|
|
||||||||
1 Department of Pediatrics, UCLA School of Medicine and Mattel Children's Hospital at UCLA; and 2 Departments of Biological Chemistry and Molecular Pharmacology, and Molecular Biology Institute, University of California, Los Angeles, California 90095
| |
ABSTRACT |
|---|
|
|
|---|
Cytokines and other mediators whose induction in inflammatory lung disease is attenuated by glucocorticoids are potential targets for development of selective anti-inflammatory treatments. We refer to genes with these regulatory characteristics as glucocorticoid-attenuated response genes, or GARGs. Systematic identification of GARGs has not been attempted previously in vivo. Using an endotoxemia model in adrenalectomized mice, we constructed a subtracted lung library enriched in endotoxemia-induced genes and identified candidate GARGs by differential hybridization screening. Northern analysis confirmed induction in the lung during endotoxemia and attenuation by glucocorticoids of 36 genes of diverse types. The majority were genes of unknown function not previously implicated in the pulmonary response to inflammation, including a new member of a 2'-5'-oligoadenylate synthetase-like family and a novel lung inducible Neuralized-related C3HC4 RING protein. Our results suggest that a full understanding of glucocorticoid effects on lung inflammation will require elucidation of the roles of an extensive network of glucocorticoid-modulated genes.
gene expression; inflammation; lipopolysaccharide; molecular cloning; mouse model
| |
INTRODUCTION |
|---|
|
|
|---|
INFLAMMATION IS
REGULATED, in part, by the anti-inflammatory actions of the
adrenal glucocorticoid hormones. Even at physiological concentrations
in unstressed animals, glucocorticoids exert an important restraining
effect on inflammatory responses (40, 41). Systemic stress
causes increased secretion of glucocorticoids, which help to limit the
injury potentially caused by uncontrolled activation of inflammatory
mediators. Adrenalectomy sensitizes animals to the lethal effects of
endotoxin, interleukin (IL)-1
, tumor necrosis factor (TNF)-
, and
viral infection, but increased glucocorticoid receptor gene dosage or
pretreatment with glucocorticoids is protective (7, 38, 50,
53). Because of their broad and powerful anti-inflammatory
effects, glucocorticoids have remained important agents in the
treatment of many inflammatory diseases, including asthma, for nearly a
half century.
Inflammation is also thought to have important roles in the pathophysiologies of bronchopulmonary dysplasia (BPD) in neonates (14, 29, 60) and of acute respiratory distress syndrome (ARDS) (11, 68, 70). Demonstrable short-term improvements in respiratory function, sometimes dramatic, resulted in widespread use of postnatal glucocorticoids for attempted prevention or treatment of BPD during the past decade. Improvement in long-term outcome has not been demonstrated, however. Because of the potential for serious adverse effects, including neurodevelopmental impairment, the routine use of corticosteroids for prevention or treatment of BPD in preterm infants is no longer recommended (3, 4, 6, 20). The results of using glucocorticoids for prevention or treatment of acute ARDS have also been disappointing (11, 68, 70), although a large multicenter trial is currently evaluating the use of glucocorticoids in the late, fibrosing phase of ARDS. The limited effectiveness of glucocorticoids in BPD and ARDS may be due, in part, to adverse effects of glucocorticoids on lung growth and repair that negate the potential benefits of reduced lung inflammation. If specific sets of inflammatory mediators important in the pathophysiology of these diseases could be identified, it might be possible to develop selective anti-inflammatory treatments that are safer and more effective.
One approach to finding new targets for anti-inflammatory treatments of
lung diseases may be to identify lung-expressed genes whose activity is
modulated by glucocorticoids. Although other mechanisms also
contribute, a major part of the anti-inflammatory actions of
glucocorticoids is attributed to their ability to attenuate the
induction of genes encoding a variety of mediators important in
inflammatory and immune responses (1, 5). Glucocorticoids inhibit the induction of the inducible form of prostaglandin H synthetase (cyclooxygenase 2), the inducible form of nitric oxide synthetase, and numerous inflammatory cytokines and chemokines including IL-1, TNF-
, and IL-8 (1, 5, 58). We refer to inflammatory stimulus-induced genes whose message expression is attenuated by glucocorticoids as glucocorticoid-attenuated response genes, or GARGs.
We previously suggested that there are many GARGs not yet described and tested that hypothesis in a cell culture model (58). Before that study, all of the known GARGs had been identified either via assays of their biological activity or by procedures based on screening for inducibility. In each case, glucocorticoid attenuation was investigated after the gene or its product had been identified. In our study, differential hybridization screening of a Swiss 3T3 cell library identified 12 different lipopolysaccharide (LPS)-inducible GARG cDNAs (58). Five were previously undescribed murine sequences, including a new chemokine, LPS-induced C-X-C chemokine, or LIX (58). The high proportion of new sequences identified in that small-scale screening supported the hypothesis that many GARGs remained to be identified. We subsequently verified that endotoxemia-induced LIX expression was strongly glucocorticoid attenuated in the lungs of adrenalectomized (ADX) mice (51). In contrast, the related chemokines KC and macrophage inflammatory protein (MIP)-2 were LPS induced but not glucocorticoid attenuated in the lungs of the ADX or normal mice, despite the ability of glucocorticoids to attenuate the induction of KC and MIP-2 induction in cell culture studies. These results emphasized the importance of in vivo studies for determining which genes are subject to attenuation by glucocorticoids in specific models of lung inflammation.
The goal of the present study was to identify GARGs induced in the lung
during endotoxemia. We hoped to identify novel genes, as well as genes
not previously implicated in lung inflammation, as candidates for
further study in other models. We also hoped to gain a better
understanding of characteristics of the GARG class as a whole. An
advantage of the endotoxemia model for this study is that intravenous
injection of LPS triggers the prompt release of endogenous mediators
including TNF-
, IL-1
, and interferon (IFN)-
, so downstream
genes responsive to these mediators, as well as those directly
responsive to LPS, are induced. Although the timing and pattern of gene
expression will differ in specific disease models, many of the genes
induced during endotoxemia are expected to participate in a wide
variety of acute and chronic inflammatory lung diseases. ADX mice were
used for the screening to eliminate the effects of endogenous
glucocorticoids and maximize potential message attenuation in
response to an exogenous steroid. The expression characteristics of
candidate GARG cDNAs were evaluated in normal as well
as ADX mice.
Anticipating that GARG messages would constitute only a small fraction
of the total mRNA population in the lung, we used a two-stage screening
strategy. First, a subtracted library enriched in endotoxemia-induced
genes was constructed with lung RNA from ADX mice. The library was then
screened by differential hybridization to select candidate GARG clones.
Northern analysis confirmed glucocorticoid attenuation of
endotoxemia-induced lung expression for 36 GARG cDNAs. The majority
were genes of unknown function not previously implicated in the
pulmonary response to inflammation. Four were new murine sequences,
including the murine ortholog of the human IFN-inducible T-cell
-chemoattractant (I-TAC) chemokine (CXCL11), as we reported
previously (71), and a new member of the guanylate binding
protein (GBP) family, murine GBP-5. We report here the complete cDNA
sequences of a new member of the 2'-5'-oligoadenylate synthetase-like family (murine OASL-2), and a novel lung-inducible Neuralized-related C3HC4 RING domain protein (LINCR) and its predicted human homolog. The results of this study indicate that the network of
glucocorticoid-attenuated genes participating in the lung response to
endotoxemia is much more extensive and diverse than previously thought.
| |
METHODS |
|---|
|
|
|---|
Animals. ADX, sham-operated, and nonoperated male Swiss-Webster mice purchased from Charles River Laboratories (Cambridge, MA) were studied at 8-12 wk of age and at least 2 wk after operation. Mice were housed under specific pathogen-free conditions in the UCLA Health Sciences Center vivarium for at least 1 wk before experimental manipulation. ADX mice were supplied with normal saline instead of water to drink. All procedures were performed in accordance with protocols approved by the UCLA animal care and use committee.
Sterile, tissue culture-certified LPS prepared by phenol extraction and gel filtration from Escherichia coli serotype O111:B4 was obtained from Sigma (St. Louis, MO). Preservative- and pyrogen-free saline (Abbott Laboratories, North Chicago, IL) was used for dilution of LPS and for control injections. Dexamethasone sodium phosphate (Dex, 4 mg/ml of dexamethasone phosphate equivalent) for injection was obtained from Elkins-Sinn (Cherry Hill, NJ). LPS (50 µg in 200 µl of sterile saline) or saline alone was injected via the tail vein. Two 400-µg doses of Dex in 100 µl of saline or saline alone were injected subcutaneously 18-20 h before and 5 min before LPS. Lungs and other organs were harvested for RNA preparation as described (51).Construction of subtracted library. A cDNA population enriched in endotoxemia-induced messages was generated using the suppression subtraction hybridization (SSH) technique (17, 18). Lung RNA for the "tester" population was prepared from ADX mice killed 1, 2, or 4 h after tail vein injection of LPS (4-5 mice per group). Lung RNA for the "driver" population was prepared from ADX mice treated with two doses of Dex as above, and the mice were killed 1, 2, and 4 h after the second dose (4 mice per group). Poly-A-selected RNAs were prepared from the pooled tester and pooled driver RNAs using the PolyATtract I kit (Promega, Madison, WI). After first- and second-strand synthesis, the tester and driver cDNAs were digested with RsaI, and aliquots of the tester cDNA were separately ligated to the SSH adapters I and II from the PCR-Select cDNA Subtraction Kit (Clontech, Palo Alto, CA). Sequential 7- and 16-h hybridizations of the driver with the adapted tester cDNAs and PCR amplification of the subtracted cDNAs were performed as described in the PCR-Select manual.
The PCR-amplified subtracted cDNAs had an XmaI site and an EagI site at opposite ends of the cDNA insert within adapter-derived sequences. The subtracted cDNAs were sequentially digested with XmaI and EagI and then ligated to EcoRI-SalI-XmaI and XhoI-NcoI-EagI adapters we designed. The EcoRI-SalI-XmaI adapter was prepared by annealing nonphosphorylated AATTCTCCAGCGTGTCGACT with 5'-phosphorylated CCGGAGTCGACACGCTGGAG. Nonphosphorylated TCGAGTGCTGTGTAGGTATCCAT and 5'-phosphorylated GGCCATGGATACCTACACAGCAC were annealed to generate the XhoI-NcoI-EagI adapter. After the ligation, we removed excess adapters and short cDNAs by passing the reaction mixture over Chromaspin-200 columns (Clontech) three times. The adapted cDNAs using T4 kinase (New England Biolabs), ligated to EcoRI- and XhoI-digested
Zap II (Stratagene,
La Jolla, CA), and packaged with Gigapack Gold III (Stratagene) were
then phosphorylated. The primary library, containing 4 × 105 phage (95% recombinants), was amplified once. The cDNA
insert sizes of 18 randomly selected phages ranged from 460 to 1,230 nt
(mean 630).
Phage screening and analysis.
Diluted aliquots from the subtracted library were plated at a density
of
950 plaques per 150-mm petri dish. One additional dish was plated
with
200 plaques. Each plate was also inoculated at specific
locations with plaque-pure control phages containing inserts of LIX,
monocyte chemoattractant protein (MCP)-1, and ribosomal protein S2
(rpS2) cDNA. Poly-A-selected RNA for the "LPS probe" was prepared
from pooled lung RNA from 10 ADX mice killed 2 h after LPS
injection. RNA for the "LPS-Dex" probe was from lungs of 12 ADX
mice pretreated with two doses of Dex and killed 2 h after LPS.
RNA for the control probe was from lungs of Dex-treated ADX mice.
Replicate filter lifts, cDNA probe synthesis, and hybridization were
performed as described (59).
3 mm from the nearest neighbor on the low-density phage filter. To
identify redundant phages within group 1, we hybridized replicate filter arrays of the phage inserts with selected insert probes. Group 1 replicates among the remaining candidates
were identified by hybridizing a replicate filter from the library screening with pooled group 1 probes (after removal of
adapter sequences). Among the 83 remaining candidates, the 32 group 2 plaques were those whose nearest neighbor was
1 mm
distant and for which the major plaque component could be identified
unambiguously by PCR. The 35 candidates remaining after elimination of
group 2 replicates were plaque purified by differential
hybridization (group 3).
Full-length cDNAs.
A nonsubtracted cDNA library in
Zap II, prepared from lung RNA of
LPS-treated ADX mice as described (71), was screened by
hybridization with the candidate LINCR insert. Potential full-length phages were converted to plasmid form and sequenced. IMAGE Consortium (37) clones for OASL-2 and human LINCR were obtained from
Incyte Genomics (Palo Alto, CA).
Northern analysis and ribonuclease protection assay.
Northern analysis of total cellular RNA, 10 µg/lane, was performed as
described (51, 58). Autoradiographic signal intensities were quantitated by PhosphorImaging (Molecular Dynamics, Sunnyvale, CA). Corrections for lane-to-lane variations in loading were made using
the signal intensity of the same filter reprobed with rpS2. We verified
that LPS and Dex did not affect lung expression of rpS2 message under
the conditions used in this study (51, 71). Signal
intensities for IFN-
and IL-6 were determined by ribonuclease protection assay (MCK-1 probe set; BD Pharmingen, San Diego, CA) and
corrected for loading variations using the rpL32 signal.
