AJP - Lung Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 282: L631-L641, 2002. First published October 5, 2001; doi:10.1152/ajplung.00085.2001
1040-0605/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/4/L631    most recent
00085.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (39)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Itani, O. A.
Right arrow Articles by Thomas, C. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Itani, O. A.
Right arrow Articles by Thomas, C. P.
Vol. 282, Issue 4, L631-L641, April 2002

SPECIAL TOPIC
Alveolar Epithelial Ion and Fluid Transport
Glucocorticoid-stimulated lung epithelial Na+ transport is associated with regulated ENaC and sgk1 expression

Omar A. Itani1, Scott D. Auerbach1, Russell F. Husted1, Kenneth A. Volk1, Shana Ageloff2, Mark A. Knepper2, John B. Stokes1,3, and Christie P. Thomas1,3

1 Department of Internal Medicine, University of Iowa College of Medicine, Iowa City 52242; 3 Veterans Affairs Medical Center, Iowa City, Iowa 52246; and 2 Laboratory of Kidney and Electrolyte Metabolism, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, Maryland 20892


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

H441 cells, a bronchiolar epithelial cell line, develop a glucocorticoid-regulated amiloride-sensitive Na+ transport pathway on permeable supports (R. Sayegh, S. D. Auerbach, X. Li, R. Loftus, R. Husted, J. B. Stokes, and C. P. Thomas. J Biol Chem 274: 12431-12437, 1999). To understand its molecular basis, we examined the effect of glucocorticoids (GC) on epithelial Na+ channel (ENaC)-alpha , -beta , and -gamma and sgk1 expression and determined the biophysical properties of Na+ channels in these cells. GC stimulated the expression of ENac-alpha , -beta , and -gamma and sgk1 mRNA, with the first effect seen by 1 h. These effects were abolished by actinomycin D, but not by cycloheximide, indicating a direct stimulatory effect on ENaC and sgk1 mRNA synthesis. The GC effect on transcription of ENaC-alpha mRNA was accompanied by a significant increase in ENaC-alpha protein levels. GC also stimulated ENaC-alpha , -beta , and -gamma and sgk1 mRNA expression in A549 cells, an alveolar type II cell line. To determine the biophysical properties of the Na+ channel, single-channel currents were recorded from cell-attached H441 membranes. An Na+-selective channel with slow kinetics and a slope conductance of 10.8 pS was noted, properties similar to ENaC-alpha , -beta , and -gamma expressed in Xenopus laevis oocytes. These experiments indicate that amiloride-sensitive Na+ transport is mediated through classic ENaC channels in human lung epithelia and that GC-regulated Na+ transport is accompanied by increased transcription of each of the component subunits and sgk1.

epithelial sodium channel; amiloride; short-circuit current; patch clamp; adenosine 3',5'-cyclic monophosphate; corticosteroids; airway epithelia; alveolar type II cells


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

THE DEVELOPING ALVEOLI in the fetal lung are filled with liquid that arises, in part, from fluid secreted in the alveolar lumen coupled to Cl- secretion (49). At the time of birth, net fluid secretion ceases and absorption occurs to establish pulmonary gas exchange. It is now clear that this transition from secretion to absorption coincides with the loss of Cl- secretion and the active reabsorption of Na+ across the luminal surface of alveolar and bronchiolar epithelia (7, 36).

The leading molecular candidate to effect Na+ absorption by the lung is the epithelial Na+ channel (ENaC). Three subunits termed alpha , beta , and gamma  have been identified by several laboratories (reviewed in Refs. 3 and 19). When expressed together, these subunits reconstitute an amiloride-sensitive Na+-selective ion channel with properties similar to that recorded in various epithelia, including fetal distal lung epithelial cells (FDLE) and alveolar type II cells (23, 56). In the developing rat fetal lung, ENaC-alpha , -beta , and -gamma mRNA are expressed around the time of birth, coinciding with the phenotype switch that occurs to reabsorb liquid from the alveolar lumen (52, 63).

There is considerable evidence that ENaC expression and function can be regulated by glucocorticoids. Glucocorticoids induce amiloride-sensitive Na+ transport in the immature fetal lung and increase Na+ and fluid transport in the adult lung (4, 17, 60). Whether given during the antenatal period to the developing fetus or during adult life, exogenous glucocorticoids increase ENaC-alpha mRNA dramatically (48, 52). In addition, the increase in lung ENaC mRNA abundance in the immediate perinatal period correlates closely with the increase in circulating endogenous glucocorticoids (51, 63). This effect of glucocorticoid hormones on ENaC expression may be a previously unrecognized mechanism of action of glucocorticoid therapy on lung maturation when given to the preterm infant (37).

The serum- and glucocorticoid-regulated serine/threonine protein kinase sgk was first described as an immediate early response gene in rat mammary epithelia and rat-2 fibroblasts (64). The sgk transcript (now renamed sgk1) is rapidly induced in vivo by glucocorticoids or aldosterone in a variety of rat tissues, and similar responses are seen in epithelial cells derived from the rabbit, amphibian, and canine kidney collecting duct (9, 13, 33, 34, 46). The stimulated kinase may have a direct impact on corticosteroid-regulated epithelial Na+ transport, as coexpression of sgk1 with ENaC-alpha , -beta , and -gamma ENaC mRNA in Xenopus oocytes significantly enhances the Na+ current (13, 34).

Alveolar type II cells and airway epithelial cells are thought to be the primary sites for reabsorption of Na+ in the lung. These cells express all ENaC mRNAs, but the biophysical profile of Na+ channels expressed in these cells may be different from that of the kidney collecting duct (31). Because channels made of ENaC-alpha alone and ENaC-alpha and -beta or ENaC-alpha and -gamma subunits have properties that are different from the heteromultimer (32), it has been proposed that the alveolar and airway Na+ channel may have a different stoichiometry of ENaC subunits. Alternatively, Na+ transport in the alveolar and airway epithelia may occur, at least partly, via non-ENaC Na+ channels.

In this paper, we describe human airway and alveolar cell lines with glucocorticoid-regulated expression of ENaC-alpha , -beta , and -gamma and sgk1 mRNA and amiloride-sensitive Na+ transport. We demonstrate that one of these cell lines shows cAMP-stimulated Na+ transport and has Na+ channels with biophysical properties predicted for an ENaC-alpha , -beta , and -gamma heteromultimer. We also determine that the glucocorticoid effects on all ENaC subunits and sgk1 are likely to be transcriptional.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Materials. Dexamethasone, amiloride, cycloheximide, forskolin, and IBMX were purchased from Sigma Biochemicals (St. Louis, MO). Actinomycin D was obtained from Roche Molecular Biochemicals (Indianapolis, IN); benzamil was from Research Biochemical International (Natick, MA), and [alpha -32P]UTP was from NEN Life Science Products (Boston, MA). Culture media were obtained from Life Technologies (Gaithersburg, MD), and DNA sequencing and synthesis was a service provided by the University of Iowa DNA core facility.

Tissue culture and RNA analysis. H441 cells were cultured in RPMI 1640, as described previously (53). A549 cells (American Tissue Culture Collection, Manassas, VA) and HEK-293 cells (Gene Transfer Vector Core, University of Iowa) were cultured, respectively, in MEM and Ham's F-12 supplemented with 10% FBS. To examine the effects of dexamethasone on gene expression, cell cultures were switched to serum-free medium and then treated with various concentrations of steroid or vehicle for 24 h in the presence or absence of actinomycin D or cycloheximide. To determine the time course for gene expression on permeable supports, H441 cells were grown on 30-mm Millicell PCF filters (Millipore, Bedford, MA), switched to serum-free steroid-free media for 24 h, and then exposed to 100 nM dexamethasone for various times. Total RNA was extracted from H441, A549, and HEK-293 cells as previously described (33).

Measurement of short-circuit current. To measure short-circuit current (Isc), H441 cells were grown for 4-7 days in RPMI 1640 with 6% serum and 100 nM dexamethasone on 12-mm Millicell PCF filters (44). To determine the effect of glucocorticoids and cAMP on epithelial Na+ transport, cells on filters were switched to steroid-free media for 24 h and then exposed to 100 nM dexamethasone or to 10 µM forskolin and 100 µM IBMX for various times. Isc and transepithelial resistance were measured at various time points in an Ussing chamber with or without 10 µM apical benzamil, and the cells were returned to normal culture conditions between measurements.

