AJP - Lung Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 281: L1484-L1493, 2001;
1040-0605/01 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nanjundan, M.
Right arrow Articles by Possmayer, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nanjundan, M.
Right arrow Articles by Possmayer, F.
Vol. 281, Issue 6, L1484-L1493, December 2001

Molecular cloning and expression of pulmonary lipid phosphate phosphohydrolases

Meera Nanjundan and Fred Possmayer

Medical Research Council Group in Fetal and Neonatal Health and Development, Departments of Biochemistry and Obstetrics and Gynaecology, University of Western Ontario, London, Ontario, Canada N6A 5A5


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Pulmonary lipid phosphate phosphohydrolase (LPP) was shown previously to hydrolyze phosphatidic acid and lysophosphatidic acid in purified rat lung plasma membranes. To better investigate the nature of pulmonary LPP isoforms and their role in the lung, LPPs were cloned by RT-PCR from both adult rat lung and type II cell RNA. The RT-PCR generated LPP1 (849 bp), up to three LPP1 variants, and LPP3 (936 bp) cDNAs. The three LPP1 variants include LPP1a (852 bp) and two novel isoforms, LPP1b (697 bp) and LPP1c (1004 bp). The pulmonary LPP1 and LPP3 isoforms are essentially identical to the previously cloned rat liver and intestinal LPPs, respectively, and the LPP1a isoform has 80% sequence identity to the human homolog. The LPP2 isoform was not detected in lung by RT-PCR. Northern analyses revealed that the mRNAs for LPP1 and LPP3 increase in fetal rat lung in late gestation to day 1 after birth. These mRNAs decrease somewhat during the neonatal period but increase slightly during postnatal development. Expression of LPP1, LPP1a, and LPP3 cDNAs in HEK 293 cells established that they encode functional LPP. In contrast, the novel isoforms LPP1b and LPP1c contain frameshifts that would result in premature termination, producing putative catalytically inactive polypeptides of 30 and 76 amino acids, respectively. Further investigation of the LPP1b isoform revealed that it was present across a variety of tissues, although at lower levels than LPP1/1a. Transient mammalian expression of LPP1b failed to increase phosphatidate phosphohydrolase activity in HEK 293 cells.

lung growth; novel isoforms; rat lung; type II cells; tissue expression; overexpression; surfactant secretion


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

THERE EXIST TWO FORMS OF PULMONARY phosphatidic acid phosphohydrolases (PAPases), namely PAP1 and lipid phosphate phosphohydrolase (LPP; formerly called PAP2). The former is a Mg2+-dependent, N-ethylmaleimide (NEM)-sensitive, cytosolic enzyme (31). Cytosolic PAP1 can translocate to the endoplasmic reticulum where it becomes metabolically functional in glycerolipid biosynthesis (31). In contrast, pulmonary LPP is an NEM-insensitive, Mg2+-independent, membrane-bound enzyme primarily localized to the plasma membrane (22, 23). Both phosphatidic acid (PA) and lysophosphatidic acid (LPA) were excellent substrates for LPP in purified rat lung plasma membranes, whereas sphingosine 1-phosphate (S-1-P) was a relatively poor substrate. This contrasts with liver LPP, the activity of which hydrolyzes PA, LPA, ceramide 1-phosphate (C-1-P), and S-1-P to similar extents (30).

Recent studies indicate a potential role for LPP in signal transduction. LPP could act to hydrolyze PA arising in the plasma membrane from diacylglycerol (DAG) kinase (10) or phospholipase D (PLD; see Ref. 24), thereby regulating the levels of PA in the plasma membrane. It has been suggested that transient elevations in DAG levels arising through phospholipase C (PLC) degradation of phosphatidylinositol bisphosphate in alveolar type II cells can be extended through the stimulation of the PLD/LPP pathway (24). LPP activity exists in isolated type II cells, plasma membrane, and in plasma membrane detergent-resistant domain (caveolae) preparations (22, 23), and a proposed function is in the regulation of surfactant phospholipid secretion. The signaling pathway would involve a plasma membrane-localized LPP, which would act sequentially to PLD in the purinergic P2u receptor cascade where it would generate DAG from phosphatidylcholine-derived PA, thereby sustaining protein kinase C (PKC) activation and surfactant secretion (24). Another proposed function of LPP may be in controlling cell growth where recovery from lung injury would involve type II cell proliferation and migration to restore the damaged type I cell population (6). Subsequently, the type II cells undergo a transdifferentiation process to reestablish the alveolar epithelium. These latter processes may require elevated DAG levels, generated by LPP for PKC activation, leading to expression of specific genes required for this process.

To further our understanding of the role of LPP in the lung, pulmonary LPP isoforms were cloned by RT-PCR using RNA from adult rat lung and type II cells. The RT-PCR generated LPP1, three LPP1 variants, and LPP3 cDNAs. The three LPP1 variants include LPP1a and two novel isoforms, LPP1b and LPP1c. The latter isoform was rare, but LPP1b was present at similar levels as LPP1/1a. A rat tissue profile was screened with isoform-specific primers to investigate whether the novel LPP1 variants are tissue specific. The developmental profiles for LPP1 and LPP3 were examined during fetal and neonatal development. Transient expression of LPP1, LPP1a, and LPP3 in HEK 293 cells was performed to verify that these cloned cDNAs encode Mg2+-independent, NEM-insensitive PAP activity.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Materials. Trizol reagent, the Superscript preamplification kit, DNase I (amplification grade), isopropylthio-beta -D-galactoside, X-gal, and tissue culture media were obtained from GIBCO-BRL. FBS was obtained from CanSera. Porcine elastase was obtained from Worthington Biochemicals. RNase H and restriction enzymes were purchased from Pharmacia Biotech. The Advantage cDNA PCR kit was obtained from Clontech Laboratories. Mineral oil and herring sperm DNA were obtained from Sigma. pGEM-3Zf(+) was obtained from Promega. XL1-blue cells and QuikHyb solution were obtained from Stratagene. [alpha -32P]dCTP and [gamma -32P]ATP were purchased from Amersham. 1-Palmitoyl-2-oleoyl-phosphatidylcholine was purchased from Avanti Polar Lipids. DAG kinase from Escherichia coli was purchased from Calbiochem.

