|
|
||||||||
Department of Medicine, National Jewish Medical and Research Center, Denver, Colorado, 80206
| |
ABSTRACT |
|---|
|
|
|---|
Bleomycin administration results in well-described intracellular oxidative stress that can lead to pulmonary fibrosis. The role of alveolar interstitial antioxidants in this model is unknown. Extracellular superoxide dismutase (EC-SOD) is the primary endogenous extracellular antioxidant enzyme and is abundant in the lung. We hypothesized that EC-SOD plays an important role in attenuating bleomycin-induced lung injury. Two weeks after intratracheal bleomycin administration, we found that wild-type mice induced a 106 ± 25% increase in lung EC-SOD. Immunohistochemical staining revealed that a large increase in EC-SOD occurred in injured lung. Using mice that overexpress EC-SOD specifically in the lung, we found a 53 ± 14% reduction in bleomycin-induced lung injury assessed histologically and a 17 ± 6% reduction in lung collagen content 2 wk after bleomycin administration. We conclude that EC-SOD plays an important role in reducing the magnitude of lung injury from extracellular free radicals after bleomycin administration.
antioxidant; transgenic mouse; immunohistochemistry
| |
INTRODUCTION |
|---|
|
|
|---|
BLEOMYCIN ADMINISTRATION RESULTS in increased reactive oxygen species (ROS) that can cause severe organ injury. Pulmonary injury in response to systemic bleomycin treatment is thought to be prominent because of diminished bleomycin inactivating enzymes in the lungs (29). Bleomycin complexes with iron to generate ROS that damage proteins, lipids, and DNA (4, 18). Although intracellular ROS are prominent after bleomycin administration (17), extracellular ROS may also be important mediators of lung injury because bleomycin binds to plasma membranes (33) and is found in the extracellular space several hours after administration (9).
There are several lines of evidence that implicate superoxide as one of the ROS that mediate lung injury. First, bleomycin intercalates with DNA to cause strand breakage via oxygen free radicals (18). Second, cytosolic superoxide dismutase (SOD) can attenuate DNA breakage in vitro (14). Third, bleomycin induces cytosolic SOD activity in the lung (11, 15) and specifically in type II alveolar cells (19). However, additional lines of evidence implicate extracellular superoxide as another source of oxidant stress created by bleomycin. First, plasma levels are detectable several days after bleomycin administration (9). Second, bleomycin does not readily cross the plasma membrane but binds to cell surfaces before being endocytosed (8, 33). Third, bleomycin increases lung leukocytes that subsequently release high levels of extracellular superoxide (39). Fourth, parenterally administered cytosolic SOD, which essentially functions as an extracellular superoxide dismutase (EC-SOD), inhibits bleomycin-induced pulmonary fibrosis (20, 31, 43). Thus many in vitro studies directly implicate intracellular superoxide as mediating bleomycin-induced injury, but the evidence implicating extracellular superoxide is only indirect.
SOD enzymes are the primary defense against excess superoxide. Mammals have three SOD enzymes: in the cytosol, SOD1 (28); in mitochondria, SOD2 (42); and in the extracellular space, SOD3 (24). Of the three known mammalian SODs, only the intracellular SODs have been studied in bleomycin lung injury; however, EC-SOD's unique extracellular location and its abundance in the lung suggest that it may play a major role in attenuating free radial injury in the lung after bleomycin administration.
In this present study, intratracheal bleomycin was used to test the hypothesis that bleomycin could induce lung EC-SOD, and immunohistochemistry was used to characterize the histological distribution of EC-SOD after bleomycin-induced lung injury. Furthermore, mice overexpressing human EC-SOD in the lung were used to test the hypothesis that high levels of EC-SOD could protect the lung from bleomycin-induced fibrosis.
| |
EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Reagents.
Enhanced chemiluminescence (ECL) +Plus Western blotting detection
reagents were from Amersham Pharmacia Biotech (Piscataway, NJ). The
protease inhibitors 3,4-dichloroisocoumarin,
1,10-phenanthroline (Boehringer Mannheim), and E-64 (ICN, Costa Mesa,
CA) were kept in stock ethanol solution at
20°C. The Vectastain ABC
Elite kit and biotinylated anti-rabbit IgG were from Vector
Laboratories (Burlingame, CA). Bleomycin sulfate was from Mead Johnson
Oncology Products. At a dose of 0.2 U/20 g mouse, this preparation was found to induce fibrosis without causing a significant mortality. All
other reagents were from Sigma.
Bleomycin administration. C57/Bl6 mice overexpressing human EC-SOD using a surfactant protein C (SPC) promoter have been previously described (12). Bleomycin administration was performed on 4 separate days using multiple animals from each group. Transgene-positive (n = 58) or -negative (n = 56) littermates (average age 62 days) were anesthetized with halothane and then given intratracheal bleomycin sulfate 0.2 U/20 g. Control mice, either transgene negative (n = 14) or positive (n = 13), were given vehicle. Mice were weighed daily and given liberal access to food and water and then killed at the end of a fortnight. Lung volumes were calculated by displacement of water after being fixed for 30 min with 4% paraformaldehyde at 20 cmH2O pressure.
Histochemistry and immunohistochemistry. Half of the mice had their lungs inflated for 30 min with 4% paraformaldehyde at 20 cmH2O pressure and embedded in paraffin. Multiple 4-µm sections were made of each sample. They were then treated twice in Hemo-D for 7 min, twice in 100% ethanol for 5 min, twice in 90% ethanol for 5 min, and then placed in distilled H2O for 5 min. One section of each sample was used for hematoxylin and eosin (H&E), Masson's trichrome, or immunohistochemical staining. For immunohistochemistry, the samples were blocked overnight at 4°C in blocking buffer (25 mM Tris pH 7.5, 500 mM NaCl, 1% Tween 20, 10% fish gelatin, and 0.05% NaN3). The samples were then incubated with 20% glycerol in H2O for 30 min and washed with blocking buffer. The sections were incubated with 1/100 affinity purified rabbit polyclonal anti-EC-SOD IgG or 1/2,000 rabbit IgG in blocking buffer for 3 h at room temperature. The sections were washed in high-salt buffer (25 mM Tris pH 7.5, 500 mM NaCl, and 1% Tween 20) three times for 5 min. A biotinylated anti-rabbit IgG, at 1/500 in blocking buffer, was placed on the sections for 30 min at room temperature. The sections were washed one time with high-salt buffer then treated for 3-5 min in 3% H2O2 in water. The samples were then washed two times for 5 min in high-salt buffer without detergent. Vectastain ABC Elite and diaminobenzidine (Vector Laboratories) kit were used as described in the kit instructions. The sections were then stained for 3 min with 1% methyl green and washed with distilled H2O. The sections were then dehydrated twice in 90% ethanol for 5 min, twice in 100% ethanol for 7 min, and twice in Hemo-D for 7 min.
Histological scoring. H&E- and trichrome-stained slides were by scored independently by two investigators blinded to treatment group and genotype. A 10 × 10 square grid on the left ocular was superimposed over a portion of each histological section repeatedly so that all lung tissue was covered once and only once. Using a Nikon light microscope with a ×20 ocular and ×2 objective lens, we scored each square in the grid as 1 if fibrosis occupied at least 50% of the square and 0 otherwise. The percent fibrosis for each section was determined by adding the number of squares scored with a 1, divided by the number of the squares counted. An average of 549 squares were counted for each section scored.
Quantitation of EC-SOD mRNA. Mouse lung total RNA was isolated using an RNeasy MIDI kit (Qiagen) and then quantitated using a SmartSpec 3000 (Bio-Rad). A Cepheid SmartCycler was used with the following protocol: RETROscript kit (Ambion, Austin, Texas) was used to generate RT product using the manufacturer's protocol with a hot start; for mouse (mEC-SOD) PCR, 2 µl of RT product was added to 20 µl of water, 1 µl of EC-SOD forward primer (50 µM TTGTTCTACGGCTTGCTACTGGC), and 1 µl of reverse primer (50 µM ATTGCATGCATCTCGGCAGC), 1 µl of 0.05× SYBR green (Molecular Probes, Eugene, OR), and one Ready-To-Go PCR bead (Amersham Pharmacia Biotech); the resulting mix was brought to 94°C for 300 s and then cycled 50 times from 94°C for 30 s to 66°C for 30 s. For 18S PCR, an identical protocol was used except that primers were from QuantumRNA 18S internal standards (Ambion) and the 50 cycles were 94°C for 30 s, 60°C for 30 s, and 72°C for 30 s. The ratio of EC-SOD mRNA relative to 18S RNA internal standards was determined using Cepheid SmartCycler software (version 1.01). Total lung 18S RNA was determined using 1% of total RNA for agarose gel electrophoresis followed by ethidium bromide staining and then quantitation (Hitachi Genetic Systems). Total lung EC-SOD mRNA was determined by multiplying total 18S RNA by the ratio of EC-SOD mRNA to 18S RNA.
EC-SOD protein quantitation.
The remaining mice had their lungs weighed and then ground in liquid
nitrogen. Tissue was then resuspended in lysis buffer (25 mM
Tris · Cl, pH 7.5; 500 NaCl; 5 mM EDTA; 0.5% Triton X-100), homogenized in a tissue shearer and then spun at low speed. The supernatant was assayed for protein concentration using a bicinchoninic acid protein assay (Pierce). Identical amounts of protein were boiled for 5 min in SDS sample buffer with 50 mM dithiothreitol and
then run into a 12% acrylamide gel. The proteins were transferred to
0.22 µM nitrocellulose. A Western blot using either
-actin (Sigma)
or rabbit polyclonal
-EC-SOD antibody was quantitated using ECL
+Plus and a Molecular Dynamics imaging system (Sunnyvale, CA).
Collagen assay. A complete description of this assay can be found in Lopez-De Leon and Rojkind (22). In brief, paraffin-embedded sections were soaked in Hemo-D to remove the paraffin. Samples were then placed in a (1:1) Hemo-D:ethanol mixture, then 100% ethanol, then 50% ethanol, then distilled water followed by 0.5 ml of sirius red and fast green FCF mixture in 0.1% picric acid. After 30 min, the solution was pulled off, and the samples washed three times in distilled water. Next, 0.25 ml of NaOH 0.1 N and 0.25 ml of methanol were added for one min. Samples were aspirated and absorbance measured at 540 and 605 nm using a 96-well plate reader. The amount of noncollagenous protein in milligram per sample was calculated by measuring the absorbency of the eluate at 605 nm divided by 2.22 (the lung fast green FCF color equivalence). The amount of collagenous protein was calculated by measuring the absorbance of the eluate at 540 nm, subtracting 29% of the absorbance at 605 nm, and then dividing by 36.3 (the sirius red color equivalence). The total amount of collagen per lung was calculated by multiplying the total protein of the lung with the ratio of collagenous protein to total protein.
Statistical analysis.
All mice came from the same C57/Bl6 background. Wild-type animals were
littermates of EC-SOD transgene-positive animals. A one-way analysis of
variance (ANOVA) was used to determine if the means were significantly
different (P < 0.05). If means were significantly
different, a Tukey-Kramer multiple group comparison test was used
to compare individual groups. Standard error was indicated for each
value by a bar, and significance listed for each comparison. A
2-test was used to calculate P values for
ratios. All values were calculated using GraphPad Prism version 3.00 for Macintosh (GraphPad Software, San Diego, CA).
| |
RESULTS |
|---|
|
|
|---|
Physiological changes in the lung after bleomycin treatment.
Overall mortality was 4/141 (3%). The mortality for the
bleomycin-treated mice was 2/56 (3%) for wild types and 2/58 (3%) for
the EC-SOD transgenics. For the saline-treated mice, mortality was 0/14
(0%) in the wild types and 0/13 (0%) in the EC-SOD transgenics. Although bleomycin-treated wild-type mice lost 17.7 ± 2.6% of their body weight and the saline-treated wild-type mice gained 8.1 ± 1.4% of their body weight (P < 0.001 for saline
vs. bleomycin treated), overexpression of EC-SOD did not significantly
attenuate this weight loss [17.6 ± 3.9% decrease in wild-type
vs. 18.3 ± 3.2% decrease in EC-SOD transgenic mice,
P = not significant (NS); see Fig.
1].
|
EC-SOD increases after bleomycin treatment.
Because bleomycin accumulates in the lung and EC-SOD is found in
abundance in lung, we hypothesized that the oxidative stress from
bleomycin would induce EC-SOD. To test this hypothesis, we measured
both EC-SOD protein (Fig. 2A)
and mRNA (Fig. 2B). After bleomycin administration, total
lung mouse EC-SOD protein increased slowly over 2 wk. At the end of 2 wk, there was a 106 ± 25% increase in the wild-type mice
(P < 0.05) and 115 ± 25% increase in EC-SOD transgenic mice. The increase in mouse EC-SOD was found even when the
data were expressed per milligram protein, actin, or collagen. There
was no increase in human EC-SOD in the EC-SOD transgenic mouse lungs.
There was also a trend toward increased total lung mouse EC-SOD mRNA in
the wild-type (increase of 65 ± 46% compared with control;
P = 0,07) and EC-SOD transgenic mice (increase of 140 ± 76% compared with control; P = 0,08). This
trend occurred mainly between days 10 and 14.
|
Lung collagen after bleomycin instillation.
Bleomycin treatment increased collagen deposition in the wild-type lung
(saline-treated 121 ± 33 µg vs. bleomycin-treated 277 ± 18 µg; P < 0.001; Fig.
3). Overexpression of EC-SOD still resulted in lung collagen accumulation (saline-treated EC-SOD transgenic mice 141 ± 17 µg vs. bleomycin-treated EC-SOD
transgenic mice 228 ± 18 µg, P < 0.001);
however, the lungs from bleomycin-treated EC-SOD transgenic mice had
less collagen than the wild-type (P < 0.05). After
bleomycin treatment, the EC-SOD transgenic mice also had a trend toward
less total lung weight (EC-SOD transgenic 370 ± 21 mg vs.
wild-type 399 ± 30 mg) and less collagen per protein (EC-SOD
transgenic 35 ± 3 µg collagen/ mg protein vs. wild-type 41 ± 1.5 µg collagen/mg protein); however, these differences were not
statistically significant. Thus after bleomycin treatment, EC-SOD-overexpressing mice had reduced levels of collagen that could be
explained only partially by increases in total lung protein.
|
Effects of overexpression of EC-SOD on histological injury.
To further elucidate the differences in collagen content between the
EC-SOD transgenic and wild-type mouse lung, we performed histological
evaluation (Fig. 4). Histological injury
was noted in both the wild-type and EC-SOD transgenic mice treated with bleomycin. There was no injury noted in the control mice. Injury consisted of patchy to confluent fibrosis with a leukocytic cellular infiltration. Severe honeycombing was noted in two specimens (one EC-SOD transgenic and one wild type). We could not discern histological differences between the fibrotic foci of the EC-SOD transgenic and
wild-type mouse lungs; however, the injured foci appeared to be smaller
in the EC-SOD transgenic lungs compared with the wild-type lungs. To
quantitate this difference, we used a grid to quantitate the amount of
injury of a histological specimen from each animal.
|
|
Immunohistochemistry of EC-SOD after bleomycin-induced lung
fibrosis.
To investigate the distribution of EC-SOD in the lung after bleomycin
treatment, we used immunohistochemical staining with polyclonal
antibodies raised against EC-SOD. In our negative controls, we found
that neither IgG (Fig. 6A) nor
antibody preadsorbed to EC-SOD (not shown) had significant staining.
Using an EC-SOD specific antibody, we found EC-SOD along alveolar
membranes, along large airways, and surrounding blood vessels (Fig.
6B). In the EC-SOD transgenic mice, there was abundant
staining associated with type II alveolar cells (Fig. 6E)
and bronchial epithelial cells (not shown). In most tissue sections
there was an occasional alveolar macrophage that stained positive (Fig.
6E). This staining was consistent with that previously
reported by Folz et al. (12) and consistent with the
activity of the SPC promoter (6). After bleomycin
treatment, both the wild-type and EC-SOD transgenic mice developed
patchy fibrosis (Fig. 6, D and F). Within these areas of fibrosis, staining for EC-SOD appeared more intense and occurred in foci that also stained positively for collagen with sirius
red. Although the fibrotic foci appeared smaller in the EC-SOD
transgenic mice, the staining within these foci was more intense.
|
| |
DISCUSSION |
|---|
|
|
|---|
Bleomycin is a commonly used chemotherapeutic agent that has severe pulmonary side effects. Although bleomycin is a well-known cause of intracellular oxidative stress, several findings in this study suggest that extracellular oxidative stress may also play a role in the pathogenesis of bleomycin-induced lung injury. First, pulmonary overexpression of EC-SOD attenuated both collagen accumulation and histological injury in the lung after bleomycin administration. Second, bleomycin induced pulmonary EC-SOD protein synthesis and accumulation in the lung.
Other investigators have reported that total lung SOD activity increases in rats (11, 19) and rabbits (27) after bleomycin administration, but this is the first study to specifically report changes in EC-SOD. An interesting feature of the rise in lung EC-SOD is that the protein increased 1 wk before the mRNA. Several possible explanations could account for this. First, EC-SOD half-life might increase in the first few days after bleomycin. Second, the efficiency of EC-SOD mRNA translation might be increased. Third, EC-SOD may come from nonpulmonary sources. Although the source of the increase in lung EC-SOD protein is not known, there was prominent EC-SOD immunostaining in lung macrophages and neutrophils, suggesting that the increase may result from the influx of inflammatory cells. Loenders et al. (21) have also reported immunostaining for EC-SOD in inflammatory cells. Later increases in lung EC-SOD may be sustained by increased lung synthesis, as suggested by the late rise in EC-SOD mRNA.
The mediators that induce EC-SOD gene transcription after bleomycin are
unknown. Although the mouse EC-SOD promoter has not been described, the
human EC-SOD promoter contains two putative antioxidant response
elements (13). The complete molecular mechanism of signal
transduction by ROS is unknown but is currently under study in our
laboratory. Although bleomycin induces a burst of ROS, this occurs
immediately after administration. Thus the late increase in EC-SOD gene
transcription is probably secondary to other mediators. The cytokines
that are induced by bleomycin may be better candidates for regulators
of EC-SOD gene transcription (32, 36). Several
investigators have found that inflammatory cytokines such as
interferon-
(2) and interleukin-1 (25) can induce EC-SOD in rat and human cell culture lines. One
pathway common to both of these pathways is nuclear factor-
B
(2). Nuclear factor-
B is also a putative
regulatory element in the human EC-SOD gene (13). Thus
early increases in EC-SOD may be a result of an influx of inflammatory
cells that carry EC-SOD protein, yet, later increases may be secondary
to the effects of the cytokine milieu on EC-SOD gene transcription.
However, in this model, bleomycin was administered as a single dose;
thus the level of lung EC-SOD before bleomycin administration may be more important than any subsequent induction of native mouse EC-SOD protein.
The difference in expression between the endogenous EC-SOD and the transgene EC-SOD is not surprising since the genes are under control of different promoters. The EC-SOD transgene utilized the human SPC promoter and not the mouse EC-SOD promoter. Our findings that bleomycin does not increase the EC-SOD transgenic protein are consistent with previous studies, which report that the SPC promoter is activated only in a sporadic manner after bleomycin injury (6, 7). Additionally, the cytokines that increase EC-SOD in cell culture have not been found to increase SPC message in whole lung preparations (5, 34).
There are several mechanisms by which EC-SOD may protect the lung from injury. Bleomycin administration generates free radicals that injure DNA (26, 40), lipids (15), and proteins (44). Superoxide is one of these free radical mediators and the lung is a major target organ of bleomycin injury. EC-SOD is abundant in lung tissue (24) and could directly attenuate lung injury by reducing superoxide concentrations in the extracellular space. Reduction of superoxide in the extracellular space might have several consequences, including decreased stimulation of fibroblasts and diminished inflammatory cell recruitment. For instance, bleomycin-induced superoxide production has been shown to stimulate fibroblasts to proliferate and differentiate into myofibroblasts, resulting in a histological appearance that is similar to idiopathic pulmonary fibrosis (41). Superoxide stimulates fibroblasts to secrete collagen (3) and mediates expression of selectins on endothelium, resulting in enhanced recruitment of leukocytes to the lung (1). Thus EC-SOD may protect both directly as an antioxidant and indirectly by blunting the initial inflammation that is induced during bleomycin administration.
The attenuation of bleomycin-induced lung injury with EC-SOD transgene
overexpression was similar to that reported by Tamagawa et al.
(38) with intravenous lecithinized SOD1. With a dose of
either 1 or 10 mg · kg
1 · day
1, these
investigators found an 11% reduction in lung weight, 16% reduction in
lung collagen, and 41% reduction in grade of fibrosis. Other
investigators have found similar reductions in lung edema, collagen
deposition, and fibrosis score after administration of high levels of
SOD2 (31) and other ROS scavengers (30).
Although these investigators did not report how much the injections
increased lung SOD activity, it is likely that their beneficial effect
was secondary to enhanced intravascular SOD activity, since all of these treatments were given parenterally. In the EC-SOD transgenic mice, EC-SOD overexpression occurred primarily in alveolar type II
cells and bronchial epithelial cells (12), suggesting that both the airway and alveolar epithelium may be important in defending against free radical injury after bleomycin. Furthermore, it is unlikely that the reduced lung injury in the EC-SOD transgenic mice is
due to differences other than an increase in EC-SOD, since cytosolic
SOD, mitochondrial SOD, glutathione peroxidase, glutathione, and
catalase have been reported to be identical in the lungs of wild-type
and EC-SOD transgenic mice (12). Although the protection afforded by EC-SOD overexpression was modest and incomplete, this is
the first report to suggest that alveolar and airway extracellular antioxidant enzymes can protect the lung from bleomycin-induced lung
fibrosis. This study was not statistically powered to detect differences in secondary outcomes such as weight loss and mortality. The lack of statistically significant improvement in these
multifactorial outcomes confirms that mediators besides extracellular
superoxide play a large role in the pathogenesis of bleomycin-induced
lung injury.
There are several compelling reasons why extracellular antioxidants might be beneficial in clinical treatment or prevention of pulmonary fibrosis. First, patients with pulmonary fibrosis have reduced epithelial lining fluid antioxidant capacity and elevated markers of oxidative stress (35). Second, administration of aerosolized glutathione has been shown to attenuate bleomycin-induced lung fibrosis (16, 23). Third, alveolar inflammatory cells from patients with pulmonary fibrosis produce excess extracellular superoxide (37). Thus targeting the extracellular space with mimics of EC-SOD may be a potentially beneficial intervention in patients suffering from pulmonary fibrosis or undergoing bleomycin chemotherapy.
In conclusion, bleomycin administration induced EC-SOD in the lung and overexpression of EC-SOD attenuated bleomycin-induced fibrosis. The only difference in the lungs that could explain the decreased fibrosis was a higher level of EC-SOD in the EC-SOD transgenic lungs [0.5 µg EC-SOD/mg lung protein in the wild-type vs. 1.5 µg EC-SOD/mg lung protein in the EC-SOD transgenic mice (12)]. Thus microgram amounts of extracellular SOD activity appear to be biologically effective at reducing bleomycin-induced lung fibrosis. This suggests that small increases in pulmonary extracellular SOD activity, by either pretreatment with EC-SOD or an extracellular SOD mimic, may be of potential therapeutic benefit in reducing bleomycin-induced lung injury.
| |
ACKNOWLEDGEMENTS |
|---|
The authors thank Dr. Brian Day for comments and suggestions.
| |
FOOTNOTES |
|---|
This work was supported in part by National Heart, Lung, and Blood Institute Grants HL-04407, HL-31992, and HL-42444, and the Andrew Goodman Fellowship in Medicine at National Jewish Medical and Research Center.
Address for reprint requests and other correspondence: R. P. Bowler, National Jewish Medical and Research Center, K707, 1400 Jackson St., Denver, CO 80206 (E-mail: BowlerR{at}njc.org).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
10.1152/ajplung.00058.2001
Received 13 February 2001; accepted in final form 5 November 2001.
| |
REFERENCES |
|---|
|
|
|---|
1.
Akgur, FM,
Brown MF,
Zibari GB,
McDonald JC,
Epstein CJ,
Ross CR,
and
Granger DN.
Role of superoxide in hemorrhagic shock-induced P-selectin expression.
Am J Physiol Heart Circ Physiol
279:
H791-H797,
2000.
2.
Brady, TC,
Chang LY,
Day BJ,
and
Crapo JD.
Extracellular superoxide dismutase is upregulated with inducible nitric oxide synthase after NF-
B activation.
Am J Physiol Lung Cell Mol Physiol
273:
L1002-L1006,
1997.
3.
Chandrakasan, G,
and
Bhatnagar RS.
Stimulation of collagen synthesis in fibroblast cultures by superoxide.
Cell Mol Biol
37:
751-755,
1991.
4.
Cunningham, ML,
Ringrose PS,
and
Lokesh BR.
Bleomycin cytotoxicity is prevented by superoxide dismutase in vitro.
Cancer Lett
21:
149-153,
1983.
5.
D'Angio, CT,
Finkelstein JN,
Lomonaco MB,
Paxhia A,
Wright SA,
Baggs RB,
Notter RH,
and
Ryan RM.
Changes in surfactant protein gene expression in a neonatal rabbit model of hyperoxia-induced fibrosis.
Am J Physiol Lung Cell Mol Physiol
272:
L720-L730,
1997.
6.
Daly, HE,
Baecher-Allan CM,
Barth RK,
D'Angio CT,
and
Finkelstein JN.
Bleomycin induces strain-dependent alterations in the pattern of epithelial cell-specific marker expression in mouse lung.
Toxicol Appl Pharmacol
142:
303-310,
1997.
7.
Daly, HE,
Baecher-Allan CM,
Paxhia AT,
Ryan RM,
Barth RK,
and
Finkelstein JN.
Cell-specific gene expression reveals changes in epithelial cell populations after bleomycin treatment.
Lab Invest
78:
393-400,
1998.
8.
Denholm, EM,
and
Phan SH.
Bleomycin binding sites on alveolar macrophages.
J Leukoc Biol
48:
519-523,
1990.
9.
Eckelman, WC,
Rzeszotarski WJ,
Siegel BA,
Kubota H,
Chelliah M,
Stevenson J,
and
Rebra RC.
Chemical and biologic properties of isolated radiolabeled bleomycin preparations.
J Nucl Med
16:
1033-1037,
1975.
10.
Enghild, JJ,
Thogersen IB,
Oury TD,
Valnickova Z,
Hojrup P,
and
Crapo JD.
The heparin-binding domain of extracellular superoxide dismutase is proteolytically processed intracellularly during biosynthesis.
J Biol Chem
274:
14818-14822,
1999.
11.
Fantone, JC,
and
Phan SH.
Oxygen metabolite detoxifying enzyme levels in bleomycin-induced fibrotic lungs.
Free Radic Biol Med
4:
399-402,
1988.
12.
Folz, RJ,
Abushamaa AM,
and
Suliman HB.
Extracellular superoxide dismutase in the airways of transgenic mice reduces inflammation and attenuates lung toxicity following hyperoxia.
J Clin Invest
103:
1055-1066,
1999.
13.
Folz, RJ,
and
Crapo JD.
Extracellular superoxide dismutase (SOD3): tissue-specific expression, genomic characterization, and computer-assisted sequence analysis of the human EC SOD gene [published erratum Genomics 23: 723, Oct 1994].
Genomics
22:
162-171,
1994.
14.
Galvan, L,
Huang CH,
Prestayko AW,
Stout JT,
Evans JE,
and
Crooke ST.
Inhibition of bleomycin-induced DNA breakage by superoxide dismutase.
Cancer Res
41:
5103-5106,
1981.
15.
Giri, SN,
Misra HP,
Chandler DB,
and
Chen ZL.
Increases in lung prolyl hydroxylase and superoxide dismutase activities during bleomycin-induced lung fibrosis in hamsters.
Exp Mol Pathol
39:
317-326,
1983.
16.
Hagiwara, SI,
Ishii Y,
and
Kitamura S.
Aerosolized administration of N-acetylcysteine attenuates lung fibrosis induced by bleomycin in mice.
Am J Respir Crit Care Med
162:
225-231,
2000.
17.
Halliwell, B,
and
Gutteridge JMC
Free Radicals in Biology and Medicine: Oxford, UK: Oxford University Press, 1999.
18.
Ishida, R,
and
Takahashi T.
Increased DNA chain breakage by combined action of bleomycin and superoxide radical.
Biochem Biophys Res Commun
66:
1432-1438,
1975.
19.
Karam, H,
Hurbain-Kosmath I,
and
Housset B.
Antioxidant activity in alveolar epithelial type 2 cells of rats during the development of bleomycin injury.
Cell Biol Toxicol
14:
13-22,
1998.
20.
Ledwozyw, A.
Protective effect of liposome-entrapped superoxide dismutase and catalase on bleomycin-induced lung injury in rats. II. Phospholipids of the lung surfactant.
Acta Physiol Hung
78:
157-162,
1991.
21.
Loenders, B,
Van Mechelen E,
Nicolai S,
Buyssens N,
Van Osselaer N,
Jorens PG,
Willems J,
Herman AG,
and
Slegers H.
Localization of extracellular superoxide dismutase in rat lung: neutrophils and macrophages as carriers of the enzyme.
Free Radic Biol Med
24:
1097-1106,
1998.
22.
Lopez-De Leon, A,
and
Rojkind M.
A simple micromethod for collagen and total protein determination in formalin-fixed paraffin-embedded sections.
J Histochem Cytochem
33:
737-743,
1985.
23.
MacNee, W,
and
Rahman I.
Oxidants/antioxidants in idiopathic pulmonary fibrosis.
Thorax
50, Suppl1:
S53-S58,
1995.
24.
Marklund, SL.
Human copper-containing superoxide dismutase of high molecular weight.
Proc Natl Acad Sci USA
79:
7634-7638,
1982.
25.
Marklund, SL.
Regulation by cytokines of extracellular superoxide dismutase and other superoxide dismutase isoenzymes in fibroblasts.
J Biol Chem
267:
6696-6701,
1992.
26.
Martin, WJ II,
and
Kachel DL.
Bleomycin-induced pulmonary endothelial cell injury: evidence for the role of iron-catalyzed toxic oxygen-derived species.
J Lab Clin Med
110:
153-158,
1987.
27.
Matalon, S,
Harper WV,
Goldinger JM,
Nickerson PA,
and
Olszowka J.
Modification of pulmonary oxygen toxicity by bleomycin treatment.
J Appl Physiol
58:
1802-1809,
1985.
28.
McCord, JM,
and
Fridovich I.
Superoxide dismutase. An enzymic function for erythrocuprein (hemocuprein).
J Biol Chem
244:
6049-6055,
1969.
29.
Muller, WE,
and
Zahn RK.
Determination of the bleomycin-inactivating enzyme in biopsies.
GANN
67:
425-430,
1976.
30.
Nici, L,
Santos-Moore A,
Kuhn C,
and
Calabresi P.
Modulation of bleomycin-induced pulmonary toxicity in the hamster by the antioxidant amifostine.
Cancer
83:
2008-2014,
1998.
31.
Parizada, B,
Werber MM,
and
Nimrod A.
Protective effects of human recombinant MnSOD in adjuvant arthritis and bleomycin-induced lung fibrosis.
Free Radic Res Commun
15:
297-301,
1991.
32.
Phan, SH,
and
Kunkel SL.
Lung cytokine production in bleomycin-induced pulmonary fibrosis.
Exp Lung Res
18:
29-43,
1992.
33.
Pron, G,
Belehradek J, Jr,
Orlowski S,
and
Mir LM.
Involvement of membrane bleomycin-binding sites in bleomycin cytotoxicity.
Biochem Pharmacol
48:
301-310,
1994.
34.
Pryhuber, GS,
Bachurski C,
Hirsch R,
Bacon A,
and
Whitsett JA.
Tumor necrosis factor-
decreases surfactant protein B mRNA in murine lung.
Am J Physiol Lung Cell Mol Physiol
270:
L714-L721,
1996.
35.
Rahman, I,
Skwarska E,
Henry M,
Davis M,
O'Connor CM,
FitzGerald MX,
Greening A,
and
MacNee W.
Systemic and pulmonary oxidative stress in idiopathic pulmonary fibrosis.
Free Radic Biol Med
27:
60-68,
1999.
36.
Smith, RE,
Strieter RM,
Phan SH,
Lukacs N,
and
Kunkel SL.
TNF and IL-6 mediate MIP-1alpha expression in bleomycin-induced lung injury.
J Leukoc Biol
64:
528-536,
1998.
37.
Strausz, J,
Muller-Quernheim J,
Steppling H,
and
Ferlinz R.
Oxygen radical production by alveolar inflammatory cells in idiopathic pulmonary fibrosis.
Am Rev Respir Dis
141:
124-128,
1990.
38.
Tamagawa, K,
Taooka Y,
Maeda A,
Hiyama K,
Ishioka S,
and
Yamakido M.
Inhibitory effects of a lecithinized superoxide dismutase on bleomycin-induced pulmonary fibrosis in mice.
Am J Respir Crit Care Med
161:
1279-1284,
2000.
39.
Tarnell, EB,
Oliver BL,
Johnson GM,
Watts FL,
and
Thrall RS.
Superoxide anion production by rat neutrophils at various stages of bleomycin-induced lung injury.
Lung
170:
41-50,
1992.
40.
Trush, MA,
Mimnaugh EG,
Ginsburg E,
and
Gram TE.
Studies on the interaction of bleomycin A2 with rat lung microsomes. II. Involvement of adventitious iron and reactive oxygen in bleomycin-mediated DNA chain breakage.
J Pharmacol Exp Ther
221:
159-165,
1982.
41.
Vyalov, SL,
Gabbiani G,
and
Kapanci Y.
Rat alveolar myofibroblasts acquire alpha-smooth muscle actin expression during bleomycin-induced pulmonary fibrosis.
Am J Pathol
143:
1754-1765,
1993.
42.
Weisiger, RA,
and
Fridovich I.
Mitochondrial superoxide simutase. Site of synthesis and intramitochondrial localization.
J Biol Chem
248:
4793-4796,
1973.
43.
Yamazaki, C,
Hoshino J,
Hori Y,
Sekiguchi T,
Miyauchi S,
Mizuno S,
and
Horie K.
Effect of lecithinized-superoxide dismutase on the interstitial pneumonia model induced by bleomycin in mice.
Jpn J Pharmacol
75:
97-100,
1997.
44.
Yamazaki, C,
Hoshino J,
Sekiguchi T,
Hori Y,
Miyauchi S,
Mizuno S,
and
Horie K.
Production of superoxide and nitric oxide by alveolar macrophages in the bleomycin-induced interstitial pneumonia mice model.
Jpn J Pharmacol
78:
69-73,
1998.
This article has been cited by other articles:
![]() |
T. R. Richens, D. J. Linderman, S. A. Horstmann, C. Lambert, Y.-Q. Xiao, R. L. Keith, D. M. Boe, K. Morimoto, R. P. Bowler, B. J. Day, et al. Cigarette Smoke Impairs Clearance of Apoptotic Cells through Oxidant-dependent Activation of RhoA Am. J. Respir. Crit. Care Med., June 1, 2009; 179(11): 1011 - 1021. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Dahl, R. P. Bowler, K. Juul, J. D. Crapo, S. Levy, and B. G. Nordestgaard Superoxide Dismutase 3 Polymorphism Associated with Reduced Lung Function in Two Large Populations Am. J. Respir. Crit. Care Med., November 1, 2008; 178(9): 906 - 912. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Gongora, H. E. Lob, U. Landmesser, T. J. Guzik, W. D. Martin, K. Ozumi, S. M. Wall, D. S. Wilson, N. Murthy, M. Gravanis, et al. Loss of Extracellular Superoxide Dismutase Leads to Acute Lung Damage in the Presence of Ambient Air: A Potential Mechanism Underlying Adult Respiratory Distress Syndrome Am. J. Pathol., October 1, 2008; 173(4): 915 - 926. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. N. Zelko, M. R. Mueller, and R. J. Folz Transcription Factors Sp1 and Sp3 Regulate Expression of Human Extracellular Superoxide Dismutase in Lung Fibroblasts Am. J. Respir. Cell Mol. Biol., August 1, 2008; 39(2): 243 - 251. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Gao, J. R. Koenitzer, J. M. Tobolewski, D. Jiang, J. Liang, P. W. Noble, and T. D. Oury Extracellular Superoxide Dismutase Inhibits Inflammation by Preventing Oxidative Fragmentation of Hyaluronan J. Biol. Chem., March 7, 2008; 283(10): 6058 - 6066. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Kamezaki, H. Tasaki, K. Yamashita, M. Tsutsui, S. Koide, S. Nakata, A. Tanimoto, M. Okazaki, Y. Sasaguri, T. Adachi, et al. Gene Transfer of Extracellular Superoxide Dismutase Ameliorates Pulmonary Hypertension in Rats Am. J. Respir. Crit. Care Med., January 15, 2008; 177(2): 219 - 226. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ganguly, T. Stoeger, S. C. Wesselkamper, C. Reinhard, M. A. Sartor, M. Medvedovic, C. R. Tomlinson, I. Bolle, J. M. Mason, G. D. Leikauf, et al. Candidate genes controlling pulmonary function in mice: transcript profiling and predicted protein structure Physiol Genomics, November 14, 2007; 31(3): 410 - 421. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Cuzzocrea, S. Ronchetti, T. Genovese, E. Mazzon, M. Agostini, R. Di Paola, E. Esposito, C. Muia, G. Nocentini, and C. Riccardi Genetic and pharmacological inhibition of GITR-GITRL interaction reduces chronic lung injury induced by bleomycin instillation FASEB J, January 1, 2007; 21(1): 117 - 129. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Juul, A. Tybjaerg-Hansen, S. Marklund, P. Lange, and B. G. Nordestgaard Genetically Increased Antioxidative Protection and Decreased Chronic Obstructive Pulmonary Disease Am. J. Respir. Crit. Care Med., April 15, 2006; 173(8): 858 - 864. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. L. Kinnula, C. L. Fattman, R. J. Tan, and T. D. Oury Oxidative Stress in Pulmonary Fibrosis: A Possible Role for Redox Modulatory Therapy Am. J. Respir. Crit. Care Med., August 15, 2005; 172(4): 417 - 422. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Genovese, S. Cuzzocrea, R. Di Paola, E. Mazzon, C. Mastruzzo, P. Catalano, M. Sortino, N. Crimi, A. P. Caputi, C. Thiemermann, et al. Effect of rosiglitazone and 15-deoxy-{Delta}12,14-prostaglandin J2 on bleomycin-induced lung injury Eur. Respir. J., February 1, 2005; 25(2): 225 - 234. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kida, M. Yoshida, S. Hoshino, K. Inoue, Y. Yano, M. Yanagita, T. Kumagai, T. Osaki, I. Tachibana, Y. Saeki, et al. Protective effect of IL-6 on alveolar epithelial cell death induced by hydrogen peroxide Am J Physiol Lung Cell Mol Physiol, February 1, 2005; 288(2): L342 - L349. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Tan, C. L. Fattman, S. C. Watkins, and T. D. Oury Redistribution of pulmonary EC-SOD after exposure to asbestos J Appl Physiol, November 1, 2004; 97(5): 2006 - 2013. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. P. Bowler, M. Nicks, K. Tran, G. Tanner, L.-Y. Chang, S. K. Young, and G. S. Worthen Extracellular Superoxide Dismutase Attenuates Lipopolysaccharide-Induced Neutrophilic Inflammation Am. J. Respir. Cell Mol. Biol., October 1, 2004; 31(4): 432 - 439. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Crapo Redox Active Agents in Inflammatory Lung Injury Am. J. Respir. Crit. Care Med., November 1, 2003; 168(9): 1027 - 1028. [Full Text] |
||||
![]() |
V. L. Kinnula and J. D. Crapo Superoxide Dismutases in the Lung and Human Lung Diseases Am. J. Respir. Crit. Care Med., June 15, 2003; 167(12): 1600 - 1619. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. P. Bowler, J. Arcaroli, E. Abraham, M. Patel, L.-Y. Chang, and J. D. Crapo Evidence for extracellular superoxide dismutase as a mediator of hemorrhage-induced lung injury Am J Physiol Lung Cell Mol Physiol, April 1, 2003; 284(4): L680 - L687. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. P. Bowler and J. D. Crapo Oxidative Stress in Airways: Is There a Role for Extracellular Superoxide Dismutase? Am. J. Respir. Crit. Care Med., December 15, 2002; 166(12): S38 - 43. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |