AJP - Lung Add DOIs to your references at manuscript stage!
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 282: L719-L726, 2002. First published October 26, 2001; doi:10.1152/ajplung.00058.2001
1040-0605/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/4/L719    most recent
00058.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (41)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bowler, R. P.
Right arrow Articles by Crapo, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bowler, R. P.
Right arrow Articles by Crapo, J. D.
Vol. 282, Issue 4, L719-L726, April 2002

Role of extracellular superoxide dismutase in bleomycin-induced pulmonary fibrosis

Russell P. Bowler, Mike Nicks, Karrie Warnick, and James D. Crapo

Department of Medicine, National Jewish Medical and Research Center, Denver, Colorado, 80206


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Bleomycin administration results in well-described intracellular oxidative stress that can lead to pulmonary fibrosis. The role of alveolar interstitial antioxidants in this model is unknown. Extracellular superoxide dismutase (EC-SOD) is the primary endogenous extracellular antioxidant enzyme and is abundant in the lung. We hypothesized that EC-SOD plays an important role in attenuating bleomycin-induced lung injury. Two weeks after intratracheal bleomycin administration, we found that wild-type mice induced a 106 ± 25% increase in lung EC-SOD. Immunohistochemical staining revealed that a large increase in EC-SOD occurred in injured lung. Using mice that overexpress EC-SOD specifically in the lung, we found a 53 ± 14% reduction in bleomycin-induced lung injury assessed histologically and a 17 ± 6% reduction in lung collagen content 2 wk after bleomycin administration. We conclude that EC-SOD plays an important role in reducing the magnitude of lung injury from extracellular free radicals after bleomycin administration.

antioxidant; transgenic mouse; immunohistochemistry


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

BLEOMYCIN ADMINISTRATION RESULTS in increased reactive oxygen species (ROS) that can cause severe organ injury. Pulmonary injury in response to systemic bleomycin treatment is thought to be prominent because of diminished bleomycin inactivating enzymes in the lungs (29). Bleomycin complexes with iron to generate ROS that damage proteins, lipids, and DNA (4, 18). Although intracellular ROS are prominent after bleomycin administration (17), extracellular ROS may also be important mediators of lung injury because bleomycin binds to plasma membranes (33) and is found in the extracellular space several hours after administration (9).

There are several lines of evidence that implicate superoxide as one of the ROS that mediate lung injury. First, bleomycin intercalates with DNA to cause strand breakage via oxygen free radicals (18). Second, cytosolic superoxide dismutase (SOD) can attenuate DNA breakage in vitro (14). Third, bleomycin induces cytosolic SOD activity in the lung (11, 15) and specifically in type II alveolar cells (19). However, additional lines of evidence implicate extracellular superoxide as another source of oxidant stress created by bleomycin. First, plasma levels are detectable several days after bleomycin administration (9). Second, bleomycin does not readily cross the plasma membrane but binds to cell surfaces before being endocytosed (8, 33). Third, bleomycin increases lung leukocytes that subsequently release high levels of extracellular superoxide (39). Fourth, parenterally administered cytosolic SOD, which essentially functions as an extracellular superoxide dismutase (EC-SOD), inhibits bleomycin-induced pulmonary fibrosis (20, 31, 43). Thus many in vitro studies directly implicate intracellular superoxide as mediating bleomycin-induced injury, but the evidence implicating extracellular superoxide is only indirect.

SOD enzymes are the primary defense against excess superoxide. Mammals have three SOD enzymes: in the cytosol, SOD1 (28); in mitochondria, SOD2 (42); and in the extracellular space, SOD3 (24). Of the three known mammalian SODs, only the intracellular SODs have been studied in bleomycin lung injury; however, EC-SOD's unique extracellular location and its abundance in the lung suggest that it may play a major role in attenuating free radial injury in the lung after bleomycin administration.

In this present study, intratracheal bleomycin was used to test the hypothesis that bleomycin could induce lung EC-SOD, and immunohistochemistry was used to characterize the histological distribution of EC-SOD after bleomycin-induced lung injury. Furthermore, mice overexpressing human EC-SOD in the lung were used to test the hypothesis that high levels of EC-SOD could protect the lung from bleomycin-induced fibrosis.


    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Reagents. Enhanced chemiluminescence (ECL) +Plus Western blotting detection reagents were from Amersham Pharmacia Biotech (Piscataway, NJ). The protease inhibitors 3,4-dichloroisocoumarin, 1,10-phenanthroline (Boehringer Mannheim), and E-64 (ICN, Costa Mesa, CA) were kept in stock ethanol solution at -20°C. The Vectastain ABC Elite kit and biotinylated anti-rabbit IgG were from Vector Laboratories (Burlingame, CA). Bleomycin sulfate was from Mead Johnson Oncology Products. At a dose of 0.2 U/20 g mouse, this preparation was found to induce fibrosis without causing a significant mortality. All other reagents were from Sigma.

Bleomycin administration. C57/Bl6 mice overexpressing human EC-SOD using a surfactant protein C (SPC) promoter have been previously described (12). Bleomycin administration was performed on 4 separate days using multiple animals from each group. Transgene-positive (n = 58) or -negative (n = 56) littermates (average age 62 days) were anesthetized with halothane and then given intratracheal bleomycin sulfate 0.2 U/20 g. Control mice, either transgene negative (n = 14) or positive (n = 13), were given vehicle. Mice were weighed daily and given liberal access to food and water and then killed at the end of a fortnight. Lung volumes were calculated by displacement of water after being fixed for 30 min with 4% paraformaldehyde at 20 cmH2O pressure.

Histochemistry and immunohistochemistry. Half of the mice had their lungs inflated for 30 min with 4% paraformaldehyde at 20 cmH2O pressure and embedded in paraffin. Multiple 4-µm sections were made of each sample. They were then treated twice in Hemo-D for 7 min, twice in 100% ethanol for 5 min, twice in 90% ethanol for 5 min, and then placed in distilled H2O for 5 min. One section of each sample was used for hematoxylin and eosin (H&E), Masson's trichrome, or immunohistochemical staining. For immunohistochemistry, the samples were blocked overnight at 4°C in blocking buffer (25 mM Tris pH 7.5, 500 mM NaCl, 1% Tween 20, 10% fish gelatin, and 0.05% NaN3). The samples were then incubated with 20% glycerol in H2O for 30 min and washed with blocking buffer. The sections were incubated with 1/100 affinity purified rabbit polyclonal anti-EC-SOD IgG or 1/2,000 rabbit IgG in blocking buffer for 3 h at room temperature. The sections were washed in high-salt buffer (25 mM Tris pH 7.5, 500 mM NaCl, and 1% Tween 20) three times for 5 min. A biotinylated anti-rabbit IgG, at 1/500 in blocking buffer, was placed on the sections for 30 min at room temperature. The sections were washed one time with high-salt buffer then treated for 3-5 min in 3% H2O2 in water. The samples were then washed two times for 5 min in high-salt buffer without detergent. Vectastain ABC Elite and diaminobenzidine (Vector Laboratories) kit were used as described in the kit instructions. The sections were then stained for 3 min with 1% methyl green and washed with distilled H2O. The sections were then dehydrated twice in 90% ethanol for 5 min, twice in 100% ethanol for 7 min, and twice in Hemo-D for 7 min.

Histological scoring. H&E- and trichrome-stained slides were by scored independently by two investigators blinded to treatment group and genotype. A 10 × 10 square grid on the left ocular was superimposed over a portion of each histological section repeatedly so that all lung tissue was covered once and only once. Using a Nikon light microscope with a ×20 ocular and ×2 objective lens, we scored each square in the grid as 1 if fibrosis occupied at least 50% of the square and 0 otherwise. The percent fibrosis for each section was determined by adding the number of squares scored with a 1, divided by the number of the squares counted. An average of 549 squares were counted for each section scored.

Quantitation of EC-SOD mRNA. Mouse lung total RNA was isolated using an RNeasy MIDI kit (Qiagen) and then quantitated using a SmartSpec 3000 (Bio-Rad). A Cepheid SmartCycler was used with the following protocol: RETROscript kit (Ambion, Austin, Texas) was used to generate RT product using the manufacturer's protocol with a hot start; for mouse (mEC-SOD) PCR, 2 µl of RT product was added to 20 µl of water, 1 µl of EC-SOD forward primer (50 µM TTGTTCTACGGCTTGCTACTGGC), and 1 µl of reverse primer (50 µM ATTGCATGCATCTCGGCAGC), 1 µl of 0.05× SYBR green (Molecular Probes, Eugene, OR), and one Ready-To-Go PCR bead (Amersham Pharmacia Biotech); the resulting mix was brought to 94°C for 300 s and then cycled 50 times from 94°C for 30 s to 66°C for 30 s. For 18S PCR, an identical protocol was used except that primers were from QuantumRNA 18S internal standards (Ambion) and the 50 cycles were 94°C for 30 s, 60°C for 30 s, and 72°C for 30 s. The ratio of EC-SOD mRNA relative to 18S RNA internal standards was determined using Cepheid SmartCycler software (version 1.01). Total lung 18S RNA was determined using 1% of total RNA for agarose gel electrophoresis followed by ethidium bromide staining and then quantitation (Hitachi Genetic Systems). Total lung EC-SOD mRNA was determined by multiplying total 18S RNA by the ratio of EC-SOD mRNA to 18S RNA.

EC-SOD protein quantitation. The remaining mice had their lungs weighed and then ground in liquid nitrogen. Tissue was then resuspended in lysis buffer (25 mM Tris · Cl, pH 7.5; 500 NaCl; 5 mM EDTA; 0.5% Triton X-100), homogenized in a tissue shearer and then spun at low speed. The supernatant was assayed for protein concentration using a bicinchoninic acid protein assay (Pierce). Identical amounts of protein were boiled for 5 min in SDS sample buffer with 50 mM dithiothreitol and then run into a 12% acrylamide gel. The proteins were transferred to 0.22 µM nitrocellulose. A Western blot using either beta -actin (Sigma) or rabbit polyclonal alpha -EC-SOD antibody was quantitated using ECL +Plus and a Molecular Dynamics imaging system (Sunnyvale, CA).

Collagen assay. A complete description of this assay can be found in Lopez-De Leon and Rojkind (22). In brief, paraffin-embedded sections were soaked in Hemo-D to remove the paraffin. Samples were then placed in a (1:1) Hemo-D:ethanol mixture, then 100% ethanol, then 50% ethanol, then distilled water followed by 0.5 ml of sirius red and fast green FCF mixture in 0.1% picric acid. After 30 min, the solution was pulled off, and the samples washed three times in distilled water. Next, 0.25 ml of NaOH 0.1 N and 0.25 ml of methanol were added for one min. Samples were aspirated and absorbance measured at 540 and 605 nm using a 96-well plate reader. The amount of noncollagenous protein in milligram per sample was calculated by measuring the absorbency of the eluate at 605 nm divided by 2.22 (the lung fast green FCF color equivalence). The amount of collagenous protein was calculated by measuring the absorbance of the eluate at 540 nm, subtracting 29% of the absorbance at 605 nm, and then dividing by 36.3 (the sirius red color equivalence). The total amount of collagen per lung was calculated by multiplying the total protein of the lung with the ratio of collagenous protein to total protein.

Statistical analysis. All mice came from the same C57/Bl6 background. Wild-type animals were littermates of EC-SOD transgene-positive animals. A one-way analysis of variance (ANOVA) was used to determine if the means were significantly different (P < 0.05). If means were significantly different, a Tukey-Kramer multiple group comparison test was used to compare individual groups. Standard error was indicated for each value by a bar, and significance listed for each comparison. A chi 2-test was used to calculate P values for ratios. All values were calculated using GraphPad Prism version 3.00 for Macintosh (GraphPad Software, San Diego, CA).


    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Physiological changes in the lung after bleomycin treatment. Overall mortality was 4/141 (3%). The mortality for the bleomycin-treated mice was 2/56 (3%) for wild types and 2/58 (3%) for the EC-SOD transgenics. For the saline-treated mice, mortality was 0/14 (0%) in the wild types and 0/13 (0%) in the EC-SOD transgenics. Although bleomycin-treated wild-type mice lost 17.7 ± 2.6% of their body weight and the saline-treated wild-type mice gained 8.1 ± 1.4% of their body weight (P < 0.001 for saline vs. bleomycin treated), overexpression of EC-SOD did not significantly attenuate this weight loss [17.6 ± 3.9% decrease in wild-type vs. 18.3 ± 3.2% decrease in EC-SOD transgenic mice, P = not significant (NS); see Fig. 1].


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 1.   Lung edema is attenuated after bleomycin injury in mice overexpressing extracellular superoxide dismutase (EC-SOD) in the lungs. Lung edema, as assessed by the ratio of wet lung weight to dry lung weight, increased 2 wk after bleomycin treatment in both wild-type (**P < 0.001) and EC-SOD transgenic mice (dagger P < 0.001). The wet/dry lung weight ratio increased to a smaller extent in the EC-SOD transgenic mice compared with wild-type mice (*P < 0.05).

Lung fibrosis is characterized by restrictive physiology. After bleomycin-induced fibrosis, lung volumes decreased by 0.19 ± 0.04 ml in wild-type mice. The EC-SOD transgenic mice had less loss of lung volume (0.10 ± 0.08 ml), although this did not reach statistical significance. Because the most significant physiological abnormality of lung fibrosis is reduced lung volume, our results suggest that there may be a trend toward improved lung physiology in the bleomycin-treated EC-SOD transgenic mice compared with controls.

The lung wet/dry ratio was used to assess lung edema (Fig. 1). This ratio was significantly higher after bleomycin treatment in both the wild-type (4.3 ± 0.1 in the saline-treated mice vs. 6.2 ± 0.6 in the bleomycin-treated wild-type mice) and EC-SOD transgenic mouse lung (4.5 ± 0.2 in the saline-treated vs. 5.4 ± 0.2 in the bleomycin-treated). EC-SOD transgene expression led to a 52% reduction in the increase in lung edema as measured by the wet/dry ratio. Thus overexpression of EC-SOD in the lungs led to reduced lung edema but was not sufficient to cause a decrease in mortality or airway function.

EC-SOD increases after bleomycin treatment. Because bleomycin accumulates in the lung and EC-SOD is found in abundance in lung, we hypothesized that the oxidative stress from bleomycin would induce EC-SOD. To test this hypothesis, we measured both EC-SOD protein (Fig. 2A) and mRNA (Fig. 2B). After bleomycin administration, total lung mouse EC-SOD protein increased slowly over 2 wk. At the end of 2 wk, there was a 106 ± 25% increase in the wild-type mice (P < 0.05) and 115 ± 25% increase in EC-SOD transgenic mice. The increase in mouse EC-SOD was found even when the data were expressed per milligram protein, actin, or collagen. There was no increase in human EC-SOD in the EC-SOD transgenic mouse lungs. There was also a trend toward increased total lung mouse EC-SOD mRNA in the wild-type (increase of 65 ± 46% compared with control; P = 0,07) and EC-SOD transgenic mice (increase of 140 ± 76% compared with control; P = 0,08). This trend occurred mainly between days 10 and 14.


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 2.   Mouse lung EC-SOD protein increases before mRNA after bleomycin administration. After bleomycin administration, wild-type and EC-SOD transgenic mice were killed at 0 (control), 3, 7, 10, and 14 days. A: total lung mouse EC-SOD protein gradually increased after bleomycin. At the end of 2 wk there was a 109 ± 25% increase in total lung mouse EC-SOD protein. (*P < 0.05 compared with wild-type day 0; #P < 0.05, ##P < 0.01 compared with transgenic day 0.) B: total lung mouse EC-SOD mRNA increased, but the increase came later than with the protein. At the end of 2 wk, there was a 99 ± 45% increase in total lung mouse EC-SOD mRNA. (*P < 0.05 compared combined wild-type transgenic mice at day 14 compared with day 0.)

Prior work by our laboratory has revealed the EC-SOD is secreted in two different forms: one that is proteolytically processed and one that is not (10). The intracellular processing removes the carboxy terminus and decreases EC-SOD's affinity toward the extracellular matrix. To investigate whether bleomycin would change intracellular proteolytic processing, we used Western blotting to quantitate the ratio of EC-SOD that had been proteolytically processed to the EC-SOD that had not been proteolytically processed. Two weeks after bleomycin, the ratio remained unchanged (0.84 ± 0.02 vs. 0.85 ± 0.01, P = NS), suggesting that the number of cells secreting EC-SOD had increased or that the processing protease increased proportionately to the increase in EC-SOD secretion.

Lung collagen after bleomycin instillation. Bleomycin treatment increased collagen deposition in the wild-type lung (saline-treated 121 ± 33 µg vs. bleomycin-treated 277 ± 18 µg; P < 0.001; Fig. 3). Overexpression of EC-SOD still resulted in lung collagen accumulation (saline-treated EC-SOD transgenic mice 141 ± 17 µg vs. bleomycin-treated EC-SOD transgenic mice 228 ± 18 µg, P < 0.001); however, the lungs from bleomycin-treated EC-SOD transgenic mice had less collagen than the wild-type (P < 0.05). After bleomycin treatment, the EC-SOD transgenic mice also had a trend toward less total lung weight (EC-SOD transgenic 370 ± 21 mg vs. wild-type 399 ± 30 mg) and less collagen per protein (EC-SOD transgenic 35 ± 3 µg collagen/ mg protein vs. wild-type 41 ± 1.5 µg collagen/mg protein); however, these differences were not statistically significant. Thus after bleomycin treatment, EC-SOD-overexpressing mice had reduced levels of collagen that could be explained only partially by increases in total lung protein.


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 3.   Overexpression of EC-SOD reduces total lung collagen after bleomycin treatment. Two weeks after intratracheal saline (control) or bleomycin, total lung collagen was quantitated. After bleomycin, lung collagen increased by 138% in the wild-type compared with control (*P < 0.001), but only 66% in the EC-SOD transgenic mouse lungs compared with control (dagger P < 0.05). There was less of an increase in the transgenic mice compared with wild-type mice (¥P < 0.05).

Effects of overexpression of EC-SOD on histological injury. To further elucidate the differences in collagen content between the EC-SOD transgenic and wild-type mouse lung, we performed histological evaluation (Fig. 4). Histological injury was noted in both the wild-type and EC-SOD transgenic mice treated with bleomycin. There was no injury noted in the control mice. Injury consisted of patchy to confluent fibrosis with a leukocytic cellular infiltration. Severe honeycombing was noted in two specimens (one EC-SOD transgenic and one wild type). We could not discern histological differences between the fibrotic foci of the EC-SOD transgenic and wild-type mouse lungs; however, the injured foci appeared to be smaller in the EC-SOD transgenic lungs compared with the wild-type lungs. To quantitate this difference, we used a grid to quantitate the amount of injury of a histological specimen from each animal.


View larger version (57K):
[in this window]
[in a new window]
 
Fig. 4.   Collagen-rich areas of fibrosis are smaller in EC-SOD transgenic mice treated with bleomycin. Two weeks after bleomycin or saline, mice lungs were perfused, fixed, and embedded in paraffin. Sections were stained for collagen with sirius red (red) and for noncollagenous protein with fast green FCF (green) and then photographed at ×10 magnification. Both control (A) and bleomycin-treated (B) animals stained for collagen around large airways and blood vessels; however, both wild-type (B) and EC-SOD transgenic-positive (C) animals had foci of fibrosis that stained strongly for collagen (arrows in B and C).

Two weeks after bleomycin, the percentage of lung with fibrosis was higher in the wild-type mice (21.8 ± 2.3%) compared with the EC-SOD transgenic mice (10.2 ± 1.8%; P < 0.01; Fig. 5). Two investigators achieved similar scores independently (wild type: 21.8 ± 2.5% and 21.9 ± 1.7%; EC-SOD transgene positive 10.5 ± 2.3% and 9.8 ± 1.4%). Thus EC-SOD overexpression attenuated the severity of bleomycin-induced lung injury by reducing the size of the fibrotic foci.


View larger version (7K):
[in this window]
[in a new window]
 
Fig. 5.   Overexpression of EC-SOD reduces lung injury after bleomycin administration. We scored mouse lungs for fibrosis by overlaying a grid onto lung sections stained with hematoxylin and eosin and Masson's trichrome. Each square on the grid was counted as positive if fibrosis occurred in >50% of the square and negative if there was <50% fibrosis. Two weeks after bleomycin administration, the percentage of lung that was fibrotic was significantly less in the EC-SOD transgenic mice compared with wild type (*P < 0.01).

Immunohistochemistry of EC-SOD after bleomycin-induced lung fibrosis. To investigate the distribution of EC-SOD in the lung after bleomycin treatment, we used immunohistochemical staining with polyclonal antibodies raised against EC-SOD. In our negative controls, we found that neither IgG (Fig. 6A) nor antibody preadsorbed to EC-SOD (not shown) had significant staining. Using an EC-SOD specific antibody, we found EC-SOD along alveolar membranes, along large airways, and surrounding blood vessels (Fig. 6B). In the EC-SOD transgenic mice, there was abundant staining associated with type II alveolar cells (Fig. 6E) and bronchial epithelial cells (not shown). In most tissue sections there was an occasional alveolar macrophage that stained positive (Fig. 6E). This staining was consistent with that previously reported by Folz et al. (12) and consistent with the activity of the SPC promoter (6). After bleomycin treatment, both the wild-type and EC-SOD transgenic mice developed patchy fibrosis (Fig. 6, D and F). Within these areas of fibrosis, staining for EC-SOD appeared more intense and occurred in foci that also stained positively for collagen with sirius red. Although the fibrotic foci appeared smaller in the EC-SOD transgenic mice, the staining within these foci was more intense.


View larger version (142K):
[in this window]
[in a new window]
 
Fig. 6.   Immunohistochemistry of bleomycin-treated animals shows intense staining for EC-SOD in fibrotic areas in the mouse lung. A: wild-type mouse lung (high power) using IgG control shows no brown pigment. B: wild-type mouse lung (medium power) using polyclonal EC-SOD antibody that stains brown. There is staining around large airways, blood vessels, and in the alveolar interstitium. C: wild-type mouse lung (high power) reveals EC-SOD immunoreactivity in the alveolar interstitium. D: wild-type mouse lung 2 wk after bleomycin (high power) shows intense staining for EC-SOD in foci of injured lung; these areas appear to be extracellular (thick arrows) and stained for collagen with sirius red (high power). E: EC-SOD transgenic mouse lung (high power) shows strong EC-SOD staining associated with type II alveolar cells (thin arrows) F: 2 wk after bleomycin, EC-SOD transgenic mouse lung (high power) have smaller foci of injured lung. EC-SOD staining appears to be extracellular (large arrows) and associated with foci that stained positive with sirius red. An alveolar macrophage shows slight intracellular staining. Bars represent 10 µm.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Bleomycin is a commonly used chemotherapeutic agent that has severe pulmonary side effects. Although bleomycin is a well-known cause of intracellular oxidative stress, several findings in this study suggest that extracellular oxidative stress may also play a role in the pathogenesis of bleomycin-induced lung injury. First, pulmonary overexpression of EC-SOD attenuated both collagen accumulation and histological injury in the lung after bleomycin administration. Second, bleomycin induced pulmonary EC-SOD protein synthesis and accumulation in the lung.

Other investigators have reported that total lung SOD activity increases in rats (11, 19) and rabbits (27) after bleomycin administration, but this is the first study to specifically report changes in EC-SOD. An interesting feature of the rise in lung EC-SOD is that the protein increased 1 wk before the mRNA. Several possible explanations could account for this. First, EC-SOD half-life might increase in the first few days after bleomycin. Second, the efficiency of EC-SOD mRNA translation might be increased. Third, EC-SOD may come from nonpulmonary sources. Although the source of the increase in lung EC-SOD protein is not known, there was prominent EC-SOD immunostaining in lung macrophages and neutrophils, suggesting that the increase may result from the influx of inflammatory cells. Loenders et al. (21) have also reported immunostaining for EC-SOD in inflammatory cells. Later increases in lung EC-SOD may be sustained by increased lung synthesis, as suggested by the late rise in EC-SOD mRNA.

The mediators that induce EC-SOD gene transcription after bleomycin are unknown. Although the mouse EC-SOD promoter has not been described, the human EC-SOD promoter contains two putative antioxidant response elements (13). The complete molecular mechanism of signal transduction by ROS is unknown but is currently under study in our laboratory. Although bleomycin induces a burst of ROS, this occurs immediately after administration. Thus the late increase in EC-SOD gene transcription is probably secondary to other mediators. The cytokines that are induced by bleomycin may be better candidates for regulators of EC-SOD gene transcription (32, 36). Several investigators have found that inflammatory cytokines such as interferon-gamma (2) and interleukin-1 (25) can induce EC-SOD in rat and human cell culture lines. One pathway common to both of these pathways is nuclear factor-kappa B (2). Nuclear factor-kappa B is also a putative regulatory element in the human EC-SOD gene (13). Thus early increases in EC-SOD may be a result of an influx of inflammatory cells that carry EC-SOD protein, yet, later increases may be secondary to the effects of the cytokine milieu on EC-SOD gene transcription. However, in this model, bleomycin was administered as a single dose; thus the level of lung EC-SOD before bleomycin administration may be more important than any subsequent induction of native mouse EC-SOD protein.

The difference in expression between the endogenous EC-SOD and the transgene EC-SOD is not surprising since the genes are under control of different promoters. The EC-SOD transgene utilized the human SPC promoter and not the mouse EC-SOD promoter. Our findings that bleomycin does not increase the EC-SOD transgenic protein are consistent with previous studies, which report that the SPC promoter is activated only in a sporadic manner after bleomycin injury (6, 7). Additionally, the cytokines that increase EC-SOD in cell culture have not been found to increase SPC message in whole lung preparations (5, 34).

There are several mechanisms by which EC-SOD may protect the lung from injury. Bleomycin administration generates free radicals that injure DNA (26, 40), lipids (15), and proteins (44). Superoxide is one of these free radical mediators and the lung is a major target organ of bleomycin injury. EC-SOD is abundant in lung tissue (24) and could directly attenuate lung injury by reducing superoxide concentrations in the extracellular space. Reduction of superoxide in the extracellular space might have several consequences, including decreased stimulation of fibroblasts and diminished inflammatory cell recruitment. For instance, bleomycin-induced superoxide production has been shown to stimulate fibroblasts to proliferate and differentiate into myofibroblasts, resulting in a histological appearance that is similar to idiopathic pulmonary fibrosis (41). Superoxide stimulates fibroblasts to secrete collagen (3) and mediates expression of selectins on endothelium, resulting in enhanced recruitment of leukocytes to the lung (1). Thus EC-SOD may protect both directly as an antioxidant and indirectly by blunting the initial inflammation that is induced during bleomycin administration.

The attenuation of bleomycin-induced lung injury with EC-SOD transgene overexpression was similar to that reported by Tamagawa et al. (38) with intravenous lecithinized SOD1. With a dose of either 1 or 10 mg · kg-1 · day-1, these investigators found an 11% reduction in lung weight, 16% reduction in lung collagen, and 41% reduction in grade of fibrosis. Other investigators have found similar reductions in lung edema, collagen deposition, and fibrosis score after administration of high levels of SOD2 (31) and other ROS scavengers (30). Although these investigators did not report how much the injections increased lung SOD activity, it is likely that their beneficial effect was secondary to enhanced intravascular SOD activity, since all of these treatments were given parenterally. In the EC-SOD transgenic mice, EC-SOD overexpression occurred primarily in alveolar type II cells and bronchial epithelial cells (12), suggesting that both the airway and alveolar epithelium may be important in defending against free radical injury after bleomycin. Furthermore, it is unlikely that the reduced lung injury in the EC-SOD transgenic mice is due to differences other than an increase in EC-SOD, since cytosolic SOD, mitochondrial SOD, glutathione peroxidase, glutathione, and catalase have been reported to be identical in the lungs of wild-type and EC-SOD transgenic mice (12). Although the protection afforded by EC-SOD overexpression was modest and incomplete, this is the first report to suggest that alveolar and airway extracellular antioxidant enzymes can protect the lung from bleomycin-induced lung fibrosis. This study was not statistically powered to detect differences in secondary outcomes such as weight loss and mortality. The lack of statistically significant improvement in these multifactorial outcomes confirms that mediators besides extracellular superoxide play a large role in the pathogenesis of bleomycin-induced lung injury.

There are several compelling reasons why extracellular antioxidants might be beneficial in clinical treatment or prevention of pulmonary fibrosis. First, patients with pulmonary fibrosis have reduced epithelial lining fluid antioxidant capacity and elevated markers of oxidative stress (35). Second, administration of aerosolized glutathione has been shown to attenuate bleomycin-induced lung fibrosis (16, 23). Third, alveolar inflammatory cells from patients with pulmonary fibrosis produce excess extracellular superoxide (37). Thus targeting the extracellular space with mimics of EC-SOD may be a potentially beneficial intervention in patients suffering from pulmonary fibrosis or undergoing bleomycin chemotherapy.

In conclusion, bleomycin administration induced EC-SOD in the lung and overexpression of EC-SOD attenuated bleomycin-induced fibrosis. The only difference in the lungs that could explain the decreased fibrosis was a higher level of EC-SOD in the EC-SOD transgenic lungs [0.5 µg EC-SOD/mg lung protein in the wild-type vs. 1.5 µg EC-SOD/mg lung protein in the EC-SOD transgenic mice (12)]. Thus microgram amounts of extracellular SOD activity appear to be biologically effective at reducing bleomycin-induced lung fibrosis. This suggests that small increases in pulmonary extracellular SOD activity, by either pretreatment with EC-SOD or an extracellular SOD mimic, may be of potential therapeutic benefit in reducing bleomycin-induced lung injury.


    ACKNOWLEDGEMENTS

The authors thank Dr. Brian Day for comments and suggestions.


    FOOTNOTES

This work was supported in part by National Heart, Lung, and Blood Institute Grants HL-04407, HL-31992, and HL-42444, and the Andrew Goodman Fellowship in Medicine at National Jewish Medical and Research Center.

Address for reprint requests and other correspondence: R. P. Bowler, National Jewish Medical and Research Center, K707, 1400 Jackson St., Denver, CO 80206 (E-mail: BowlerR{at}njc.org).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

10.1152/ajplung.00058.2001

Received 13 February 2001; accepted in final form 5 November 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1.   Akgur, FM, Brown MF, Zibari GB, McDonald JC, Epstein CJ, Ross CR, and Granger DN. Role of superoxide in hemorrhagic shock-induced P-selectin expression. Am J Physiol Heart Circ Physiol 279: H791-H797, 2000.

2.   Brady, TC, Chang LY, Day BJ, and Crapo JD. Extracellular superoxide dismutase is upregulated with inducible nitric oxide synthase after NF-kappa B activation. Am J Physiol Lung Cell Mol Physiol 273: L1002-L1006, 1997.

3.   Chandrakasan, G, and Bhatnagar RS. Stimulation of collagen synthesis in fibroblast cultures by superoxide. Cell Mol Biol 37: 751-755, 1991.

4.   Cunningham, ML, Ringrose PS, and Lokesh BR. Bleomycin cytotoxicity is prevented by superoxide dismutase in vitro. Cancer Lett 21: 149-153, 1983.

5.   D'Angio, CT, Finkelstein JN, Lomonaco MB, Paxhia A, Wright SA, Baggs RB, Notter RH, and Ryan RM. Changes in surfactant protein gene expression in a neonatal rabbit model of hyperoxia-induced fibrosis. Am J Physiol Lung Cell Mol Physiol 272: L720-L730, 1997.

6.   Daly, HE, Baecher-Allan CM, Barth RK, D'Angio CT, and Finkelstein JN. Bleomycin induces strain-dependent alterations in the pattern of epithelial cell-specific marker expression in mouse lung. Toxicol Appl Pharmacol 142: 303-310, 1997.

7.   Daly, HE, Baecher-Allan CM, Paxhia AT, Ryan RM, Barth RK, and Finkelstein JN. Cell-specific gene expression reveals changes in epithelial cell populations after bleomycin treatment. Lab Invest 78: 393-400, 1998.

8.   Denholm, EM, and Phan SH. Bleomycin binding sites on alveolar macrophages. J Leukoc Biol 48: 519-523, 1990.

9.   Eckelman, WC, Rzeszotarski WJ, Siegel BA, Kubota H, Chelliah M, Stevenson J, and Rebra RC. Chemical and biologic properties of isolated radiolabeled bleomycin preparations. J Nucl Med 16: 1033-1037, 1975.

10.   Enghild, JJ, Thogersen IB, Oury TD, Valnickova Z, Hojrup P, and Crapo JD. The heparin-binding domain of extracellular superoxide dismutase is proteolytically processed intracellularly during biosynthesis. J Biol Chem 274: 14818-14822, 1999.

11.   Fantone, JC, and Phan SH. Oxygen metabolite detoxifying enzyme levels in bleomycin-induced fibrotic lungs. Free Radic Biol Med 4: 399-402, 1988.

12.   Folz, RJ, Abushamaa AM, and Suliman HB. Extracellular superoxide dismutase in the airways of transgenic mice reduces inflammation and attenuates lung toxicity following hyperoxia. J Clin Invest 103: 1055-1066, 1999.

13.   Folz, RJ, and Crapo JD. Extracellular superoxide dismutase (SOD3): tissue-specific expression, genomic characterization, and computer-assisted sequence analysis of the human EC SOD gene [published erratum Genomics 23: 723, Oct 1994]. Genomics 22: 162-171, 1994.

14.   Galvan, L, Huang CH, Prestayko AW, Stout JT, Evans JE, and Crooke ST. Inhibition of bleomycin-induced DNA breakage by superoxide dismutase. Cancer Res 41: 5103-5106, 1981.

15.   Giri, SN, Misra HP, Chandler DB, and Chen ZL. Increases in lung prolyl hydroxylase and superoxide dismutase activities during bleomycin-induced lung fibrosis in hamsters. Exp Mol Pathol 39: 317-326, 1983.

16.   Hagiwara, SI, Ishii Y, and Kitamura S. Aerosolized administration of N-acetylcysteine attenuates lung fibrosis induced by bleomycin in mice. Am J Respir Crit Care Med 162: 225-231, 2000.

17.   Halliwell, B, and Gutteridge JMC Free Radicals in Biology and Medicine: Oxford, UK: Oxford University Press, 1999.

18.   Ishida, R, and Takahashi T. Increased DNA chain breakage by combined action of bleomycin and superoxide radical. Biochem Biophys Res Commun 66: 1432-1438, 1975.

19.   Karam, H, Hurbain-Kosmath I, and Housset B. Antioxidant activity in alveolar epithelial type 2 cells of rats during the development of bleomycin injury. Cell Biol Toxicol 14: 13-22, 1998.

20.   Ledwozyw, A. Protective effect of liposome-entrapped superoxide dismutase and catalase on bleomycin-induced lung injury in rats. II. Phospholipids of the lung surfactant. Acta Physiol Hung 78: 157-162, 1991.

21.   Loenders, B, Van Mechelen E, Nicolai S, Buyssens N, Van Osselaer N, Jorens PG, Willems J, Herman AG, and Slegers H. Localization of extracellular superoxide dismutase in rat lung: neutrophils and macrophages as carriers of the enzyme. Free Radic Biol Med 24: 1097-1106, 1998.

22.   Lopez-De Leon, A, and Rojkind M. A simple micromethod for collagen and total protein determination in formalin-fixed paraffin-embedded sections. J Histochem Cytochem 33: 737-743, 1985.

23.   MacNee, W, and Rahman I. Oxidants/antioxidants in idiopathic pulmonary fibrosis. Thorax 50, Suppl1: S53-S58, 1995.

24.   Marklund, SL. Human copper-containing superoxide dismutase of high molecular weight. Proc Natl Acad Sci USA 79: 7634-7638, 1982.

25.   Marklund, SL. Regulation by cytokines of extracellular superoxide dismutase and other superoxide dismutase isoenzymes in fibroblasts. J Biol Chem 267: 6696-6701, 1992.

26.   Martin, WJ II, and Kachel DL. Bleomycin-induced pulmonary endothelial cell injury: evidence for the role of iron-catalyzed toxic oxygen-derived species. J Lab Clin Med 110: 153-158, 1987.

27.   Matalon, S, Harper WV, Goldinger JM, Nickerson PA, and Olszowka J. Modification of pulmonary oxygen toxicity by bleomycin treatment. J Appl Physiol 58: 1802-1809, 1985.

28.   McCord, JM, and Fridovich I. Superoxide dismutase. An enzymic function for erythrocuprein (hemocuprein). J Biol Chem 244: 6049-6055, 1969.

29.   Muller, WE, and Zahn RK. Determination of the bleomycin-inactivating enzyme in biopsies. GANN 67: 425-430, 1976.

30.   Nici, L, Santos-Moore A, Kuhn C, and Calabresi P. Modulation of bleomycin-induced pulmonary toxicity in the hamster by the antioxidant amifostine. Cancer 83: 2008-2014, 1998.

31.   Parizada, B, Werber MM, and Nimrod A. Protective effects of human recombinant MnSOD in adjuvant arthritis and bleomycin-induced lung fibrosis. Free Radic Res Commun 15: 297-301, 1991.

32.   Phan, SH, and Kunkel SL. Lung cytokine production in bleomycin-induced pulmonary fibrosis. Exp Lung Res 18: 29-43, 1992.

33.   Pron, G, Belehradek J, Jr, Orlowski S, and Mir LM. Involvement of membrane bleomycin-binding sites in bleomycin cytotoxicity. Biochem Pharmacol 48: 301-310, 1994.

34.   Pryhuber, GS, Bachurski C, Hirsch R, Bacon A, and Whitsett JA. Tumor necrosis factor-alpha decreases surfactant protein B mRNA in murine lung. Am J Physiol Lung Cell Mol Physiol 270: L714-L721, 1996.

35.   Rahman, I, Skwarska E, Henry M, Davis M, O'Connor CM, FitzGerald MX, Greening A, and MacNee W. Systemic and pulmonary oxidative stress in idiopathic pulmonary fibrosis. Free Radic Biol Med 27: 60-68, 1999.

36.   Smith, RE, Strieter RM, Phan SH, Lukacs N, and Kunkel SL. TNF and IL-6 mediate MIP-1alpha expression in bleomycin-induced lung injury. J Leukoc Biol 64: 528-536, 1998.

37.   Strausz, J, Muller-Quernheim J, Steppling H, and Ferlinz R. Oxygen radical production by alveolar inflammatory cells in idiopathic pulmonary fibrosis. Am Rev Respir Dis 141: 124-128, 1990.

38.   Tamagawa, K, Taooka Y, Maeda A, Hiyama K, Ishioka S, and Yamakido M. Inhibitory effects of a lecithinized superoxide dismutase on bleomycin-induced pulmonary fibrosis in mice. Am J Respir Crit Care Med 161: 1279-1284, 2000.

39.   Tarnell, EB, Oliver BL, Johnson GM, Watts FL, and Thrall RS. Superoxide anion production by rat neutrophils at various stages of bleomycin-induced lung injury. Lung 170: 41-50, 1992.

40.   Trush, MA, Mimnaugh EG, Ginsburg E, and Gram TE. Studies on the interaction of bleomycin A2 with rat lung microsomes. II. Involvement of adventitious iron and reactive oxygen in bleomycin-mediated DNA chain breakage. J Pharmacol Exp Ther 221: 159-165, 1982.

41.   Vyalov, SL, Gabbiani G, and Kapanci Y. Rat alveolar myofibroblasts acquire alpha-smooth muscle actin expression during bleomycin-induced pulmonary fibrosis. Am J Pathol 143: 1754-1765, 1993.

42.   Weisiger, RA, and Fridovich I. Mitochondrial superoxide simutase. Site of synthesis and intramitochondrial localization. J Biol Chem 248: 4793-4796, 1973.

43.   Yamazaki, C, Hoshino J, Hori Y, Sekiguchi T, Miyauchi S, Mizuno S, and Horie K. Effect of lecithinized-superoxide dismutase on the interstitial pneumonia model induced by bleomycin in mice. Jpn J Pharmacol 75: 97-100, 1997.

44.   Yamazaki, C, Hoshino J, Sekiguchi T, Hori Y, Miyauchi S, Mizuno S, and Horie K. Production of superoxide and nitric oxide by alveolar macrophages in the bleomycin-induced interstitial pneumonia mice model. Jpn J Pharmacol 78: 69-73, 1998.


Am J Physiol Lung Cell Mol Physiol 282(4):L719-L726
1040-0605/02 $5.00 Copyright © 2002 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Respir. Crit. Care Med.Home page
T. R. Richens, D. J. Linderman, S. A. Horstmann, C. Lambert, Y.-Q. Xiao, R. L. Keith, D. M. Boe, K. Morimoto, R. P. Bowler, B. J. Day, et al.
Cigarette Smoke Impairs Clearance of Apoptotic Cells through Oxidant-dependent Activation of RhoA
Am. J. Respir. Crit. Care Med., June 1, 2009; 179(11): 1011 - 1021.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
M. Dahl, R. P. Bowler, K. Juul, J. D. Crapo, S. Levy, and B. G. Nordestgaard
Superoxide Dismutase 3 Polymorphism Associated with Reduced Lung Function in Two Large Populations
Am. J. Respir. Crit. Care Med., November 1, 2008; 178(9): 906 - 912.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
M. C. Gongora, H. E. Lob, U. Landmesser, T. J. Guzik, W. D. Martin, K. Ozumi, S. M. Wall, D. S. Wilson, N. Murthy, M. Gravanis, et al.
Loss of Extracellular Superoxide Dismutase Leads to Acute Lung Damage in the Presence of Ambient Air: A Potential Mechanism Underlying Adult Respiratory Distress Syndrome
Am. J. Pathol., October 1, 2008; 173(4): 915 - 926.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
I. N. Zelko, M. R. Mueller, and R. J. Folz
Transcription Factors Sp1 and Sp3 Regulate Expression of Human Extracellular Superoxide Dismutase in Lung Fibroblasts
Am. J. Respir. Cell Mol. Biol., August 1, 2008; 39(2): 243 - 251.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Gao, J. R. Koenitzer, J. M. Tobolewski, D. Jiang, J. Liang, P. W. Noble, and T. D. Oury
Extracellular Superoxide Dismutase Inhibits Inflammation by Preventing Oxidative Fragmentation of Hyaluronan
J. Biol. Chem., March 7, 2008; 283(10): 6058 - 6066.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
F. Kamezaki, H. Tasaki, K. Yamashita, M. Tsutsui, S. Koide, S. Nakata, A. Tanimoto, M. Okazaki, Y. Sasaguri, T. Adachi, et al.
Gene Transfer of Extracellular Superoxide Dismutase Ameliorates Pulmonary Hypertension in Rats
Am. J. Respir. Crit. Care Med., January 15, 2008; 177(2): 219 - 226.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
K. Ganguly, T. Stoeger, S. C. Wesselkamper, C. Reinhard, M. A. Sartor, M. Medvedovic, C. R. Tomlinson, I. Bolle, J. M. Mason, G. D. Leikauf, et al.
Candidate genes controlling pulmonary function in mice: transcript profiling and predicted protein structure
Physiol Genomics, November 14, 2007; 31(3): 410 - 421.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
S. Cuzzocrea, S. Ronchetti, T. Genovese, E. Mazzon, M. Agostini, R. Di Paola, E. Esposito, C. Muia, G. Nocentini, and C. Riccardi
Genetic and pharmacological inhibition of GITR-GITRL interaction reduces chronic lung injury induced by bleomycin instillation
FASEB J, January 1, 2007; 21(1): 117 - 129.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
K. Juul, A. Tybjaerg-Hansen, S. Marklund, P. Lange, and B. G. Nordestgaard
Genetically Increased Antioxidative Protection and Decreased Chronic Obstructive Pulmonary Disease
Am. J. Respir. Crit. Care Med., April 15, 2006; 173(8): 858 - 864.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
V. L. Kinnula, C. L. Fattman, R. J. Tan, and T. D. Oury
Oxidative Stress in Pulmonary Fibrosis: A Possible Role for Redox Modulatory Therapy
Am. J. Respir. Crit. Care Med., August 15, 2005; 172(4): 417 - 422.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
T. Genovese, S. Cuzzocrea, R. Di Paola, E. Mazzon, C. Mastruzzo, P. Catalano, M. Sortino, N. Crimi, A. P. Caputi, C. Thiemermann, et al.
Effect of rosiglitazone and 15-deoxy-{Delta}12,14-prostaglandin J2 on bleomycin-induced lung injury
Eur. Respir. J., February 1, 2005; 25(2): 225 - 234.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
H. Kida, M. Yoshida, S. Hoshino, K. Inoue, Y. Yano, M. Yanagita, T. Kumagai, T. Osaki, I. Tachibana, Y. Saeki, et al.
Protective effect of IL-6 on alveolar epithelial cell death induced by hydrogen peroxide
Am J Physiol Lung Cell Mol Physiol, February 1, 2005; 288(2): L342 - L349.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
R. J. Tan, C. L. Fattman, S. C. Watkins, and T. D. Oury
Redistribution of pulmonary EC-SOD after exposure to asbestos
J Appl Physiol, November 1, 2004; 97(5): 2006 - 2013.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
R. P. Bowler, M. Nicks, K. Tran, G. Tanner, L.-Y. Chang, S. K. Young, and G. S. Worthen
Extracellular Superoxide Dismutase Attenuates Lipopolysaccharide-Induced Neutrophilic Inflammation
Am. J. Respir. Cell Mol. Biol., October 1, 2004; 31(4): 432 - 439.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
J. D. Crapo
Redox Active Agents in Inflammatory Lung Injury
Am. J. Respir. Crit. Care Med., November 1, 2003; 168(9): 1027 - 1028.
[Full Text]


Home page
Am. J. Respir. Crit. Care Med.Home page
V. L. Kinnula and J. D. Crapo
Superoxide Dismutases in the Lung and Human Lung Diseases
Am. J. Respir. Crit. Care Med., June 15, 2003; 167(12): 1600 - 1619.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
R. P. Bowler, J. Arcaroli, E. Abraham, M. Patel, L.-Y. Chang, and J. D. Crapo
Evidence for extracellular superoxide dismutase as a mediator of hemorrhage-induced lung injury
Am J Physiol Lung Cell Mol Physiol, April 1, 2003; 284(4): L680 - L687.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
R. P. Bowler and J. D. Crapo
Oxidative Stress in Airways: Is There a Role for Extracellular Superoxide Dismutase?
Am. J. Respir. Crit. Care Med., December 15, 2002; 166(12): S38 - 43.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/4/L719    most recent
00058.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (41)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bowler, R. P.
Right arrow Articles by Crapo, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bowler, R. P.
Right arrow Articles by Crapo, J. D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online