Cloning of hsgk1, -2, and -3. Total RNA prepared from H441 cells that had been treated with 100 nM dexamethasone for 24 h was reverse transcribed using oligo(dT) and Moloney murine leukemia virus reverse transcriptase as previously described (33). Briefly, 2 µl of first-strand cDNA was subjected to PCR amplification for 25 cycles using gene-specific primers and Taq DNA polymerase (Promega, Madison, WI) to obtain hsgk1, -2, and -3 cDNA fragments. To clone hsgk1, the primers 5'-CTCCTGCAGAAGGACAGGA and 5'-GGACAGGCTCTTCGGTAAACT were used with an anneal step at 55°C; to clone hsgk2, the primers 5'-TGTATCTCTCTGCCCTGCCAACC and 5'-CATTTCCCAGCCTCCATTCC were used with an anneal step at 55°C; and to clone hsgk3, the primers 5'-CCACTTACAAAGAGAACGGTCC and 5'-CATACAGAACAGCCCCAAGG used were with an anneal step at 62°C. Amplified fragments were cloned into pCRXLTOPO (Invitrogen, Carlsbad, CA), and individual clones were sequenced.

Ribonuclease protection assay for ENaC and sgk. Steady-state levels of ENaC-alpha , -beta , and -gamma mRNA were measured by ribonuclease protection assay (RPA) in H441 and A549 cells grown either as monolayers on 75-cm2 polystyrene flasks (Corning) or on 30-mm Millicell PCF filters. To measure ENaC-alpha , -beta , and -gamma mRNA, 10 µg RNA samples were hybridized with individual radiolabeled antisense cRNA probes along with 18S rRNA as a control. Templates for synthesis of human ENaC-1alpha and human ENaC-gamma cRNA probes have been previously described, as has solution hybridization, nuclease digestion, and identification of nuclease-protected products by PAGE (44, 54). To measure human ENaC-beta mRNA levels, one of two templates was used. In some experiments, a 537-bp human ENaC-beta fragment in pCR3.1 (gift from Paul McCray, University of Iowa) was used to create a linearized template, and a 182-bp cRNA probe was then synthesized from the T7 promoter to protect a 102-bp ENaC-beta cRNA fragment from ribonuclease digestion. In later experiments, a human ENaC-beta fragment in pCRII (Invitrogen) was used to create a linearized template, and a 358-bp cRNA probe synthesized from the SP6 promoter was used to protect a 177-bp cRNA fragment from ribonuclease digestion.

For hsgk2 and -3, cDNAs cloned into pCRXLTOPO were linearized with BamH I, and antisense cRNA probes were synthesized from the T7 promoter. For hsgk1, the full-length cDNA was amplified from H441 RNA using 5'-ACGTCTTTCTGTCTCCCCG and 5'- GGCTCCACCAAAAGGCTAAC; a 181-bp Apa I-Dra I fragment was subcloned into pCDNA3 (Invitrogen) and linearized, and a cRNA probe was synthesized from the T7 promoter. H441 cell RNA was hybridized with hsgk cRNA and 18S rRNA probes, and mRNA expression levels were determined by RPA, as described for ENaC-alpha , -beta , and -gamma .

Immunoblotting of ENaC-alpha . H441 cells exposed to 100 nM dexamethasone or vehicle for 24 h were directly lysed in 1× Laemmli buffer (1.5% SDS, 6% glycerol, and 50 mM Tris, pH 6.8), and protein concentration was determined by spectrofluorometry (2). Protein lysates (30 µg protein/lane) were heated to 60°C for 15 min and resolved by SDS-PAGE on 10% polyacrylamide minigels (Bio-Rad, Hercules, CA). Gels were transferred electrophoretically to nitrocellulose membranes and blocked with 5 g/dl nonfat dry milk. Membranes were then incubated with an anti-ENaC-alpha antibody [ENaC-alpha antibody 3560-2(4); IgG concentration = 0.518 µg/ml] overnight at 4°C in a diluent containing 150 mM NaCl, 50 mM sodium phosphate, pH 7.5, 10 mg/dl sodium azide, 50 mg/dl Tween 20, and 1 g/dl BSA (30). After a series of washes, membranes were exposed to anti-rabbit IgG conjugated to horseradish peroxidase (Pierce, Rockford, IL) at 0.16 µg/ml. Luminol-based enhanced chemiluminescence (LumiGLO; Kirkegaard and Perry Laboratories, Gaithersburg, MD) was used to detect antibody-antigen binding upon exposure to light-sensing film. Appropriate bands were then analyzed using densitometry (Molecular Dynamics, San Jose, CA).

Transient transfection and analysis of reporter activity. The organization of the 5'-end of the human ENaC-alpha gene has been described previously (33, 53). A portion of the 5'-flanking region of the human ENaC-alpha gene (-487 +55), which contains the functional glucocorticoid response element (GRE), was cloned upstream of the firefly luciferase gene in the plasmid pGL3basic (Promega). The GRE of human ENaC-alpha , AGAACAgaaTGTCCT, was mutated within this plasmid to AGTCTAgaaTGTCCT using the Quikchange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) and primers 5'-CAGTGTAAAGAAGTCTAGAATGTCCTAGGGCCC and 5'-GGGCCCTAGGACATTCTAGACTTCTTTACACTG. Briefly, the -487 +55 construct in pGL3basic was annealed with the above primers and extended with Pfu DNA polymerase, the parental plasmid was then digested with Dpn I, and the extended circular double-stranded DNA molecule (-487 +55 mutGRE) was recovered by transformation into bacteria.

A549 and HEK 293 cells were grown in 24-well plates until subconfluent and then were transfected, using LipofectAMINE Plus (Life Technologies), with 1 µg of the ENaC-alpha promoter-reporter construct and 1 µg of pRL-SV40 (Promega) as a control for transfection efficiency. For HEK-293 experiments, TAT3-luc, a plasmid in which three tandem copies of the GRE in the rat tyrosine amino transferase gene was placed upstream of a TATA-driven firefly luciferase construct, was tested (29). The day after transfection, cells were treated with 100 nM dexamethasone or vehicle, and 24 h later cell lysates were prepared and reporter gene activity was performed as previously described (33).

Patch clamp of H441 cells. H441 cells were grown on a Transwell-clear filter (Costar, Cambridge, MA) for 4 days in RPMI 1640 containing 6% FBS and 100 nM dexamethasone and then for 2 days in serum-free RPMI containing 100 nM dexamethasone. Before patch-clamp analysis, the Isc for each filter was measured in an Ussing chamber and ranged between 5 and 7 µA/cm2. Single channel currents were measured in cell-attached patches while cells were superfused at 37°C, using an Axopatch 2B voltage-clamp amplifier under the control of the pClamp software suite (Axon Instruments, Burlingame, CA), as described earlier (57). The bathing solution contained (in mM) 140 NaCl, 4.5 KCl, 2.5 CaCl2, 1 MgCl2, 10 HEPES, and 5 D-glucose, pH 7.35, and the pipette solution contained (in mM) 140 LiCl, 3 MgCl2, and 10 HEPES, pH 7.35. Slope conductance was calculated using pClamp software (Axon Instruments).


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

We have previously shown, by Isc measurements, that H441 cells express a glucocorticoid-regulated Na+ transport pathway (44). To begin to determine the basis for regulation of Na+ transport, we first measured the time course for glucocorticoid-mediated stimulation of Isc in H441 cells grown on permeable supports. Isc begins to increase after 4 h of glucocorticoid exposure and is clearly elevated by 6 h (Fig. 1A). The current continues to increase over the next 18 h, and, as we have previously reported, almost all of the current is inhibited by 10 µM benzamil, an ENaC inhibitor (44). In the control cells, there was a slow decline in Isc over 24 h, which was not related to a change in resistance and may have been secondary to the continued serum and steroid deprivation. The results confirm that glucocorticoids increase benzamil-sensitive Na+ transport, consistent with an increase in ENaC function.


View larger version (32K):
[in this window]
[in a new window]
 
Fig. 1.   Effect of 100 nM dexamethasone (Dex) on short-circuit current (Isc) and epithelial Na+ channel (ENaC) expression in H441 cells grown on permeable support. A: Dex, compared with vehicle (ctrl), increases Isc beginning after 4 h. *P < 0.05 and #P < 0.01, Student's t-test; n = 11 experiments. Values are means ± SE. B: Dex increases ENaC-alpha mRNA expression in H441 cells in a time-dependent manner and significantly by 4 h. *P < 0.05, Student's t-test; n = 3. The ratio of ENaC-alpha mRNA to 18S rRNA at each time point was compared with the corresponding level at time 0, which was arbitrarily set at 1. C: Dex increases ENaC-gamma mRNA expression at 2 h, which persists for up to 24 h. The effect of Dex on ENaC-alpha is also evident at 24 h, and the effect on ENaC-beta is only evident by 24 h. A representative ribonuclease protection assay (RPA) from 1 of 3 experiments is shown.

We next determined, by RPA, if ENaC subunit mRNAs were regulated by glucocorticoids in H441 cells. The effect of 100 nM dexamethasone on ENaC mRNA from H441 cells grown on filters was examined at different time points. The results demonstrate that dexamethasone increased the expression of all three subunits in a time-dependent manner, with a different profile for each of the three subunits. Under basal conditions, although there was abundant expression of ENaC-alpha , ENaC-beta and -gamma expression was not identifiable (Fig. 1, B and C). In the presence of dexamethasone, ENaC-alpha mRNA levels increased significantly by 4 h and continued to increase over the next several hours. The ENaC-gamma subunit mRNA was substantially increased as early as 2 h, the earliest time point tested, and continued to increase up to 24 h, whereas the ENaC-beta subunit was only increased at 24 h. When coupled with the Na+ transport data in Fig. 1A, the results show that the increase in ENaC-gamma and -alpha mRNA levels occurs before an increase in Na+ transport and suggests that the increase in transport may be accompanied by an increase in some subunit proteins. The data also indicate that an increase in expression of ENaC-beta mRNA may not be required for the early glucocorticoid effect on Na+ transport in H441 cells. To assess if the glucocorticoid regulation of ENaC-alpha , -beta , and -gamma mRNA was qualitatively different if the cells were grown on solid supports, the expression of these three subunits was also determined in H441 cells grown in polystyrene cell culture flasks. Although a careful time course analysis was not performed, the data showed that glucocorticoids stimulate ENaC-alpha , -beta , and -gamma expression in a similar fashion (data not shown). We then determined the dose-response curve for dexamethasone at 24 h for each of the three subunits when H441 cells were grown on solid supports. Under steroid-free conditions, ENaC-alpha expression was easily detectable, whereas ENaC-beta and -gamma expression was difficult to identify, and dexamethasone increased the expression of each of the three mRNAs in a dose-dependent manner (Fig. 2, A-C).


View larger version (70K):
[in this window]
[in a new window]
 
Fig. 2.   Effect of Dex on ENaC-alpha , -beta , and -gamma expression: dose response. H441 cells were grown on solid supports and exposed to various concentrations of Dex for 24 h, and ENaC-alpha (A), -beta (B), and -gamma (C) expression was assessed by RPA. As a control for RNA loading, 18S RNA was assessed simultaneously.

To determine if the increase in ENaC mRNA is accompanied by an increase in ENaC protein, cell lysates from glucocorticoid- and vehicle-treated H441 cells were immunoblotted with specific polyclonal antibodies raised against the rat ENaC-alpha and -gamma proteins (30). The results clearly demonstrate that there is a two- to threefold increase in ENaC-alpha protein after exposure to 100 nM dexamethasone for 24 h (Fig. 3). We were unable to detect ENaC-beta or -gamma protein in these cells using our antibody, which may relate to abundance of the protein or the affinity of the antibodies for the human protein.


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 3.   Effect of 100 nM Dex on ENaC-alpha protein in H441 cells. H441 cells were grown on solid supports and exposed to Dex or vehicle for 24 h, and protein expression was assessed by Western blot analysis. A specific band was detected in all lanes (A), and the results were quantitated by densitometry (B). *P < 0.001; n = 3. Data are means ± SE.

The finding that all three ENaC subunits are regulated by glucocorticoids in H441 cells prompted us to examine ENaC mRNA expression in A549 cells. Recently, Lazrak et al. (26, 27) reported that A549 cells, a human type II alveolar epithelial cell line, have glucocorticoid-stimulated amiloride-inhibitable Na+ transport with regulated expression of some ENaC subunits. Our results show that all three subunits are not detectable by RPA under basal conditions but are induced by stimulation with 100 nM dexamethasone. Although ENaC-alpha mRNA is evident as early as 2 h after stimulation, ENaC-beta and -gamma expression was only evident at later time points (Fig. 4, A-C).


View larger version (53K):
[in this window]
[in a new window]
 
Fig. 4.   Effect of Dex on ENaC-alpha , -beta , and -gamma expression in A549 cells. A549 cells were grown on solid supports and exposed to Dex for various times, and ENaC-alpha (A), -beta (B), and -gamma (C) expression was assessed by RPA. As a control for RNA loading, 18S RNA was assessed simultaneously.

There is increasing evidence that sgk1 may be responsible, at least in part, for the corticosteroid-mediated increase in Na+ transport in amphibian, rabbit, and rat kidney (13, 34). The mRNA for sgk1 is rapidly induced by glucocorticoids and aldosterone, and coexpression of sgk1 with ENaC-alpha , -beta , and -gamma subunits in Xenopus oocytes leads to an increase in Na+ transport. This effect of sgk is achieved by increasing the number of ENaC channels assembled at the cell surface (16). The increase in sgk1 mRNA by glucocorticoids was first noted in rat mammary epithelia and has also been reported in the canine collecting duct and in some human epithelial cell lines (33, 35, 64), although, when first cloned, the human sgk1 (hsgk1) transcript did not appear to be regulated by glucocorticoids (58). Recently, two related transcripts, sgk2 and sgk3 have been cloned from human tissues, and these gene products also possess similar kinase activity (25). We first asked if any of the sgk isoforms were expressed in H441 cells. We were able to clone each of the hsgk isoforms by RT-PCR, confirming that all sgk isoforms are expressed in these cells (Fig. 5A). To examine their regulation, we measured steady-state levels of hsgk transcripts by RPA in H441 cells. Our results clearly demonstrate that hsgk1 is increased by corticosteroid treatment, with a maximal effect seen at 1 h (Fig. 5B). Hsgk3 is not induced by corticosteroids (data not shown). In addition, hsgk2 was not identifiable by RPA in H441 cells, and its regulation was not examined further.


View larger version (52K):
[in this window]
[in a new window]
 
Fig. 5.   Human sgk (hsgk) isoforms in H441 cells. A: RT-PCR of H441 RNA identifies sgk1, sgk2, and sgk3 in H441 cells. B: representative RPA of hsgk1 expression in H441 cells after treatment with Dex for various time periods. As a control for RNA loading, 18S rRNA was assessed simultaneously.

We next asked if the effects of glucocorticoids on ENaC subunits and sgk1 in H441 cells were at a transcriptional level and if protein synthesis was required. We have previously shown that the glucocorticoid and mineralocorticoid effect on ENaC-alpha expression on human and canine ENaC-alpha expression was transcriptional (33, 44), so these experiments were restricted to ENaC-gamma and -beta and sgk1 transcripts. The effect of dexamethasone on ENaC-beta and -gamma and sgk1 expression was abolished by simultaneous treatment with actinomycin D, providing strong supportive evidence that glucocorticoids increase transcription of ENaC-beta and -gamma subunits (Fig. 6, A and B). Cycloheximide, a protein synthesis inhibitor, had no effect on basal levels of ENaC-beta and -gamma and appeared to augment dexamethasone-induced ENaC-gamma and -beta expression (Fig. 6, A and B), suggesting that a labile intermediary protein expressed in H441 cells may inhibit the glucocorticoid effects on these genes. In contrast to the results seen with ENaC-beta and -gamma , cycloheximide superinduced basal and corticosteroid-stimulated sgk1 mRNA expression (Fig. 6C).


View larger version (41K):
[in this window]
[in a new window]
 
Fig. 6.   Effect of actinomycin D and cycloheximide on Dex-stimulated ENaC-gamma and -beta and sgk1 expression in H441 cells. Actinomycin D (Act) or cycloheximide (Chx) was added simultaneously with vehicle or Dex to H441 cells for 24 h, and mRNA levels were measured by RPA. Act abolishes Dex-stimulated ENaC-gamma (A) and -beta (B) and sgk1 (C) expression. Chx appears to enhance Dex-stimulated ENaC-gamma (A) and -beta (B), and sgk1 (C) expression and can stimulate sgk1 independently of Dex.

Because hsgk1 was transcriptionally regulated by glucocorticoids in one human epithelial cell line, we asked if other human epithelial cells would also show similar regulation. We evaluated hsgk1 expression by RPA in A549 cells and in a human embryonic kidney cell line (HEK-293). Hsgk1 was rapidly increased by dexamethasone in A549 cells but not in HEK-293 cells (Fig. 7, A and B). To further explore the differential glucocorticoid response in these cell lines, we expressed a luciferase-coupled human ENaC-alpha promoter-enhancer in A549 cells. This promoter-enhancer construct contains the functional GRE of the human ENaC-alpha gene (44), and the data show that reporter gene activity was robustly stimulated by dexamethasone in A549 cells (Fig. 7C). This response was predictable, since the human ENaC-alpha transcript, at least in our studies, is induced by dexamethasone (Fig. 4A). Consistent with our previous studies, a targeted mutation of the ENaC-alpha GRE abolished the dexamethasone response, confirming that the GRE in the ENaC-alpha gene is necessary and sufficient for glucocorticoids to stimulate ENaC-alpha transcription in A549 cells. The inability of glucocorticoids to stimulate hsgk1 expression in HEK-293 cells is not because of the absence of a functional glucocorticoid receptor (GR), since the plasmid TAT3-luc is fully responsive to glucocorticoids and likely indicates that unidentified cofactors may modulate glucocorticoid regulation of sgk in specific epithelia.


View larger version (41K):
[in this window]
[in a new window]
 
Fig. 7.   Glucocorticoid regulation of hsgk1 expression and gene transcription in A549 and human embryonic kidney (HEK)-293 cells. Representative RPA of hsgk1 expression in A549 (A) and HEK-293 (B) cells after treatment with Dex for various time periods. As a control for RNA loading, 18S rRNA was assessed simultaneously. Dex stimulates hsgk1 expression in A549 cells but not in HEK-293 cells. C: ENaC-alpha promoter-luciferase constructs [-487 +55 or -487 +55 glucocorticoid response element mutation (mutGRE)] were transfected into A549 cells and treated with Dex or vehicle for 24 h before assay. *P < 0.001 compared with control, Student's t-test; n = 4. Data are means ± SE. The results indicate that Dex stimulates ENaC-alpha gene transcription in A549 cells. D: TAT-3luc plasmid containing a glucocorticoid-responsive promoter-enhancer coupled to luciferase was transfected in HEK-293 cells and treated with Dex or vehicle for 24 h before assay. *P < 0.001 compared with control, Student's t-test; n = 4. The results indicate that HEK-293 cells contain a functional glucocorticoid receptor (GR) but do not support transcription of the sgk1 gene.

Given that all three ENaC subunits were regulated by corticosteroids, we hypothesized that the corticosteroid-stimulated Na+ transport in H441 cells occurred via a classic ENaC heteromultimeric complex. To determine the biophysical properties of H441 Na+ channels, glucocorticoid-stimulated cells grown on permeable supports were subjected to patch-clamp analysis at 37°C with Li+ in the pipette. All patches were made on the apical membrane in the cell-attached mode, and channels were rarely seen. When channels were occasionally identified, the single channel traces showed very long open and close times (several hundred milliseconds, usually), a well-known characteristic of ENaC channels. The open-channel current amplitude for various voltages was measured, and a current-voltage plot was generated (Fig. 8). Linear regression analysis of these points gives a slope conductance of 10.8 pS. Extrapolation of the conductance line indicates a very positive reversal potential indicative of an Na+-selective channel. These characteristics are indistinguishable from ENaC channels heterologously expressed in Xenopus oocytes (53).


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 8.   Single-channel recordings from cell-attached patches in H441 cells. A: traces on top were at a holding voltage of -60 mV. Channel openings are downward deflections, and there appeared to be only 1 channel in this patch. Note the long open and close times. B: current-voltage relationship of current recorded at each voltage. The slope conductance for this channel with Li+ in the pipette and measured at 37°C is 10.8 pS.

Another signaling pathway with direct effects on Na+ transport in airway epithelial cells involves the stimulation of cAMP, as occurs, for example, with epinephrine stimulation (38). To determine if the H441 cell is a model to study cAMP regulation of Na+ transport, we used forskolin, a direct activator of adenylyl cyclase, and IBMX, a phosphodiesterase inhibitor, to elevate intracellular cAMP levels. When grown on permeable supports, cAMP stimulation led to a substantial increase in Isc after 24 h in these cells (Fig. 9A). To confirm that the increase in current was the result of Na+ transport and not Cl- secretion, the effect of 10 µM benzamil on basal and stimulated Isc was examined. The results demonstrate that almost all of the current is benzamil-sensitive, thus excluding a significant contribution from Cl- secretion (Fig. 9A). To examine the effect of corticosteroids and cAMP stimulation together, the effect of these agents on Isc was measured. The results show that forskolin/IBMX stimulation further enhanced the effect of corticosteroids on Isc and that the effect appeared to be more than additive (Fig. 9B). Finally, we examined the time course of the forskolin/IBMX effect on Isc. cAMP stimulation on Isc was fairly rapid with an effect that was obvious within 5 min, and this Isc remained persistently elevated (Fig. 9C). When 10 µM benzamil was added to the apical surface, the current was completely abolished, thus confirming that almost all electrogenic ion transport could be accounted for by Na+ entry at the apical membrane.


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 9.   Effect of forskolin and IBMX on Isc in H441 cells. A: H441 cells were exposed to forskolin-IBMX or vehicle for 24 h, and then total and benzamil-sensitive Isc was measured. #P < 0.05 compared with control total Isc; *P < 0.0001 compared with control Isc, Student's t-test; n = 4. Data are means ± SE. Benzamil-sensitive current was not significantly different compared with total current in the presence of forskolin-IBMX. B: effect of forskolin and IBMX on vehicle- and Dex-treated H441 monolayers. Total Isc measured after 24 h shows that forskolin enhances the Dex effect on Isc, and this effect is more than additive. The Isc values for all groups were significantly different (P < 0.01; n = 3). The nonparametric Kruskal-Wallis test was used, since the variance between groups for Isc was different. C: short-term effect of forskolin-IBMX on H441 cells grown with 100 nM Dex. Electrical measurements were made with 145 mM NaHCO3 in the bath (n = 3).


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

In this paper, we report that glucocorticoids regulate the expression of ENaC-alpha , -beta , and -gamma , and sgk1 mRNA in two human lung cell lines. The H441 cell line, established from the pericardial fluid of a patient with papillary adenocarcinoma of the lung, expresses the Clara cell 10-kDa (CC-10) protein, the surfactant proteins-A, -B, and -D, and has the morphological characteristics of a bronchiolar epithelial cell line of Clara cell lineage (20, 39, 43, 50). We have recently reported that glucocorticoids stimulate amiloride-sensitive Na+ transport in this cell line and that this correlates with the regulated expression of ENaC-alpha (44), similar to that reported in primary cultures of fetal and adult rat lung epithelial cells (11, 15). We now report that glucocorticoids increase the expression of ENaC-beta and -gamma and sgk1 in this cell line. The A549 cell line, also established from a lung adenocarcinoma, displays characteristics that are more typical of alveolar type II cells, yet they do not express any of the surfactant genes (8, 47). Recently, the biophysical properties of Na+ channels and the expression profile of ENaC mRNA in A549 cells and their modulation by glucocorticoids were reported (26, 27). In this study, 24-48 h after stimulation with 1 µM dexamethasone the authors demonstrated a 17-fold increase in ENaC-gamma mRNA, a 1.6-fold increase in ENaC-beta mRNA, and no increase in ENaC-alpha mRNA by RT-PCR. To our knowledge, this is the first report of a lung epithelial cell where ENaC-alpha mRNA is not regulated by glucocorticoids. Our results are different and clearly show a substantial and early increase in ENaC-alpha mRNA in A549 cells when stimulated with 100 nM dexamethasone (Fig. 4A). This result is in agreement with studies done by others and us, demonstrating that the glucocorticoid-responsive enhancer of the human ENaC-alpha gene is functional in A549 cells (Fig. 7C and Ref. 62). The studies reported in this paper provide clear evidence that glucocorticoids regulate expression of all three subunits in these human lung epithelial cell lines. The reason for the apparent discrepancy from the previously published work is not clear but may result from dissimilar culture conditions and/or different methods for measurement of RNA levels.

The finding that all three ENaC subunits are regulated by glucocorticoids in these cell lines was, at first, a little surprising, since many investigators have reported that corticosteroids increase expression of ENaC-alpha but not -beta and -gamma mRNA in the fetal and mature rodent lung (48, 52). Developmental studies in the rat lung demonstrate that, although ENaC-alpha mRNA expression shows a dramatic increase at the time of birth, coinciding with the perinatal glucocorticoid surge, expression of ENaC-beta and -gamma mRNA is either not evident or increases modestly before birth (52, 63). Analysis of the available literature, however, suggests that developmental expression and glucocorticoid regulation of ENaC subunits may be different in the human lung and in derived epithelia. Human (21 wk gestation) fetal lung explants express ENaC-alpha , -beta , and -gamma mRNA in culture, and all three subunits are further regulated by glucocorticoids (55). Using specific polyclonal antisera against ENaC-beta and -gamma subunits, Gaillard et al. (18) recently demonstrated ENaC-beta and -gamma subunit protein expression as early as 17 wk of gestation in human bronchial and bronchiolar epithelium and by 30 wk of gestation in a pattern similar to adult airways. Further evidence that the fetal and perinatal regulation of ENaC expression is different in humans compared with rodents is the difference in lung phenotype between patients who have homozygous loss of function mutations in the ENaC-alpha subunit and mice in which the ENaC-alpha subunit has been inactivated. Although the human mutation causes severe renal disease, pseudohypoaldosteronism type 1 with salt wasting, hypotension, and hyperkalemia, the lung phenotype is milder, with a tendency to increased airway fluid and a chronic cough (12, 24, 45). By contrast, ENaC-alpha knockout mice die within a few hours of birth from inadequate lung liquid absorption (22).

Glucocorticoids increase the mRNA levels for ENaC-alpha , -beta and -gamma subunits and sgk1 in a cell- and tissue-specific fashion. An imperfect palindromic GRE in the 5'-flanking region of the human and rat ENaC-alpha gene is necessary and sufficient for glucocorticoid regulation of the ENaC-alpha subunit (28, 33, 40, 44). Similarly, a GRE in the 5'-flanking region of the rat sgk1 gene is required for steroid regulation of sgk1 (65). The temporal profile of expression of sgk1 and ENaC-alpha after glucocorticoid stimulation is quite different, with sgk1 transcript levels that peak within 1 h, although increases in ENaC-alpha mRNA levels are only evident by 2 h and then continue to increase for 24-48 h. These differences probably arise, in part, from complex regulation by additional transcription factors that modulate the rate of glucocorticoid-dependent transcription of individual genes and, in part, from differences in mRNA stability. Furthermore, all tissues that express GR do not show glucocorticoid regulation of ENaC-alpha and sgk1, indicating that cell-specific coactivators and/or repressors determine spatial expression of these genes. The lack of regulation of hsgk1 in the Hep G2 cell line, a cell line in which the GR is clearly expressed, was interpreted by Waldegger et al. (58) as indicating that the human sgk1 transcript, in contrast to amphibian and rodent sgk1, was not regulated by corticosteroids. In support of this hypothesis, the authors were unable to locate a GRE in the proximal 2.4 kb of the 5'-flanking region of the hgsk1 gene (59). Our studies with two human lung cell lines clearly indicate that hsgk1 is regulated by glucocorticoids, and, at least in the H441 cell line, this effect is transcriptional. These studies are in agreement with recently published studies demonstrating that sgk1 is a glucocorticoid-regulated transcript in several human cell lines (35). Our findings suggest that hsgk1 may be regulated by a GRE within the transcriptosome of the hsgk1 gene but that this element may be further 5' and flanking, 3' and flanking, or elsewhere within the gene.

Glucocorticoids also regulate ENaC-beta and -gamma mRNA levels in H441 and A549 cells, and, based on the ability of actinomycin D to abolish glucocorticoid-dependent expression, this effect is likely to be at the level of gene transcription. We have cloned and characterized the 5'-flanking region of human ENaC-gamma and -beta genes and have not yet identified a functional glucocorticoid-responsive enhancer (1, 54a). This could indicate that the glucocorticoid-dependent regulation of ENaC-beta and -gamma is not transcriptional, although it is more likely that the enhancer elements are located elsewhere in the genome. At the present time, we can only conclude that, although ENaC-alpha and sgk1 are regulated by GREs, the molecular basis for glucocorticoid regulation of ENaC-beta and -gamma remains unknown.

The biophysical properties of Na+ channels in alveolar and airway epithelial cells have been studied by single channel analysis. Several types of channels have been identified, including calcium-activated nonselective and Na+-selective cation channels and a calcium-insensitive Na+-selective channel (for review, see Ref. 31). The calcium-insensitive Na+ channel identified in rat FDLE cells has a conductance of 4.4 pS, is highly Na+ selective, and has long open and slow times very similar to the properties of ENaC-alpha , -beta , and -gamma reconstituted Na+ channels in Xenopus oocytes (10, 56). Na+-selective channels were also identified by patch-clamp analysis of A549 cells, where dexamethasone increased channel open time and open probability and altered channel conductance from 8.6 to 4.4 pS (26, 27). In this paper, we report that H441 cells express an Na+-selective channel with a conductance of 10.8 pS when measurements were performed at 37°C and Li+ was used as the charge carrier. The kinetic properties of the channel seen in H441 cells are very typical of ENaC channels. When heterologously expressed in Xenopus oocytes and when measurements were made at 22°C with Li+ in the pipette, the human ENaC subunits reconstitute an Na+-selective channel with a slope conductance of ~7 pS (53). We believe that these channels cannot be distinguished from the 4.4-pS channel seen in FDLE and corticosteroid-treated A549 cells (27, 56). The disparity in channel conductance between the H441 channel and those reported from Na+-selective channels in FDLE and A549 probably reflect differences in the temperature at which measurements were made and the use of Li+ rather than Na+ as the charge carrier (41, 42). Our results also suggest that the ENaC heteromultimer is the ion channel responsible for Na+ transport in H441 cells, at least under glucocorticoid-treated conditions. We are unable to comment on the properties of Na+ channels in H441 cells not stimulated with glucocorticoids, since these channels were very difficult to identify. Recently, Jain and colleagues (23) demonstrated that alveolar type II cell expression of a highly selective Na+ channel with ENaC-type properties was substantially enhanced when these cells were exposed to corticosteroids and grown on permeable supports in the presence of an air-liquid interface. The significance of the Ca2+-activated and nonselective cation channels that have been previously reported from a variety of lung epithelial cells is not entirely clear but could be attributed to the substrate on which the cells are grown, the culture conditions, and the patch configuration in those studies.

In addition to glucocorticoids, amiloride-inhibitable Na+ transport in airway epithelia can be regulated by arginine vasopressin and by catecholamines (6, 14, 21). Catecholamines and arginine vasopressin are thought to act via their second messenger cAMP, since their effects can be mimicked by membrane-permeant analogs of cAMP (5, 61). We use forskolin and IBMX to increase cAMP levels and show that amiloride-sensitive Na+ transport is increased in H441 cells. This increase is seen even in the absence of glucocorticoids, and, more importantly, cAMP stimulation potentiates the effect seen with glucocorticoids, suggesting that these agonists activate distinct pathways. In contrast to the effect of glucocorticoids on Na+ transport, which takes hours, the effect of forskolin/IBMX is seen within minutes and persists for at least 24 h, suggesting that posttranscriptional and transcriptional mechanisms are likely to play a part in this effect. In comparison, cAMP stimulation of the amiloride-sensitive Na+ current in fetal rat alveolar epithelial cells was seen at 8 h, the first time point reported, and there was no additive effect with glucocorticoids (15). The increase in Na+ transport seen with cAMP in these primary cultures correlated with an increase in ENaC-alpha mRNA expression, similar to results we have seen in H441 cells (data not shown). The H441 cell line thus appears to be a good model to study glucocorticoid- and cAMP-regulated Na+ transport mediated by ENaC.


    ACKNOWLEDGEMENTS

We thank Kang Liu for excellent technical support, Paul McCray for the gift of a human ENaC-beta cDNA clone, and David Pearce and Keith Yamamoto for the TAT3-luc cDNA clone and acknowledge the DNA synthesis and sequencing services provided by the University of Iowa DNA core facility.


    FOOTNOTES

Portions of the work submitted here were presented in abstract form at the American Thoracic Society meeting in 2000.

This work was supported in part by March of Dimes Birth Defects Foundation Research Grant 6-FY99-444, National Institute of Diabetes and Digestive and Kidney Diseases Grants DK-54348 and DK-52617, by a grant from the Department of Veteran's Affairs, and by a Career Investigator Award from the American Lung Association to C. P. Thomas.

Address for reprint requests and other correspondence: C. P. Thomas, Dept. of Internal Medicine, E300 GH, Univ. of Iowa, 200 Hawkins Dr., Iowa City, IA 52242 (E-mail: christie-thomas{at}uiowa.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

10.1152/ajplung.00085.2001

Received 7 March 2001; accepted in final form 10 October 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Auerbach, SD, Loftus RW, Itani OA, and Thomas CP. The human amiloride-sensitive epithelial sodium channel gamma subunit promoter: functional analysis and identification of a polypurine-polypyrimidine tract with the potential for triplex DNA formation. Biochem J 347: 105-114, 2000.

2.   Avruch, J, and Wallach DF. Preparation and properties of plasma membrane and endoplasmic reticulum fragments from isolated rat fat cells. Biochim Biophys Acta 233: 334-347, 1971.

3.   Barbry, P, and Hofman P. Molecular biology of Na+ absorption. Am J Physiol Gastrointest Liver Physiol 273: G571-G585, 1997.

4.   Barker, PM, Markiewicz M, Parker KA, Walters DV, and Strang LB. Synergistic action of triiodothyronine and hydrocortisone on epinephrine-induced reabsorption of fetal lung liquid. Pediatr Res 27: 588-591, 1990.

5.   Berthiaume, Y. Effect of exogenous cAMP and aminophylline on alveolar and lung liquid clearance in anesthetized sheep. J Appl Physiol 70: 2490-2497, 1991.

6.   Berthiaume, Y, Staub N, and Mathay M. Beta-adrenergic agonists increase lung liquid clearance in anesthetized sheep. J Clin Invest 79: 335-343, 1987.

7.   Bland, R, and Nielson D. Developmental changes in lung epithelial ion transport and liquid movement. Annu Rev Physiol 54: 373-394, 1992.

8.   Braun, H, and Suske G. Combinatorial action of HNF3 and Sp family transcription factors in the activation of the rabbit uteroglobin/CC10 promoter. J Biol Chem 273: 9821-9828, 1998.

9.   Brennan, FE, and Fuller PJ. Rapid upregulation of serum and glucocorticoid-regulated kinase (sgk) gene expression by corticosteroids in vivo. Mol Cell Endocrinol 166: 129-136, 2000.

10.   Canessa, CM, Schild L, Buell G, Thorens B, Gautschi I, Horisberger JD, and Rossier BC. Amiloride-sensitive epithelial Na+ channel is made of three homologous subunits. Nature 367: 463-467, 1994.

11.   Champigny, G, Voilley N, Lingueglia E, Friend V, Barbry P, and Lazdunski M. Regulation of expression of the lung amiloride-sensitive Na+ channel by steroid hormones. EMBO J 13: 2177-2181, 1994.

12.   Chang, SS, Grunder S, Hanukoglu A, Rosler A, Mather PM, Hanukoglu I, Schild L, Lu Y, Shimkets RA, Nelson-Williams C, Rossier BC, and Lifton RP. Mutations in subunits of the epithelial sodium channel cause salt wasting with hyperkalemic acidosis, pseudohypoaldosteronism type 1. Nat Genet 12: 248-253, 1996.

13.   Chen, SY, Bhargava A, Mastroberardino L, Meijer OC, Wang J, Buse P, Firestone GL, Verrey F, and Pearce D. Epithelial sodium channel regulated by aldosterone-induced protein sgk. Proc Natl Acad Sci USA 96: 2514-2519, 1999.

14.   Crandall, E, Heming T, Palombo R, and Goodman B. Effect of terbutaline on sodium transport in isolated perfused rat lung. J Appl Physiol 60: 289-294, 1986.

15.   Dagenais, A, Denis C, Vives MF, Girouard S, Masse C, Nguyen T, Yamagata T, Grygorczyk C, Kothary R, and Berthiaume Y. Modulation of alpha-ENaC and alpha1-Na+-K+-ATPase by cAMP and dexamethasone in alveolar epithelial cells. Am J Physiol Lung Cell Mol Physiol 281: L217-L230, 2001.

16.   De La Rosa, DA, Zhang P, Naray-Fejes-Toth A, Fejes-Toth G, and Canessa CM. The serum and glucocorticoid kinase sgk increases the abundance of epithelial sodium channels in the plasma membrane of Xenopus oocytes. J Biol Chem 274: 37834-37839, 1999.

17.   Folkesson, HG, Norlin A, Wang Y, Abedinpour P, and Matthay MA. Dexamethasone and thyroid hormone pretreatment upregulate alveolar epithelial fluid clearance in adult rats. J Appl Physiol 88: 416-424, 2000.

18.   Gaillard, D, Hinnrasky J, Coscoy S, Hofman P, Matthay MA, Puchelle E, and Barbry P. Early expression of beta - and gamma -subunits of epithelial sodium channel during human airway development. Am J Physiol Lung Cell Mol Physiol 278: L177-L184, 2000.

19.   Garty, H, and Palmer LG. Epithelial sodium channels: function and regulation. Physiol Rev 77: 359-396, 1997.

20.   George, TN, Miakotina OL, Goss KL, and Snyder JM. Mechanism of all trans-retinoic acid and glucocorticoid regulation of surfactant protein mRNA. Am J Physiol Lung Cell Mol Physiol 274: L560-L566, 1998.

21.   Hooper, SB, Wallace MJ, and Harding R. Amiloride blocks the inhibition of fetal lung liquid secretion caused by AVP but not by asphyxia. J Appl Physiol 74: 111-115, 1993.

22.   Hummler, E, Barker P, Gatzy J, Beermann F, Verdumo C, Schmidt A, Boucher R, and Rossier BC. Early death due to defective neonatal lung liquid clearance in alpha ENaC-deficient mice. Nat Genet 12: 325-328, 1996.

23.   Jain, L, Chen XJ, Ramosevac S, Brown LA, and Eaton DC. Expression of highly selective sodium channels in alveolar type II cells is determined by culture conditions. Am J Physiol Lung Cell Mol Physiol 280: L646-L658, 2001.

24.   Kerem, E, Bistritzer T, Hanukoglu A, Hofman T, Zhou Z, Bennett W, MacLaughlin E, Barker P, Nash M, Quittell L, Boucher R, and Knowles MR. Pulmonary epithelial sodium-channel dysfunction and excess airway liquid in pseudohypoaldosteronism. N Engl J Med 341: 156-162, 1999.

25.   Kobayashi, T, Deak M, Morrice N, and Cohen P. Characterization of the structure and regulation of two novel isoforms of serum- and glucocorticoid-induced protein kinase. Biochem J 344: 189-197, 1999.

26.   Lazrak, A, Samanta A, and Matalon S. Biophysical properties and molecular characterization of amiloride-sensitive sodium channels in A549 cells. Am J Physiol Lung Cell Mol Physiol 278: L848-L857, 2000.

27.   Lazrak, A, Samanta A, Venetsanou K, Barbry P, and Matalon S. Modification of biophysical properties of lung epithelial Na+ channels by dexamethasone. Am J Physiol Cell Physiol 279: C762-C770, 2000.

28.   Lin, HH, Zentner MD, Ho HLL, Kim KJ, and Ann DK. The gene expression of the amiloride-sensitive epithelial sodium channel alpha -subunit is regulated by antagonistic effects between glucocorticoid hormone and ras pathways in salivary epithelial cells. J Biol Chem 274: 21544-21554, 1999.

29.   Liu, W, Wang J, Sauter N, and Pearce D. Steroid receptor heterodimerization demonstrated in vitro and in vivo. Proc Natl Acad Sci USA 92: 12480-12484, 1995.

30.   Masilamani, S, Kim GH, Mitchell C, Wade JB, and Knepper MA. Aldosterone-mediated regulation of ENaC alpha, beta, and gamma subunit proteins in rat kidney. J Clin Invest 104: 19-23, 1999.

31.   Matalon, S, and O'Brodovich H. Sodium channels in alveolar epithelial cells: molecular characterization, biophysical properties and physiological significance. Annu Rev Physiol 61: 627-661, 1999.

32.   McNicholas, CM, and Canessa CM. Diversity of channels generated by different combinations of epithelial sodium channel subunits. J Gen Physiol 109: 681-692, 1997.

33.   Mick, VE, Itani OA, Loftus RW, Husted RF, Schmidt TJ, and Thomas CP. The alpha  subunit of the epithelial sodium channel is an aldosterone-induced transcript in mammalian collecting ducts, and this transcriptional response is mediated via distinct cis-elements in the 5' flanking region of the gene. Mol Endocrinol 15: 575-588, 2001.

34.   Naray-Fejes-Toth, A, Canessa C, Cleaveland ES, Aldrich G, and Fejes-Toth G. sgk is an aldosterone-induced kinase in the renal collecting duct. J Biol Chem 274: 16973-16978, 1999.

35.   Naray-Fejes-Toth, A, Fejes-Toth G, Volk KA, and Stokes JB. SGK is a primary glucocorticoid-induced gene in the human. J Steroid Biochem Mol Biol 75: 51-56, 2000.

36.   O'Brodovich, H. Epithelial ion transport in the fetal and perinatal lung. Am J Physiol Lung Cell Mol Physiol 261: L555-L564, 1991.

37.   O'Brodovich, HM. Immature epithelial Na+ expression is one of the pathogenetic mechanisms leading to human neonatal respiratory distress syndrome. Proc Assoc Am Phys 108: 345-355, 1996.

38.   Olver, R, Ramsden C, Strang L, and Walters D. The role of amiloride-blockable sodium transport in adrenaline-induced lung liquid reabsorption in the fetal lamb. J Physiol (Lond) 376: 321-340, 1986.

39.   O'Reilly, M, Gazdar A, Morris R, and Whitsett J. Differential effects of glucocorticoid on expression of surfactant proteins in a human lung adenocarcinoma cell line. Biochim Biophys Acta 970: 194-204, 1988.

40.   Otulakowski, G, Rafii B, Bremner HR, and O'Brodovich H. Structure and hormone responsiveness of the gene encoding the alpha-subunit of the rat amiloride-sensitive epithelial sodium channel. Am J Respir Cell Mol Biol 20: 1028-1040, 1999.

41.   Palmer, LG. Epithelial Na+ channels: function and diversity. Annu Rev Physiol 54: 51-66, 1992.

42.   Palmer, LG, and Frindt G. Conductance and gating of epithelial Na+ channels from rat cortical collecting tubule. Effects of luminal Na+ and Li+. J Gen Physiol 1: 121-138, 1988.

43.   Rust, K, Bingle L, MW, Persson A, and Crouch E. Characterization of the human surfactant protein D promoter: transcriptional regulation of SP-D gene expression by glucocorticoids. Am J Respir Cell Mol Biol 14: 121-130, 1996.

44.   Sayegh, R, Auerbach SD, Li X, Loftus R, Husted R, Stokes JB, and Thomas CP. Glucocorticoid induction of epithelial sodium channel expression in lung and renal epithelia occurs via trans-activation of a hormone response element in the 5' flanking region of the human epithelial sodium channel alpha  subunit gene. J Biol Chem 274: 12431-12437, 1999.

45.   Schaedel, C, Marthinsen L, Kristoffersson AC, Kornfalt R, Nilsson KO, Orlenius B, and Holmberg L. Lung symptoms in pseudohypoaldosteronism type 1 are associated with deficiency of the alpha -subunit of the epithelial sodium channel. J Pediatr 135: 739-745, 1999.

46.   Shigaev, A, Asher C, Latter H, Garty H, and Reuveny E. Regulation of sgk by aldosterone and its effects on the epithelial Na+ channel. Am J Physiol Renal Physiol 278: F613-F619, 2000.

47.   Smith, B. Cell line A549: a model system for the study of alveolar type II cell function. Am Rev Respir Dis 115: 285-293, 1977.

48.   Stokes, JB, and Sigmund RD. Regulation of rENaC mRNA by dietary NaCl and steroids: organ, tissue and steroid heterogeneity. Am J Physiol Cell Physiol 274: C1699-C1707, 1998.

49.   Strang, LB. Fetal lung liquid: secretion and reabsorption. Physiol Rev 71: 991-1016, 1991.

50.   Suske, G, Lorenz W, Klug J, Gazdar A, and Beato M. Elements of the rabbit uteroglobin promoter mediating its transcription in epithelial cells from the endometrium and lung. Gene Expr 2: 339-352, 1992.

51.   Talbot, CL, Bosworth DG, Briley EL, Fenstermacher DA, Boucher RC, Gabriel SE, and Barker PM. Quantitation and localization of ENaC subunit expression in fetal, newborn, and adult mouse lung. Am J Respir Cell Mol Biol 20: 398-406, 1999.

52.   Tchepichev, S, Ueda J, Canessa CM, Rossier BC, and O'Brodovich HM. The lung epithelial Na+ channel subunits are differentially regulated during development and by steroids. Am J Physiol Cell Physiol 269: C805-C812, 1995.

53.   Thomas, CP, Auerbach SD, Stokes JB, and Volk KA. 5' Heterogeneity in amiloride-sensitive epithelial sodium channel alpha subunit mRNA leads to distinct NH2-terminal variant proteins. Am J Physiol Cell Physiol 274: C1312-C1323, 1998.

54.   Thomas, CP, Doggett NA, Fisher R, and Stokes JB. Genomic organization and the 5' flanking region of the gamma subunit of the human amiloride-sensitive epithelial sodium channel. J Biol Chem 271: 26062-26066, 1996.

54a.  Thomas CP, Loftus RW, Liu KZ, and Itani OA. Genomic organization of the 5' end of human ENaC-beta and preliminary characterization of its promoter. Am J Physiol Renal Physiol. In press.

55.   Venkatesh, VC, and Katzberg HD. Glucocorticoid regulation of epithelial sodium channel genes in human fetal lung. Am J Physiol Lung Cell Mol Physiol 273: L227-L233, 1997.

56.   Voilley, N, Lingueglia E, Champigny G, Mattei MG, Waldmann R, Lazdunski M, and Barbry P. The lung amiloride-sensitve Na+ channel: biophysical properties, pharmacology, ontogenesis, and molecular cloning. Proc Natl Acad Sci USA 91: 247-251, 1994.

57.   Volk, KA, Sigmund RD, Snyder PM, McDonald FJ, Welsh MJ, and Stokes JB. rENaC is the predominant Na+ channel in the apical membrane of the rat renal inner medullary collecting duct. J Clin Invest 96: 2748-2757, 1995.

58.   Waldegger, S, Barth P, Raber G, and Lang F. Cloning and characterization of a putative human serine/threonine protein kinase transcriptionally modified during anisotonic and isotonic alterations of cell volume. Proc Natl Acad Sci USA 94: 4440-4445, 1997.

59.   Waldegger, S, Erdel M, Nagl UO, Barth P, Raber G, Steuer S, Utermann G, Paulmichl M, and Lang F. Genomic organization and chromosomal localization of the human SGK protein kinase gene. Genomics 51: 299-302, 1998.

60.   Wallace, MJ, Hooper SB, and Harding R. Effects of elevated fetal cortisol concentrations on the volume, secretion, and reabsorption of lung liquid. Am J Physiol Regulatory Integrative Comp Physiol 269: R881-R887, 1995.

61.   Walters, DV, Ramsden CA, and Olver RE. Dibutyryl cAMP induces a gestation-dependent absorption of fetal lung liquid. J Appl Physiol 68: 2054-2059, 1990.

62.   Wang, HC, Zentner MD, Deng HT, Kim KJ, Wu R, Yang PC, and Ann DK. Oxidative stress disrupts glucocorticoid hormone-dependent transcription of the amiloride-sensitive epithelial sodium channel alpha-subunit in lung epithelial cells through ERK-dependent and thioredoxin-sensitive pathways. J Biol Chem 275: 8600-8609, 2000.

63.   Watanabe, S, Matsushita K, Stokes J, and McCray P. Developmental regulation of epithelial sodium channel subunit mRNA expression in rat colon and lung. Am J Physiol Gastrointest Liver Physiol 275: G1227-G1235, 1998.

64.   Webster, MK, Goya L, and Firestone GL. Immediate-early transcriptional regulation and rapid mRNA turnover of a putative serine/threonine protein kinase. J Biol Chem 268: 11482-11485, 1993.

65.   Webster, MK, Goya L, Ge Y, Maiyar AC, and Firestone GL. Characterization of sgk, a novel member of the serine/threonine protein kinase gene family which is transcriptionally induced by glucocorticoids and serum. Mol Cell Biol 13: 2031-2040, 1993.


Am J Physiol Lung Cell Mol Physiol 282(4):L631-L641



This article has been cited by other articles:


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
N. M. Jesse, J. McCartney, X. Feng, E. M. Richards, C. E. Wood, and M. Keller-Wood
Expression of ENaC subunits, chloride channels, and aquaporins in ovine fetal lung: ontogeny of expression and effects of altered fetal cortisol concentrations
Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2009; 297(2): R453 - R461.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
H.-G. Nie, L. Chen, D.-Y. Han, J. Li, W.-F. Song, S.-P. Wei, X.-H. Fang, X. Gu, S. Matalon, and H.-L. Ji
Regulation of epithelial sodium channels by cGMP/PKGII
J. Physiol., June 1, 2009; 587(11): 2663 - 2676.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
H.-G. Nie, T. Tucker, X.-F. Su, T. Na, J.-B. Peng, P. R. Smith, S. Idell, and H.-L. Ji
Expression and Regulation of Epithelial Na+ Channels by Nucleotides in Pleural Mesothelial Cells
Am. J. Respir. Cell Mol. Biol., May 1, 2009; 40(5): 543 - 554.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
M. M. Vasquez, S. B. Mustafa, A. Choudary, S. R. Seidner, and R. Castro
Regulation of Epithelial Na+ Channel (ENaC) in the Salivary Cell Line SMG-C6
Experimental Biology and Medicine, May 1, 2009; 234(5): 522 - 531.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
H. Sheng, T. Sun, B. Cong, P. He, Y. Zhang, J. Yan, C. Lu, and X. Ni
Corticotropin-releasing hormone stimulates SGK-1 kinase expression in cultured hippocampal neurons via CRH-R1
Am J Physiol Endocrinol Metab, October 1, 2008; 295(4): E938 - E946.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
V. Shlyonsky, A. Goolaerts, F. Mies, and R. Naeije
Electrophysiological Characterization of Rat Type II Pneumocytes in Situ
Am. J. Respir. Cell Mol. Biol., July 1, 2008; 39(1): 36 - 44.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
G. Otulakowski, W. Duan, S. Gandhi, and H. O'Brodovich
Steroid and Oxygen Effects on eIF4F Complex, mTOR, and ENaC Translation in Fetal Lung Epithelia
Am. J. Respir. Cell Mol. Biol., October 1, 2007; 37(4): 457 - 466.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
R. F. Husted, K. A. Volk, R. D. Sigmund, and J. B. Stokes
Discordant effects of corticosteroids and expression of subunits on ENaC activity
Am J Physiol Renal Physiol, September 1, 2007; 293(3): F813 - F820.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
M. M. Myerburg, J. D. Latoche, E. E. McKenna, L. P. Stabile, J. S. Siegfried, C. A. Feghali-Bostwick, and J. M. Pilewski
Hepatocyte growth factor and other fibroblast secretions modulate the phenotype of human bronchial epithelial cells
Am J Physiol Lung Cell Mol Physiol, June 1, 2007; 292(6): L1352 - L1360.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
R. R. Quesnell, X. Han, and B. D. Schultz
Glucocorticoids stimulate ENaC upregulation in bovine mammary epithelium
Am J Physiol Cell Physiol, May 1, 2007; 292(5): C1739 - C1745.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
A. Dagenais, R. Frechette, M.-E. Clermont, C. Masse, A. Prive, E. Brochiero, and Y. Berthiaume
Dexamethasone inhibits the action of TNF on ENaC expression and activity
Am J Physiol Lung Cell Mol Physiol, December 1, 2006; 291(6): L1220 - L1231.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
F. Lang, C. Bohmer, M. Palmada, G. Seebohm, N. Strutz-Seebohm, and V. Vallon
(Patho)physiological Significance of the Serum- and Glucocorticoid-Inducible Kinase Isoforms.
Physiol Rev, October 1, 2006; 86(4): 1151 - 1178.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
G. Otulakowski, B. Rafii, M. Harris, and H. O'Brodovich
Oxygen and Glucocorticoids Modulate {alpha}ENaC mRNA Translation in Fetal Distal Lung Epithelium
Am. J. Respir. Cell Mol. Biol., February 1, 2006; 34(2): 204 - 212.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
S. R. Pondugula, N. N. Raveendran, Z. Ergonul, Y. Deng, J. Chen, J. D. Sanneman, L. G. Palmer, and D. C. Marcus
Glucocorticoid regulation of genes in the amiloride-sensitive sodium transport pathway by semicircular canal duct epithelium of neonatal rat
Physiol Genomics, January 12, 2006; 24(2): 114 - 123.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
M. Quinkler, I. J. Bujalska, K. Kaur, C. U. Onyimba, S. Buhner, B. Allolio, S. V. Hughes, M. Hewison, and P. M. Stewart
Androgen Receptor-Mediated Regulation of the {alpha}-Subunit of the Epithelial Sodium Channel in Human Kidney
Hypertension, October 1, 2005; 46(4): 787 - 798.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
C. P. Thomas, J. R. Campbell, P. J. Wright, and R. F. Husted
cAMP-stimulated Na+ transport in H441 distal lung epithelial cells: role of PKA, phosphatidylinositol 3-kinase, and sgk1
Am J Physiol Lung Cell Mol Physiol, October 1, 2004; 287(4): L843 - L851.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
C. P. Thomas, R. W. Loftus, and K. Z. Liu
AVP-induced VIT32 gene expression in collecting duct cells occurs via trans-activation of a CRE in the 5'-flanking region of the VIT32 gene
Am J Physiol Renal Physiol, September 1, 2004; 287(3): F460 - F468.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. J. Ramminger, K. Richard, S. K. Inglis, S. C. Land, R. E. Olver, and S. M. Wilson
A regulated apical Na+ conductance in dexamethasone-treated H441 airway epithelial cells
Am J Physiol Lung Cell Mol Physiol, August 1, 2004; 287(2): L411 - L419.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
M. T. Clunes, A. G. Butt, and S. M. Wilson
A glucocorticoid-induced Na+ conductance in human airway epithelial cells identified by perforated patch recording
J. Physiol., June 15, 2004; 557(3): 809 - 819.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
T. J. Cole, N. M. Solomon, R. Van Driel, J. A. Monk, D. Bird, S. J. Richardson, R. J. Dilley, and S. B. Hooper
Altered Epithelial Cell Proportions in the Fetal Lung of Glucocorticoid Receptor Null Mice
Am. J. Respir. Cell Mol. Biol., May 1, 2004; 30(5): 613 - 619.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. B. Mustafa, R. J. DiGeronimo, J. A. Petershack, J. L. Alcorn, and S. R. Seidner
Postnatal glucocorticoids induce {alpha}-ENaC formation and regulate glucocorticoid receptors in the preterm rabbit lung
Am J Physiol Lung Cell Mol Physiol, January 1, 2004; 286(1): L73 - L80.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
B. C. Willis, K.-J. Kim, X. Li, J. Liebler, E. D. Crandall, and Z. Borok
Modulation of ion conductance and active transport by TGF-{beta}1 in alveolar epithelial cell monolayers
Am J Physiol Lung Cell Mol Physiol, December 1, 2003; 285(6): L1192 - L1200.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
O. A. Weisz and J. P. Johnson
Noncoordinate regulation of ENaC: paradigm lost?
Am J Physiol Renal Physiol, November 1, 2003; 285(5): F833 - F842.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
O. A. Itani, J. R. Campbell, J. Herrero, P. M. Snyder, and C. P. Thomas
Alternate promoters and variable splicing lead to hNedd4-2 isoforms with a C2 domain and varying number of WW domains
Am J Physiol Renal Physiol, November 1, 2003; 285(5): F916 - F929.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
O. A. Itani, K. L. Cornish, K. Z. Liu, and C. P. Thomas
Cycloheximide increases glucocorticoid-stimulated alpha -ENaC mRNA in collecting duct cells by p38 MAPK-dependent pathway
Am J Physiol Renal Physiol, April 1, 2003; 284(4): F778 - F787.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
S. Jovanovic, R. M. Crawford, H. J. Ranki, and A. Jovanovic
Large Conductance Ca2+-Activated K+ Channels Sense Acute Changes in Oxygen Tension in Alveolar Epithelial Cells
Am. J. Respir. Cell Mol. Biol., March 1, 2003; 28(3): 363 - 372.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
U. H. Thome, I. C. Davis, S. V. Nguyen, B. J. Shelton, and S. Matalon
Modulation of sodium transport in fetal alveolar epithelial cells by oxygen and corticosterone
Am J Physiol Lung Cell Mol Physiol, February 1, 2003; 284(2): L376 - L385.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
O. A. Itani, K. Z. Liu, K. L. Cornish, J. R. Campbell, and C. P. Thomas
Glucocorticoids stimulate human sgk1 gene expression by activation of a GRE in its 5'-flanking region
Am J Physiol Endocrinol Metab, November 1, 2002; 283(5): E971 - E979.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
M. A. Matthay
Editorial: Alveolar Epithelial Ion and Fluid Transport: Regulation of ion and fluid transport across the distal pulmonary epithelia: new insights
Am J Physiol Lung Cell Mol Physiol, April 1, 2002; 282(4): L595 - L598.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/4/L631    most recent
00085.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (39)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Itani, O. A.
Right arrow Articles by Thomas, C. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Itani, O. A.
Right arrow Articles by Thomas, C. P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online