Sequence analysis. Sequence analysis and contig assembly were performed with MacVector and AssemblyLign (Accelrys, Madison, WI). We performed multiple alignment and phylogenetic analysis using Clustal W (64) and drew tree diagrams from the Clustal W output using TreeView (43). The human LINCR cDNA was predicted from genomic sequences using the GENSCAN (12) and Fgenes (http:// genomic.sanger.ac.uk/) programs. We determined the positions of ubiquitin-like domains in the OASL proteins by searching the National Center for Biotechnology Information conserved domain database (2).
| |
RESULTS |
|---|
|
|
|---|
Identification of candidate GARG cDNAs. To identify candidate GARG cDNAs, we constructed a subtracted library enriched in endotoxemia-induced genes and then screened the library by differential hybridization. The subtraction was performed using the SSH technique (17, 18), as described in METHODS. The tester and driver were RsaI-digested cDNA populations prepared from lung RNA of LPS-treated and of Dex-treated ADX mice, respectively. The differential hybridization screening was performed by hybridizing replicate filter lifts of the subtracted library phage with 1) an LPS cDNA probe synthesized from lung RNA of ADX mice killed 2 h after intravenous injection of LPS, 2) an LPS-Dex probe from lung RNA of ADX mice pretreated with Dex and killed 2 h after intravenous injection of LPS, and 3) a control cDNA probe from lung RNA of ADX mice treated with Dex. The criteria for selection of GARG candidate phage plaques were 1) increased signal density on the LPS filter compared with the control filter (induction during endotoxemia) and 2) decreased signal on the LPS-Dex filter compared with the LPS filter (glucocorticoid attenuation). More than 90% of the library clones screened satisfied the first criterion, verifying that the library was highly enriched in endotoxemia-induced genes. From a screening of 6,600 plaques, we identified 599 candidate GARG phage satisfying both criteria (9% of the phage screened).
The candidate phage were analyzed in three stages (see METHODS). The 42 group 1 clones yielded cDNAs for 12 different genes, 10 of which were subsequently confirmed as GARGs by Northern analysis (below). The group 2 and group 3 clones yielded 19 and 24 additional genes, respectively, of which 13 in each group were confirmed as GARGs. In accordance with the expectation that the randomly picked group 1 clones were likely to be those most abundant in the subtracted library, all had been cloned previously. There were two novel cDNAs (GBP-5 and LINCR) in group 2 and two (I-TAC and OASL-2) in group 3. Because of the method used to eliminate replicate phage, the abundances of clones for the cDNAs in groups 1 and 2 were not determined. However, 11 of the 13 confirmed group 3 GARGs were represented by a single clone. The large proportion of single isolates among the group 3 clones indicates that the screening was not exhaustive.Candidate gene expression in normal and ADX mice.
To confirm the identification of GARG cDNAs and eliminate false
positives among the 55 final candidates, we evaluated their expression
characteristics by Northern analysis. First, induction during
endotoxemia and attenuation by Dex of all candidates were evaluated in
normal (nonoperated) mice. Our criteria for a GARG message were
1) an endotoxemia-induced increase in lung message expression of twofold or more and 2) attenuation by Dex of
25% or more of the endotoxemia-induced increase. Thirty-five of the 55 candidate cDNAs met both of these criteria in normal mice
(Table 1).
|
|
, MCP-1,
MIP-1
, and IFN-inducible GTPase (IIGP). The ADX-enhanced LPS-induced expression of these genes was reduced by Dex to levels similar to those in LPS-Dex-treated normal and sham-operated mice (Fig.
1), which indicates that the enhancement of LPS-induced expression in
ADX mice was due to loss of the endogenous glucocorticoid response and
not to other effects of adrenalectomy.
Characteristics of the GARG cDNAs.
The 36 GARG cDNAs identified in this study include diverse categories
of genes (Table 1). Although all were induced by LPS and attenuated by
Dex, they exhibited wide quantitative differences in responses to LPS
and Dex in normal mice and qualitative differences in the effect of
adrenalectomy. IFN-
, IL-6, LIX, and monokine induced by IFN-
(MIG), previously identified as GARGs and included in Table 1 for
comparison, were not among the 36 cDNAs identified in the
screen. This provides a further indication that the screening was not exhaustive. Four of the cDNAs cloned in the GARG screening were
new murine sequences: I-TAC, GBP-5, OASL-2, and LINCR. Our results for
murine I-TAC were reported previously (71). The sequence
features and expression characteristics of murine GBP-5, a new member
of the GBP family of large GTPases (46, 72), will be
described separately (T. T. Nguyen and J. B. Smith,
unpublished data). The complete cDNA sequences of OASL-2 and
LINCR are described below.
Identification of a new OASL gene, murine OASL-2.
One of the group 3 clones had an incomplete open reading
frame with similarity to the human 2'-5'-OASL and murine
M1204/OASL-p54 proteins (26, 49, 65). We refer to M1204
and its presumed alternative splice form (GenBank AK010034) as murine
OASL-1. To clarify the relationship of our partial cDNA to these genes, we searched the GenBank expressed sequence tag database and identified what proved to be a full-length OASL-2 cDNA (IMAGE clone
3661036). The complete sequence was assigned GenBank accession
number AF426289. The OASL-2 cDNA is 2,070 nt, including a 15-nt poly-A
tail after the consensus polyadenylation signal AATAAA at nt
2,031-2,036. The cDNA contains a 1,533-nt open reading frame
encoding the 511-amino acid (AA) residue OASL-2 protein, which has a
molecular mass of 59 kDa and a predicted isoelectric point of
7.53. The initiating ATG at nt 27-30 is the first ATG in
the sequence and occurs in the context GCCatgG, which matches the
strong consensus context (A/G)NNatgG for
translation initiation (32). Murine OASL-2 message was
induced >100-fold in lungs of LPS-treated mice and attenuated by Dex
(Table 1, Fig. 1). The
2.5-kb message was expressed in the small
intestine of control mice and strongly induced during endotoxemia in
the heart, liver, spleen, small intestine, and kidneys (not shown), as
well as in the lung (Fig. 1).
340-residue amino terminal domain similar to human
2'-5'-oligoadenylate synthetase 1 (OAS-1). Human OAS-1 consists
largely of a single OAS domain (Fig. 3A), whereas OAS-2 has
two and OAS-3 has three tandem OAS repeats (not shown). The OASL
domains of the OASL family members are 37-43% identical to human
OAS-1. In contrast, the murine OAS-1 and human OAS-1 proteins are 67%
identical.
|
|
Identification of a novel Neuralized-related RING domain protein,
LINCR.