Cloning and sequencing of LPPs from rat lung and rat type II cells. The isolation of alveolar type II cells was followed according to Dobbs (7). Lungs were perfused with 0.9% saline as previously described (22). Total RNA was prepared using Trizol reagent. The RNA was DNase treated before first-strand cDNA synthesis. The reverse transcriptase reaction was performed using oligo(dT)12-18 as the primer and Superscript H--Reverse transcriptase. The cDNA was then RNase treated before the PCR reaction. PCR primers for amplification of LPP1, LPP2, and LPP3 were based on GenBank sequences (U90556, AA734786, and Y07783, respectively). The primers for LPP1 span the start and stop codon (bold) and contain the following Bgl II and Sal I sites (underlined): 5'-GAGAGATCTGTGACCATGTTCGACAAGCC (5'-primer) and 5'-GAGGTCGACCCCTTCAGGGCTCGTGATTA (3'-primer). The primers for LPP2 span the start and an internal region (3rd domain of active site) and contain an EcoR I site as follows: 5'- CCGGAATTCGACCATGGAGAGGA (5'-primer) and 5'-GCTCCAGTGGTGTTTGTAATCA (3'-primer). The primers for LPP3 also span the start and 3'-adjacent to the stop codon and contain BamH I sites as follows: 5'-CTCGGATCCGCCAGCGCCATGCAAACGTA (5'-primer) and 5'-TTCGGATCCAGTGCTCTGGAGGCCGCAGC (3'-primer).

The reaction mixture (100 µl) contained 1× Clontech buffer (containing 3.25 mM Mg2+), dNTPs (0.4 mM each), primers (0.4 µM), and cDNA (2 µl). The Clontech proofreading enzyme polymerase mixture (0.5 units) was added, and then the samples were overlaid with light mineral oil. The incubation conditions were 94°C for 5 min followed by 30 cycles of 2 min at 94°C, 2 min at 62°C, and 2 min at 72°C. PCR products were subjected to electrophoresis on 1.2% agarose gels in 40 mM Tris-borate containing 1 mM EDTA and 0.001 mg/ml ethidium bromide.

The LPP1 PCR product was restriction enzyme digested with Bgl II and Sal I overnight at 37°C and ligated into pGEM-3Zf(+), which was gel purified after overnight restriction enzyme digestion. The LPP3 PCR product was restriction enzyme digested with BamH I overnight at 37°C and ligated into pGEM-3Zf(+), which was dephosphorylated with calf intestinal phosphatase after overnight restriction enzyme digestion. Competent XL1-blue cells were transformed with the ligation products, and positive colonies were selected by performing blue-white colony screening.

Nucleotide sequencing of the various LPP clones was performed using fluorescent dye primer extensions with an automated DNA sequencer (Robarts Research Institute, DNA Sequencing Facility). The LPP sequences were analyzed using the BLAST and DiAlign2 programs.

Verification of LPP1 variants. The LPP variants were verified by using a combination of primers that were designed to be isoform specific. The PCR products were cloned into the pGEM-3Zf(+) vector and sequenced. The primers for LPP1/LPP1a, LPP1b, and LPP1c (primer set A) were 5'-GAGAGATCTGTGACCATGTTCGACAAGCC (5'-primer; start) and 5'-GAGGTCGACGGCCGCAGTCTGCCTATACGA (3'-primer; 383-365 bp). The primers for LPP1 and LPP1a (primer set B) were 5'-GCTGGCTGGATTGCCTTATATA (5'-primer; 60-87 bp), 5'-AACAGCGTGAAGTACCCGTACC (5'-primer; 130-151 bp), and 5'-GAGGTCGACGGCCGCAGTCTGCCTATAGA (3'-primer; 386-365 bp). The primers for region IIB (see Fig. 1) of LPP1 (primer set C) were 5'-GCTGGCTGGATTGCCTTATATA (5'-primer; 68-81 bp) and 5'-TCCACCTAATAACGCATAAGGG (3'-primer; 196-175 bp). The primers for region IIA (see Fig. 1) of LPP1a (primer set D) were 5'-TTCCATGCCTATGGCTGTTGTA (5'-primer; 57-78 bp) and 5'-CAAGCCCCACTAGGACGAGTAC (3'-primer; 186-165 bp).


View larger version (81K):
[in this window]
[in a new window]
 
Fig. 1.   Nucleotide sequence alignment of the lipid phosphate phosphohydrolase (LPP1) isoforms from lung tissue. Sequences were aligned using the DiAlign2 program. Dashes, absence of bases; RL, rat lung; bold, insertions or deletions in the novel isoforms.

Southern analysis of tissue profile. RNA was isolated from tissues obtained from 150- to 200-g Sprague-Dawley rats. As described above, RT-PCR was performed, and the products were run on a 2% agarose gel. The gel was denatured in denaturing buffer (0.5 M NaOH and 1.5 M NaCl) for 30 min at room temperature. Subsequently, the gel was transferred to neutralizing buffer [0.5 M Tris · HCl (pH 7.0) and 1.5 M NaCl] and slowly shaken for 30 min at room temperature. The gel was soaked in 20× saline-sodium citrate (SSC) transfer buffer for 30 min and then transferred to a nylon membrane using the Turboblotter Rapid Downward Transfer System (Schleicher & Schull). Blots were probed with LPP1.

