|
|
||||||||
B and MAPK/ERK
mechanisms
1 Center for Surgical Research and Departments of Surgery and 2 Anesthesiology, University of Alabama at Birmingham, Birmingham, Alabama 35294
| |
ABSTRACT |
|---|
|
|
|---|
The acute respiratory distress
syndrome (ARDS) is a major cause of morbidity after injury. We
hypothesized that alveolar macrophage (AM
) chemokine and cytokine
release after hemorrhage and sepsis is regulated by NF-
B and MAPK.
Adult male rats underwent soft tissue trauma and hemorrhagic shock
(~90 min) followed by crystalloid resuscitation. Sepsis was induced
by cecal ligation and puncture (CLP) 20 h after
resuscitation. AM
were harvested, and TNF-
, IL-6, and
macrophage inflammatory protein (MIP)-2 release and serum IL-6 and
TNF-
levels were measured at 5 h after HCLP. Lung tissues were
analyzed for activation of NF-
B, myeloperoxidase activity, and
wet/dry weight ratio. In control animals, AM
were stimulated with
LPS with or without inhibitors of NF-
B and MAPK. Serum TNF-
and
IL-6 levels and spontaneous AM
TNF-
and MIP-2 release were
elevated (P < 0.05) after HCLP, concomitantly with the
development of lung edema and leukocyte activation. Activation of
NF-
B increased in lungs from the hemorrhage and CLP group compared
with shams. Inhibition of NF-
B or the upstream MAPK significantly
decreased LPS-stimulated AM
activation. Because enhanced release of
inflammatory mediators by AM
may contribute to ARDS after severe
trauma, inhibition of intracellular signaling pathways represents a
target to attenuate organ injury under those conditions.
mitogen-activated protein kinase; leukocytes; macrophage
inflammatory protein; acute respiratory distress syndrome; extracellular signal-regulated kinase; nuclear factor-
B
| |
INTRODUCTION |
|---|
|
|
|---|
TRAUMATIC INJURIES and the ensuing sepsis and septic shock are the leading causes of death in the ages 1-44 years in the United States (3, 18). Recent studies by Heckbert et al. (15) have shown that 39% of the trauma patients with a documented episode of hypotension during or shortly after the incident develop infectious complications. Under those conditions, the respiratory system is the most frequently affected organ system, and lung dysfunction is the first step in the development of multiple organ failure (4). Thus the acute respiratory distress syndrome (ARDS) is a major cause of death in surgical intensive care units with an incidence of ~10-14 cases per 100,000 people and an associated mortality rate of 36-52% (35). Although the exact sequence of events leading to the clinical picture of ARDS remains unknown, experimental and clinical studies have suggested that the migration of polymorphonuclear granulocytes (PMN) into the lung tissue plays a key role in the cascade of events leading to ARDS (21, 28, 37).
Studies have suggested that macrophage-derived chemokines, such as the
macrophage inflammatory protein-2 (MIP-2), play an important role in
mediating PMN influx into the lung interstitium (20, 32,
36). In addition to the extensive influx of monocytes (17), activation of nuclear transcriptional regulatory
factors such as nuclear factor-
B (NF-
B) in alveolar macrophages
(AM
), which has been reported in patients suffering from ARDS
(22, 24, 33), is believed to be involved in the activation
of the local immune reaction (1, 42). Studies in different
experimental animal models have shown that systemic stressors, such as
endotoxemia, hemorrhagic shock, or sepsis per se, can modulate the in
vivo activity of AM
and their reactivity to a subsequent in vitro stimulation (9, 12, 39). However, in the usual clinical situation, the patients who are most susceptible to multiple organ failure are the ones who encounter several sequential insults after the
initial injury (4, 37).
In light of these findings, the aim of our study was to examine the
inflammatory response of the lung parenchyma as well as macrophage
activity in a "two-hit" rat model of sequential injuries. We
hypothesized that after soft tissue trauma, severe hemorrhagic shock,
and subsequent induction of polymicrobial sepsis, characteristic signs
of tissue damage and inflammation, such as edema formation, neutrophil
accumulation, and activation of NF-
B in lung tissues are detectable,
and, if so, we wondered whether there is any correlation in the
activation of AM
as characterized by their increased chemokine and
cytokine release. In a second set of experiments, we investigated whether the activation of AM
, mimicked by in vitro LPS stimulation, could be abolished by inhibitors of NF-
B and MAPKs.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Experimental procedures. The previously described nonheparinized model of trauma and hemorrhage in the rat (19, 40) was used with minor modifications. Briefly, male Sprague-Dawley rats (250-300 g; Charles River Labs, Wilmington, MA) fasted overnight before the experiments but were allowed water ad libitum. The animals were anesthetized by methoxyflurane (Mallinckrodt Veterinary, Mundelein, IL) inhalation, and a 5-cm midline incision was performed to induce soft tissue trauma. After this, the abdomen was closed in layers, and the wounds were bathed with 1% lidocaine (Elkins-Sinn, Cherry Hill, NJ) throughout the surgical procedure to reduce postoperative pain. The catheters were then placed in both femoral arteries and the right femoral vein [polyethylene (PE-50) tubing; Becton Dickinson, Sparks, MD]. Upon awakening, the rats were bled to and maintained at a mean arterial pressure (MAP) of 40 mmHg until the animals could not maintain a MAP of 40 mmHg unless extra fluid in the form of Ringer lactate was administered. This time was termed as maximum bleed-out, and the amount of withdrawn blood was noted. The animals were then maintained at MAP of 40 mmHg until 40% of the maximum bleed-out volume was returned in the form of Ringer lactate. The rats were then resuscitated with four times the volume of the withdrawn blood in the form of Ringer lactate over 60 min, and shed blood was not used for resuscitation. The catheters were then removed, the vessels were ligated, and the skin incisions were closed with sutures. Sham-operated animals underwent the same groin dissection, which included the ligation of both femoral arteries and the right vein; however, neither hemorrhage nor resuscitation was carried out.
After returning to the cages, the rats were allowed food and water ad libitum. At 20 h after the completion of fluid resuscitation or sham operation, the animals were again anesthetized with methoxyflurane, and polymicrobial sepsis was induced by cecal ligation and puncture (CLP) as described by Chaudry et al. (8). Briefly, after a 2-cm midline incision was made, the cecum was exposed, ligated proximal to the ileocecal valve, punctured twice with an 18-gauge needle, and returned to the abdominal cavity. The abdominal cavity was then closed in layers, and the rats were resuscitated with saline solution subcutaneously (3 ml/100 g body wt). Our previous studies have shown that blood cultures are positive for Escherichia coli, Streptococcus bovis, Proteus mirabilis, Enterococcus faecalis, and Bacteroides fragilis within 1 h after CLP (41). Sham-operated animals underwent the same surgical procedure except that the cecum was neither ligated nor punctured. All animal experiments were performed according to the guidelines of the Animal Welfare Act and The Guide for Care and Use of Laboratory Animals from the National Institutes of Health. The Institutional Animal Care and Use Committee of the University of Alabama at Birmingham approved this project.Isolation of AM
.
At 5 h after CLP, AM
were collected from the bronchopulmonary
lavage fluid as described by Leeper-Woodford et al. (23). The animals were anesthetized with pentobarbital intraperitoneally and
exsanguinated. The lungs were lavaged with a total of 50 ml of
phosphate-buffered saline (Organomed). The cell fractions were then
washed, counted, and suspended (106 cells/ml) in
Dulbecco's modified Eagle's medium (DMEM) in 24-well plates.
After 2 h of incubation (37°C at 5% CO2),
nonadherent cells were removed, and 1 ml of fresh DMEM containing 10%
fetal bovine serum and 1% penicillin-streptomycin was added to the
adhered AM
. After an incubation period of 4 h, the supernatants
were harvested and frozen at
70°C until assayed. In additional
groups of control animals, isolated AM
were stimulated with LPS (10 µg/ml; Sigma, St. Louis, MO) in the presence of either the MAPK inhibitors SB-203580 and PD-98059 (10 µmol) or 200 µmol of
pyrrolidinedithiocarbamate (PDTC, an inhibitor of NF-
B
translocation; all purchased from Sigma).
Measurement of proinflammatory cytokines and chemokines.
The levels of TNF-
, IL-6, and MIP-2 in the supernatants, TNF-
,
and IL-6 and in the serum were determined by an ELISA (PharMingen, Biosource) according to the manufacturer's instructions.
Myeloperoxidase activity.
Myeloperoxidase (MPO) activity in the lungs was determined as described
by Lukaszewicz et al. (28). All reagents were purchased from Sigma. Briefly, lungs were excised, rinsed with saline, and frozen
in liquid nitrogen at
70°C until assayed. Frozen lung samples were
thawed and homogenized in 10 volumes of 20 mmol/l potassium phosphate,
pH 7.4, for 30 s. The samples were then centrifuged at 14,000 rpm
for 30 min at 4°C. The pellets were resuspended in 10 volumes of 50 mmol/l potassium phosphate, pH 6.0, containing 0.5%
hexadecyltrimethylammonium bromide. Samples were kept on ice and
sonicated with a probe sonicator at two-thirds the maximum setting for
~40 s and centrifuged at 14,000 rpm at 4°C for 10 min. Supernatants
were then added to a 96-well plate at 5 µl/well and 196 µl of
reaction buffer containing 530 nmol/l o-dianisidine and 150 nmol/l H2O2 in (added immediately before use)
50 mmol/l potassium phosphate, pH 6.0. Light absorbances at 490 and 620 nm (reference wavelength) were read and compared with those obtained in
wells containing a known activity of MPO standard purified from human
leukocytes (Sigma, activity as declared on batch) (28). Protein content in the samples was determined by the Bradford assay
(Bio-Rad).
EMSA.