The LINCR cDNA was represented by a single group 2 candidate
clone containing a 2,078-nt insert with an incomplete open reading frame at the 5'-end. Northern blotting using the insert as a probe identified a single 2.8-kb band in lung RNA from LPS-treated mice. Basic local alignment search tool (BLAST) searching revealed no significant matches to known sequences. Four full-length LINCR clones
were obtained by screening a nonsubtracted library prepared from the
same RNA used for the tester population of the subtracted library. Two
clones were completely sequenced on both strands and were identical
except for a silent polymorphism at nt 105 of the 2,588-nt consensus
sequence, which includes a 15-nt poly-A tail. The LINCR sequence was
assigned GenBank accession number AF321278. The sequence contains a
762-nt open reading frame encoding the predicted LINCR protein and a
1,759-nt 3'-untranslated region with a single AUUUA sequence,
associated with rapid message degradation (54) at
1,111-1,115. The first ATG in the sequence, at 61-63, occurs
in the context CTGatgG, which is adequate for translation initiation (32). In contrast, the next ATG, at
89-91, is in the context CCAatgC, which is
highly unfavored. Identification of ATG 61-63 as encoding the
initiating methionine is also supported by the similarities, described
below, between LINCR and other conserved proteins. In contrast,
translations of other open reading frames in the LINCR cDNA had no
detectable homology to other proteins in any species. There is no
in-frame upstream stop codon before ATG 61-63, so the possibility
of an upstream ATG not included in the LINCR cDNA sequence cannot be
ruled out entirely. However, the observed mRNA size of 2.8 kb is
consistent with the 2,573-nt length of the cDNA plus a
200-nt poly-A tail.
|
|
Identification of a predicted human LINCR homolog. A translated BLAST search of the GenBank draft human genome sequence database using the murine LINCR protein sequence identified a closely related gene on human chromosome 2p11 (GenBank NT026970.3). Analysis of the genomic sequence identified exons encoding the predicted sequence of human LINCR (Fig. 4). Within the region shown, human LINCR is 67% identical and 9% similar to murine LINCR. The NH2-terminal region of human LINCR is not shown in Fig. 4 because alternative exon predictions for this region could not be distinguished. To date, we have not identified a cDNA clone encoding the complete human LINCR. However, the portion of human LINCR shown in Fig. 4 is encoded by a segment of IMAGE clone 3346442 (GenBank BC012317). Despite our uncertainty about its amino terminal region, human LINCR is likely to be similar to murine LINCR in containing only a single NR domain, because no second NR domain occurs within the 60 kb of contiguous sequence upstream of this gene, or indeed anywhere in the available human chromosome 2 sequence.
| |
DISCUSSION |
|---|
|
|
|---|
Glucocorticoid hormones act via the glucocorticoid receptor to modulate the expression of a large number of genes involved in inflammatory and immune responses and other processes (1, 39). This study focuses on the subset of genes whose induction in response to inflammatory stimuli is attenuated by glucocorticoids, which we refer to as GARGs to distinguish them from noninduced genes whose expression is reduced by glucocorticoids. Our underlying hypothesis is that GARG expression characteristics define a large subset of inflammation-related genes and that identifying and determining the functions of GARGs participating in specific disease processes will reveal new targets for therapeutic intervention.
The results of this study, the first to attempt the systematic
identification of GARGs in an in vivo model, indicate that genes with
these regulatory characteristics are numerous and diverse. As expected,
some of the 36 cDNAs cloned and verified as GARGs by Northern analysis
in this study (Table 1) represent well-known proinflammatory mediators,
including IL-1
, the chemokines IP-10, MCP-1, and MIP-1
, and
adhesion proteins ICAM-1, P-selectin, and vascular cell adhesion
molecule-1. The presence of suppressor of cytokine
signaling-3, a negative feedback regulator of IFN-
signaling
(31, 61), serves as an important reminder that anti- as
well as proinflammatory mediators may have GARG expression characteristics. In addition, many of the cDNAs we cloned represent genes of unknown function or genes not previously associated with lung inflammation. Four were previously unknown sequences. All these
genes are candidates for further study to determine their functional
roles in lung disease models. The collection as a whole should also be
useful in studies of the diverse molecular mechanisms by which
glucocorticoids attenuate gene expression (1, 5).
The GARG cDNAs identified in this study represent diverse functional
and structural categories of genes (Table 1). Half of these cDNAs were
originally identified as IFN-inducible genes. These include
the three members of the IFN-induced tetratricopeptide repeat domain
family (p56 or IFN-inducible-56 family) cloned in our earlier GARG
screening in 3T3 cells (13, 36, 57, 69) and multiple
members of the GBP and IRG-47 families of IFN-inducible GTP-binding
proteins (8, 25, 46, 66). It was recently demonstrated that the IRG-47 family member IFN-
-induced GTPase (Table 1) is involved in host resistance to Toxoplasma
gondii (24, 63). Human GBP-1 and murine GBP-2 have
recently been shown to modulate cell proliferation (22,
23). The chemokines IP-10 and MIG, which together with I-TAC
form a distinct subgroup of C-X-C chemokines (71), were
also originally cloned as IFN-inducible genes (19). The
fact that a high proportion of the genes identified in this study were
originally described as IFN-inducible genes may reflect, in part, the
role of IFN-
release in endotoxemia. However, it may also be a
reflection of the major efforts devoted to characterizing
IFN-
-induced genes (9, 15), many of which are also
induced by LPS or other inflammatory cytokines.
We used ADX mice for our screening to eliminate the effects of
endogenous glucocorticoids and maximize potential message attenuation in response to an exogenous steroid. This choice was based on our
previous studies of LIX, whose endotoxemia-induced expression in the
lung and other tissues was glucocorticoid attenuated in ADX but not
normal mice (51). In the present study, we found that all
but one of the GARG cDNAs we identified were glucocorticoid attenuated
in normal as well as ADX mice (Table 1). However, significant
enhancements of endotoxemia-induced expression were observed for
several genes in addition to LIX, including IL-6, ICAM-1, P-selectin,
IL-1
, MCP-1, MIP-1
, and IIGP (Table 1). ADX-induced enhancement
of message expression has been described for IFN-
, IL-1
, IL-6,
and a few other cytokines in the spleen during murine cytomegalovirus
infection (53) and for IL-1
and IL-6 in spleens of
LPS-treated rats (45, 55). Interestingly, the LPS-induced
expression of the IFN-
-induced chemokines MIG and I-TAC was reduced
40-50% in ADX compared with normal and sham-operated mice (Table
1, Fig. 1), whereas expression of the closely related IFN-
-induced
chemokine IP-10 was unaffected by adrenalectomy. The mechanisms
responsible for these gene-specific effects of adrenalectomy have not
been studied. Perhaps the genes showing the largest ADX-induced
increases in LPS-induced expression are those most sensitive to
attenuation by endogenous glucocorticoids at the levels induced during
endotoxemia. Alternatively, the LPS-induced expression of specific
genes might be affected by loss of adrenal catecholamines and increased
norepinephrine secretion or by other compensatory responses to adrenalectomy.
The idea of finding new potential targets for anti-inflammatory
treatments by identifying genes with GARG regulatory characteristics is
applicable to other inflammatory models and is not limited to the
specific techniques used in this study. Microarrays are now more widely
available than at the time this study was initiated and would likely be
the method of choice for future studies. Nevertheless, microarrays
remain expensive and do not, as yet, provide true genome-wide coverage,
so screening of subtracted libraries should continue to be valuable for
certain applications. Some of the techniques developed for this study
may be useful to other investigators. Although the subtracted cDNAs
produced by the SSH procedure can be easily cloned into plasmid
vectors, differential screening of
-phages is more sensitive and
reproducible in our experience (59). Unfortunately, the
standard SSH adapters do not include sites convenient for cloning into
. Rather than alter the SSH adapters, which might have unpredictable
effects on the efficiency of the suppression PCR (17), we
designed adapters that facilitated both the cloning into
Zap II
and, by incorporating convenient restriction and primer sites, the
downstream analysis of phage inserts. The approaches we used to
identify phage inserts by PCR and to eliminate redundant phage by
hybridization avoided repeated differential screenings for plaque
purification and greatly reduced sequencing costs.
One of the cDNAs we cloned encoded a new OASL gene (26, 49, 65), which we call murine OASL-2. The functions of the OASL genes are unknown, but the OASs have a well-defined function in a regulated RNA decay pathway involved in the antiviral and growth inhibitory effects of IFNs (30, 48, 56). When activated by double-stranded (ds) RNA, the OAS enzymes catalyze the production of a mixture of 2'-5'-linked oligomers of adenylate (2-5A), whose only known function is to activate the latent ribonuclease RNase L. RNase L activation requires 2-5A oligomers containing three or more adenylates.
The OASL genes contain an NH2-terminal OAS-like domain plus two characteristic COOH-terminal ubiquitin-like domains not present in the OAS genes (Figs. 2 and 3A). Intrinsic ubiquitin-like domains may participate in regulating the activity or stability of some proteins (26), but the role of the ubiquitin-like domains in the OASL proteins has not been determined. The function of the OAS domain in the OASL proteins is uncertain also. Neither the p-59 and p-56 forms of human OASL had any detectable 2-5A synthetase activity (26, 49). In contrast, murine OASL-1 (M1204 form) synthesized 2-5A dimers (incapable of activating RNase L) but not larger oligomers. The activity was not dependent on or enhanced by dsRNA, however. The protein we refer to as chicken OASL has OAS activity and was originally described as chicken OAS (62, 73). The sizes of the 2-5A oligomers produced by chicken OAS/OASL and requirement for activation by dsRNA were not reported, however. From an evolutionary point of view, it will be very interesting to determine whether the chicken genome contains orthologs of the mammalian OAS genes (lacking ubiquitin-like domains) in addition to the OAS/OASL gene. If not, this would suggest that the mammalian OAS family evolved by gene duplication from an ancestral vertebrate OASL gene.
Phylogenetic analysis indicates that the OASL-2 protein is closely
related to human OASL (Fig. 3B). However, the expression patterns of these genes differ. We found that murine OASL-2 message was
easily detected in the small intestine but not the spleen in control
mice and, during endotoxemia, was strongly induced in the lung, heart,
liver, spleen, and kidneys (not shown). In contrast, expression of
human OASL message in small intestine was low, with greater expression
in spleen, peripheral blood leukocytes, and other tissues
(26). In cell lines, human OASL message was induced by
IFN-
or IFN-
(26, 49). Murine OASL-1 (M1204), cloned
from a murine spleen dendritic cell library, was expressed in thymus,
bone marrow, and mature dendritic cells, but not in the other
leukocytes tested, and was localized by in situ hybridization to
dendritic cells in spleen and lung (65). Future studies
directly comparing the expression and regulation of murine OASL-1 and
OASL-2 may provide useful clues about their functions.
The LINCR cDNA encodes a novel protein related to the Drosophila neuralized gene product, which is involved in Notch pathway-dependent cell fate decisions (34, 35, 75). The Neur protein is localized primarily to the plasma membrane (34, 75). It contains two copies of the distinctive NR domain, plus a COOH-terminal C3HC4 RING domain (10, 47). Recent studies have shown that the RING domains of Drosophila and Xenopus Neur have ubiquitin E3 ligase activity and that at least one of the targets of ubiquitination by Neur is the Notch ligand Delta (16, 33, 44, 74). Human and murine homologs of Drosophila neur have also been identified recently. Human Neur was cloned as potential tumor suppressor gene on chromosome 10 at a site frequently deleted in malignant astrocytomas (42). Remarkably, the murine and human Neur proteins are 94% identical (52, 67), suggesting that they serve a critical, highly conserved function.
Murine LINCR and its predicted human homolog on chromosome 2 (Fig. 4) share a COOH-terminal RING domain similar to those in murine, human, and Drosophila Neur, and in C. elegans F10D7.5 but have only a single NR domain (Fig. 5). Murine Neur was expressed in multiple tissues in the embryo but was detected in adults only in brain (52), consistent with functions in development and the nervous system. In contrast, LINCR mRNA was expressed in the adult mouse small intestine, a tissue constantly exposed to inflammatory stimulation by luminal bacteria. LINCR expression was also induced in the lung during endotoxemia and attenuated by Dex (Fig. 1 and data not shown). LINCR's expression pattern and structural similarity to Neur suggest the hypothesis that it may act as an E3 ligase to target for degradation one or more components of signaling pathways involved in innate immune or cell differentiation responses.
The 36 cDNAs identified in this study probably represent only a
fraction of the GARGs involved in the lung response to endotoxemia. We
know that the differential screening was not exhaustive, because eleven
of the 13 confirmed GARGs from the group 3 candidate pool were single isolates. Furthermore, known GARGs including IFN-
, IL-6,
LIX, and MIG (Table 1) were not identified in the screening, perhaps
because their message expression was low at the 2-h time point chosen
for the differential screening. Injection of LPS is expected to trigger
a cascade of immediate-early, early, and late gene induction, so we
would expect to identify different sets of GARGs if the evaluation were
performed at other time points. Together, our results suggest that
future studies using microarrays or other techniques could identify
many additional glucocorticoid-attenuated response genes whose
functions and roles in lung inflammation are presently unknown.
| |
ACKNOWLEDGEMENTS |
|---|
This work was supported by National Heart, Lung, and Blood Institute Grant HL-57008 to J. B. Smith.
| |
FOOTNOTES |
|---|
Present addresses: Heather Hughes, Dept. of Neurobiology and Behavior, Univ. of California, Irvine, CA; Leonor Rovai, Manufacturing Research & Technology, Alpha Therapeutic Corp., Los Angeles, CA.
