studies (20). Furthermore, these two pathways made no discernible contribution to Utah Valley PM-induced IL-8 expression in human airway epithelial cells, since kinase-deficient p38 kinase and JNK did not alter the increased IL-8 promoter reporter activity in BEAS-2B cells exposed to Utah Valley PM from Y1 (Wu, unpublished observations).

Additionally, the physicochemical properties may play a crucial role in Utah Valley PM-induced IL-8 mRNA and protein expression. At the same doses, dusts from Y1, Y2, and Y3 activated the ERK pathway with different potencies, leading to differential IL-8 expression. These results are consistent with data showing increased IL-8 production in the lungs of humans instilled with Utah Valley PM from Y1 and Y3 but not from Y2 (6a). The general coherence between in vivo and in vitro studies suggests that molecular approaches such as those described in this study may be useful in the investigation of the mechanisms through which Utah Valley PM exerts its effects. Moreover, the discovery that the EGF receptor signaling pathway is associated with IL-8 expression in human airway epithelial cells, the primary initiators of the inflammatory response in the lungs, may provide clues for therapeutic application of kinase inhibitors to PM-related pulmonary inflammation.


    ACKNOWLEDGEMENTS

We gratefully acknowledge the technical assistance of Lisa Dailey and Jacqueline D. Carter and advice from Drs. William Reed and Ilona Jaspers.


    FOOTNOTES

The research described in this article has been reviewed by the National Health and Environmental Effects Research Laboratory, United States Environmental Protection Agency, and has been approved for publication. Approval does not signify that the contents necessarily reflect the views and policies of the Agency, nor does mention of trade names constitute endorsement or recommendation for use.

Address for reprint requests and other correspondence: R. B. Devlin, Human Studies Division, National Health and Environmental Effects Research Laboratory, US Environmental Protection Agency, Research Triangle Park, NC 27711 (E-mail: devlin.robert{at}epa.gov).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 1 November 2000; accepted in final form 23 March 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Bernstein, LR, Ferris DK, Colburn NH, and Sobel ME. A family of mitogen-activated protein kinase-related proteins interacts in vivo with activator protein-1 transcription factor. J Biol Chem 269: 9401-9404, 1994[Abstract/Free Full Text].

2.   Carter, JD, Ghio AJ, Samet JM, and Devlin RB. Cytokine production by human airway epithelial cells after exposure to an air pollution particle is metal-dependent. Toxicol Appl Pharmacol 146: 180-188, 1997[Web of Science][Medline].

3.   Daub, H, Weiss FU, Wallasch C, and Ullrich A. Role of transactivation of the EGF receptor in signaling by G-protein-coupled receptors. Nature 379: 557-560, 1996[Medline].

4.   Dudley, DT, Pang L, Decker SJ, Bridges AJ, and Saltiel AR. A synthetic inhibitor of the mitogen-activated protein kinase cascade. Proc Natl Acad Sci USA 92: 7686-7689, 1995[Abstract/Free Full Text].

5.   Force, T, and Bonventre JV. Growth factors and mitogen-activated protein kinases. Hypertension 31: 152-161, 1998[Abstract/Free Full Text].

6.   Frampton, MW, Ghio AJ, Samet JM, Carson JL, Carter JD, Devlin RB, and Pope CA. Effects of aqueous extracts of PM10 filters from the Utah Valley on human airway epithelial cells. Am J Physiol Lung Cell Mol Physiol 277: L960-L967, 1999[Abstract/Free Full Text].

6a.  Ghio AJ and Devlin RB. Inflammatory lung injury after bronchial instillation of air pollution particles. Am J Respir Crit Care Med. In press.

7.   Jaspers, I, Samet JM, and Reed W. Arsenite exposure of cultured airway epithelial cells activates B-dependent interleukin-8 gene expression in the absence of nuclear factor-B nuclear translocation. J Biol Chem 274: 31025-31033, 1999[Abstract/Free Full Text].

8.   Kowenz-Leutz, E, Twamley G, Ansieau S, and Leutz A. Novel mechanism of C/EBP beta (NF-M) transcriptional control: activation through depression. Genes Dev 8: 2781-2791, 1994[Abstract/Free Full Text].

9.   Levin, DE, and Errede B. The proliferation of MAP kinase signaling pathways in yeast. Curr Opin Cell Biol 7: 197-202, 1995[Web of Science][Medline].

10.   Li, X, Lee JW, Graves LM, and Earp HS. Angiotensin II stimulates ERK via two pathways in epithelial cells: protein kinase C suppresses a G-protein coupled receptor-EGF receptor transactivation pathway. EMBO J 17: 2574-2583, 1998[Web of Science][Medline].

11.   Liu, Y, Gorospe M, Yang C, and Holbrook NJ. Role of mitogen-activated protein kinase phosphatase during the cellular response to genotoxic stress. Inhibition of c-Jun N-terminal kinase activity and AP-1-dependent gene activation. J Biol Chem 270: 8377-8380, 1995[Abstract/Free Full Text].

12.   Liu, Y, Guyton KZ, Gorospe M, Xu Q, Lee JC, and Holbrook NJ. Differential activation of ERK, JNK/SAPK and P38/CSBP/RK map kinase family members during the cellular response to arsenite. Free Radic Biol Med 21: 771-781, 1996[Web of Science][Medline].

13.   Marais, R, Wynne J, and Treisman R. The SRF accessory protein Elk-1 contains a growth factor-regulated transcriptional activation domain. Cell 73: 381-393, 1993[Web of Science][Medline].

14.   Minden, A, and Karin M. Regulation and function of the JNK subgroup of MAP kinases. Biochim Biophys Acta 1333: F85-F104, 1997[Medline].

15.   Minden, A, Lin A, McMahon M, Lange-Carter C, Derijard B, Davis RJ, Johnson GL, and Karin M. Differential activation of ERK and JNK mitogen-activated protein kinases by Raf-1 and MEKK. Science 266: 1719-1723, 1994[Abstract/Free Full Text].

16.   Pope, CAI Respiratory hospital admissions associated with PM10 pollution in Utah, Salt Lake, and Cache Valleys. Arch Environ Health 46: 90-97, 1991[Web of Science][Medline].

17.   Quay, JL, Reed W, Samet JM, and Devlin RB. Air pollution particles induce IL-6 gene expression in human airway epithelial cells via NF-kappaB activation. Am J Respir Cell Mol Biol 19: 98-106, 1998[Abstract/Free Full Text].

18.   Reddel, RR, Ke Y, Gerwin BI, McMenamin MG, Lechner JF, Su RT, Brash DE, Park JB, Rhim JS, and Harris CC. Transformation of human bronchial epithelial cells by infection with SV40 or adenovirus-12 SV40 hybrid virus, or transfection via strontium phosphate coprecipitation with a plasmid containing SV40 early region genes. Cancer Res 48: 1904-1909, 1988[Abstract/Free Full Text].

19.   Roebuck, KA. Regulation of interleukin-8 gene expression. J Interferon Cytokine Res 19: 429-438, 1999[Web of Science][Medline].

20.   Samet, JM, Graves LM, Quay J, Dailey LA, Devlin RB, Ghio AJ, Wu W, Bromberg PA, and Reed W. Activation of MAPKs in human bronchial epithelial cells exposed to metals. Am J Physiol Lung Cell Mol Physiol 275: L551-L558, 1998[Abstract/Free Full Text].

21.   Seth, A, Alvarez E, Gupta S, and Davis RJ. A phosphorylation site located in the NH2-terminal domain of c-Myc increases transactivation of gene expression. J Biol Chem 266: 23521-23524, 1991[Abstract/Free Full Text].

22.   US Environmental Protection Agency. Air Quality Criteria for Particulate Matter. Research Triangle Park, NC: EPA, 1996, vol. 166, p. 111-119 (Publication No. EPA/600/P-95/1bF).

23.   Winston, BW, Lange-Carter CA, Gardner AM, Johnson GL, and Riches DW. Tumor necrosis factor alpha rapidly activates the mitogen-activated protein kinase (MAPK) cascade in a MAPK kinase kinase-dependent, c-Raf-1-independent fashion in mouse macrophages. Proc Natl Acad Sci USA 92: 1614-1618, 1995[Abstract/Free Full Text].

24.   Wu, W, Graves LM, Jaspers I, Devlin RB, Reed W, and Samet JM. Activation of the EGF receptor signaling pathway in human airway epithelial cells exposed to metals. Am J Physiol Lung Cell Mol Physiol 277: L924-L931, 1999[Abstract/Free Full Text].

25.   Zanella, CL, Timblin CR, Cummins A, Jung M, Goldberg J, Raabe R, Tritton TR, and Mossman BT. Asbestos-induced phosphorylation of epidermal growth factor receptor is linked to c-fos and apoptosis. Am J Physiol Lung Cell Mol Physiol 277: L684-L693, 1999[Abstract/Free Full Text].


Am J Physiol Lung Cell Mol Physiol 281(2):L483-L489



This article has been cited by other articles:


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
C. Jeulin, V. Seltzer, D. Bailbe, K. Andreau, and F. Marano
EGF mediates calcium-activated chloride channel activation in the human bronchial epithelial cell line 16HBE14o-: involvement of tyrosine kinase p60c-src
Am J Physiol Lung Cell Mol Physiol, September 1, 2008; 295(3): L489 - L496.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
M. Rumelhard, K. Ramgolam, R. Hamel, F. Marano, and A. Baeza-Squiban
Expression and role of EGFR ligands induced in airway cells by PM2.5 and its components
Eur. Respir. J., December 1, 2007; 30(6): 1064 - 1073.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
Y.-M. Kim, W. Reed, W. Wu, P. A. Bromberg, L. M. Graves, and J. M. Samet
Zn2+-induced IL-8 expression involves AP-1, JNK, and ERK activities in human airway epithelial cells
Am J Physiol Lung Cell Mol Physiol, May 1, 2006; 290(5): L1028 - L1035.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
Y.-M. Kim, W. Reed, A. G. Lenz, I. Jaspers, R. Silbajoris, H. S. Nick, and J. M. Samet
Ultrafine carbon particles induce interleukin-8 gene transcription and p38 MAPK activation in normal human bronchial epithelial cells
Am J Physiol Lung Cell Mol Physiol, March 1, 2005; 288(3): L432 - L441.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
W. Wu, J. M. Samet, R. Silbajoris, L. A. Dailey, D. Sheppard, P. A. Bromberg, and L. M. Graves
Heparin-Binding Epidermal Growth Factor Cleavage Mediates Zinc-Induced Epidermal Growth Factor Receptor Phosphorylation
Am. J. Respir. Cell Mol. Biol., April 1, 2004; 30(4): 540 - 547.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
S. Blanchet, K. Ramgolam, A. Baulig, F. Marano, and A. Baeza-Squiban
Fine Particulate Matter Induces Amphiregulin Secretion by Bronchial Epithelial Cells
Am. J. Respir. Cell Mol. Biol., April 1, 2004; 30(4): 421 - 427.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. S. Tjabringa, J. Aarbiou, D. K. Ninaber, J. W. Drijfhout, O. E. Sorensen, N. Borregaard, K. F. Rabe, and P. S. Hiemstra
The Antimicrobial Peptide LL-37 Activates Innate Immunity at the Airway Epithelial Surface by Transactivation of the Epidermal Growth Factor Receptor
J. Immunol., December 15, 2003; 171(12): 6690 - 6696.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (27)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wu, W.
Right arrow Articles by Devlin, R. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wu, W.
Right arrow Articles by Devlin, R. B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online