Active NF-
B isoforms in nuclear extracts of whole lungs were
detected by EMSA. The NF-
B oligonucleotide containing the consensus sequence gatcgaggggactttccctagc (Stratagene, La Jolla, CA)
was end labeled by incubation of the oligonucleotide with
[
-32P]ATP (
6,000 Ci/mmol; New England Nuclear) and
T4 polynucleotide kinase according to the manufacturer's instructions
(Stratagene). Purification of the labeled oligonucleotide was carried
out with a NucTrap probe purification columns (Stratagene). Each
25-µl assay contained 20 ng of nuclear extracts, ~20,000 counts/min (cpm) of radiolabeled double-stranded target oligonucleotide, distilled
H2O, and incubation buffer (Stratagene). After a
30-min incubation period on ice, 2 ml of 0.1% (wt/vol in water)
bromphenol blue dye were added to the reaction, and each of the samples
was loaded onto a 6% DNA retardation gel (Novex, Carlsbad, CA). The gels were run at 20-25 mA for ~40 min at 4°C in a Tris
borate-EDTA buffer. After electrophoresis, the band intensities
were quantified using a phosphorimager (Packard Instruments, Meriden,
CT) to analyze each lane. After this, gels were dried and
exposed for autoradiography.
B isoforms p50 and p65
were added to the binding reaction mixture and incubated at room
temperature for 30 min subsequent to the incubation of the labeled
oligonucleotide probe with the nuclear extracts. The antibodies used
were specific to the isoform indicated and cross-reactive with rat
protein. After incubation, the reaction mixture was electrophoresed as
described above.
Determination of lung water content.
In a separate cohort, animals were exsanguinated at the end of the
experiment; the lungs were excised, weighed, and then dried for 24 h at 95°C. Lung water content (%) was calculated as (wet wt
dry wt)/(wet wt) × 100.
Histology of lung tissues. The alterations in lung morphology were examined in a separate group of sham-operated animals and in animals after trauma-hemorrhage and induction of subsequent sepsis (HCLP). Lung tissues were harvested and fixed in 10% neutral buffered formalin (Sigma) and later embedded in paraffin. The tissues were then sectioned at a thickness of 5 µm and stained with hematoxylin and eosin, and slides were evaluated by light microscopy and documented by photographs. Several sections from each lung from various lobes were examined, and all were consistent with the presence of significant lung injury.
Statistical analysis.
The results are presented as means ± SE. One-way ANOVA and
Student-Newman-Keuls test for multiple comparisons were used, and the
differences were considered significant at a P value
0.05.
| |
RESULTS |
|---|
|
|
|---|
Serum levels of proinflammatory cytokine.
The results in Fig. 1A
indicate that after HCLP, serum levels of IL-6 were found to be
1,228 ± 317 pg/ml. Serum levels of IL-6 were undetectable in
sham-operated animals, whereas serum levels of TNF-
were 15 ± 6 pg/ml, and they increased by 700% (P < 0.05) after
HCLP (Fig. 1B).
|
AM
cytokine and MIP-2 release.
As shown in Fig. 2A,
spontaneous TNF-
secretion in cultured AM
from sham-operated
animals was 369 ± 120 pg/ml, and the secretion was significantly
higher in AM
from HCLP animals (by 186%; P < 0.05). Unstimulated MIP-2 secretion in AM
from sham-operated animals
was found to be 1,113 ± 246 pg/ml, and the secretion increased by
190% after HCLP (Fig. 2B; P < 0.05).
Spontaneous, unstimulated IL-6 release was undetectable in both groups.
|
Lung MPO activity and lung water content.
MPO activity in lungs harvested from sham-operated animals was found to
be 0.17 ± 0.06 U/mg protein, and this increased by 348%
(P < 0.05) after HCLP (Fig.
3A). Water content in control animals was 77.3 ± 1.1%, and it increased to 79.7 ± 0.2%
after HCLP (P < 0.05; Fig. 3B).
|
Histological alterations after HCLP.
Representative histological lung biopsy findings in control and
experimental animals are shown in Fig. 4.
Figure 4A represents the normal lung architecture observed
in sham controls. Figure 4B represents the histological
findings in the lungs of rats subjected to trauma-hemorrhage and CLP.
Diffuse alveolitis is observed with intense neutrophil accumulation,
infiltrates, and widening of the alveolar septa by the inflammatory
process.
|
Activation of NF-
B in lung tissue.
As shown in Fig. 5, the activity
of NF-
B in nuclear extracts of whole lungs was significantly
increased in HCLP animals compared with sham controls
(P < 0.05). Supershift assays demonstrated that
NF-
B complexes contain p65 and p50 subunits. Figure 5A
shows representative blots of EMSA, whereas Fig. 5B shows
cpm from three animals in each group. The subsequent supershift
analysis is shown in Fig. 5C.
|
Effects of NF-
B and MAPK inhibition on TNF-
release by AM
.
In additional experiments, AM
were isolated from sham-operated
animals and stimulated in vitro with LPS (10 µg/ml). Such AM
(106 cells/ml) released 2,120 ± 120 pg/ml of TNF-
(Fig. 6). The addition of the specific
MAPK inhibitor SB-203508 (P38) and PD-985098 (P42/44) to the cell
culture medium simultaneously with LPS significantly decreased TNF-
secretion (P < 0.05). In a similar fashion, the NF-
B inhibitor PDTC also decreased TNF-
release in the culture supernatant (P < 0.05) (Fig. 6).
|
Effects of NF-
B and MAPK inhibition on MIP-2 release by AM
.
MIP-2 release by AM
(106 cells/ml) from sham-operated
animals released 8,607 ± 955 pg/ml after in vitro stimulation
with LPS (10 µg/ml; Fig. 7). The
addition of the MAPK or NF-
B inhibitors SB-203580/PD-98059 and PDTC
decreased MIP-2 production by 73.3 and 71.9%, respectively
(P < 0.05).
|
| |
DISCUSSION |
|---|
|
|
|---|
Previous studies from our laboratory have shown that although
rodents in the early stage of sepsis without undergoing prior trauma-hemorrhage show the characteristic signs of a systemic inflammatory response, activation of the AM
population is not detectable in the early stage of sepsis (2, 10). Our
present results indicate that serum levels of the proinflammatory
cytokines IL-6 and TNF-
were significantly elevated at 5 h
after trauma-hemorrhage and CLP. Moreover, neutrophil activation as
assessed by MPO activity in whole lung tissue, as well as lung water
content, was significantly increased in this two-hit injury model
compared with sham-operated animals. The accumulation of
neutrophils was associated with the activation of NF-
B
transcriptional activity in lung tissues as assessed by its binding to
the consensus sequence. The activated NF-
B complex was supershifted
with p65 antibodies, indicating that the complex was composed of both
p50 and p65. These findings are in keeping with the fact that the
p50/p65 heterodimer is responsible for the transcriptional activity
(38), i.e., the inflammatory response, whereas p50/p50
homodimers have been associated with inhibition of stress gene
transcription (6). These findings, indicating a local
inflammatory response in the lungs, were associated with the
histological alterations in trauma-hemorrhage and septic animals, which
included edema formation, intra-alveolar hemorrhage, and PMN
accumulation. Moreover, the release of TNF-
and MIP-2 in cultured
AM
in the absence of any stimuli (e.g., LPS) was markedly increased
5 h after the induction of sepsis. Together, these results
demonstrate that after a combination of trauma, hemorrhagic shock, and
a subsequent sepsis, the local inflammatory response of the lung tissue
is associated with an increased release of cytokines in the AM
.
Nwariaku et al. (34) reported a depression of
the AM
activity for 5 days after hemorrhagic shock with a reduced
release of TNF-
after the in vitro stimulation with LPS. In our
two-hit model, the amount of spontaneous TNF-
release by isolated
macrophages as well as in the bronchoalveolar lavage (BAL) fluid was
significantly elevated after HCLP, indicating a different response of
the AM
to in vitro stimulation with LPS compared with the in vivo
situation of sepsis. The increase in MIP-2 levels in the BAL fluid and
in the supernatant of cultured, isolated AM
associated with the increased PMN sequestration into the lung tissue suggests that activation of the local monocyte population contributes to the sequestration of PMNs and the sustained inflammatory reaction within
the lung tissue under those conditions. However, in the present study,
measurement of arterial blood gases was not performed, and thus it
remains unknown whether pulmonary functional impairment occurred in our
double-hit model of trauma-hemorrhage and subsequent sepsis.
To further examine the cellular mechanisms involved in the inflammatory
activation of AM
, we assessed the effects of inhibitors of NF-
B
activation (PDTC) and MAPK (SB-203580 and PD-98059) on the release of
TNF-
and MIP-2 in isolated AM
stimulated with LPS. The combined
inhibition of P38 and P42/44 was used, since our preliminary studies
indicated that maximal suppression of cytokine release was obtained by
the combination of both antagonists. These observations are supported
by studies of Carter et al. (7), who have shown that the
release of cytokines by AM
is regulated by both kinases. Our results
indicate that inhibition of NF-
B translocation (PDTC) decreased
TNF-
and MIP-2 release more than fourfold, although it has to be
mentioned that PDTC, despite being repeatedly used as an NF-
B
antagonist, has other effects that could contribute to the observed
results, such as being a strong antioxidant (31).
Similarly, inhibition of the upstream MAPK P38 and P42/44 resulted in a
comparable decrease in cytokine and chemokine release. Thus these
signal-transducing kinases appear to be upstream regulators of the
proinflammatory cytokine release by AM
.
Perpetuation of the systemic inflammatory response syndrome is thought
to be a major contributor to the ARDS (11, 12). Once ARDS
is manifested, it appears that a vicious cycle of increased FIO2 demands and positive end-expiratory
pressure to sustained acceptable peripheral oxygen delivery produces
further lung damage (16). Understanding the inflammatory
milieu might help to interrupt this cascade of events and improve
outcome once a diagnosis of ARDS is made. Lentsch et al.
(24) have recently shown that AM
play an essential role
in recruiting neutrophils and perpetuating lung injury. Moreover, they
confirmed that among other cytokines and chemokines, TNF-
plays a
central role in recruiting PMN to the lung tissues. By depleting rat
lungs of AM
, they were able to show that in whole lung tissue
NF-
B was suppressed in a model of immunoglobulin G-induced lung
injury. Furthermore, NF-
B activation was restored after instillation
of TNF-
into the lungs (24). Studies by
Lindsey et al. (25, 26) have shown that after
pulmonary atelectasis in rats, cytokine production by isolated AM
was significantly increased. In contrast, polymicrobial sepsis per se
in the absence of prior trauma-hemorrhage did not activate AM
to
release inflammatory mediators (2). Moreover, Fan et
al. (12) have demonstrated that hemorrhage per
se does not activate AM
; however, it primes this cell population for
an exaggerated response to a subsequent stimulus. In light of these
findings, our data suggest that priming by antecedent shock might be
essential for an increased release of inflammatory mediators after
subsequent stimuli, such as sepsis. This suggestion appears
important, since even minor direct lung injuries that are commonly
observed in critically ill patients, such as 1-h pulmonary atelectasis,
can trigger significant activation of the lung immune cells (25,
26). The release of proinflammatory cytokines by AM
appears
to involve the activation of the signal-transducing MAPK system and to
be transcriptionally regulated by the activation of NF-
B. Recent
studies have indicated that inhibition of those factors can reduce the
inflammatory response and reduce lung injury in rats after LPS infusion
or intratracheal allergen administration (13, 14, 27,
29, 43).
The second part of our studies using isolated AM
from control
animals and inhibition of P38 and p44/42 as well as NF-
B, resulting
in a depression of cytokine and chemokine release, suggests that both
pathways are crucial for AM
activation. Indeed, several investigators have shown that MAPK act as upstream activators of
NF-
B (5). However, Means et al. (30) have
shown that distinct MAPK pathways are utilized in different macrophage
populations. It therefore remains to be determined whether this
mechanism of activation is specific for AM
without affecting other
cell populations such as peritoneal macrophages.
In summary, our results support the hypothesis that, due to their
release of MIP-2 and TNF-
, AM
play a key role in PMN recruitment in the lungs after multiple injuries, such as HCLP and subsequent sepsis. Because our data demonstrate that the production of MIP-2 and
TNF-
is dependent on NF-
B and upstream kinases, inhibitions of
these pathways by the administration of specific inhibitors could be a
novel approach in the treatment or the prevention of ARDS in the
critically ill patient.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Zheng F. Ba for superb technical assistance.
| |
FOOTNOTES |
|---|
The National Institutes of Health (NIH) Award R37 GM-39519 (I. H. Chaudry) supported this investigation. P. Wang is the recipient of NIH Independent Scientist Award KO2 AI-01461.
Address for reprint requests and other correspondence: I. H. Chaudry, Center for Surgical Research and Dept. of Surgery, Univ. of Alabama at Birmingham, 1670 Univ. Blvd., VH G094, Birmingham, AL 35294-0019 (E-mail: Irshad.Chaudry{at}ccc.uab.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
10.1152/ajplung.00465.2001
Received 6 December 2001; accepted in final form 13 May 2002.
| |
REFERENCES |
|---|
|
|
|---|
1.
Abraham, E,
Carmody A,
Shenkar R,
and
Arcaroli J.
Neutrophils as early immunologic effectors in hemorrhage- or endotoxemia-induced acute lung injury.
Am J Physiol Lung Cell Mol Physiol
279:
L1137-L1145,
2000
2.
Ayala, A,
Perrin MM,
Kisala JM,
Ertel W,
and
Chaudry IH.
Polymicrobial sepsis selectively activates peritoneal but not alveolar macrophages to release inflammatory mediators (interleukins-1 and -6 and tumor necrosis factor).
Circ Shock
36:
191-199,
1992[Web of Science][Medline].
3.
Barton, RG,
and
Cerra FB.
Initial management of trauma. The first 5 minutes.
Postgrad Med
88:
83-90,
1990[Medline].
4.
Baue, AE,
Durham R,
and
Faist E.
Systemic inflammatory response syndrome (SIRS), multiple organ dysfunction syndrome (MODS), multiple organ failure (MOF): are we winning the battle?
Shock
10:
79-89,
1998[Web of Science][Medline].
5.
Birkenkamp, KU,
Tuyt LM,
Lummen C,
Wierenga AT,
Kruijer W,
and
Vellenga E.
The p38 MAP kinase inhibitor SB203580 enhances nuclear factor-kappa B transcriptional activity by a non-specific effect upon the ERK pathway.
Br J Pharmacol
131:
99-107,
2000[Web of Science][Medline].
6.
Bohuslav, J,
Kravchenko VV,
Parry GC,
Erlich JH,
Gerondakis S,
Mackman N,
and
Ulevitch RJ.
Regulation of an essential innate immune response by the p50 subunit of NF-kappaB.
J Clin Invest
102:
1645-1652,
1998[Web of Science][Medline].
7.
Carter, AB,
Monick MM,
and
Hunninghake GW.
Both Erk and p38 kinases are necessary for cytokine gene transcription.
Am J Respir Cell Mol Biol
20:
751-758,
1999
8.
Chaudry, IH,
Wichterman KA,
and
Baue AE.
Effect of sepsis on tissue adenine nucleotide levels.
Surgery
85:
205-211,
1979[Web of Science][Medline].
9.
Doherty, GM,
Jensen JC,
Alexander HR,
Buresh CM,
and
Norton JA.
Pentoxifylline suppression of tumor necrosis factor gene transcription.
Surgery
110:
192-198,
1991[Web of Science][Medline].
10.
Ertel, W,
Morrison MH,
Wang P,
Ba ZF,
Ayala A,
and
Chaudry IH.
The complex pattern of cytokines in sepsis. Association between prostaglandins, cachectin, and interleukins.
Ann Surg
214:
141-148,
1991[Web of Science][Medline].
11.
Faist, E,
Kupper TS,
Baker CC,
Chaudry IH,
Dwyer J,
and
Baue AE.
Depression of cellular immunity after major injury. Its association with posttraumatic complications and its reversal with immunomodulation.
Arch Surg
121:
1000-1005,
1986
12.
Fan, J,
Kapus A,
Li YH,
Rizoli S,
Marshall JC,
and
Rotstein OD.
Priming for enhanced alveolar fibrin deposition after hemorrhagic shock: role of tumor necrosis factor.
Am J Respir Cell Mol Biol
22:
412-421,
2000
13.
Fan, J,
Ye RD,
and
Malik AB.
Transcriptional mechanisms of acute lung injury.
Am J Physiol Lung Cell Mol Physiol
281:
L1037-L1050,
2001
14.
Feng, L,
Jang BC,
and
Hwang D.
Inhibitor of protein tyrosine kinase, radicicol, suppresses the expression of cyclooxygenase and pro-inflammatory cytokines in LPS-stimulated rat alveolar macrophage in part by accelerating degradation of mRNA.
Adv Exp Med Biol
407:
281-288,
1997[Web of Science][Medline].
15.
Heckbert, SR,
Vedder NB,
Hoffman W,
Winn RK,
Hudson LD,
Jurkovich GJ,
Copass MK,
Harlan JM,
Rice CL,
and
Maier RV.
Outcome after hemorrhagic shock in trauma patients.
J Trauma
45:
545-549,
1998[Web of Science][Medline].
16.
Held, HD,
Boettcher S,
Hamann L,
and
Uhlig S.
Ventilation-induced chemokine and cytokine release is associated with activation of nuclear factor-kappaB and is blocked by steroids.
Am J Respir Crit Care Med
163:
711-716,
2001
17.
Huber, TS,
Gaines GC,
Welborn MB, III,
Rosenberg JJ,
Seeger JM,
and
Moldawer LL.
Anticytokine therapies for acute inflammation and the systemic inflammatory response syndrome: IL-10 and ischemia/reperfusion injury as a new paradigm.
Shock
13:
425-434,
2000[Web of Science][Medline].
18.
Jarrar, D,
Chaudry IH,
and
Wang P.
Organ dysfunction following hemorrhage and sepsis: mechanisms and therapeutic approaches (Review).
Int J Mol Med
4:
575-583,
1999[Web of Science][Medline].
19.
Jarrar, D,
Wang P,
and
Chaudry IH.
Hepatocellular dysfunction: "Basic considerations."
In: Surgical Treatment-Evidence-Based and Problem-Oriented, edited by Holzheimer RG,
and Mannick JA.. Munich: Zuckschwerdt, 2001, p. 763-767.
20.
Kang, JL,
Lee HW,
Lee HS,
Pack IS,
Chong Y,
Castranova V,
and
Koh Y.
Genistein prevents nuclear factor-kappa B activation and acute lung injury induced by lipopolysaccharide.
Am J Respir Crit Care Med
164:
2206-2212,
2001
21.
Kirkpatrick, AW,
Meade MO,
Mustard RA,
and
Stewart TE.
Strategies of invasive ventilatory support in ARDS.
Shock
6 Suppl 1:
S17-S22,
1996[Medline].
22.
Le Tulzo, Y,
Shenkar R,
Kaneko D,
Moine P,
Fantuzzi G,
Dinarello CA,
and
Abraham E.
Hemorrhage increases cytokine expression in lung mononuclear cells in mice: involvement of catecholamines in nuclear factor-
B regulation and cytokine expression.
J Clin Invest
99:
1516-1524,
1997[Web of Science][Medline].
23.
Leeper-Woodford, SK,
and
Detmer K.
Acute hypoxia increases alveolar macrophage tumor necrosis factor activity and alters NF-kappaB expression.
Am J Physiol Lung Cell Mol Physiol
276:
L909-L916,
1999
24.
Lentsch, AB,
Czermak BJ,
Bless NM,
Van Rooijen N,
and
Ward PA.
Essential role of alveolar macrophages in intrapulmonary activation of NF-kappaB.
Am J Respir Cell Mol Biol
20:
692-698,
1999
25.
Lindsey, HJ,
Kisala JM,
Ayala A,
and
Chaudry IH.
Alveolar macrophages exposed to hyperoxia demonstrate early enhanced cytokine productive capacity.
Surg Forum
43:
66-67,
1992.
26.
Lindsey, HJ,
Kisala JM,
Ayala A,
Lehman D,
Herdon CD,
and
Chaudry IH.
Pentoxifylline attenuates oxygen-induced lung injury.
J Surg Res
56:
543-548,
1994[Web of Science][Medline].
27.
Liu, SF,
Ye X,
and
Malik AB.
In vivo inhibition of nuclear factor-kappa B activation prevents inducible nitric oxide synthase expression and systemic hypotension in a rat model of septic shock.
J Immunol
159:
3976-3983,
1997[Abstract].
28.
Lukaszewicz, GC,
Souba WW,
and
Abcouwer SF.
Induction of cytokine-induced neutrophil chemoattractant (CINC) mRNA in the lungs of septic rats.
J Trauma
41:
222-228,
1996[Web of Science][Medline].
29.
Massberg, S,
Enders G,
Matos FC,
Tomic LI,
Leiderer R,
Eisenmenger S,
Messmer K,
and
Krombach F.
Fibrinogen deposition at the postischemic vessel wall promotes platelet adhesion during ischemia-reperfusion in vivo.
Blood
94:
3829-3838,
1999
30.
Means, TK,
Pavlovich RP,
Roca D,
Vermeulen MW,
and
Fenton MJ.
Activation of TNF-alpha transcription utilizes distinct MAP kinase pathways in different macrophage populations.
J Leukoc Biol
67:
885-893,
2000[Abstract].
31.
Meyer, M,
Schreck R,
and
Baeuerle PA.
H2O2 and antioxidants have opposite effects on activation of NF-kappa B and AP-1 in intact cells: AP-1 as secondary antioxidant-responsive factor.
EMBO J
12:
2005-2015,
1993[Web of Science][Medline].
32.
Mizgerd, JP,
Spieker MR,
and
Doerschuk CM.
Early response cytokines and innate immunity: essential roles for TNF receptor 1 and type I IL-1 receptor during Escherichia coli pneumonia in mice.
J Immunol
166:
4042-4048,
2001
33.
Moine, P,
McIntyre R,
Schwartz MD,
Kaneko D,
Shenkar R,
Le Tulzo Y,
Moore EE,
and
Abraham E.
NF-kappaB regulatory mechanisms in alveolar macrophages from patients with acute respiratory distress syndrome.
Shock
13:
85-91,
2000[Web of Science][Medline].
34.
Nwariaku, FE,
McIntyre KL,
Sikes PJ,
and
Mileski WJ.
Alterations in alveolar macrophage tumor necrosis factor (TNF) response following hemorrhagic shock.
Shock
4:
200-203,
1995[Web of Science][Medline].
35.
Reynolds, HN,
McCunn M,
Borg U,
Habashi N,
Cottingham C,
and
Bar-Lavi Y.
Acute respiratory distress syndrome: estimated incidence and mortality rate in a 5 million-person population base.
Crit Care (Lond)
2:
29-34,
1998[Medline].
36.
Rijneveld, AW,
van den Dobbelsteen GP,
Florquin S,
Standiford TJ,
Speelman P,
van Alphen L,
and
van der Poll T.
Roles of interleukin-6 and macrophage inflammatory protein-2 in pneumolysin-induced lung inflammation in mice.
J Infect Dis
185:
123-126,
2002[Web of Science][Medline].
37.
Roupie, E,
Lepage E,
Wysocki M,
Fagon JY,
Chastre J,
Dreyfuss D,
Mentec H,
Carlet J,
Brun-Buisson C,
Lemaire F,
and
Brochard L.
Prevalence, etiologies and outcome of the acute respiratory distress syndrome among hypoxemic ventilated patients. SRLF Collaborative Group on Mechanical Ventilation Societe de Reanimation de Langue Francaise.
Intensive Care Med
25:
920-929,
1999[Web of Science][Medline].
38.
Schmitz, ML,
and
Baeuerle PA.
The p65 subunit is responsible for the strong transcription activating potential of NF-kappa B.
EMBO J
10:
3805-3817,
1991[Web of Science][Medline].
39.
Shanley, TP,
Davidson BA,
Nader ND,
Bless N,
Vasi N,
Ward PA,
Johnson KJ,
and
Knight PR.
Role of macrophage inflammatory protein-2 in aspiration-induced lung injury.
Crit Care Med
28:
2437-2444,
2000[Web of Science][Medline].
40.
Wang, P,
and
Chaudry IH.
Crystalloid resuscitation restores but does not maintain cardiac output following severe hemorrhage.
J Surg Res
50:
163-169,
1991[Web of Science][Medline].
41.
Wang, P,
and
Chaudry IH.
A single hit model of polymicrobial sepsis: cecal ligation and puncture.
Sepsis
2:
227-233,
1998.
42.
Yang, L,
Cohn L,
Zhang DH,
Homer R,
Ray A,
and
Ray P.
Essential role of nuclear factor kappaB in the induction of eosinophilia in allergic airway inflammation.
J Exp Med
188:
1739-1750,
1998
43.
You, M,
Flick LM,
Yu D,
and
Feng GS.
Modulation of the nuclear factor kappa B pathway by Shp-2 tyrosine phosphatase in mediating the induction of interleukin (IL)-6 by IL-1 or tumor necrosis factor.
J Exp Med
193:
101-110,
2001
This article has been cited by other articles:
![]() |
P. S. Wolf, H. E. Merry, A. S. Farivar, A. S. McCourtie, and M. S. Mulligan Stress-activated protein kinase inhibition to ameliorate lung ischemia reperfusion injury J. Thorac. Cardiovasc. Surg., March 1, 2008; 135(3): 656 - 665. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. R. Crisostomo, Y. Wang, T. A. Markel, M. Wang, T. Lahm, and D. R. Meldrum Human mesenchymal stem cells stimulated by TNF-{alpha}, LPS, or hypoxia produce growth factors by an NF{kappa}B- but not JNK-dependent mechanism Am J Physiol Cell Physiol, March 1, 2008; 294(3): C675 - C682. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-C. Hsieh, M. Frink, C.-H. Hsieh, M. A. Choudhry, M. G. Schwacha, K. I. Bland, and I. H. Chaudry Downregulation of migration inhibitory factor is critical for estrogen-mediated attenuation of lung tissue damage following trauma-hemorrhage Am J Physiol Lung Cell Mol Physiol, May 1, 2007; 292(5): L1227 - L1232. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zhang, L. Zhi, S. Moochhala, P. K. Moore, and M. Bhatia Hydrogen sulfide acts as an inflammatory mediator in cecal ligation and puncture-induced sepsis in mice by upregulating the production of cytokines and chemokines via NF-{kappa}B Am J Physiol Lung Cell Mol Physiol, April 1, 2007; 292(4): L960 - L971. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Lehnert, T. Uehara, B. U. Bradford, H. Lind, Z. Zhong, D. A. Brenner, I. Marzi, and J. J. Lemasters Lipopolysaccharide-binding protein modulates hepatic damage and the inflammatory response after hemorrhagic shock and resuscitation Am J Physiol Gastrointest Liver Physiol, September 1, 2006; 291(3): G456 - G463. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-P. Yu, S. Yang, Y.-C. Hsieh, M. A. Choudhry, K. I. Bland, and I. H. Chaudry Maintenance of lung myeloperoxidase activity in proestrus females after trauma-hemorrhage: upregulation of heme oxygenase-1 Am J Physiol Lung Cell Mol Physiol, September 1, 2006; 291(3): L400 - L406. [Abstract] [Full Text] [PDF] |
||||
![]() |
R.-F. Guo, N. C. Riedemann, L. Sun, H. Gao, K. X. Shi, J. S. Reuben, V. J. Sarma, F. S. Zetoune, and P. A. Ward Divergent Signaling Pathways in Phagocytic Cells during Sepsis J. Immunol., July 15, 2006; 177(2): 1306 - 1313. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-P. Yu, Y.-C. Hsieh, T. Suzuki, T. Shimizu, M. A. Choudhry, M. G. Schwacha, and I. H. Chaudry Salutary effects of estrogen receptor-beta agonist on lung injury after trauma-hemorrhage Am J Physiol Lung Cell Mol Physiol, May 1, 2006; 290(5): L1004 - L1009. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. P. Schneider, M. G. Schwacha, and I. H. Chaudry Influence of gender and age on T-cell responses in a murine model of trauma-hemorrhage: differences between circulating and tissue-fixed cells J Appl Physiol, March 1, 2006; 100(3): 826 - 833. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Lang, P. Dong, E. K. Hosszu, and I. R. Doyle Effect of CO2 on LPS-induced cytokine responses in rat alveolar macrophages Am J Physiol Lung Cell Mol Physiol, July 1, 2005; 289(1): L96 - L103. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. A. Altemeier, G. Matute-Bello, C. W. Frevert, Y. Kawata, O. Kajikawa, T. R. Martin, and R. W. Glenny Mechanical ventilation with moderate tidal volumes synergistically increases lung cytokine response to systemic endotoxin Am J Physiol Lung Cell Mol Physiol, September 1, 2004; 287(3): L533 - L542. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Severgnini, S. Takahashi, L. M. Rozo, R. J. Homer, C. Kuhn, J. W. Jhung, G. Perides, M. Steer, P. M. Hassoun, B. L. Fanburg, et al. Activation of the STAT pathway in acute lung injury Am J Physiol Lung Cell Mol Physiol, June 1, 2004; 286(6): L1282 - L1292. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Kuebler, Y. Yokoyama, D. Jarrar, B. Toth, L. W. Rue III, K. I. Bland, P. Wang, and I. H. Chaudry Administration of Progesterone After Trauma and Hemorrhagic Shock Prevents Hepatocellular Injury Arch Surg, July 1, 2003; 138(7): 727 - 734. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |