|
|
||||||||
Departments of 1 Pediatrics and 2 Microbiology and Immunology, School of Medicine of Virginia Commonwealth University, Richmond, Virginia 23298-0276
| |
ABSTRACT |
|---|
|
|
|---|
To determine if the alveolar macrophage
inflammatory cytokine response to oxygen differs in premature cells,
macrophages were obtained from litters of premature (27 days) and term
(31 days) rabbits. The majority of these cells were nonspecific
esterase positive and actively phagocytosed latex particles. The cells that expressed cytokines also reacted with a monoclonal antibody against rabbit macrophages. After incubation overnight in 5 or 95%
oxygen, the amount of interleukin (IL)-1
and IL-8 mRNA was assessed
by RT-PCR and the amount of cytokine protein by quantitative immunofluorescence microscopy. The preterm macrophage showed a significant increase in cytokine mRNA and protein after overnight incubation in 95% oxygen. This response was not seen in the term cells. Only premature macrophages had a significant increase in intracellular oxygen radical content, measured by
2',7'-dichlorofluorescin analysis, after incubation in 95% oxygen.
This enhanced inflammatory cytokine response to oxygen may be one
mechanism involved in the early development of chronic lung disease in
premature infants.
chronic lung disease; prematurity; rabbits
| |
INTRODUCTION |
|---|
|
|
|---|
CHRONIC LUNG DISEASE (CLD) can occur in newborn infants who require supplemental oxygen and positive pressure ventilation after birth. The incidence of CLD is directly proportional to the degree of prematurity (38). This is true for the classic form of this condition, originally called bronchopulmonary dysplasia, as well as the newer type of CLD, which occurs after less intense exposure to hyperoxia and volutrauma. This latter condition is associated with the younger and smaller infants who are surviving in greater numbers compared with 30 years ago (25).
It has been known for almost 20 years that infants who would go
on to develop CLD have a stronger and more prolonged acute inflammatory
response in their lungs compared with those who recover from
respiratory distress syndrome (RDS) without long-term sequelae (34). More recently, several investigators reported that
inflammatory mediators such as interleukin (IL)-1
(37),
IL-6 (5), tumor necrosis factor (TNF)-
(27), and IL-8 (29) are present in higher
concentrations in lung lavage from babies who develop CLD. These
mediators are present in animal models of CLD (9), and there is evidence that they play an active role in the early
pathophysiology of CLD (33).
Although several different environmental and infectious stimuli have been implicated in the initiation of the lung injury that culminates in CLD, the major ones are mechanical ventilation and oxygen toxicity (1). In some animal models, the latter is felt to be the stronger risk factor for CLD (10). Oxygen, through formation of oxygen radicals, can damage tissue, and radicals can act as secondary messengers to promote elaboration of mediators (42). Because the premature lung is deficient in its antioxidant capacity (3), exposure to oxygen is likely to lead to an increase in oxygen radical formation (17). After injury from oxygen, an inflammatory reaction develops in the lungs, orchestrated through the local elaboration of chemical mediators, including the cytokines listed above. Many different cells in the lung can express inflammatory mediators (28), but the alveolar macrophage is the most likely initial source of cytokines after exposure to hyperoxia (7).
The relationships between prematurity and CLD and between early inflammation and CLD are well established. However, the relationship between prematurity and the pulmonary inflammatory response to oxygen has not been extensively investigated. Specifically, it is not known whether the premature alveolar macrophage reaction to hyperoxia is different from that seen in macrophages from term lungs. In part, this may have been due to limitations in techniques available to study cells that are present in relatively fewer numbers in the premature lungs. By pooling cells obtained by lung lavage from litters of rabbits and by employing amplification techniques to measure the amount of cytokine mRNA and protein expressed after in vitro hyperoxia exposure, we have been able to examine how prematurity affects the alveolar macrophage cytokine response to oxygen.
| |
METHODS |
|---|
|
|
|---|
Female New Zealand White rabbits with timed pregnancies were obtained from commercial breeders and kept for at least 4 days to allow for acclimatization. Animals were given food ad libitum, provided with nesting boxes, and given 12-h light/dark cycles.
Litters of preterm (27-day gestation) and term (31-day gestation) fetuses were delivered by hysterotomy immediately after pentobarbital sodium euthanasia of the doe, and each pup was given a lethal dose of pentobarbital intraperitoneally within seconds of delivery. This prevented significant exposure to room air oxygen. All protocols were approved by the Institutional Animal Care and Use Committee.
Lung lavage was performed through a 23- or 25-gauge (for the term and preterm pups, respectively) butterfly needle placed in the trachea under direct visualization. Each pup was lavaged three times with 1 ml of warmed 150 mM NaCl-1 mM EDTA solution. The aspirates from each pup in the litter were pooled and kept on ice. For adult rabbits, lavage was performed with five aliquots of 10 ml each of the NaCl-EDTA solution.
The pooled samples were centrifuged at 1,200 g × 10 min at 4°C, the red cells were lysed in 1 ml of endotoxin-free water, and the cells were recentrifuged at 1,200 g × 3 min at 4°C before being suspended in complete medium (RPMI 1640 with 10% fetal calf serum, 2 mM L-glutamine, 25 mM HEPES, 100 U/ml penicillin, and 100 µg/ml streptomycin). Fetal calf serum was from Sigma (St. Louis, MO), and medium and additives were from Bio-Whittaker (Walkersville, MD). Manual cell counts and viability by 0.2% trypan blue exclusion were performed, and the volume was adjusted to a final concentration of 25 × 103 live cells/ml. In sterile 96-well plates, 0.2 ml of cell suspension (5 × 103 cells) was placed in a well, and the plates were incubated in 5% O2-5% CO2-balance N2 at 37°C for 2 h. We removed nonadherent cells by washing gently three times with Hanks' balanced salt solution (Bio-Whittaker). Complete medium was then added back, and the plates were placed in the 5% O2-5% CO2 environment or in a modular chamber (Billups-Rothenberg, Del Mar, CA), which was then flushed with 95% O2-5% CO2 at 5 l/min × 90 s and incubated at 37°C overnight. Oxygen tension of the medium after overnight incubation in the chamber was >500 mmHg (model 165 Ciba-Corning blood gas analyzer; Bayer Diagnostics, Tarrytown, NY). In some experiments, adult or term cells were incubated in low or high oxygen with or without 1 µg/ml of endotoxin (Escherichia coli lipopolysaccharide, serotype 026:B6; Sigma).
Cell characterization. Cells from preterm and term litters were incubated on chamber slides and then processed for May-Grunwald/Giemsa staining for morphology, for nonspecific esterase staining (Sigma), or for phagocytosis, based on an overnight incubation in 5% oxygen with 9 × 107 1 µm sterile latex beads (Sigma) in 0.2 ml of complete medium. Alveolar macrophages were identified by immunofluorescent staining with RAM11, a monoclonal antibody specific for an intracellular antigen in rabbit macrophages (41) as described below.
Reverse transcription-polymerase chain reaction.
Total RNA was isolated using a single step guanidine-urea-phenol system
(Ultraspec II; Biotecx, Houston, TX), extracted in chloroform,
precipitated in isopropanol and then 75% ethanol, and stored at
80°C in diethyl pyrocarbonate-treated water. It was
uncommon to have sufficient RNA from the newborn animals to perform any
direct quantitation, so a housekeeping gene,
-actin, was used in a
semiquantitative RT-PCR assay to correct for differing yields of RNA.
or IL-8 gene (at 1.2 µM) and for
-actin (0.6 µM) were added. The PCR reaction then proceeded
through 36 cycles at 95°C × 71 s, 65°C × 61 s, and 72°C × 82 s, followed by a 10-min extension at
72°C. For IL-1
, the primers were
3'-GACCCTCCTTGTAAGGCTTGCTTTAG and
5'-TCCCTGGTGTTGTCTGGCACGTATGA,
which nets a 437-bp product between positions 890 and 453 of the rabbit
gene (32). The IL-8 primers were
3'-GAGTGGACCTCACTGTGCAA
and 5'-GCCAGTGGCAACAAATAACA and
defined a 594-bp portion of the IL-8 gene between position 197 and 791 (43). The other primer pair was
3'-CTCCGTGAGGATCTTCATGAGGTAGT and
5'-CGCGAGAAGATGACCCAGATCATGTT,
giving a 221-bp product from position 660 to 421 of the rabbit
-actin gene (20). PCR products were resolved on a 2%
agarose gel, transferred to a Nytran membrane (Schleicher & Schuell,
Keene NH) overnight in 2× SSC, and then ultraviolet cross-linked to
the membrane (Stratolinker UV, 1,200 µJ).
For the Southern blot, the IL-1
or IL-8 and the
-actin probes
(100 ng each) were end-labeled with 750 and 150 µCi 32P,
respectively (DNA 5'-End Labeling Kit; Boehringer-Mannheim, Indianapolis, IN). The IL-1
probe
CCTGTCCTGCGTGATGAAAGACGATAAACC was complementary to position 609-638 of the rabbit gene
(32). The IL-8 probe,
CTGTCGTAGGGCTGCCTGATAAAATGTAGG,
was complementary to positions 430-459 of the rabbit gene
(43), and the
-actin probe,
CATCGTGATGGACTCTGGCGACGGGGTCAC,
was complementary to positions 525-554 for rabbit
-actin
(20). The blot was incubated for 1 h at 37°C in
hybridization solution [0.1% BSA (wt/vol), 0.1% polyvinylpyrrolidone
(wt/vol), 0.1% Ficoll, 2× SSC, 0.1% SDS (wt/vol), 0.025% yeast RNA
(wt/vol) in 50 mM sodium phosphate, pH 6.5] and then hybridized
overnight at 37°C in the same solution containing both probes. The
blot was then washed with 2× SSC-0.1% SDS × 10 min at 37°C
twice and 0.2× SSC-0.1% SDS × 1 h at 37°C twice. The labeled blot was exposed to X-ray film at room temperature. At least
three different experiments were performed with each age group, and
Figs. 2 and 3 are representative of the same results obtained within
each age group.
Intracellular immunofluorescent staining. Lung lavage cells were incubated on glass chamber slides (LabTek 8 chamber slides; Nalge, Napierville, IL) using 0.4 ml (~1 × 104 cells)/chamber, incubated, and washed as described above and then placed in 95% O2-5% CO2 overnight. Four hours before staining, medium was replaced with fresh medium containing 0.133 µl of monensin solution/well (Cytostain kit; PharMingen, San Diego, CA). After aspirating off the medium with monensin, we fixed and stained the cells according the manufacturer's instructions accompanying the Cytostain kit. In brief, the cells were first fixed for 20 min in fixation/permeabilization buffer. All subsequent dilutions and washes were performed with the wash solution supplied, which contains saponin and 0.1% sodium azide in phosphate-buffered saline. Wells were washed twice between each incubation. Blocking antibodies (100 µg/ml) were incubated for 10 min, and first and second antibodies for 30 min. All incubations were performed at 4°C, and the final incubation was in the dark.
Antibodies utilized for IL-1
staining were, in sequence, goat IgG
(Sigma), polyclonal goat anti-human IL-1
(5 µg/ml; R & D Systems,
Minneapolis, MN), pig IgG (Sigma), and fluorescein isothiocyanate
(FITC)-labeled pig anti-goat IgG (1:30; Boehringer-Mannheim). Antibodies utilized for IL-8 were mouse IgG (Sigma), mouse anti-rabbit IL-8 (5 µg/ml, clone 2g3.2; PharMingen), rat IgG (Sigma), and FITC-labeled rat anti-mouse IgG1 (1:50; PharMingen). Rabbit
macrophage staining was performed utilizing mouse IgG (Sigma), mouse
anti-rabbit macrophage (1.2 µg/ml, clone RAM11; Dako, Carpinteria,
CA), donkey IgG (Sigma), and Texas red-labeled donkey anti-mouse IgG
(1:100; Jackson Immunoresearch, West Grove, PA).
After being stained, the cells were sequentially photographed during
exposure to light at 450-480 nm for FITC and then at 550-590
nm for Texas red, if necessary. All slides were either visualized
immediately or stored in the dark at 4°C for no more than 3 days.
Multiple ×200 images were captured from an Olympus Provus system
microscope through the attached high-speed charge-coupled device camera
(SenSys camera; Photometrics, Tucson, AZ).
Fluorescence was quantitated using IPLab Spectrum version 3.1 scientific image analysis software (Signal Analytics, Vienna, VA).
Background fluorescence was subtracted from each image. To control for
nonspecific fluorescence, the average fluorescent pixel density from
cells not incubated with the primary antibody was subtracted from the
fluorescence pixel density/cell from cells exposed to both the primary
and FITC-labeled secondary antibody. Mean fluorescence levels were
calculated from at least 100 cells per well. Mean cellular fluorescence
levels for each oxygen exposure were analyzed for significant
differences by two-way ANOVA and Tukey's post hoc t-test.