Northern analysis. A 1% agarose-RNA formaldehyde gel containing total RNA from tissues (20 µg/lane) was transferred to nylon membranes. Prehybridization for 20 min at 68°C in QuikHyb solution was followed by hybridization with the appropriate probe with 100 µl of denatured herring sperm DNA for 1 h at 68°C. For LPP3, the blots were washed for 1 h at 60°C in 2× SSC and 0.1% SDS followed by a 30-min wash in 0.1× SSC and 0.1% SDS at room temperature. For LPP1, the blots were washed in 0.1× SSC and 0.1% SDS at room temperature for 6 h. LPP1 and LPP3 probes were prepared by random prime labeling using [alpha -32P]dCTP. The membranes were exposed to X-ray film between 24 and 72 h for the LPP3 probe and up to 1 wk for the LPP1 probe.

Transient expression of LPPs in HEK 293 cells. HEK cells were maintained in DMEM (high glucose) containing 10% FBS. LPP1 and LPP1b were first digested from pGEM-3Zf(+) with Sal I, blunt ended with Klenow fragment, and Kpn I digested. LPP1a was digested from pGEM-3Zf(+) with Hind III, blunt ended with Klenow fragment, and Kpn I digested. LPP3 was digested from pGEM-3Zf(+) with BamH I and blunt ended with Klenow fragment. These LPP1/1a/1b inserts were then subcloned into the Kpn I and Xba I (blunt-ended) sites and, for LPP3 cDNAs, into the Xba I (blunt-ended) site of the mammalian expression vector pTracer-CMV2 (Invitrogen). The orientation was verified by a combination of restriction enzyme digestion and sequencing. Transfection-quality plasmid DNA was obtained using a Maxi Plasmid Preparative Kit (Qiagen). Transient expression of LPP1, LPP1b, and LPP3 was obtained using 1 µg of DNA and Effectene transfection reagent (Qiagen). Transient expression of LPP1a was obtained using 2 µg of DNA. Cells were harvested 36-48 h posttransfection, sonicated for 10 s (3 bursts), and then centrifuged at 100,000 g for 1 h at 4°C in a Ti70.1 rotor to obtain total membranes.

LPP assays. The activity was assayed using pure PA as substrate. Unlabeled PA and [32P]PA were prepared as described previously (22). Reaction mixtures contained 100 mM Tris-maleate buffer, pH 6.5, 0.6 mM PA (0.4 mCi/mmol), 0.5 mM EDTA, 0.5 mM EGTA, pH 7.0, 0.2 mg of essentially fatty acid-free albumin, and 1 mM dithiothreitol in a final reaction volume of 0.1 ml. Incubation times were 60 min in duration at 37°C. The protein was preincubated at 37°C for 10 min with 4.2 mM NEM. Reactions were terminated by the addition of 1.5 ml of chloroform-methanol (1:1). The phases were broken with 0.75 ml of 0.1 N HCl, and a sample of the upper aqueous phase was taken for scintillation counting to determine the [32P]Pi released (22).

Other assays. Protein was determined by the method of Lowry et al. (19) in the presence of 1% SDS using BSA as a standard.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Cloning of pulmonary LPPs and variants. LPP isoforms were cloned from perfused rat lung and freshly isolated alveolar type II cells that were maintained on tissue culture plastic overnight. Primers were designed to amplify the entire coding sequence of LPP1, LPP3, and a partial region of LPP2. RT-PCR products were cloned and sequenced revealing the presence of mRNA for LPP1 and its variants in lung (LPP1a, -1b, and -1c) and type II cells (LPP1b). LPP2 mRNA was not detected in lung or type II cells but was detected in RNA from rat brain, indicating that LPP2 mRNA is not expressed by lung. LPP3 was present in whole lung and type II cells.

The LPP1 PCR products, when sequenced, revealed multiple products, including LPP1, LPP1a, LPP1b, and LPP1c. Figures 1 and 2, respectively, show the nucleotide sequence alignment and a graphical view of the LPP1 variants. The LPP1 products (LPP1, -1a, and -1b) were confirmed using other combinations of primers whose products were verified by sequencing. The LPP1 and LPP3 isoforms proved essentially identical to the previously cloned rat liver (5, 9) and intestinal isoforms (3, 10), respectively. Predicted amino acid sequences were identical to those reported previously. The LPP1a isoform is homologous to the human (11, 18) and guinea pig (12, 28) isoforms. The LPP1b and LPP1c isoforms are novel but contain nucleotide insertions/deletions (as indicated in bold in Figs. 1 and 2) that result in a frameshift leading to early termination of the polypeptide. A homolog of the LPP1b isoform was recently identified in the database of expressed sequence tags (dbEST) that was cloned from Bovine Taurus cartilage fetus (Genbank accession no. AV595831).


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 2.   Graphic view of the cDNA-to-protein alignment of LPP1 and its variants. The cDNAs for LPP1 and LPP1a are divided into the following three regions: I, IIA or IIB, and III. LPP1 and LPP1a diverge at region II. The protein alignment is shown below the cDNA. The red boxes represent transmembrane domains, and the violet regions represent the domains of the active site. *NH2-linked glycosylation site. The cDNA for LPP1b contains an extra G nucleotide (shown in yellow and marked with *) leading to a frameshift and is lacking region II. Likewise, LPP1c contains both regions IIA and IIB, with a nucleotide deletion leading to a frameshift. The bases at the edges of these regions are shown above each region to show the frameshifts that occur in the novel LPP isoforms. Orange, region I; green, region III.

Sequence analysis of pulmonary LPP isoforms. Hydropathy plot analysis of LPP1, LPP1a, and LPP3 based on the Kyte and Doolittle algorithm using the TMHMM program suggests that each has six membrane-spanning regions, whereas the predicted truncated isoforms could have only one (LPP1b) or two (LPP1c) transmembrane domains (data not shown). The full-length proteins (LPP1, LPP1a, and LPP3) contain an active site comprised of three domains (Fig. 3), which is part of a novel phosphatase superfamily that includes glucose 6-phosphatase, certain acid phosphatases, and chloroperoxidase (5, 27). They each contain a potential NH2-linked glycosylation site at amino acid positions 142, 143, and 171 (LPP1, LPP1a, and LPP3, respectively). The principal divergent regions among these LPPs include the NH2- and COOH-termini. Regions of divergence between LPP1 and LPP1a include the end of transmembrane region I and the beginning of transmembrane region II as well as certain residues in the first extracellular loop (Fig. 3). The LPP1 and LPP1a isoforms are most probably derived from alternative splicing. The expected molecular weights of the full-length LPPs are 31.9 kDa (LPP1), 32.0 kDa (LPP1a), and 35.2 kDa (LPP3).


View larger version (44K):
[in this window]
[in a new window]
 
Fig. 3.   Amino acid sequence alignment of pulmonary LPP1, LPP1a, and LPP3. The predicted rat lung amino acid sequences are aligned with those of the human sequences [Genbank sequences BAA22593 (LPP1), ACC16032 (LPP1a), and NP-003704 (LPP3)]. Alignment was performed using the DiAlign2 program. The predicted membrane-spanning regions are denoted TM-1 through TM-6, and the active sites are shown in gray.

The LPP1b isoform contains a G nucleotide insertion at the 58th base, which would predict a peptide of 30 amino acids (3.61 kDa). Likewise, the LPP1c isoform contains a nucleotide deletion at the 214th base, which would predict a peptide of 76 amino acids (8.55 kDa). Their predicted sequences are shown in Fig. 4. If proteins are expressed, these isoforms would be catalytically inactive, since they would not possess the active site. Furthermore, they would both lack the NH2-linked glycosylation site. Three different preparations of lung RNA were used for the RT-PCR, resulting in the consistent appearance of LPP1b, whereas LPP1c was much rarer. The LPP1b isoform was not generated in reactions without cDNA. PCR of LPP1 or LPP1a cDNAs did not result in the formation of LPP1b cDNA.


View larger version (6K):
[in this window]
[in a new window]
 
Fig. 4.   Amino acid sequences of the novel truncated LPP1 isoforms. The cDNA sequences were translated using a DNA sequence translator program.

Overexpression of rat pulmonary LPPs in HEK 293 cells. Transient transfection of rat lung LPP1, LPP1a, and LPP3 cDNAs in HEK cells resulted in an 8.7-, 2.4-, and 16.9-fold increase in membrane-bound LPP enzyme activity, respectively (Fig. 5). The activity of the three LPP isoforms was assayed using phosphatidate as a substrate in the presence of NEM and without Mg2+. Therefore, these rat lung cDNAs encode functional NEM-insensitive, Mg2+-independent phosphatidate phosphatases. Transient expression of the LPP1b isoform did not affect the LPP activity, since it was predicted to lack the three domains of the active site. Transient expression of these cDNAs was initially attempted in SV-40 large-T antigen transformed mouse type II-like lung epithelial cell lines (MLE12 and MLE15) to investigate the role of LPP in surfactant secretion. However, transient transfections were without success. These cell lines have high endogenous LPP enzyme activity, and thus stable expression of various LPPs, including LPP1b, was attempted. However, cell death resulted with the MLE12 cell line, and increases in LPP enzyme activity were not detected in the MLE15 cell line using an inducible tetracycline system.


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 5.   Overexpression of pulmonary LPPs in HEK 293 cells. Transient transfections of LPP cDNAs and empty vector were performed using Effectene reagent. Cells were harvested 48 h posttransfection, and 10 µg of total membranes and sonicates were analyzed for N-ethylmaleimide-insensitive LPP enzyme activity using phosphatidic acid as the substrate in the absence of Mg2+.

Analysis of LPP isoforms across a rat tissue profile. Northern analysis of a tissue profile is shown in Fig. 6A. Tissues that were investigated include the brain, liver, intestine, kidney, uterus, spleen, and heart. The LPP1 RNA is highly expressed in the lung and intestine. The LPP3 RNA levels are high in lung, liver, and brain tissues. As shown in Fig. 6B, semiquantitative RT-PCR using common 3'- and 5'-primers designed to distinguish between LPP1/LPP1a and LPP1b (~400- and ~250-bp products) indicated LPP1 was the predominant product in all tissues examined. Although lower than LPP1/1a, LPP1b was clearly detected in all tissues and was relatively abundant in the lung and brain. Semiquantitative RT-PCR using a single 3'- and two 5'-primers indicated that LPP1a levels were lower than LPP1. LPP1a was detected in relatively high abundance in the liver, intestine, kidney, and brain. Lower relative levels were noted in the remaining tissues, especially heart, and evidence for LPP1a was detected in only one of the two uterine samples.


View larger version (70K):
[in this window]
[in a new window]
 
Fig. 6.   Expression of LPPs across a rat tissue profile. A: Northern analysis using LPP1 and LPP3 as probes. B: Southern analysis of RT-PCR products of LPP1 variants LPP1/1a (top) and LPP1b (bottom). C: Southern analysis of RT-PCR products of LPP1 variants LPP1 (top) and LPP1a (bottom).

Developmental profiles for pulmonary LPPs. To obtain insight into the potential functions of the cloned LPP isoforms, their mRNA expression patterns were investigated across rat lung development. The profiles for the mRNA levels of LPP1 and LPP3 were determined by Northern analysis (Fig. 7). The mRNA levels were low at 17 days of gestation but increased slightly in the fetal period (21 and 22 days gestation). There was a further increase in LPP1 mRNA expression in the newborns that remained high until day 4. The mRNA expression increased further on day 16, although remaining low compared with that in the newborn. The mRNA levels for LPP3 were low at 17 days of gestation and increased at 19 days gestation. The mRNA increased in the early neonate (1 or 2 days) and remained fairly constant during the first week of life. The mRNA expression increased during the second week of life (16 days) and in the adult.


View larger version (42K):
[in this window]
[in a new window]
 
Fig. 7.   Northern blot analysis of LPP1 (A), LPP3 (B), and beta -actin, loading control (C), during fetal, neonatal, and late development. RNA was from gestational days 17, 19, 21, and 22; days 1, 2, 4, 9, and 16 after birth; and in adults (Ad). Representative results from n = 3 experiments.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

LPP isoforms in rat lung and type II cells. In the lung, we previously observed that PA and LPA were excellent substrates in plasma membranes, whereas S-1-P was a relatively poor substrate (22). To investigate the possible presence of novel pulmonary isoforms, LPPs were cloned by RT-PCR from both adult rat lung and type II cell RNA that generated LPP1, three LPP1 variants (LPP1a, LPP1b, and LPP1c), and LPP3 cDNAs. The LPP2 isoform was absent in lung tissue but present in brain, as determined by RT-PCR, consistent with previous studies demonstrating the presence of human LPP2 mRNA in brain (9).

The cDNAs for all three major LPP isoforms (LPP1, LPP2, and LPP3) code for proteins with six transmembrane domains and a potential NH2-linked glycosylation site located between transmembrane domains III and IV. All LPPs examined to date appear to be glycosylated, and altering the potential sites abolishes glycosylation of LPP1 (34). Comparison of LPP sequences with other members of the novel phosphatase family, such as glucose 6-phosphatase, chloroperoxidase, and acid phosphatase, revealed three highly conserved domains (5, 27). Conserved domains I and II flank the glycosylation site, whereas conserved domain III lies between transmembrane domains V and VI. Site-directed mutagenesis studies show that certain amino acids within these three conserved domains are essential for enzymatic activity. Taken together with recent evidence showing that the COOH-terminus of LPP1 is cytosolic (12), this would position the active site of LPP1, and apparently the other major isoforms, on the external side of the plasma membrane. In keeping with the above, coexpression of LPP1 in the readily transfectable rat2 fibroblast cell line resulted in an enhanced capacity for hydrolyzing exogenously administered LPA, PA, and C-1-P. LPA, C-1-P, and S-1-P are biologically active lipids that have been implicated in eliciting various biological responses, including cellular proliferation, differentiation, migration, and inhibition of apoptosis (1, 17). LPP1 was recently shown to be capable of hydrolyzing exogenously presented LPA (33) and to attenuate LPA-mediated effects on cellular proliferation through the endothelial differentiation gene-2 (EDG-2) receptor (32). Ras-transformed rat2 fibroblasts, which exhibit lower LPP-specific activities compared with their parental cell line, possess higher PA-to-DAG ratios, suggesting that the ectoenzyme is able to access endogenous PA generated within the cell (21). Consistent with this suggestion, Sciorra and Morris (25) have provided evidence that LPP3 can generate DAG sequentially to PLD in HEK 293 cells in caveolin-enriched domains. The manner by which PA, apparently generated on the cytosolic leaflet of the plasma membrane, becomes available to LPP active sites on the cell's external surface is not known. In addition, the substrate specificity of LPP1a, its localization, and its possible functions require further investigation.

Function of LPP1b. LPP1b is a novel isoform that predicts an inactive truncated protein of 30 amino acids. The possibility that LPP1b could be generated by PCR through chance was considered. PCR was performed using three separate preparations of RNA from lung tissue, and this isoform was generated in all reactions. Bidirectional sequencing was performed on numerous clones showing the consistent presence of the "G" nucleotide in exactly the same position in all clones sequenced. PCR of LPP1 and LPP1a clones consistently produced the original cDNAs without the "extra" G nucleotide. Tissue profiles showed that LPP1b was expressed at relatively high levels in the lung and brain and varied across tissues different from that of the LPP1/LPP1a isoforms. Furthermore, LPP1b mRNA, determined by RT-PCR, was present in some human lung epithelial cells, namely human bronchial epithelial cells and an adenocarcinoma lung cell line, A549 (J. Faulkner and F. Possmayer, unpublished observations), and preliminary results suggest the presence of LPP1b mRNA in mouse lung cells. Thus the mRNA for this LPP1 variant is present in species other than the rat.

Whether the LPP1b isoform is produced or remains present in cells is unknown, and such a protein would be inactive. Precedent exists for transcription of mRNAs coding for truncated isoforms of PLD, DAG kinase, and PLC-delta , which would lack catalytic activity. It has been proposed that such isoforms might possess regulatory functions at either the mRNA or the protein level.

For example, Steed et al. (26) have observed that human PLD-2 cDNAs can contain a 56-bp splicing insert that results in premature termination during translation. This PLD-2c variant was detected in a large number of tissues and was relatively high compared with PLD-2a (active) in liver and heart but relatively low in skeletal muscle and brain. Splice variants of PLD-1a, such as PLD-1 and PLD-1b, show 114-bp deletions that would result in the generation of inactive proteins because they lack the essential transphosphatidylation motif contained in PLD-1a. It has been suggested that proteins corresponding to PLD-1, PLD-1b, PLD-2a, and PLD-2c may have functional roles, for example, by acting as modulators of PLD activators, but this has not been demonstrated definitively (26).

Kai et al. (15) have observed that human retina exhibits abundant expression of a phosphatidylserine-dependent DAG kinase isoform that appears to function in phosphatidylinositol regeneration from DAG arising through PLC activation. Compared with the retina, other human tissues contain very low levels of DAG kinase-gamma RNA but express a catalytically inactive form of DAG kinase-gamma in varying amounts. A low level of the full-length DAG kinase, but not the truncated form, is expressed in the brain. Although the mechanism is unknown, these results indicate regulated expression of the different DAG kinase isoforms at the mRNA level. The authors propose that truncation through mRNA splicing could represent a physiological mechanism for downregulating expression of this enzyme (15).

Rat testes express an alternate splice form of PKC, designated PKC-delta III, with an 83-nucleotide insertion within the caspase-3 recognition domain that results in premature truncation (29). The resulting protein possesses regulatory segments but lacks the catalytic domain. When expressed in Chinese hamster ovary-K1 cells, PKC-delta III was predominantly localized to plasma membranes, whereas the parental PKC-delta I isoform was homogeneously dispersed throughout the cytoplasm. Phorbol ester stimulation promoted only a small further translocation of PKC-delta III but a more prominent translocation of PKC-delta I. The authors propose that PKD-delta III could act as a dominant-negative modulator of PKC activation (29).

PLD and DAG kinase generate PA at the plasma membrane, whereas PKC-delta is activated by DAG. We consider it possible that the generation of LPP1b mRNA could provide a means of downregulating LPP1 or LPP1a mRNA transcription. It is also possible that LPP1b protein could function in a modulatory capacity, for example, acting as a dominant-negative type during up- or downregulation. It is stressed that no direct evidence is yet available, and the presence of LPP1b peptide must still be demonstrated in cells. Overexpression of LPP1b in HEK 293 cells did not affect LPP activity assayed in vitro. Further studies using pulmonary type II or other cells are required to test these suggestions.

Expression of pulmonary LPPs. Across the variety of rat tissues examined, lung showed a high expression of LPP1 mRNA and relatively high levels of LPP1a and LPP1b mRNAs. LPP3 mRNA levels were also high in the lung, although lower than the liver and brain. The LPP2 isoform was detected in the rat brain but was absent in the lung. Hooks and colleagues (9) have described high tissue-specific expression of human LPP2 detected in brain, pancreas, and placenta. The profiles obtained in this study compare similarly with those obtained for LPP1 and LPP3 in the mouse and human (16, 17). Leung and colleagues (18) have indicated higher expression of the human LPP1a isoform in certain tissues, including the heart and pancreas. In rats, LPP1 appears to be predominant over LPP1a or LPP1b in most tissues.

LPP1 and LPP3 mRNA levels increased in fetal rat lung in late gestation to the first day of life, declined slightly in the neonatal period, but tended to increase during later development. LPP1b levels, as indicated by semiquantitative RT-PCR, declined relative to LPP1/1a during late gestation and postnatal development. LPP1a mRNA expression was low in fetal lung and increased after birth.

Transient expression of the pulmonary LPP cDNAs in HEK 293 cells confirms that the full-length pulmonary LPPs are, indeed, catalytically active members of the LPP/PAP2 superfamily. Meanwhile, expression of the novel LPP1b isoform did not modulate LPP enzyme activity, consistent with the catalytically inactive, truncated 30-residue protein. The reason for our inability to overexpress LPPs in the MLE12 cell line is unknown but may be the result of toxic effects arising from the high constitutive expression. Overexpression of lipid signaling enzymes may lead to changes in cell morphology because of membrane damage, which may eventually lead to cell death from the strong cytomegalovirus promoter in the pTracer-CMV2 expression vector. It was reported that stable ECV 340 and HEK 293 cell lines overexpressing LPP1, LPP1a, and LPP3 had a significant decrease in PA content compared with control cell lines (18, 25).

Other potential LPPs. It is possible that there exist other LPPs that have yet to be cloned from lung. A S-1-P phosphohydrolase recently cloned by Mandala et al. (20) had high homology to the active site of the LPPs but was proposed to contain 8-10 transmembrane domains. Boudker and Futerman (4) have identified an NEM-insensitive, Mg2+-independent activity in rat liver plasma membranes that demonstrates specificity toward C-1-P. There also exists a nuclear LPP activity characterized by Baker and Chang (2) in neuronal nuclei that appears to be NEM insensitive and Mg2+ independent. It displayed specificity toward LPA but was inhibited only by S-1-P and not C-1-P. Furthermore, Imai and collaborators (11) have recently described an activity in ovarian cancer cells that is NEM insensitive and Mg2+ independent with activity against LPA that was not inhibited by S-1-P or C-1-P. Hence, the enzymological properties of these activities, including their substrate specificity, distinguish them from the presently cloned LPPs.

The cloning of the NEM-sensitive, Mg2+-dependent PAP1 and its substrate specificity has not been reported yet. This enzyme may also be implicated in signaling, as reported by various investigators (13, 14). Other NEM-sensitive enzymes may exist, including an activity characterized by Frank and Waechter (8) that is unaffected by Mg2+ and catalyses the hydrolysis of polyisoprenyl phosphate and PA with similar efficiencies.

We have shown previously that pulmonary LPP activity exists in alveolar type II cells and hydrolyzes PA and LPA in purified lung plasma membranes. Thus various LPPs were cloned by RT-PCR from both adult rat lung and type II cell RNA generating LPP1, up to three LPP1 variants, and LPP3 cDNAs. The three LPP1 variants include LPP1a and two novel truncated isoforms, LPP1b and LPP1c. The full-length rat lung cDNAs encode functional NEM-insensitive phosphatidate phosphohydrolases. These pulmonary LPPs are proposed to be involved in regulating surfactant phospholipid secretion in alveolar type II cells and in controlling cell growth during lung development and injury. The LPP1b and LPP1c isoforms contain frameshifts that would result in premature termination, producing putative catalytically inactive polypeptides of 30 and 76 amino acids, respectively. Further investigation of the LPP1b isoform mRNA across a tissue profile revealed that it exists in a number of tissues and is relatively abundant in lung. At present, the significance of the LPP1b isoform is not known.


    ACKNOWLEDGEMENTS

We thank Dr. Morris Kates, Professor Emeritus, Department of Biochemistry, University of Ottawa, Canada, who first reported phosphatidic acid phosphatase, for his continued interest and support.


    FOOTNOTES

We thank Dr. D. Brindley (University of Alberta, Edmonton) for stimulating discussions. We thank Allan Grolla and Dave Dales for synthesizing the oligonucleotides (London Regional Cancer Centre, London, Ontario). We thank the laboratory of Dr. Stephen Ferguson (Robarts Research Institute) for providing HEK 293 cells for the expression studies. We also thank Anne Brickenden for invaluable technical assistance and Anne Brickenden and Dr. Lin Zhao for very helpful discussion. We also thank Dr. Zhao for repeating the RT-PCR and sequencing of some segments of LPP1, LPP1a, LPP1b, and LPP3.

This work was supported by a group grant from the Canadian Institutes of Health Research and grants from the Ontario Thoracic Society, the London Health Sciences Centre, and the Child Health Research Institute of London.

Address for reprint requests and other correspondence: F. Possmayer, Dept. of Obstetrics and Gynecology, 339 Windermere Rd., The Univ. of Western Ontario, London, Ontario, Canada N6A 5A5 (E-mail: fpossmay{at}uwo.ca).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 2 February 2001; accepted in final form 9 July 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   An, S. Identification and characterization of G protein-coupled receptors for lysophosphatidic acid and sphingosine-1-phosphate. Ann NY Acad Sci 905: 25-33, 2000[Abstract/Free Full Text].

2.   Baker, RR, and Chang H. A metabolic path for the degradation of lysophosphatidic acid, an inhibitor of lysophosphatidylcholine lysophospholipase, in neuronal nuclei of cerebral cortex. Biochim Biophys Acta 1483: 58-68, 2000[Medline].

3.   Barila, D, Plateroti M, Nobili F, Onetti Muda A, Xie Y, Morimoto T, and Perozzi G. The Dri 42 gene, whose expression is up-regulated during epithelial differentiation, encodes a novel endoplasmic reticulum resident transmembrane protein. J Biol Chem 271: 29928-29936, 1996[Abstract/Free Full Text].

4.   Boudker, O, and Futerman AH. Detection and characterization of ceramide-1-phosphate phosphatase activity in rat liver plasma membrane. J Biol Chem 268: 22150-22155, 1993[Abstract/Free Full Text].

5.   Brindley, DN, and Waggoner DW. Mammalian lipid phosphate phosphohydrolases. J Biol Chem 273: 24281-24284, 1998[Free Full Text].

6.   Castranova, V, Rabovsky J, Tucker JH, and Miles PR. The alveolar type II epithelial cell: a multifunctional pneumocyte. Toxicol Appl Pharmacol 93: 472-483, 1988[ISI][Medline].

7.   Dobbs, LG. Isolation and culture of alveolar type II cells. Am J Physiol Lung Cell Mol Physiol 258: L134-L147, 1990[Abstract/Free Full Text].

8.   Frank, DW, and Waechter CJ. Purification and characterization of a polyisoprenyl phosphate phosphatase from pig brain. Possible dual specificity. J Biol Chem 273: 11791-11798, 1998[Abstract/Free Full Text].

9.   Hooks, SB, Ragan SP, and Lynch KR. Identification of a novel human phosphatidic acid phosphatase type 2 isoform. FEBS Lett 427: 188-192, 1998[ISI][Medline].

10.   Ide, H, and Weinhold PA. Properties of diacylglycerol kinase in adult and fetal rat lung. Biochim Biophys Acta 713: 547-554, 1982[Medline].

11.   Imai, A, Furui T, Tamaya T, and Mills GB. A gonadotropin-releasing hormone-responsive phosphatase hydrolyses lysophosphatidic acid within the plasma membrane of ovarian cancer cells. J Clin Endocrinol Metab 85: 3370-3375, 2000[Abstract/Free Full Text].

12.   Jasinska, R, Zhang QX, Pilquil C, Singh I, Xu J, Dewald J, Dillon DA, Berthiaume LG, Carman GM, Waggoner DW, and Brindley DN. Lipid phosphate phosphohydrolase-1 degrades exogenous glycerolipid and sphingolipid phosphate esters. Biochem J 340: 677-686, 1999.

13.   Jiang, Y, Lu Z, Zang Q, and Foster DA. Regulation of phosphatidic acid phosphohydrolase by epidermal growth factor. Reduced association with the EGF receptor followed by increased association with protein kinase Cepsilon. J Biol Chem 271: 29529-29532, 1996[Abstract/Free Full Text].

14.   Johnson, CA, Balboa MA, Balsinde J, and Dennis EA. Regulation of cyclooxygenase-2 expression by phosphatidate phosphohydrolase in human amnionic WISH cells. J Biol Chem 274: 27689-27693, 1999[Abstract/Free Full Text].

15.   Kai, M, Sakane F, Imai S, Wada I, and Kanoh H. Molecular cloning of a diacylglycerol kinase isozyme predominantly expressed in human retina with a truncated and inactive enzyme expression in most other human cells. J Biol Chem 269: 18492-18498, 1994[Abstract/Free Full Text].

16.   Kai, M, Wada I, Imai S, Sakane F, and Kanoh H. Identification and cDNA cloning of 35-kDa phosphatidic acid phosphatase (type 2) bound to plasma membranes. Polymerase chain reaction amplification of mouse H2O2-inducible hic53 clone yielded the cDNA encoding phosphatidic acid phosphatase. J Biol Chem 271: 18931-18938, 1996[Abstract/Free Full Text].

17.   Kai, M, Wada I, Imai S, Sakane F, and Kanoh H. Cloning and characterization of two human isozymes of Mg++-independent phosphatidic acid phosphatase. J Biol Chem 272: 24572-24578, 1997[Abstract/Free Full Text].

18.   Leung, DW, Tompkins CK, and White T. Molecular cloning of two alternatively spliced forms of human phosphatidic acid phosphatase cDNAs that are differentially expressed in normal and tumor cells. DNA Cell Biol 17: 377-385, 1998[ISI][Medline].

19.   Lowry, OH, Rosebrough NJ, Farr AL, and Randall RJ. Protein measurement with the Folin-phenol reagent. J Biol Chem 193: 265-275, 1951[Free Full Text].

20.   Mandala, SM, Thornton R, Galve-Roperh I, Poulton S, Peterson C, Olivera A, Bergstrom J, Kurtz MB, and Spiegel S. Molecular cloning and characterization of a lipid phosphohydrolase that degrades sphingosine-1-phosphate and induces cell death. Proc Natl Acad Sci USA 97: 7859-7864, 2000[Abstract/Free Full Text].

21.   Martin, A, Gomez-Munoz A, Waggoner DW, Stone JC, and Brindley DN. Decreased activities of phosphatidate phosphohydrolase and phospholipase D in ras and tyrosine kinase (fps) transformed fibroblasts. J Biol Chem 268: 23924-23932, 1993[Abstract/Free Full Text].

22.   Nanjundan, M, and Possmayer F. Characterization of the pulmonary NEM-insensitive phosphatidate phosphohydrolase. Exp Lung Res 26: 361-381, 2000[ISI][Medline].

23.   Nanjundan, M, and Possmayer F. Pulmonary lipid phosphate phosphohydrolase in plasma membrane signaling platforms. Biochem J 358: 637-646, 2001[ISI][Medline].

24.   Rooney, SA. The surfactant system and lung phospholipid biochemistry. Am Rev Respir Dis 131: 439-460, 1985[ISI][Medline].

25.   Sciorra, VA, and Morris AJ. Sequential actions of phospholipase D and phosphatidic acid phosphohydrolase 2b generate diglyceride in mammalian cells. Mol Biol Cell 10: 3863-3876, 1999[Abstract/Free Full Text].

26.   Steed, PM, Clark KL, Boyar WC, and Lasala DJ. Characterization of human PLD2 and the analysis of PLD isoform splice variants. FASEB J 12: 1309-1317, 1998[Abstract/Free Full Text].

27.   Stukey, J, and Carman GM. Identification of a novel phosphatase sequence motif. Protein Sci 6: 469-472, 1997[Abstract].

28.   Tate, RJ, Tolan D, and Pyne S. Molecular cloning of magnesium-independent type 2 phosphatidic acid phosphatases from airway smooth muscle. Cell Signal 11: 515-522, 1999[ISI][Medline].

29.   Ueyama, T, Ren Y, Ohmori S, Sakai K, Tamaki N, and Saito N. cDNA cloning of an alternative splicing variant of protein kinase C delta (PKC deltaIII), a new truncated form of PKCdelta, in rats. Biochem Biophys Res Commun 269: 557-563, 2000[ISI][Medline].

30.   Waggoner, DW, Gomez-Munoz A, Dewald J, and Brindley DN. Phosphatidate phosphohydrolase catalyzes the hydrolysis of ceramide 1-phosphate, lysophosphatidate, and sphingosine 1-phosphate. J Biol Chem 271: 16506-16509, 1996[Abstract/Free Full Text].

31.   Walton, PA, and Possmayer F. Translocation of Mg2+-dependent phosphatidate phosphohydrolase between cytosol and endoplasmic reticulum in a permanent cell line from human lung. Biochem Cell Biol 64: 1135-1140, 1986[ISI][Medline].

32.   Xu, J, Love LM, Singh I, Zhang QX, Dewald J, Wang DA, Fischer DJ, Tigyi G, Berthiaume LG, Waggoner DW, and Brindley DN. Lipid phosphate phosphatase-1 and Ca2+ control lysophosphatidate signaling through EDG-2 receptors. J Biol Chem 275: 27520-27530, 2000[Abstract/Free Full Text].

33.   Xu, J, Zhang QX, Pilquil C, Berthiaume LG, Waggoner DW, and Brindley DN. Lipid phosphate phosphatase-1 in the regulation of lysophosphatidate signaling. Ann NY Acad Sci 905: 81-90, 2000[Abstract/Free Full Text].

34.   Zhang, QX, Pilquil CS, Dewald J, Berthiaume LG, and Brindley DN. Identification of structurally important domains of lipid phosphate phosphatase-1: implications for its sites of action. Biochem J 345: 181-184, 2000.


Am J Physiol Lung Cell Mol Physiol 281(6):L1484-L1493
1040-0605/01 $5.00 Copyright © 2001 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
M. Nanjundan and F. Possmayer
Pulmonary phosphatidic acid phosphatase and lipid phosphate phosphohydrolase
Am J Physiol Lung Cell Mol Physiol, January 1, 2003; 284(1): L1 - L23.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nanjundan, M.
Right arrow Articles by Possmayer, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nanjundan, M.
Right arrow Articles by Possmayer, F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online