Address for reprint requests and other correspondence: J. B. Smith, Pediatrics/Neonatology, UCLA Center for the Health Sciences B2-325, 10833 Le Conte Ave., Los Angeles, CA 90095 (E-mail: JBSmith{at}ucla.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
April 26, 2002;10.1152/ajplung.00496.2001
Received 31 December 2001; accepted in final form 11 April 2002.
| |
REFERENCES |
|---|
|
|
|---|
1.
Adcock, IM.
Molecular mechanisms of glucocorticosteroid actions.
Pulm Pharmacol Ther
13:
115-126,
2000[Web of Science][Medline].
2.
Altschul, SF,
Madden TL,
Schäffer AA,
Zhang J,
Zhang Z,
Miller W,
and
Lipman DJ.
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res
25:
3389-3402,
1997
3.
American Academy of Pediatrics and Canadian Paediatric Society.
Postnatal corticosteroids to treat or prevent chronic lung disease in preterm infants.
Pediatrics
109:
330-338,
2002
4.
Bancalari, E.
Corticosteroids and neonatal chronic lung disease.
Eur J Pediatr
157:
S31-S37,
1998[Medline].
5.
Barnes, PJ.
Anti-inflammatory actions of glucocorticoids: molecular mechanisms.
Clin Sci (Colch)
94:
557-572,
1998[Medline].
6.
Barrington, KJ.
The adverse neuro-developmental effects of postnatal steroids in the preterm infant: a systematic review of RCTs.
BMC Pediatr
1:
1,
2001[Medline].
7.
Bertini, R,
Bianchi M,
and
Ghezzi P.
Adrenalectomy sensitizes mice to the lethal effects of interleukin 1 and tumor necrosis factor.
J Exp Med
167:
1708-1712,
1988
8.
Boehm, U,
Guethlein L,
Klamp T,
Ozbek K,
Schaub A,
Fütterer A,
Pfeffer K,
and
Howard JC.
Two families of GTPases dominate the complex cellular response to IFN-gamma.
J Immunol
161:
6715-6723,
1998
9.
Boehm, U,
Klamp T,
Groot M,
and
Howard JC.
Cellular responses to interferon-gamma.
Annu Rev Immunol
15:
749-795,
1997[Web of Science][Medline].
10.
Boulianne, GL,
de la Concha A,
Campos-Ortega JA,
Jan LY,
and
Jan YN.
The Drosophila neurogenic gene neuralized encodes a novel protein and is expressed in precursors of larval and adult neurons.
EMBO J
10:
2975-2983,
1991[Web of Science][Medline].
11.
Brower, RG,
Ware LB,
Berthiaume Y,
and
Matthay MA.
Treatment of ARDS.
Chest
120:
1347-1367,
2001[Web of Science][Medline].
12.
Burge, C,
and
Karlin S.
Prediction of complete gene structures in human genomic DNA.
J Mol Biol
268:
78-94,
1997[Web of Science][Medline].
13.
Chebath, J,
Merlin G,
Metz R,
Benech P,
and
Revel M.
Interferon-induced 56,000 Mr protein and its mRNA in human cells: molecular cloning and partial sequence of the cDNA.
Nucleic Acids Res
11:
1213-1226,
1983
14.
Clark, RH,
Gerstmann DR,
Jobe AH,
Moffitt ST,
Slutsky AS,
and
Yoder BA.
Lung injury in neonates: causes, strategies for prevention, and long-term consequences.
J Pediatr
139:
478-486,
2001[Web of Science][Medline].
15.
De Veer, MJ,
Holko M,
Frevel M,
Walker E,
Der S,
Paranjape JM,
Silverman RH,
and
Williams BR.
Functional classification of interferon-stimulated genes identified using microarrays.
J Leukoc Biol
69:
912-920,
2001
16.
Deblandre, GA,
Lai EC,
and
Kintner C.
Xenopus neuralized is a ubiquitin ligase that interacts with XDelta1 and regulates Notch signaling.
Dev Cell
1:
795-806,
2001[Web of Science][Medline].
17.
Diatchenko, L,
Lau YF,
Campbell AP,
Chenchik A,
Moqadam F,
Huang B,
Lukyanov S,
Lukyanov K,
Gurskaya N,
Sverdlov ED,
and
Siebert PD.
Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries.
Proc Natl Acad Sci USA
93:
6025-6030,
1996
18.
Diatchenko, L,
Lukyanov S,
Lau YF,
and
Siebert PD.
Suppression subtractive hybridization: a versatile method for identifying differentially expressed genes.
Methods Enzymol
303:
349-380,
1999[Web of Science][Medline].
19.
Farber, JM.
Mig and IP-10: CXC chemokines that target lymphocytes.
J Leukoc Biol
61:
246-257,
1997[Abstract].
20.
Finer, NN,
Craft A,
Vaucher YE,
Clark RH,
and
Sola A.
Postnatal steroids: short-term gain, long-term pain?
J Pediatr
137:
9-13,
2000[Web of Science][Medline].
21.
Freemont, PS.
RING for destruction?
Curr Biol
10:
R84-R87,
2000[Web of Science][Medline].
22.
Gorbacheva VY, Lindner D, Sen GC, and Vestal DJ. The IFN-induced
GTPase, mGBP-2: role in IFN-
induced murine fibroblast
proliferation. J Biol Chem (November 28, 2001).
10.1074/jbc. M110542200.
23.
Guenzi, E,
Topolt K,
Cornali E,
Lubeseder-Martellato C,
Jorg A,
Matzen K,
Zietz C,
Kremmer E,
Nappi F,
Schwemmle M,
Hohenadl C,
Barillari G,
Tschachler E,
Monini P,
Ensoli B,
and
Sturzl M.
The helical domain of GBP-1 mediates the inhibition of endothelial cell proliferation by inflammatory cytokines.
EMBO J
20:
5568-5577,
2001[Web of Science][Medline].
24.
Halonen, SK,
Taylor GA,
and
Weiss LM.
Gamma interferon-induced inhibition of Toxoplasma gondii in astrocytes is mediated by IGTP.
Infect Immun
69:
5573-5576,
2001
25.
Han, BH,
Park DJ,
Lim RW,
Im JH,
and
Kim HD.
Cloning, expression, and characterization of a novel guanylate-binding protein, GBP3 in murine erythroid progenitor cells.
Biochim Biophys Acta
1384:
373-386,
1998[Medline].
26.
Hartmann, R,
Olsen HS,
Widder S,
Jorgensen R,
and
Justesen J.
p59OASL, a 2'-5' oligoadenylate synthetase like protein: a novel human gene related to the 2'-5' oligoadenylate synthetase family.
Nucleic Acids Res
26:
4121-4128,
1998
27.
Jackson, PK,
Eldridge AG,
Freed E,
Furstenthal L,
Hsu JY,
Kaiser BK,
and
Reimann JD.
The lore of the RINGs: substrate recognition and catalysis by ubiquitin ligases.
Trends Cell Biol
10:
429-439,
2000[Web of Science][Medline].
28.
Joazeiro, CA,
and
Weissman AM.
RING finger proteins: mediators of ubiquitin ligase activity.
Cell
102:
549-552,
2000[Web of Science][Medline].
29.
Jobe, AH,
and
Bancalari E.
Bronchopulmonary dysplasia.
Am J Respir Crit Care Med
163:
1723-1729,
2001
30.
Justesen, J,
Hartmann R,
and
Kjeldgaard NO.
Gene structure and function of the 2'-5'-oligoadenylate synthetase family.
Cell Mol Life Sci
57:
1593-1612,
2000[Web of Science][Medline].
31.
Karlsen, AE,
Ronn SG,
Lindberg K,
Johannesen J,
Galsgaard ED,
Pociot F,
Nielsen JH,
Mandrup-Poulsen T,
Nerup J,
and
Billestrup N.
Suppressor of cytokine signaling 3 (SOCS-3) protects beta-cells against interleukin-1beta- and interferon-gamma-mediated toxicity.
Proc Natl Acad Sci USA
98:
12191-12196,
2001
32.
Kozak, M.
Interpreting cDNA sequences: some insights from studies on translation.
Mamm Genome
7:
563-574,
1996[Web of Science][Medline].
33.
Lai, EC,
Deblandre GA,
Kintner C,
and
Rubin GM.
Drosophila neuralized is a ubiquitin ligase that promotes the internalization and degradation of delta.
Dev Cell
1:
783-794,
2001[Web of Science][Medline].
34.
Lai, EC,
and
Rubin GM.
Neuralized functions cell-autonomously to regulate a subset of notch-dependent processes during adult Drosophila development.
Dev Biol
231:
217-233,
2001[Web of Science][Medline].
35.
Lai, EC,
and
Rubin GM.
Neuralized is essential for a subset of Notch pathway-dependent cell fate decisions during Drosophila eye development.
Proc Natl Acad Sci USA
98:
5637-5642,
2001
36.
Lee, CG,
Demarquoy J,
Jackson MJ,
and
O'Brien WE.
Molecular cloning and characterization of a murine LPS-inducible cDNA.
J Immunol
152:
5758-5767,
1994[Abstract].
37.
Lennon, G,
Auffray C,
Polymeropoulos M,
and
Soares MB.
The IMAGE Consortium: an integrated molecular analysis of genomes and their expression.
Genomics
33:
151-152,
1996[Web of Science][Medline].
38.
Masferrer, JL,
Seibert K,
Zweifel B,
and
Needleman P.
Endogenous glucocorticoids regulate an inducible cyclooxygenase enzyme.
Proc Natl Acad Sci USA
89:
3917-3921,
1992
39.
McEwen, BS,
Biron CA,
Brunson KW,
Bulloch K,
Chambers WH,
Dhabhar FS,
Goldfarb RH,
Kitson RP,
Miller AH,
Spencer RL,
and
Weiss JM.
The role of adrenocorticoids as modulators of immune function in health and disease: neural, endocrine and immune interactions.
Brain Res Rev
23:
79-133,
1997[Medline].
40.
Munck, A,
Guyre PM,
and
Holbrook NJ.
Physiological functions of glucocorticoids in stress and their relation to pharmacological actions.
Endocr Rev
5:
25-44,
1984
41.
Munck, A,
and
Naray-Fejes-Toth A.
Glucocorticoids and stress: permissive and suppressive actions.
Ann NY Acad Sci
746:
115-130,
1994[Web of Science][Medline].
42.
Nakamura, H,
Yoshida M,
Tsuiki H,
Ito K,
Ueno M,
Nakao M,
Oka K,
Tada M,
Kochi M,
Kuratsu J,
Ushio Y,
and
Saya H.
Identification of a human homolog of the Drosophila neuralized gene within the 10q25.1 malignant astrocytoma deletion region.
Oncogene
16:
1009-1019,
1998[Web of Science][Medline].
43.
Page, RD.
TreeView: an application to display phylogenetic trees on personal computers.
Comput Appl Biosci
12:
357-358,
1996
44.
Pavlopoulos, E,
Pitsouli C,
Klueg KM,
Muskavitch MA,
Moschonas NK,
and
Delidakis C.
Neuralized encodes a peripheral membrane protein involved in delta signaling and endocytosis.
Dev Cell
1:
807-816,
2001[Web of Science][Medline].
45.
Pezeshki, G,
Pohl T,
and
Schobitz B.
Corticosterone controls interleukin-1 beta expression and sickness behavior in the rat.
J Neuroendocrinol
8:
129-135,
1996[Web of Science][Medline].
46.
Prakash, B,
Praefcke GJ,
Renault L,
Wittinghofer A,
and
Herrmann C.
Structure of human guanylate-binding protein 1 representing a unique class of GTP-binding proteins.
Nature
403:
567-571,
2000[Medline].
47.
Price, BD,
Chang Z,
Smith R,
Bockheim S,
and
Laughon A.
The Drosophila neuralized gene encodes a C3HC4 zinc finger.
EMBO J
12:
2411-2418,
1993[Web of Science][Medline].
48.
Rebouillat, D,
and
Hovanessian AG.
The human 2',5'-oligoadenylate synthetase family: interferon-induced proteins with unique enzymatic properties.
J Interferon Cytokine Res
19:
295-308,
1999[Web of Science][Medline].
49.
Rebouillat, D,
Marié I,
and
Hovanessian AG.
Molecular cloning and characterization of two related and interferon-induced 56-kDa and 30-kDa proteins highly similar to 2'-5' oligoadenylate synthetase.
Eur J Biochem
257:
319-330,
1998[Web of Science][Medline].
50.
Reichardt, HM,
Umland T,
Bauer A,
Kretz O,
and
Schütz G.
Mice with an increased glucocorticoid receptor gene dosage show enhanced resistance to stress and endotoxic shock.
Mol Cell Biol
20:
9009-9017,
2000
51.
Rovai, LE,
Herschman HR,
and
Smith JB.
The murine neutrophil-chemoattractant chemokines LIX, KC, and MIP-2 have distinct induction kinetics, tissue distributions, and tissue-specific sensitivities to glucocorticoid regulation in endotoxemia.
J Leukoc Biol
64:
494-502,
1998[Abstract].
52.
Ruan, Y,
Tecott L,
Jiang MM,
Jan LY,
and
Jan YN.
Ethanol hypersensitivity and olfactory discrimination defect in mice lacking a homolog of Drosophila neuralized.
Proc Natl Acad Sci USA
98:
9907-9912,
2001
53.
Ruzek, MC,
Pearce BD,
Miller AH,
and
Biron CA.
Endogenous glucocorticoids protect against cytokine-mediated lethality during viral infection.
J Immunol
162:
3527-3533,
1999
54.
Sachs, AB.
Messenger RNA degradation in eukaryotes.
Cell
74:
413-421,
1993[Web of Science][Medline].
55.
Schobitz, B,
Van Den Dobbelsteen M,
Holsboer F,
Sutanto W,
and
De Kloet ER.
Regulation of interleukin 6 gene expression in rat.
Endocrinology
132:
1569-1576,
1993
56.
Sen, GC.
Novel functions of interferon-induced proteins.
Semin Cancer Biol
10:
93-101,
2000[Web of Science][Medline].
57.
Smith, JB,
and
Herschman HR.
The glucocorticoid attenuated response genes GARG-16, GARG-39, and GARG-49/IRG2 encode inducible proteins containing multiple tetratricopeptide repeat domains.
Arch Biochem Biophys
330:
290-300,
1996[Web of Science][Medline].
58.
Smith, JB,
and
Herschman HR.
Glucocorticoid-attenuated response genes encode intercellular mediators, including a new C-X-C chemokine.
J Biol Chem
270:
16756-16765,
1995
59.
Smith, JB,
and
Herschman HR.
Identification of inflammatory mediators by screening for glucocorticoid-attenuated response genes.
Methods Enzymol
287:
250-265,
1997[Web of Science][Medline].
60.
Speer, CP.
New insights into the pathogenesis of pulmonary inflammation in preterm infants.
Biol Neonate
79:
205-209,
2001[Web of Science][Medline].
61.
Suzuki, A,
Hanada T,
Mitsuyama K,
Yoshida T,
Kamizono S,
Hoshino T,
Kubo M,
Yamashita A,
Okabe M,
Takeda K,
Akira S,
Matsumoto S,
Toyonaga A,
Sata M,
and
Yoshimura A.
CIS3/SOCS3/SSI3 plays a negative regulatory role in STAT3 activation and intestinal inflammation.
J Exp Med
193:
471-481,
2001
62.
Tatsumi, R,
Hamada K,
Sekiya S,
Wakamatsu M,
Namikawa T,
Mizutani M,
and
Sokawa Y.
2',5'-oligoadenylate synthetase gene in chicken: gene structure, distribution of alleles and their expression.
Biochim Biophys Acta
1494:
263-268,
2000[Medline].
63.
Taylor, GA,
Collazo CM,
Yap GS,
Nguyen K,
Gregorio TA,
Taylor LS,
Eagleson B,
Secrest L,
Southon EA,
Reid SW,
Tessarollo L,
Bray M,
McVicar DW,
Komschlies KL,
Young HA,
Biron CA,
Sher A,
and
Vande Woude GF.
Pathogen-specific loss of host resistance in mice lacking the IFN-gamma-inducible gene IGTP.
Proc Natl Acad Sci USA
97:
751-755,
2000
64.
Thompson, JD,
Higgins DG,
and
Gibson TJ.
CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice.
Nucleic Acids Res
22:
4673-4680,
1994
65.
Tiefenthaler, M,
Marksteiner R,
Neyer S,
Koch F,
Hofer S,
Schuler G,
Nussenzweig M,
Schneider R,
and
Heufler C.
M1204, a novel 2',5' oligoadenylate synthetase with a ubiquitin-like extension, is induced during maturation of murine dendritic cells.
J Immunol
163:
760-765,
1999
66.
Vestal, DJ,
Buss JE,
McKercher SR,
Jenkins NA,
Copeland NG,
Kelner GS,
Asundi VK,
and
Maki RA.
Murine GBP-2: a new IFN-gamma-induced member of the GBP family of GTPases isolated from macrophages.
J Interferon Cytokine Res
18:
977-785,
1998[Web of Science][Medline].
67.
Vollrath, B,
Pudney J,
Asa S,
Leder P,
and
Fitzgerald K.
Isolation of a murine homologue of the Drosophila neuralized gene, a gene required for axonemal integrity in spermatozoa and terminal maturation of the mammary gland.
Mol Cell Biol
21:
7481-7494,
2001
68.
Ware, LB,
and
Matthay MA.
The acute respiratory distress syndrome.
N Engl J Med
342:
1334-1349,
2000
69.
Wathelet, MG,
Clauss IM,
Content J,
and
Huez GA.
The IFI-56K and IFI-54K interferon-inducible human genes belong to the same gene family.
FEBS Lett
231:
164-171,
1988[Web of Science][Medline].
70.
Weinacker, AB,
and
Vaszar LT.
Acute respiratory distress syndrome: physiology and new management strategies.
Annu Rev Med
52:
221-237,
2001[Web of Science][Medline].
71.
Widney, DP,
Xia YR,
Lusis AJ,
and
Smith JB.
The murine chemokine CXCL11 (IFN-inducible T cell alpha chemoattractant) is an IFN-
- and lipopolysaccharide-inducible glucocorticoid-attenuated response gene expressed in lung and other tissues during endotoxemia.
J Immunol
164:
6322-6331,
2000
72.
Wynn, TA,
Nicolet CM,
and
Paulnock DM.
Identification and characterization of a new gene family induced during macrophage activation.
J Immunol
147:
4384-4392,
1991[Abstract].
73.
Yamamoto, A,
Iwata A,
Koh Y,
Kawai S,
Murayama S,
Hamada K,
Maekawa S,
Ueda S,
and
Sokawa Y.
Two types of chicken 2',5'-oligoadenylate synthetase mRNA derived from alleles at a single locus.
Biochim Biophys Acta
1395:
181-191,
1998[Medline].
74.
Yeh, E,
Dermer M,
Commisso C,
Zhou L,
McGlade CJ,
and
Boulianne GL.
Neuralized functions as an E3 ubiquitin ligase during Drosophila development.
Curr Biol
11:
1675-1679,
2001[Web of Science][Medline].
75.
Yeh, E,
Zhou L,
Rudzik N,
and
Boulianne GL.
Neuralized functions cell autonomously to regulate Drosophila sense organ development.
EMBO J
19:
4827-4837,
2000[Web of Science][Medline].
This article has been cited by other articles:
![]() |
C. Commisso and G. L. Boulianne The NHR1 Domain of Neuralized Binds Delta and Mediates Delta Trafficking and Notch Signaling Mol. Biol. Cell, January 1, 2007; 18(1): 1 - 13. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. Smith and H. R. Herschman Targeted Identification of Glucocorticoid-attenuated Response Genes: In Vitro and in Vivo Models Proceedings of the ATS, November 1, 2004; 1(3): 275 - 281. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |