AJP - Lung Columbus Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 282: L440-L447, 2002. First published October 19, 2001; doi:10.1152/ajplung.00202.2001
1040-0605/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/3/L440    most recent
00202.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gillett, A. M.
Right arrow Articles by Hooper, S. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gillett, A. M.
Right arrow Articles by Hooper, S. B.
Vol. 282, Issue 3, L440-L447, March 2002

SPECIAL TOPIC
Pre- and Postnatal Lung Development, Maturation, and Plasticity
Increased expansion of the lung stimulates calmodulin 2 expression in fetal sheep

A. M. Gillett1, M. J. Wallace1, M. T. Gillespie2, and S. B. Hooper1

1 Department of Physiology, Monash University, Victoria, 3800; and 2 St. Vincent's Institute of Medical Research, Fitzroy, Victoria, 3065, Australia


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Obstruction of the fetal trachea causes the lungs to expand with accumulated liquid. Although this is a potent stimulus for lung growth, the mechanisms involved are unknown. Our aim was to identify genes that are differentially expressed as a result of increased fetal lung expansion. Using differential display RT-PCR, we isolated a cDNA fragment partially encoding calmodulin 2 (CALM2) and identified the remainder of the coding region by 5'-rapid amplification of cDNA ends. Differential expression of CALM2 was confirmed by Northern blot analysis; CALM2 mRNA levels were increased to 161 ± 5% of control at 2 days of increased lung expansion, induced by tracheal obstruction (TO), and had returned to control levels at days 4 and 10. Using in situ hybridization analysis, we found that the proportion of CALM2-labeled cells increased from 10.3 ± 1.0% to 21.4 ± 6.8% by 2 days of TO. This increase in CALM2 expression was reflected by a tendency for calmodulin protein levels to increase from 122.7 ± 17.3 to 156.5 ± 17.7 at 2 days of TO. Thus increases in fetal lung expansion result in time-dependent changes in CALM2 mRNA levels, which closely parallels the changes in lung DNA synthesis rates. As calmodulin is essential for cell proliferation, increased CALM2 mRNA levels may reflect an important role for calmodulin in expansion-induced fetal lung growth.

fetus; DNA synthesis; tracheal obstruction; lung growth


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

THE GROWTH AND DEVELOPMENT of the fetal lung is dependent upon adequate distension of the future airways with liquid. This liquid is secreted into the lung lumen and exits the lung via the fetal trachea (9). Thus obstruction of the fetal trachea causes secreted liquid to accumulate within the future airways, causing the lungs to expand (1, 9, 12). The increase in lung expansion resulting from short periods (<7 days) of tracheal obstruction (TO) is a potent stimulus for fetal lung growth (11, 26). In contrast, the drainage of lung liquid results in lung deflation and the complete cessation of fetal lung growth (1, 25).

Previous studies have shown that the increase in lung growth induced by TO follows a distinct time course and that this growth is essentially complete within 7 days in fetal sheep (11, 26). In addition, we have shown that the increase in DNA synthesis rates is maximal at 2 days after TO, indicating that the signal(s) responsible for initiating the cellular proliferation is probably highest at this point (26). We hypothesized that this time period (<2 days) would be optimal for attempting to identify factors responsible for initiating the increase in fetal lung growth induced by TO. Thus the aim of our study was to identify genes that are differentially expressed in response to 36 h of increased lung expansion in fetal sheep. We used differential display reverse transcription polymerase chain reaction (DD RT-PCR) (15, 16) to characterize differential changes in gene expression in lung tissue after an increase in lung expansion (for review see Ref. 36). Control lung tissue was compared with lung tissue exposed to increased lung expansion obtained from the same fetus. This was achieved by ligating the left bronchus, as previously described (23), while the right lung was maintained at a control level of expansion.

In this study we report the identification of one gene, calmodulin 2 (CALM2), that is differentially expressed in response to an increase in fetal lung expansion. Calmodulin is a primary mediator of calcium signaling (2) and is a rate-limiting component that regulates cellular proliferation and differentiation in a variety of systems (19, 22). Our results suggest that enhanced CALM2 expression in the fetal lung may be an important component of the stretch-induced increase in fetal lung growth.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Surgical procedures. Aseptic surgery was performed on two pregnant, date-mated, Merino × Border Leicester ewes at 112 days of gestation (term ~147 days). Anesthesia of the ewe and fetus was induced with thiopental sodium (1 g iv) and maintained by continuous inhalation of halothane (0.5-2% in O2 and NO2: 50:50 vol/vol). The fetal head and neck were exposed via a hysterotomy, and saline-filled polyvinyl catheters were inserted into the fetal carotid artery, jugular vein, and amniotic sac to monitor fetal well-being. Two large-bore silicone rubber catheters were also inserted into the midcervical trachea, one directed toward the lungs and the other directed toward, but not entering, the fetal larynx. A third catheter (polyvinyl) was inserted into the lower trachea and subsequently fed into the left bronchus (see below). The left bronchus of the fetus was exposed, via a right thoracotomy, and a silk ligature was placed around it as previously described (23). The tip of the polyvinyl catheter, previously inserted into the lower trachea, was fed into the left bronchus, and its position was confirmed by palpation before the ligature was tied. All catheters were exteriorized from the ewe, and all tracheal catheters, including the left bronchial catheter, were joined to form a continuous tracheal loop that allowed the normal flow of liquid into and out of both lungs (10). Thus liquid was allowed to flow into and out of the left lung during the recovery period. The ewe and fetus were given at least 5 days to recover from the surgical procedure before the start of the experimental protocol. This ensured that a period of at least 5 days separated the surgical procedure from the period of increased left lung expansion to minimize the detection of genes affected by the surgical procedure.

Experimental protocol. At 126 days of gestation (~83% of gestation; term is ~147 days), the left bronchus was obstructed for 36 h, by occluding the left bronchial catheter, to increase expansion of the left lung. Complete obstruction was confirmed by measuring the increase in intraluminal pressure within the left lung (26). A previous study in our laboratory (23) showed that obstruction of the left bronchus and overexpansion of the left lung for 25 days do not cause significant mediastinal shift or encroach upon the right side of the chest. Rather, expansion and growth of the left lung occur in a caudal direction, causing eversion of the diaphragm on the left side (23). At 128 days of gestation, after 36 h of left bronchus obstruction (LBO), the fetal lung was drained of liquid immediately before the fetus and ewe were humanely killed with an overdose of intravenous pentobarbital sodium. The fetus was weighed, the fetal lungs were removed, and the left and right lungs were separated and weighed. Portions of both left and right lungs were snap frozen in liquid nitrogen. This stage of gestation (126-128 days gestational age) corresponds to the alveolar stage of lung development in fetal sheep.

DD RT-PCR analysis and DNA sequencing. Total RNA was extracted from frozen portions of control lung tissue (right lung), and lung tissue was exposed to 36 h of increased expansion (left lung) with a modified guanidine thiocyanate/cesium chloride method (3). The DD RT-PCR procedure used is a modification of the version that has previously been described (15, 16). Total RNA (50 µg) was DNase treated (DNase I, Boehringer Mannheim), and quadruplicate samples (2 µg) were reverse transcribed (AMV RT, Promega) at 42°C for 2 h. The 25-µl reaction contained 50 pmol of the 3' oligo(dT) primer (T12VA, where V indicates the nucleotide A, G, or C; GIBCO BRL), 8 mM dithiothreitol (DTT), and 20 µM 2-deoxynucleotide 5'-triphosphates (dNTPs, Promega). An aliquot (2 µl) of the product was then amplified by PCR. The 20-µl reactions contained 50 pmol of the T12VA 3' oligo(dT) primer, 25 rho mol of a 5' arbitrary primer (10-mer; Operon Technologies), 10 µM dNTPs, [alpha -35S]dATP (Pharmacia Biotech), Taq DNA polymerase buffer, and 2 U Taq DNA polymerase (Boehringer Mannheim). PCR was performed at 94°C for 30 s, 40°C for 1 min, and 72°C for 30 s for 40 cycles, followed by one elongation phase at 72°C for 5 min.

The amplified cDNA fragments, which represented subsets of the original mRNA pool, were separated by electrophoresis using a 6% polyacrylamide sequencing gel. The gel was then mounted on filter paper (Whatmann), dried at 80°C for 2 h, and exposed to autoradiographic film (Kodak Biomax ML). Differentially expressed bands were identified by visual inspection of the autoradiograph and excised from the gel using sterile razor blades. They were placed in 100 µl of diethyl pyrocarbonate-treated H2O at room temperature for 15 min and then boiled for 15 min. The eluted DNA fragments were then reamplified using the same PCR reaction conditions, primers, and reagents as stated above without the radiolabeled [alpha -35S]dATP and with 20 mM dNTPs. The reaction mixtures were purified (Wizard PCR preps, Promega) and ligated into a plasmid vector (PGEM T-Easy, Promega). The cDNA inserts were sequenced using dye terminator mix (Big Dye, Perkin Elmer) and an automated sequencer. Comparison of the DNA sequence with the GenBank database was undertaken using the basic alignment search tool alignment algorithm provided by the National Institutes of Health.

Northern blot analysis. Confirmation that the identified cDNA fragments are differentially expressed in response to an increase in fetal lung expansion was made by Northern blot analysis using lung tissue collected from 1) the right (control) and left (expanded) lungs of fetuses exposed to LBO (n = 2) and 2) a separate group of 20 fetal sheep. The latter group of fetal sheep were exposed to 0 (control, n = 5), 2 (n = 5), 4 (n = 5), or 10 (n = 5) days of increased lung expansion induced by TO with all experiments terminating on 127-128 days of gestation. The experimental protocols and the changes in lung weights, DNA synthesis rates, and lung DNA, and protein contents for each of these fetuses have been previously described (13, 26).

Total RNA was extracted from all fetal lung tissue samples and the mRNA levels, complementary to the isolated cDNA fragments, were measured by Northern blot analysis as described previously (17). Briefly, total RNA was extracted from fetal lung tissue using a modified version of the guanidine thiocyanate-cesium chloride method (3). The total RNA was denatured and separated in a 1% agarose gel (15% vol/vol formaldehyde), transferred to a nylon membrane (Duralon, Stratagene) by capillary action and cross-linked to the membrane via exposure to ultraviolet light (Hoeffer UVC 500, Amrad). The membrane was then incubated in hybridization buffer [50% vol/vol deionized formamide, 7% wt/vol SDS, 5× saline-sodium phosphate EDTA, and 0.1 mg/ml denatured and fragmented salmon sperm DNA (salmon sperm DNA, GIBCO BRL)] for 3-4 h at 42°C. The membranes were then hybridized with the 32P-labeled cDNA fragment and isolated by DD RT-PCR for 24 h at 42°C. These probes were labeled using the random-priming labeling technique (oligo labeling kit, Pharmacia) and were purified using Sephadex G-50 DNA grade columns (nick columns, Pharmacia Biotech). After hybridization, the membranes were washed twice in 1× standard saline-sodium citrate (SSC; 0.1% SDS) for 20 min at 42°C and once in 0.1× SSC (0.1% SDS) for 20 min at 42°C. The membranes were air dried and sealed in plastic bags, and the level of radioactivity was quantified by exposure to storage phosphor screens (Molecular Dynamics, Sunnyvale, CA). To standardize the amount of RNA loaded onto each lane, the blots were stripped and reprobed (as described above) with a 32P-labeled cDNA probe specific for ovine 18S ribosomal RNA. The relative levels of mRNA were quantified by measuring the total integrated density of each band using image analysis software (ImageQuanT, Molecular Dynamics) and were expressed as a ratio of the level of 18S rRNA. Each Northern blot was repeated at least twice to ensure that the results obtained were consistent.

Identification of the full CALM2 cDNA sequence by 5'-rapid amplification of cDNA ends. One of the differentially expressed cDNA fragments isolated was found to encode the 3'-end of CALM2. The remainder of the ovine CALM2 cDNA sequence was obtained using a previously optimized protocol for CALM (35) by 5'-rapid amplification of cDNA ends (RACE, GIBCO BRL). Briefly, 50 fmol of a degenerate primer (5'-TCATCATYTGTACRAAYTCTTC-3'), which is specific for all three CALM cDNA sequences, was incubated with 5 µg of fetal sheep lung RNA in 0.4 M KCl and 10 mM PIPES at 52°C for 24 h before the RNA was reverse transcribed (Superscript-II RT, GIBCO BRL). The RNA was then degraded with RNases H and T1, and the cDNA was purified. A homopolymeric tail was attached to the 3'-end of the cDNA using dCTP and terminal deoxynucleotidyl transferase. The resulting cDNA strand was PCR amplified using a nested CALM2 primer (400 nM; 5'-TCATTTTTCTTGCCATCATTGTC-3'), a deoxyinosine-containing primer recognizing the homopolymeric tail (400 nM; GIBCO BRL), 1.5 mM MgCl2 and 200 µM each dNTP, [alpha -35S]dATP, Taq DNA polymerase buffer, and 2.5 U Taq DNA polymerase. PCR was performed at 94°C for 30 s, 55°C for 1 min, 72°C for 2 min, for 30 cycles, followed by one elongation phase at 72°C for 7 min. The products were separated on a 4% polyacrylamide gel and exposed to autoradiographic film. Bands were excised from the gel, eluted, and subcloned as above, then sequenced and compared with the GenBank DNA database.

In situ hybridization analysis. Paraffin sections of lung tissue (4 µm) were mounted on glass slides (Superfrost, Menzel-Glaser), with each slide containing lung tissue from a control fetus (n = 4) and a fetus exposed to 2 days of TO (n = 4) (13). At least three sections, obtained from different regions of the lung, were used from each fetus; the tissue blocks and sections were chosen at random. The tissue sections were hydrated, incubated with proteinase K (1 µg/ml in 0.1 M Tris · HCl buffer) for 1 h at 37°C, washed in distilled H2O, and then incubated in 0.1 M triethanolamine at room temperature for 10 min. The tissue sections were then dehydrated again and incubated in hybridization buffer (50% formamide, 0.75 M NaCl, 0.05 M NaPO4 buffer, pH 7.4, 0.01 M EDTA, 0.150 mM DTT, 1% SDS, 5× Denhardt's, 0.2 mg/ml heparin, 0.5 mg/ml tRNA, 0.05 mg/ml poly A and poly C, and 0.25 mg/ml ssDNA) at 55°C. The 35S-labeled RNA probe (see below) was added to fresh prewarmed hybridization buffer and then applied (10 µl) to each of the tissue sections, which were then coverslipped and incubated overnight at 55°C in an oven. After hybridization, the slides were washed four times in 4× SSC (100 mM 2-mercaptoethanol) for 15 min each. The sections were washed in 0.5 M NaCl and 0.05 M NaPO4 buffer for 10 min, then incubated in 0.025 mg/ml RNase A, 0.5 M NaCl, 0.05 M NaPO4 buffer at 37°C for 30 min, followed by washing in Criterion wash (0.5 M NaCl, 0.05 M NaPO4, 100 mM 2-mercaptoethanol) for 30 min at 58°C. Finally, the slides were washed in 0.5× SSC (containing 20 mM 2-mercaptoethanol) for 3 h, and the tissue sections were then dehydrated in a series of 0.3 M ammonium acetate/ethanol washes. The slides were dried, dipped in photographic emulsion (Kodak NTB-2), and stored in the dark for 4-5 wk at 4°C. The photographic emulsion was developed using D-19 developer (Kodak) and fixed using Kodak fixer. The slides were then rinsed in distilled water, and the sections counterstained using cresyl violet. To calculate the proportion of CALM2 labeled cells, we counted ~500 cells in total from each animal using sections from at least three different locations within the lung. These tissue sections were viewed under a light microscope at a magnification of ×100.

The cDNA template used to generate the RNA probes was a 115-bp fragment of the CALM2 cDNA fragment isolated using DD RT-PCR. This fragment is specific for CALM2 and encoded most of the 3'-untranslated region (UTR) (see Fig. 1). The fragment was generated by PCR, using specific primers (5', ACAAATGATGACAGCAAAGTGA; 3', AGGGGGAAACCTTTTACAGA), and was ligated into a plasmid vector (PGEM T-Easy, Promega). Northern blot analysis confirmed that this probe bound to only one transcript, which was of an identical size to that which hybridized with the longer 416-bp cDNA probe isolated by DD RT-PCR. The sense and antisense RNA probes were generated using the T7 and SP6 promoters and labeled by incorporation of [35S]dUTP. The labeled probe and unincorporated [35S]dUTP were separated using push trap columns (Stratagene). Hybridization with the sense RNA probe was used to assess nonspecific hybridization.


View larger version (50K):
[in this window]
[in a new window]
 
Fig. 1.   Nucleotide and predicted protein sequence for ovine calmodulin 2 (CALM2). The 416-bp cDNA fragment that was identified and isolated using differential display RT-PCR of mRNA extracted from control and expanded fetal lung tissue is highlighted in bold. The remainder of the 5' region was obtained by 5'-rapid amplification of cDNA ends using mRNA extracted from fetal lung tissue as a template. The isolated sequence was 96% homologous to the human CALM2 coding sequence. The GenBank accession number for this sequence is AY046946. Underlining indicates the cDNA sequence used as a template to generate the sense and antisense RNA probes for in situ hybridization.

Western blot analysis. Fetal lung tissue samples (~250 mg) were homogenized in 2.5 ml of prechilled buffer [1% Triton X-100, 50 mM Tris · HCl, pH 7.4, 150 mM NaCl, 1 mM phenylmethylsulfonyl fluoride, 10 mM EDTA, and 0.1 µg/ml protease inhibitor cocktail (Sigma P8340)], then left to stand on ice for 10 min. The samples were centrifuged at 14,000 g for 10 min, and the protein concentration of the supernatant was measured. Aliquots of each sample, containing 40 µg of protein, were boiled (5 min) to denature proteins. These were then separated by SDS polyacrylamide gel (15%) electrophoresis and transferred onto a polyvinylidene difluoride membrane (NEN Life Sciences, Boston, MA) by electrotransfer overnight at 4°C. The proteins were then fixed by incubation in a 0.025 M KPO4 buffer (0.2% glutaraldehyde) for 45 min. The membrane was then rinsed in Tris-buffered saline (TBS) and incubated for 1 h at room temperature in blocking buffer (1× TBS, 3% nonfat dry milk powder) before the membrane was incubated overnight at 4°C with the anti-calmodulin primary antibody (mouse monoclonal, Upstate Biotechnology) diluted 1:1,000 in TBS. The blot was then washed twice in water before it was incubated with a secondary antibody (anti-mouse; diluted 1:5,000 in TBS) conjugated to horseradish peroxidase for 1.5 h at room temperature. The blot was again rinsed twice in water and then twice in 0.05% Tween 20 for 5 min each. Enhanced chemiluminescence reagents (Amersham, vol 1:1) were added to the blot for 1 min. The blot was then exposed to film for between 1 and 5 min depending on the strength of the signal. The film was scanned, and the total integrated density of each calmodulin protein band was quantified using an image analysis system.

Statistical analysis. Data are presented as means ± SE. The total integrated density of the CALM2 mRNA transcript was divided by the total integrated density of the 18S rRNA band for each lane to adjust for minor RNA loading differences between lanes. Statistical comparisons between control fetuses and fetuses exposed to TO were only made between samples run in the same Northern or Western blot and, therefore, were subjected to the same hybridization and exposure conditions. Differences between the CALM2 mRNA levels in control fetuses and fetuses exposed to 2, 4, or 10 days of TO were compared using a Student's unpaired t-test. Calmodulin protein levels in control fetuses and fetuses exposed to 2, 4, and 10 days of TO were run on the same blot, and, therefore, differences between the groups were analyzed by a one-way ANOVA. The accepted level of significance for all the statistical analyses was P < 0.05. CALM2 mRNA levels in fetuses exposed to TO were expressed as a percentage of the mean control values run on the same blot to depict the time course for the changes in CALM2 mRNA levels after obstruction of the fetal trachea.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

DD RT-PCR and 5'-RACE. Five arbitrary 5'-primers and one anchored 3'-primer were used to identify ~50 differentially expressed bands. Six bands were chosen and successfully subcloned, and differential expression was confirmed by Northern blot analysis. All six cDNA fragments were sequenced, but only one contained coding region and could be identified; the other five have been stored for further analysis. The identified cDNA fragment was 416 bp in length and was found to partially encode for calmodulin. Based on the human calmodulin sequence, the cDNA fragment comprised 303 bp of coding sequence and 113 bp of 3'-UTR. The 303-bp coding sequence (Fig. 1) corresponded to amino acids 49-149 of human calmodulin. The 5' arbitrary primer used for amplification of the cDNA subset from which the calmodulin fragment was obtained was 5'-TCGGTCATAG-3', which was present at the 5'-end of the PCR fragment; the anchored primer T12VA (T12GA) was present at the 3'-end of the PCR fragment (Fig. 1).

There are three human calmodulin genes, and the sequence we initially identified was thought to be the ovine homolog of CALM2, as it had 96% (393/402) homology with human (h) CALM2 and only 86% (266/307) homology with hCALM1 and 82% (218/263) homology with hCALM3. Extension of this differentially expressed clone in the 5' direction, using 5'-RACE, yielded the remaining 155 bp of coding region for CALM2 (458 bp in total; Fig. 1) in addition to 68 nucleotides of the 5'-UTR. Identification of this sequence confirmed that the differentially expressed clone we had isolated was ovine CALM2. Ovine CALM2 cDNA shares 96% (594/615) homology with hCALM2, 85% (395/464) homology with hCALM1 and 82% (373/453) homology with hCALM3.

Northern blot analysis. Differential expression of CALM2 mRNA in response to an increase in fetal lung expansion was confirmed by Northern blot and in situ hybridization analyses. The isolated CALM2 cDNA hybridized with a single RNA transcript of 1.4 kb (Fig. 2A). At 36 h after LBO, CALM2 mRNA levels in left lung tissue (expanded) were increased to 172 ± 7% of the mean control value measured in tissue from the right lung (Fig. 2A).


View larger version (47K):
[in this window]
[in a new window]
 
Fig. 2.   Northern blot analyses for CALM2 mRNA in lung tissue collected from 3 separate regions of the right fetal lung (control) and left (expanded) fetal lung at 36 h after the left bronchus was obstructed (LBO; A) and control fetuses and fetuses exposed to 2 days of increased lung expansion induced by tracheal obstruction (TO; B). CALM2 mRNA levels were expressed as a ratio of the density of the 18S rRNA band to adjust for minor loading differences between lanes. C: Western blot analysis of calmodulin protein levels in lung tissue from control fetuses and fetuses exposed to 2, 4, and 10 days of TO (n = 5 for each group).

In separate groups of fetuses subjected to TO, CALM2 mRNA levels were significantly increased from 204 ± 38 in control fetuses to 329 ± 11 at 2 days after TO (Figs. 2B and 3A). However, CALM2 mRNA levels were not different from control values after either 4 days of TO (control, 264 ± 39, vs. 4 days TO, 278 ± 34) or 10 days of TO (control, 113 ± 12, vs. 10 days TO, 123 ± 33). Expressed as a percentage of the mean control value from each Northern blot, fetal lung CALM2 mRNA levels were increased from 100.0 ± 21.1% in control fetuses to 161 ± 5% of control at 2 days of TO (P < 0.05) but were similar to control values at 4 days of TO (105 ± 14% vs. 100.0 ± 16.4%) and 10 days of TO (125 ± 34% vs. 100.0 ± 14.3%) (Fig. 3A).


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 3.   A: CALM2 mRNA levels (means ± SE), measured by Northern blot analysis, in lung tissue collected from control fetuses (open bars) and fetuses exposed to 2, 4, and 10 days of TO (solid bars). The relative densities of the calmodulin mRNA bands were expressed as a ratio of the 18S rRNA band and are presented as a percentage of the mean control value measured on each separate blot. B: the proportion of lung cells labeled in situ by hybridization with a specific CALM2 RNA probe in control fetuses and fetuses exposed to 2 days of TO. *Significantly different from control values.

In situ hybridization analysis. Using the specific antisense RNA probe for CALM2, we found that the proportion of lung cells labeled increased from 10.3 ± 1.0% in control fetuses to 21.4 ± 6.3% in fetuses exposed to 2 days of TO (Fig. 3B). The fetal lung cells expressing CALM2 included type II epithelial cells, fibroblasts, and endothelial cells.

Western blot analysis. A single protein band of 17-kDa was detected using the anti-calmodulin monoclonal antibody (Fig. 1C). Mean calmodulin levels in lung tissue tended to increase from 122.7 ± 17.3 in control fetuses to 156.5 ± 17.7 in fetuses exposed to 2 days of TO (Fig. 4), although the difference was not significant (P = 0.11). Mean calmodulin levels returned to control values by 4 days of TO (113.2 ± 10.6) and remained at these levels at 10 days of TO (118.7 ± 15.5).


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 4.   Calmodulin protein levels measured in fetal lung tissue by Western blot analysis. The lung tissue was collected from control fetuses and fetuses exposed to 2, 4, and 10 days of TO (n = 5 for each group). Although calmodulin levels in fetal lung tissue were not different from control values in any of the TO groups of fetuses, calmodulin levels tended to be elevated (P = 0.11) in fetuses exposed to 2 days of TO.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Our results demonstrate that the technique of differential display was successful in detecting a previously undescribed change in the mRNA levels for CALM2 in response to increased lung expansion induced by TO in fetal sheep. Using Northern blot analysis, we detected a single 1.4-kb calmodulin transcript, and, at 36 h after LBO, the level of this transcript was increased above control values. In separate groups of fetuses exposed to varying lengths of increased lung expansion induced by TO, the mRNA levels encoding CALM2 were significantly increased above control values at 2 days of TO but were not different to control values after 4 or 10 days of TO. Similarly, the proportions of cells expressing CALM2 mRNA in lung tissue were doubled in fetuses exposed to 2 days of TO compared with control fetuses. This pattern of increased expression at 2 days of TO is very similar to the time course for the changes in pulmonary DNA synthesis rates after an increase in fetal lung expansion induced by TO (26, 27).

Our initial identification of CALM2 was based on a high degree of homology between the differentially expressed cDNA fragment we isolated and the previously described sequence for mammalian calmodulin. Extension of this cDNA fragment in the 5' direction, using 5'-RACE, yielded the remainder of the coding sequence for ovine CALM2, confirming that the differentially expressed cDNA fragment originally isolated encoded CALM2 (Fig. 1). All three mammalian calmodulin genes encode for an identical 149-amino acid protein and demonstrate a high level of homology between species (6). Indeed, we found that the cDNA sequence for ovine CALM2 shares a high degree of homology (96%; Ref. 37) with human CALM2 and a lesser degree of homology with human CALM1 (85%; Ref. 33) and human CALM3 (82%; Ref. 7). Calmodulin is the main calcium signaling mechanism for eukaryotic cells, and it binds calcium ions to form a Ca+/calmodulin complex. This, in turn, binds and inactivates autoinhibitory domains in many important protein kinases (6). Thus calmodulin can act as a permissive factor for the function of target proteins, including some protein kinases involved in growth signaling pathways (20, 21). In particular, calmodulin has been shown to play an essential role in the G1 to S phase transition in cell growth (19), and many cellular regulatory cascades rely on calmodulin for their function (20, 21).

The transcriptional regulation of calmodulin's expression is complex, as it is encoded by multiple genes, which probably reflects its involvement in a diverse variety of cellular pathways. In mammals, calmodulin is encoded by three separate genes (CALM1, CALM2, and CALM3), each with unique promoter and intron regions (7, 14, 28, 37, 40). The five transcripts generated by the three genes predominantly differ in their 5'- and 3'-UTR and share nucleotide homology of ~80% in their coding region, but all encode for an identical 149-amino acid protein (7). As each of the three calmodulin genes are independently regulated, the levels of each individual transcript varies in a tissue- and growth stage-specific manner. Based on the sequence of the cDNA fragment isolated, the differentially expressed 1.4-kb calmodulin transcript we detected by Northern blot analysis is a product of the CALM2 gene (37). This is the first evidence to indicate that CALM2 may be the predominant calmodulin gene involved in regulating expansion-induced fetal lung growth and development.

Previous in vitro experiments involving antisense transcripts for calmodulin (5), monoclonal calmodulin antibodies (32), highly specific calmodulin antagonists (8, 24, 34), and nuclear-targeted calmodulin antagonist peptides (38) have established the vital role that calmodulin plays in cellular growth and proliferation. These studies have demonstrated that reducing or blocking the effects of calmodulin reduces the rate of cell growth and proliferation in culture. In particular, a close interrelationship has been established between calmodulin transcriptional activity and cell cycle events in vitro (4). Similarly, in vivo experiments have confirmed that reductions in calmodulin levels (30) or lung-specific blockade of calmodulin activity (38) reduces growth and development of the lung. For instance, administration of the calmodulin antagonist trifluoperazine (TFP) to immature rats markedly reduced subsequent lung growth and impaired structural development of the lung, including alveolarization (30). Furthermore, in vivo expression of a calmodulin inhibitor protein in type II alveolar epithelial cells, using the human surfactant protein C promoter, has been shown to disrupt lung development in transgenic mice (39).

Our finding that CALM2 was differentially expressed in response to an increase in fetal lung expansion and that the changes in CALM2 mRNA levels closely parallel the changes in DNA synthesis rates in response to an increase in lung expansion supports the concept that calmodulin plays an important role in expansion-induced growth and development of the fetal lung. The mechanisms by which an increase in fetal lung expansion stimulates fetal lung growth and development are largely unknown (12), but our findings, in combination with the findings of previous studies (30, 38, 39), indicate that increased intracellular calmodulin levels, via activation of the CALM2 gene, may play an important role. Although it has been widely speculated that production and release of growth factors, which act in a local paracrine fashion, mediate the cellular proliferation induced by increased lung stretch (11, 12, 18), intercellular chemical signaling may not be the predominant regulatory mechanism. Indeed, it is possible that mechanical coupling between adjacent cells and between cells and the extracellular matrix is the predominant stimulus. This, in turn, may directly activate an intracellular cascade of which calmodulin plays a central role. Although it was not possible to quantify cell types within the fetal lung that had specifically increased CALM2 expression in this study, we note that CALM2 expression was localized in type II epithelial cells, fibroblasts, and endothelial cells in both control fetuses and fetuses exposed to 2 days of TO. We previously found that all of these cell types proliferate in response to an increase in fetal lung expansion (29), indicating that increased CALM2 expression may be closely linked with cellular proliferation within the lung.

The involvement of calmodulin in expansion-induced lung growth may not be restricted to the fetus, as calmodulin levels increase during accelerated lung growth induced by hemipneumonectomy in immature rats (27). The increase in lung growth after hemipnuemonectomy is thought to be expansion dependent (31), and the time course for the change in calmodulin levels (29) is very similar to that observed in this study after TO. That is, the greatest increase in calmodulin levels occurred at 2 days after hemipneumonectomy and coincided with a large increase in pulmonary DNA synthesis rates. Furthermore, the administration of TFP reduced the increase in calmodulin activity and the increase in lung growth after hemipneumonectomy (29). However, the precise role that calmodulin may play in the intracellular pathways leading to cellular proliferation in the lung is currently unknown but warrants further investigation.

Although calmodulin protein levels tended to be increased in fetal lung tissue at 2 days of TO, the increase in CALM2 expression, as determined by both Northern blot and in situ hybridization analyses, was far greater than the increase in protein levels. There are a number of possible explanations for this discrepancy, including the possibility of reduced translation of this gene product. However, as the protein encoded by each of the three CALM genes is identical and will be detected by the antibody, we consider it more likely that expression and translation into protein from the CALM1 and CALM3 genes (which may be unaltered or reduced by TO) may mask changes in whole tissue calmodulin levels associated with alterations in CALM2 expression. It is unknown whether CALM1 and CALM3 genes are differentially regulated by alterations in fetal lung expansion; this requires investigation.

In summary, we have shown that CALM2 is differentially expressed in response to an increase in fetal lung expansion and that the change in expression pattern closely parallels the change in DNA synthesis rates under these conditions. It is now recognized that calmodulin plays an important role in the processes controlling cell replication, indicating that intracellular calmodulin levels may, in part, mediate the expansion-induced cellular proliferation within the fetal lung.


    ACKNOWLEDGEMENTS

The authors gratefully acknowledge the expert technical assistance of A. Satragno, A. Thiel, and Nicole Horwood (St. Vincent's Institute of Medical Research).


    FOOTNOTES

This work was supported by the National Health and Medical Research Council of Australia.

Address for reprint requests and other correspondence: S. B. Hooper, Dept. of Physiology, P.O. Box 13F, Monash Univ., Victoria 3800, Australia (E-mail: stuart.hooper{at}med.monash.edu.au).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

10.1152/ajplung.00202.2001

Received 9 August 2001; accepted in final form 12 October 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Alcorn, D, Adamson TM, Lambert TF, Maloney JE, Ritchie BC, and Robinson PM. Morphological effects of chronic tracheal ligation and drainage in the fetal lamb lung. J Anat 123: 649-660, 1977.

2.   Chin, D, and Means AR. Calmodulin: a prototypical calcium sensor. Trends Cell Biol 10: 322-328, 2000.

3.   Chirgwin, JM, Przybyla AE, MacDonald RJ, and Rutter WJ. Isolation of biologically active ribonucleic acid from sources enriched with ribonuclease. Biochemistry 18: 5294-5299, 1979.

4.   Christenson, MA, and Means AR. Coordinate regulation of mRNAs from multiple calmodulin genes during myoblast differentiation in vitro. J Cell Physiol 154: 343-349, 1993.

5.   Davidkova, G, Zhang SP, Nichols RA, and Weiss B. Reduced level of calmodulin in PC12 cells induced by stable expression of calmodulin antisense RNA inhibits cell proliferation and induces neurite outgrowth. Neuroscience 75: 1003-1019, 1996.

6.   Van Eldik, LJ, and Watterson DM. Calmodulin and Signal Transduction. San Diego, CA: Academic, 1998.

7.   Fischer, R, Koller M, Flura M, Mathews S, Strehler-Page MA, Krebs J, Penniston JT, Carafoli E, and Strehler EE. Multiple divergent mRNAs code for a single human calmodulin. J Biol Chem 263: 17055-17062, 1988.

8.   Grief, F, Soroff HS, Albers KM, and Taichman LB. The effect of trifluoperazine, a calmodulin antagonist, on the growth of normal and malignant epidermal keratinocytes in culture. Eur J Cancer Clin Oncol 25: 19-26, 1989.

9.   Harding, R, and Hooper SB. Regulation of lung expansion and lung growth before birth. J Appl Physiol 81: 209-224, 1996.

10.   Hooper, SB, Dickson KA, and Harding R. Lung liquid secretion, flow and volume in response to moderate asphyxia in fetal sheep. J Dev Physiol 10: 473-485, 1988.

11.   Hooper, SB, Han VKM, and Harding R. Changes in lung expansion alter pulmonary DNA synthesis and IGF-II gene expression in fetal sheep. Am J Physiol Lung Cell Mol Physiol 265: L403-L409, 1993.

12.   Hooper, SB, and Harding R. Fetal lung liquid: a major determinant of the growth and functional development of the fetal lung. Clin Exp Pharmacol Physiol 22: 235-247, 1995.

13.   Keramidaris, E, Hooper SB, and Harding R. Effect of gestational age on the increase in fetal lung growth following tracheal obstruction. Exp Lung Res 22: 283-298, 1996.

14.   Koller, M, Schnyder B, and Strehler EE. Structural organization of the human CaMIII calmodulin gene. Biochim Biophys Acta 1087: 180-189, 1990.

15.   Liang, P, and Pardee AB. Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science 257: 967-971, 1992.

16.   Liang, P, Zhu W, Zhang X, Guo Z, O'Connell RP, Averboukh L, Wang F, and Pardee AB. Differential display using one-base anchored oligo-dT primers. Nucleic Acids Res 22: 5763-5764, 1994.

17.   Lines, A, Nardo L, Phillips ID, Possmayer F, and Hooper SB. Alterations in lung expansion affect surfactant protein A, B, and C mRNA levels in fetal sheep. Am J Physiol Lung Cell Mol Physiol 276: L239-L245, 1999.

18.   Liu, M, and Post M. Mechanochemical signal transduction in the fetal lung. J Appl Physiol 89: 2078-2084, 2000.

19.   Lopez-Girona, A, Bosch M, Bachs O, and Agell N. Addition of calmodulin antagonists to NRK cells during G1 inhibits proliferating cell nuclear antigen expression. Cell Calcium 18: 30-40, 1995.

20.   Means, AR. Calcium, calmodulin and cell cycle regulation. FEBS Lett 347: 1-4, 1994.

21.   Means, AR. Regulatory cascades involving calmodulin-dependent protein kinases. Mol Endocrinol 14: 4-13, 2000.

22.   Means, AR, VanBerkum MF, Bagchi I, Lu KP, and Rasmussen CD. Regulatory functions of calmodulin. Pharmacol Ther 50: 255-270, 1991.

23.   Moessinger, AC, Harding R, Adamson TM, Singh M, and Kiu GT. Role of lung fluid volume in growth and maturation of the fetal sheep lung. J Clin Invest 86: 1270-1277, 1990.

24.   Musgrove, EA, Wakeling AE, and Sutherland RL. Points of action of estrogen antagonists and a calmodulin antagonist within the MCF-7 human breast cancer cell cycle. Cancer Res 49: 2398-2404, 1989.

25.   Nardo, L, Hooper SB, and Harding R. Lung hypoplasia can be reversed by short-term obstruction of the trachea in fetal sheep. Pediatr Res 38: 690-696, 1995.

26.   Nardo, L, Hooper SB, and Harding R. Stimulation of lung growth by tracheal obstruction in fetal sheep: relation to luminal pressure and lung liquid volume. Pediatr Res 43: 184-190, 1998.

27.   Nardo, L, Maritz G, Harding R, and Hooper SB. Changes in lung structure and cellular division induced by tracheal obstruction in fetal sheep. Exp Lung Res 26: 105-119, 2000.

28.   Nojima, H. Structural organization of multiple rat calmodulin genes. J Mol Biol 208: 269-282, 1989.

29.   Ofulue, AF, Matsui R, and Thurlbeck WM. Role of calmodulin as an endogenous initiatory factor in compensatory lung growth after pneumonectomy. Pediatr Pulmonol 15: 145-150, 1993.

30.   Ofulue, AF, Sekhon H, Cherukupalli K, Khadempour H, and Thurlbeck WM. Morphometric and biochemical changes in lungs of growing rats treated with a calmodulin antagonist. Pediatr Pulmonol 10: 46-51, 1991.

31.   Rannels, DE. Role of physical forces in compensatory growth of the lung. Am J Physiol Lung Cell Mol Physiol 257: L179-L189, 1989.

32.   Reddy, GP, Reed WC, Sheehan E, and Sacks DB. Calmodulin-specific monoclonal antibodies inhibit DNA replication in mammalian cells. Biochemistry 31: 10426-10430, 1992.

33.   Rhyner, JA, Ottiger M, Wicki R, Greenwood TM, and Strehler EE. Structure of the human CALM1 calmodulin gene and identification of two CALM1-related pseudogenes CALM1P1 and CALM1P2. Eur J Biochem 225: 71-82, 1994.

34.   Schuller, HM, Orloff M, and Reznik GK. Antiproliferative effects of the Ca2+/calmodulin antagonist B859-35 and the Ca2+-channel blocker verapamil on human lung cancer cell lines. Carcinogenesis 12: 2301-2303, 1991.

35.   Skinner, TL, Kerns RT, and Bender PK. Three different calmodulin-encoding cDNAs isolated by a modified 5'-RACE using degenerate oligodeoxyribonucleotides. Gene 151: 247-251, 1994.

36.   Sunday, ME. Differential display RT-PCR for identifying novel gene expression in the lung. Am J Physiol Lung Cell Mol Physiol 269: L273-L284, 1995.

37.   Toutenhoofd, SL, Foletti D, Wicki R, Rhyner JA, Garcia F, Tolon R, and Strehler EE. Characterization of the human CALM2 calmodulin gene and comparison of the transcriptional activity of CALM1, CALM2 and CALM3. Cell Calcium 23: 323-338, 1998.

38.   Wang, J, Campos B, Jamieson GA, Jr, Kaetzel MA, and Dedman JR. Functional elimination of calmodulin within the nucleus by targeted expression of an inhibitor peptide. J Biol Chem 270: 30245-30248, 1995.

39.   Wang, J, Campos B, Kaetzel MA, and Dedman JR. Expression of a calmodulin inhibitor peptide in progenitor alveolar type II cells disrupts lung development. Am J Physiol Lung Cell Mol Physiol 271: L245-L250, 1996.

40.   Ye, Q, and Berchtold MW. Structure and expression of the chicken calmodulin I gene [erratum appears in Gene 213: 225, 1998]. Gene 194: 63-68, 1997.


Am J Physiol Lung Cell Mol Physiol 282(3):L440-L447
1040-0605/02 $5.00 Copyright © 2002 the American Physiological Society



This article has been cited by other articles:


Home page
Physiol. GenomicsHome page
F. Sozo, M. J. Wallace, V. A. Zahra, C. E. Filby, and S. B. Hooper
Gene expression profiling during increased fetal lung expansion identifies genes likely to regulate development of the distal airways
Physiol Genomics, January 12, 2006; 24(2): 105 - 113.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
B. J. Joyce, M. J. Wallace, R. A. Pierce, R. Harding, and S. B. Hooper
Sustained changes in lung expansion alter tropoelastin mRNA levels and elastin content in fetal sheep lungs
Am J Physiol Lung Cell Mol Physiol, April 1, 2003; 284(4): L643 - L649.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
I. F. McMurtry
Editorial: Introduction: pre- and postnatal lung development, maturation, and plasticity
Am J Physiol Lung Cell Mol Physiol, March 1, 2002; 282(3): L341 - L344.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/3/L440    most recent
00202.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gillett, A. M.
Right arrow Articles by Hooper, S. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gillett, A. M.
Right arrow Articles by Hooper, S. B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online