Intracellular oxygen radical content. After overnight incubation in 5 or 95% oxygen, the cells from the premature and term rabbits were incubated for 15 min in fresh medium supplemented with 10 µM 2',7'-dichlorofluorescin (DCF). DCF has been used to measure intracellular oxygen species in a large variety of cells types, including macrophages in many different species (22). The unoxidized dye is nonfluorescent and freely permeable through the cell membrane, but once exposed to reactive oxygen species (ROS), the DCF produced is both fluorescent and more polar. The fluorescent dye remains within the cell for up to 1 h (36). Overall, the relative amount of fluorescent dye present measures general oxidative stress and the steady-state concentration of ROS.
The cells were then exposed to fluorescent light, and microscopic images of dye-exposed and dye-unexposed cells were digitally captured. The amount of autofluorescence for each oxygen concentration and gestational age was calculated by image analysis from the non-DCF-exposed cells, and this value was subtracted from the fluorescence intensity values of the DCF-exposed cells. At least 100 cells per sample were used for the calculation. To determine if there were any significant differences between premature and term alveolar macrophages in the fluorescent density after hyperoxia, we analyzed the data by two-way ANOVA and then by Tukey's test.| |
RESULTS |
|---|
|
|
|---|
Cell characteristics. Each litter consisted of between 5 and 13 pups with a median of 8 pups per litter. The average total cell yields were 18,500 ± 8,900 (mean ± SE) cells/pup in premature rabbit litters and 102,900 ± 36,600 cells/pup for the term litters. The Mann-Whitney's test showed that the term litters had significantly more cells (P < 0.05), but this difference was not significant when cell yield was corrected for weight (619 ± 299 cells/g for the premature rabbits, 2,058 ± 732 cells/g for the term, P = 0.1). Term cells were >95% macrophage by morphology, nonspecific esterase positivity, and latex bead phagocytosis observation. In the preterm wells, 73-86% of the cells were macrophages by the three criteria, whereas the rest appeared to be epithelial cells.
In Fig. 1 are representative sequential photomicrographs of cells lavaged from a litter of preterm rabbits incubated overnight in 95% oxygen and stained with anti-IL-1
and
anti-rabbit macrophage antibodies. The bright cells, which are positive
for IL-1
, are also positively identified as macrophages.
|
Induction of cytokine message.
As seen in the representative example in Fig.
2, macrophages from the preterm rabbit
expressed a small amount of IL-8 mRNA in 5% oxygen, but after
overnight exposure to 95% oxygen there was an increase in the cytokine
message. The term macrophages did not demonstrate a similar IL-8 mRNA
change after hyperoxic exposure. Similarly, only preterm macrophages
showed a vigorous IL-1
message induction in 95% oxygen. The term
and adult macrophages expressed IL-1
mRNA when incubated with
endotoxin but not when exposed to hyperoxia (Fig.
3).
|
|
Induction of IL-8 protein.
The preterm macrophages also expressed more IL-8 protein after
hyperoxic exposure compared with term cells. Figure
4 includes representative
photomicrographs of fluorescently labeled anti-IL-8 from the two age
groups after 5 and 95% oxygen exposure. The mean fluorescence per cell
in each group is shown on the graph in Fig. 5 and is significantly elevated in the
preterm 95% oxygen-exposed cells compared with the 5% oxygen exposed.
|
|
Intracellular oxygen radical accumulation.
When cells were incubated overnight in 5 or 95% oxygen and then
incubated for 15 min in medium with DCF, there was a significant rise
in the mean fluorescent density in the premature macrophages, which was
not seen in the term cells. Figure 6
includes representative photomicrographs of cells from each age in each
oxygen concentration, and Fig. 7 is a
graph of the mean values for each group. Only the preterm cells had a
significant rise in cellular oxygen radical content after hyperoxia.
|
|
| |
DISCUSSION |
|---|
|
|
|---|
When exposed to concentrations of oxygen far in excess of what is
available in utero, the antioxidant-deficient premature lung produces
high amounts of reactive oxygen intermediates (ROI) (15,
17). In many, although not all, cell types, ROI activate transcription promoters such as nuclear factor (NF)-
B
(31). Most of the inflammatory cytokines that have been
found in the lungs of premature infants who develop CLD, including
IL-1
, TNF-
, IL-6, and IL-8, have NF-
B target sequences in
their promoter region (4). This would explain how exposure
to oxygen or to oxidant stress can promote expression of these
cytokines in vitro (11-13, 35). It would also explain
how, in the very premature infant with the least developed antioxidant
defenses, exposure to even small amounts of direct oxygen toxicity
could provoke the initial inflammatory signs that lead to CLD.
Evidence to support this pathophysiological model for CLD has all been indirect to date, due, in some measure, to the technical difficulties inherent in studying preterm animals or cells. The data presented in this study are, as far as we know, the first that directly demonstrate that cells from the premature lung behave differently when exposed to hyperoxia from those from term or adult lungs.
First, when incubated overnight, the premature macrophages had a significant increase in their intracellular oxygen radical content as measured by DCF fluorescence. DCF may be activated by a variety of radicals (21). Furthermore, activation of DCF may depend not only on the production rate of one or more radicals but also on the complex system of enzymatic and nonenzymatic antioxidants. Higher DCF fluorescence, therefore, may reflect the overall steady-state oxygen radical status within the cell. Thus these results do not identify a specific antioxidant deficiency or deficiencies in the preterm vs. the term rabbit macrophage.
When incubated overnight in 95% oxygen, preterm alveolar macrophages
increased their mRNA expression of the proinflammatory cytokines
IL-1
and IL-8. The amount of intracellular IL-8 protein was also
significantly elevated. There were too few macrophages to measure
secreted IL-8 in the medium. The macrophages lavaged from the lungs of
term rabbits did not respond. Term rabbits are more resistant
to hyperoxia-induced lung injury compared with premature rabbits, just
as premature human infants are more vulnerable to lung injury and CLD
(16). One reason may be that the term lung can upregulate
its antioxidant capabilities, whereas the preterm lung cannot
(16). Our findings now add another difference between the premature and the term lung after exposure to hyperoxia.
The macrophage is a major source of inflammatory cytokines in the lung.
Macrophages from patients with acute RDS produce increased amounts of
IL-8 (14). When rats were rendered macrophage deficient, they not only tolerated hyperoxia (7) but they also did
not demonstrate a rise in their intrapulmonary NF-
B activation
(30). Macrophages have been seen in the human fetal lung
as early as 20 wk of gestation (2), but the number of
macrophages recovered by lung lavage is low until a few hours to a day
before delivery (23). By 3-4 days of life, macrophage
numbers begin to approach adult levels when corrected for lung or body
weight (39). Although Jacobs et al. (24)
showed that, in preterm monkeys, the presence of RDS depressed the
number of macrophages, more recent work has shown that the number of
macrophages increases after birth with or without surfactant treatment
in preterm infants with RDS (19). During the course of
CLD, the macrophage is the predominant leukocyte obtained by lung
lavage (8). It is likely that, after preterm labor and
birth, macrophages are present and active. So, although in the
unactivated lung used in our experiments the low macrophage number in
the premature lung may reduce the significance of an increase in
cytokine expression, this may not be true in the preterm infant in whom
the lung macrophage population increases quickly after birth.
Because there are fewer macrophages in fetal animals delivered operatively, it is more difficult to study their function, but no alternative currently exists for obtaining unstimulated alveolar macrophages from premature animals. Pooling material from the lungs of complete litters of fetal rabbits that have not breathed allowed us to obtain a significant number of unstimulated preterm alveolar macrophages. In spite of this, we had to use techniques such as RT-PCR and quantitative immunohistochemistry to generate a detectable amount of DNA and protein for analysis.
These techniques are extremely sensitive and so may provide false
positive results. One source of error may be the relatively more
heterogeneous cell population obtained from the preterm lungs compared
with the term and adult lungs. This may especially affect the RT-PCR.
However, the IL-1
-producing cells in our study reacted strongly with
a monoclonal antibody that is specific for rabbit macrophages.
There is some controversy regarding the source(s) of alveolar
macrophages in the fetus. Evidence supports the model that the macrophage is derived from circulating monocytic cells that undergo final differentiation in the tissues (18). More recently,
data from lung explant cultures have given rise to the hypothesis that fetal lung macrophages may originate from mesenchymal cells present in
the pulmonary tissue (40). It is possible that the cells taken from the preterm rabbits were progeny of this mesenchymal source
and those from the term animals came from hematopoietic sources. This
possible difference in ontogeny might explain their difference in
responses to oxygen, but, since it is not possible, as of yet, to
differentiate these populations of macrophages (if they exist), this
explanation must remain speculative. Another possible explanation for
our findings is a higher cell death rate in the macrophages from the
older animals; i.e., these cells died before they were able to increase
cytokine levels. Both hyperoxia and excess ROI can induce cell
death, both by apoptosis and necrosis (6). This
does not seem likely in this study, however, since the preterm and term
rabbit macrophages cultured overnight in 95% oxygen were still capable
of expressing equal amounts of
-actin message. Another possibility
is that the cytokine reaction of term macrophages, while similar to
that of the preterm cells, is delayed beyond the overnight oxygen
exposure that can stimulate the premature macrophages. The term
macrophage did produce IL-1
mRNA in response to endotoxin during the
same incubation period. Even if there was some delay in the term cell,
the earlier response of the premature cells is consistent with the
pathophysiological model described above.
It is not clear if the overproduction of proinflammatory cytokines or the underproduction of counterregulatory cytokines, or a combination of both, is a predominant cause of lung damage in the premature infant. Jones et al. (26) noted that not only persistence of IL-8 but absence of IL-10 were seen in premature infants with RDS. Only inflammation promoters were examined in this study. The effect of prematurity on macrophage expression of anti-inflammatory cytokines has not been studied to date.
This study examined only one concentration of oxygen and one period of exposure. The relative paucity of preterm macrophages makes examination of a wide range of treatment conditions difficult. It is also difficult to test a series of antioxidants to determine whether oxygen radical blockade will reduce cytokine expression in premature macrophages, so our finding of a relationship among oxygen exposure, proinflammatory cytokine expression, and prematurity cannot yet be causally linked with a significant degree of certainty.
Because CLD is a disease of prematurity, determining how the preterm lung responds to relevant stimuli is critical. The data presented here outline two such differences, concentrating on one important risk factor and one cell response. Future studies will be needed to examine whether there are differences in the premature response to other agents, such as volutrauma or infection, and to other cells and the lung as a whole. Identifying the difference in the premature response may provide targets for therapies aimed at preventing CLD in premature infants.
| |
ACKNOWLEDGEMENTS |
|---|
The authors thank Drs. Alpha A. Fowler III, Thomas Paisley, Kenneth Roth, Christopher Shelbourne, and Gregory Klisch, and Bernard Fischer and Anne C. Eischeid for advice and help.
| |
FOOTNOTES |
|---|
This work was supported by an American Academy of Pediatrics resident research grant (P. G. Comber) and a March of Dimes basic research grant (H. J. Rozycki).
Address for reprint requests and other correspondence: H. J. Rozycki, Div. of Neonatal-Perinatal Medicine, Box 980276, MCV Station, Richmond, VA 23298-0276 (E-mail: hrozycki{at}hsc.vcu.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
First published January 18, 2002;10.1152/ajplung.00230.2001
Received 18 June 2001; accepted in final form 6 January 2002.
| |
REFERENCES |
|---|
|
|
|---|
1.
Abman, SH,
and
Groothuis JR.
Pathophysiology and treatment of bronchopulmonary dysplasia: current issues.
Pediatr Clin North Am
41:
277-315,
1994.
2.
Alenghat, E,
and
Esterly JR.
Alveolar macrophages in perinatal infants.
Pediatrics
74:
221-223,
1984.
3.
Asikainen, TM,
Raivio KO,
Saksela M,
and
Kinnula VL.
Expression and developmental profile of antioxidant enzymes in human lung and liver.
Am J Respir Cell Mol Biol
19:
942-949,
1998.
4.
Baeuerle, PA,
Rupec RA,
and
Pahl HL.
Reactive oxygen intermediates as second messengers of a general pathogen response.
Pathol Biol (Paris)
44:
29-35,
1996.
5.
Bagchi, A,
Viscardi RM,
Taciak V,
Ensor JE,
McCrea KA,
and
Hasday JD.
Increased activity of interleukin-6 but not tumor necrosis factor-alpha in lung lavage of premature infants is associated with the development of bronchopulmonary dysplasia.
Pediatr Res
36:
244-252,
1994.
6.
Barazzone, C,
Horowitz S,
Donati YR,
Rodriguez I,
and
Piguet PF.
Oxygen toxicity in mouse lung: pathways to cell death.
Am J Respir Cell Mol Biol
19:
573-581,
1998.
7.
Berg, JT,
White JE,
and
Tsan MF.
Response of alveolar macrophage-depleted rats to hyperoxia.
Exp Lung Res
21:
175-185,
1995.
8.
Clement, A,
Chadelat K,
Sardet A,
Grimfeld A,
and
Tournier G.
Alveolar macrophage status in bronchopulmonary dysplasia.
Pediatr Res
23:
470-473,
1988.
9.
Coalson, JJ,
Winter VT,
Siler-Khodr T,
and
Yoder BA.
Neonatal chronic lung disease in extremely immature baboons.
Am J Respir Crit Care Med
160:
1333-1346,
1999.
10.
Davis, JM,
Dickerson B,
Metlay L,
and
Penney DP.
Differential effects of oxygen and barotrauma on lung injury in the neonatal piglet.
Pediatr Pulmonol
10:
157-163,
1991.
11.
Deaton, PR,
McKellar CT,
Culbreth R,
Veal CF,
and
Cooper JA.
Hyperoxia stimulates interleukin-8 release from alveolar macrophages and U937 cells: attenuation by dexamethasone.
Am J Physiol Lung Cell Mol Physiol
267:
L187-L192,
1994.
12.
DeForge, LE,
Preston AM,
Takeuchi E,
Kenney J,
Boxer LA,
and
Remick DG.
Regulation of interleukin 8 gene expression by oxidant stress.
J Biol Chem
268:
25568-25576,
1993.
13.
Desmarquest, P,
Chadelat K,
Corroyer S,
Cazals V,
and
Clement A.
Effect of hyperoxia on human macrophage cytokine response.
Respir Med
92:
951-960,
1998.
14.
Donnelly, SC,
Strieter RM,
Kunkel SL,
Walz A,
Robertson CR,
Carter DC,
Grant IS,
Pollok AJ,
and
Haslett C.
Interleukin-8 and development of adult respiratory distress syndrome in at-risk patient groups.
Lancet
13:
643-647,
1993.
15.
Frank, L,
Price LT,
and
Whitney PL.
Possible mechanism for late gestational development of the antioxidant enzymes in the fetal rat lung.
Biol Neonate
70:
116-127,
1996.
16.
Frank, L,
and
Sosenko IR.
Failure of premature rabbits to increase antioxidant enzymes during hyperoxic exposure: increased susceptibility to pulmonary oxygen toxicity compared with term rabbits.
Pediatr Res
29:
292-296,
1991.
17.
Freeman, BA,
and
Crapo JD.
Hyperoxia increases oxygen radical production in rat lungs and lung mitochondria.
J Biol Chem
256:
10986-10992,
1981.
18.
Godleski, JJ,
and
Brain JD.
The origin of alveolar macrophages in mouse radiation chimeras.
J Exp Med
136:
630-643,
1972.
19.
Grigg, J,
Arnon S,
Chase A,
and
Silverman M.
Inflammatory cells in the lungs of premature infants on the first day of life: perinatal risk factors and origin of cells.
Arch Dis Child
69:
40-43,
1993.
20.
Harris, DE,
Warshaw DM,
and
Periasamy M.
Nucleotide sequences of the rabbit alpha-smooth-muscle and beta-non-muscle actin mRNAs.
Gene
112:
265-266,
1992.
21.
Hempel, SL,
Buettner GR,
O'Malley YQ,
Wessels DA,
and
Flaherty DM.
Dihydrofluorescein diacetate is superior for detecting intracellular oxidants: comparison with 2',7'-dichlorodihydrofluorescein diacetate, 5(and 6)-carboxy-2',7'-dichlorodihydrofluorescein diacetate, and dihydrorhodamine 123.
Free Radic Biol Med
27:
146-159,
1999.
22.
Imrich, A,
and
Kobzik L.
Flow cytometric analysis of macrophage oxidative metabolism using DCFH.
Methods Mol Biol
91:
97-108,
1998.
23.
Jackson, JC,
Chi EY,
Wilson CB,
Truog WE,
Teh TC,
and
Hodson WA.
Sequence of inflammatory cell migration into lung during recovery from hyaline membrane disease in premature newborn monkeys.
Am Rev Respir Dis
135:
937-940,
1987.
24.
Jacobs, RF,
Wilson CB,
Palmer S,
Springmeyer SC,
Henderson WR,
Glover DM,
Kessler DLJ,
Murphy JH,
Hughes JP,
and
van Belle G.
Factors related to the appearance of alveolar macrophages in the developing lung.
Am Rev Respir Dis
131:
548-553,
1985.
25.
Jobe, AB,
and
Ikegami M.
Mechanisms initiating lung injury in the preterm.
Early Hum Dev
53:
81-94,
1998.
26.
Jones, CA,
Cayabyab RG,
Kwong KY,
Stotts C,
Wong B,
Hamdan H,
Minoo P,
and
deLemos RA.
Undetectable interleukin (IL)-10 and persistent IL-8 expression early in hyaline membrane disease: a possible developmental basis for the predisposition to chronic lung inflammation in preterm newborns.
Pediatr Res
39:
966-975,
1996.
27.
Jonsson, B,
Tullus K,
Brauner A,
Lu Y,
and
Noack G.
Early increase of TNF alpha and IL-6 in tracheobronchial aspirate fluid indicator of subsequent chronic lung disease in preterm infants.
Arch Dis Child
77:
F198-F201,
1997.
28.
Kelley, J.
Cytokines of the lung.
Am Rev Respir Dis
141:
765-788,
1990.
29.
Kotecha, S,
Chan B,
Azam N,
Silverman M,
and
Shaw RJ.
Increase in interleukin-8 and soluble intercellular adhesion molecule-1 in bronchoalveolar lavage fluid from premature infants who develop chronic lung disease.
Arch Dis Child
72:
F90-F96,
1995.
30.
Lentsch, AB,
Czermak BJ,
Bless NM,
Van Rooijen N,
and
Ward PA.
Essential role of alveolar macrophages in intrapulmonary activation of NF-kappaB.
Am J Respir Cell Mol Biol
20:
692-698,
1999.
31.
Li, N,
and
Karin M.
Is NF-kappaB the sensor of oxidative stress?
FASEB J
13:
1137-1143,
1999.
32.
Mori, S,
Goto F,
Goto K,
Ohkawara S,
Maeda S,
Shimada K,
and
Yoshinga M.
Cloning and sequence analysis of a cDNA for lymphocyte proliferation potentiating factor of rabbit polymorphonuclear leukocytes: identification as rabbit IL-1
.
Biochem Biophys Res Commun
150:
1237-1243,
1988.
33.
Narimanbekov, IO,
and
Rozycki HJ.
Effect of IL-1 blockade on inflammatory manifestations of acute ventilator-induced lung injury in a rabbit model.
Exp Lung Res
21:
239-254,
1995.
34.
Ogden, BE,
Murphy SA,
Saunders GC,
Pathak D,
and
Johnson JD.
Neonatal lung neutrophils and elastase/proteinase inhibitor imbalance.
Am Rev Respir Dis
130:
817-821,
1984.
35.
Remick, DG,
DeForge LE,
and
Villarete LH.
Oxidant regulation of cytokine gene expression.
In: Oxygen, Gene Expression and Cellular Function, edited by Clerch LB,
and Massaro D.. New York: Marcel Dekker, 1997, p. 243-277.
36.
Royall, JA,
and
Ischiropoulos H.
Evaluation of 2',7'-dichlorfluorescin and dihydrorhodamine 123 as fluorescent probes for intracellular H2O2 in cultured endothelial cells.
Arch Biochem Biophys
302:
348-355,
1993.
37.
Rozycki, HJ.
Bronchoalveolar interleukin-1 beta in infants on day 1 of life.
South Med J
87:
991-996,
1994.
38.
Rozycki, HJ,
and
Narla L.
Early versus late identification of infants at high risk of developing moderate to severe bronchopulmonary dysplasia.
Pediatr Pulmonol
21:
345-352,
1996.
39.
Sieger, L.
Pulmonary alveolar macrophages in pre- and post-natal rabbits.
J Reticuloendothel Soc
23:
389-395,
1978.
40.
Sorokin, SP,
McNelly NA,
and
Hoyt RF.
CFU-rAM, the origin of lung macrophages, and the macrophage lineage.
Am J Physiol Lung Cell Mol Physiol
263:
L299-L307,
1992.
41.
Tsudaka, T,
Rosenfeld M,
Ross R,
and
Gowan AM.
Immunocytochenmical analysis of cellular components in atherosclerotic lesions. Use of monoclonal antibodies with the Watanabe and fat-fed rabbit.
Arteriosclerosis
6:
601-613,
1986.
42.
Winrow, VR,
Winyard PG,
Morris CJ,
and
Blake DR.
Free radicals in inflammation: second messengers and mediators of destruction.
Br Med Bull
49:
507-522,
1993.
43.
Yoshimura, T,
and
Yukhi N.
Neutrophil attractant/activation protein-1 and monocyte chemoattractant protein-1 in rabbit-cDNA cloning and their expression in spleen cells.
J Immunol
146:
3483-3488,
1991.
This article has been cited by other articles:
![]() |
J. D. Lang, M. Figueroa, K. D. Sanders, M. Aslan, Y. Liu, P. Chumley, and B. A. Freeman Hypercapnia via Reduced Rate and Tidal Volume Contributes to Lipopolysaccharide-induced Lung Injury Am. J. Respir. Crit. Care Med., January 15, 2005; 171(2): 147 - 157. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |