AJP - Lung AJP: Gastrointestinal and Liver Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 283: L799-L805, 2002; doi:10.1152/ajplung.00465.2001
1040-0605/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (38)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jarrar, D.
Right arrow Articles by Chaudry, I. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jarrar, D.
Right arrow Articles by Chaudry, I. H.
Vol. 283, Issue 4, L799-L805, October 2002

Alveolar macrophage activation after trauma-hemorrhage and sepsis is dependent on NF-kappa B and MAPK/ERK mechanisms

Doraid Jarrar1, Joachim F. Kuebler1, Loring W. Rue III1, Sadis Matalon2, Ping Wang1, Kirby I. Bland1, and Irshad H. Chaudry1

1 Center for Surgical Research and Departments of Surgery and 2 Anesthesiology, University of Alabama at Birmingham, Birmingham, Alabama 35294


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The acute respiratory distress syndrome (ARDS) is a major cause of morbidity after injury. We hypothesized that alveolar macrophage (AMPhi ) chemokine and cytokine release after hemorrhage and sepsis is regulated by NF-kappa B and MAPK. Adult male rats underwent soft tissue trauma and hemorrhagic shock (~90 min) followed by crystalloid resuscitation. Sepsis was induced by cecal ligation and puncture (CLP) 20 h after resuscitation. AMPhi were harvested, and TNF-alpha , IL-6, and macrophage inflammatory protein (MIP)-2 release and serum IL-6 and TNF-alpha levels were measured at 5 h after HCLP. Lung tissues were analyzed for activation of NF-kappa B, myeloperoxidase activity, and wet/dry weight ratio. In control animals, AMPhi were stimulated with LPS with or without inhibitors of NF-kappa B and MAPK. Serum TNF-alpha and IL-6 levels and spontaneous AMPhi TNF-alpha and MIP-2 release were elevated (P < 0.05) after HCLP, concomitantly with the development of lung edema and leukocyte activation. Activation of NF-kappa B increased in lungs from the hemorrhage and CLP group compared with shams. Inhibition of NF-kappa B or the upstream MAPK significantly decreased LPS-stimulated AMPhi activation. Because enhanced release of inflammatory mediators by AMPhi may contribute to ARDS after severe trauma, inhibition of intracellular signaling pathways represents a target to attenuate organ injury under those conditions.

mitogen-activated protein kinase; leukocytes; macrophage inflammatory protein; acute respiratory distress syndrome; extracellular signal-regulated kinase; nuclear factor-kappa B


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

TRAUMATIC INJURIES and the ensuing sepsis and septic shock are the leading causes of death in the ages 1-44 years in the United States (3, 18). Recent studies by Heckbert et al. (15) have shown that 39% of the trauma patients with a documented episode of hypotension during or shortly after the incident develop infectious complications. Under those conditions, the respiratory system is the most frequently affected organ system, and lung dysfunction is the first step in the development of multiple organ failure (4). Thus the acute respiratory distress syndrome (ARDS) is a major cause of death in surgical intensive care units with an incidence of ~10-14 cases per 100,000 people and an associated mortality rate of 36-52% (35). Although the exact sequence of events leading to the clinical picture of ARDS remains unknown, experimental and clinical studies have suggested that the migration of polymorphonuclear granulocytes (PMN) into the lung tissue plays a key role in the cascade of events leading to ARDS (21, 28, 37).

Studies have suggested that macrophage-derived chemokines, such as the macrophage inflammatory protein-2 (MIP-2), play an important role in mediating PMN influx into the lung interstitium (20, 32, 36). In addition to the extensive influx of monocytes (17), activation of nuclear transcriptional regulatory factors such as nuclear factor-kappa B (NF-kappa B) in alveolar macrophages (AMPhi ), which has been reported in patients suffering from ARDS (22, 24, 33), is believed to be involved in the activation of the local immune reaction (1, 42). Studies in different experimental animal models have shown that systemic stressors, such as endotoxemia, hemorrhagic shock, or sepsis per se, can modulate the in vivo activity of AMPhi and their reactivity to a subsequent in vitro stimulation (9, 12, 39). However, in the usual clinical situation, the patients who are most susceptible to multiple organ failure are the ones who encounter several sequential insults after the initial injury (4, 37).

In light of these findings, the aim of our study was to examine the inflammatory response of the lung parenchyma as well as macrophage activity in a "two-hit" rat model of sequential injuries. We hypothesized that after soft tissue trauma, severe hemorrhagic shock, and subsequent induction of polymicrobial sepsis, characteristic signs of tissue damage and inflammation, such as edema formation, neutrophil accumulation, and activation of NF-kappa B in lung tissues are detectable, and, if so, we wondered whether there is any correlation in the activation of AMPhi as characterized by their increased chemokine and cytokine release. In a second set of experiments, we investigated whether the activation of AMPhi , mimicked by in vitro LPS stimulation, could be abolished by inhibitors of NF-kappa B and MAPKs.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Experimental procedures. The previously described nonheparinized model of trauma and hemorrhage in the rat (19, 40) was used with minor modifications. Briefly, male Sprague-Dawley rats (250-300 g; Charles River Labs, Wilmington, MA) fasted overnight before the experiments but were allowed water ad libitum. The animals were anesthetized by methoxyflurane (Mallinckrodt Veterinary, Mundelein, IL) inhalation, and a 5-cm midline incision was performed to induce soft tissue trauma. After this, the abdomen was closed in layers, and the wounds were bathed with 1% lidocaine (Elkins-Sinn, Cherry Hill, NJ) throughout the surgical procedure to reduce postoperative pain. The catheters were then placed in both femoral arteries and the right femoral vein [polyethylene (PE-50) tubing; Becton Dickinson, Sparks, MD]. Upon awakening, the rats were bled to and maintained at a mean arterial pressure (MAP) of 40 mmHg until the animals could not maintain a MAP of 40 mmHg unless extra fluid in the form of Ringer lactate was administered. This time was termed as maximum bleed-out, and the amount of withdrawn blood was noted. The animals were then maintained at MAP of 40 mmHg until 40% of the maximum bleed-out volume was returned in the form of Ringer lactate. The rats were then resuscitated with four times the volume of the withdrawn blood in the form of Ringer lactate over 60 min, and shed blood was not used for resuscitation. The catheters were then removed, the vessels were ligated, and the skin incisions were closed with sutures. Sham-operated animals underwent the same groin dissection, which included the ligation of both femoral arteries and the right vein; however, neither hemorrhage nor resuscitation was carried out.

After returning to the cages, the rats were allowed food and water ad libitum. At 20 h after the completion of fluid resuscitation or sham operation, the animals were again anesthetized with methoxyflurane, and polymicrobial sepsis was induced by cecal ligation and puncture (CLP) as described by Chaudry et al. (8). Briefly, after a 2-cm midline incision was made, the cecum was exposed, ligated proximal to the ileocecal valve, punctured twice with an 18-gauge needle, and returned to the abdominal cavity. The abdominal cavity was then closed in layers, and the rats were resuscitated with saline solution subcutaneously (3 ml/100 g body wt). Our previous studies have shown that blood cultures are positive for Escherichia coli, Streptococcus bovis, Proteus mirabilis, Enterococcus faecalis, and Bacteroides fragilis within 1 h after CLP (41). Sham-operated animals underwent the same surgical procedure except that the cecum was neither ligated nor punctured.

All animal experiments were performed according to the guidelines of the Animal Welfare Act and The Guide for Care and Use of Laboratory Animals from the National Institutes of Health. The Institutional Animal Care and Use Committee of the University of Alabama at Birmingham approved this project.

Isolation of AMPhi . At 5 h after CLP, AMPhi were collected from the bronchopulmonary lavage fluid as described by Leeper-Woodford et al. (23). The animals were anesthetized with pentobarbital intraperitoneally and exsanguinated. The lungs were lavaged with a total of 50 ml of phosphate-buffered saline (Organomed). The cell fractions were then washed, counted, and suspended (106 cells/ml) in Dulbecco's modified Eagle's medium (DMEM) in 24-well plates. After 2 h of incubation (37°C at 5% CO2), nonadherent cells were removed, and 1 ml of fresh DMEM containing 10% fetal bovine serum and 1% penicillin-streptomycin was added to the adhered AMPhi . After an incubation period of 4 h, the supernatants were harvested and frozen at -70°C until assayed. In additional groups of control animals, isolated AMPhi were stimulated with LPS (10 µg/ml; Sigma, St. Louis, MO) in the presence of either the MAPK inhibitors SB-203580 and PD-98059 (10 µmol) or 200 µmol of pyrrolidinedithiocarbamate (PDTC, an inhibitor of NF-kappa B translocation; all purchased from Sigma).

Measurement of proinflammatory cytokines and chemokines. The levels of TNF-alpha , IL-6, and MIP-2 in the supernatants, TNF-alpha , and IL-6 and in the serum were determined by an ELISA (PharMingen, Biosource) according to the manufacturer's instructions.

Myeloperoxidase activity. Myeloperoxidase (MPO) activity in the lungs was determined as described by Lukaszewicz et al. (28). All reagents were purchased from Sigma. Briefly, lungs were excised, rinsed with saline, and frozen in liquid nitrogen at -70°C until assayed. Frozen lung samples were thawed and homogenized in 10 volumes of 20 mmol/l potassium phosphate, pH 7.4, for 30 s. The samples were then centrifuged at 14,000 rpm for 30 min at 4°C. The pellets were resuspended in 10 volumes of 50 mmol/l potassium phosphate, pH 6.0, containing 0.5% hexadecyltrimethylammonium bromide. Samples were kept on ice and sonicated with a probe sonicator at two-thirds the maximum setting for ~40 s and centrifuged at 14,000 rpm at 4°C for 10 min. Supernatants were then added to a 96-well plate at 5 µl/well and 196 µl of reaction buffer containing 530 nmol/l o-dianisidine and 150 nmol/l H2O2 in (added immediately before use) 50 mmol/l potassium phosphate, pH 6.0. Light absorbances at 490 and 620 nm (reference wavelength) were read and compared with those obtained in wells containing a known activity of MPO standard purified from human leukocytes (Sigma, activity as declared on batch) (28). Protein content in the samples was determined by the Bradford assay (Bio-Rad).

EMSA. Active NF-kappa B isoforms in nuclear extracts of whole lungs were detected by EMSA. The NF-kappa B oligonucleotide containing the consensus sequence gatcgaggggactttccctagc (Stratagene, La Jolla, CA) was end labeled by incubation of the oligonucleotide with [gamma -32P]ATP (>= 6,000 Ci/mmol; New England Nuclear) and T4 polynucleotide kinase according to the manufacturer's instructions (Stratagene). Purification of the labeled oligonucleotide was carried out with a NucTrap probe purification columns (Stratagene). Each 25-µl assay contained 20 ng of nuclear extracts, ~20,000 counts/min (cpm) of radiolabeled double-stranded target oligonucleotide, distilled H2O, and incubation buffer (Stratagene). After a 30-min incubation period on ice, 2 ml of 0.1% (wt/vol in water) bromphenol blue dye were added to the reaction, and each of the samples was loaded onto a 6% DNA retardation gel (Novex, Carlsbad, CA). The gels were run at 20-25 mA for ~40 min at 4°C in a Tris borate-EDTA buffer. After electrophoresis, the band intensities were quantified using a phosphorimager (Packard Instruments, Meriden, CT) to analyze each lane. After this, gels were dried and exposed for autoradiography.

For supershift assays, antibodies to the NF-kappa B isoforms p50 and p65 were added to the binding reaction mixture and incubated at room temperature for 30 min subsequent to the incubation of the labeled oligonucleotide probe with the nuclear extracts. The antibodies used were specific to the isoform indicated and cross-reactive with rat protein. After incubation, the reaction mixture was electrophoresed as described above.

Determination of lung water content. In a separate cohort, animals were exsanguinated at the end of the experiment; the lungs were excised, weighed, and then dried for 24 h at 95°C. Lung water content (%) was calculated as (wet wt - dry wt)/(wet wt) × 100.

Histology of lung tissues. The alterations in lung morphology were examined in a separate group of sham-operated animals and in animals after trauma-hemorrhage and induction of subsequent sepsis (HCLP). Lung tissues were harvested and fixed in 10% neutral buffered formalin (Sigma) and later embedded in paraffin. The tissues were then sectioned at a thickness of 5 µm and stained with hematoxylin and eosin, and slides were evaluated by light microscopy and documented by photographs. Several sections from each lung from various lobes were examined, and all were consistent with the presence of significant lung injury.

Statistical analysis. The results are presented as means ± SE. One-way ANOVA and Student-Newman-Keuls test for multiple comparisons were used, and the differences were considered significant at a P value <= 0.05.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Serum levels of proinflammatory cytokine. The results in Fig. 1A indicate that after HCLP, serum levels of IL-6 were found to be 1,228 ± 317 pg/ml. Serum levels of IL-6 were undetectable in sham-operated animals, whereas serum levels of TNF-alpha were 15 ± 6 pg/ml, and they increased by 700% (P < 0.05) after HCLP (Fig. 1B).


View larger version (9K):
[in this window]
[in a new window]
 
Fig. 1.   Effects of trauma-hemorrhage and subsequent sepsis (HCLP) on serum levels of the proinflammatory mediators IL-6 (A) and TNF-alpha (B). Animals in the HCLP group were subjected to soft tissue trauma and then bled to and maintained at a mean arterial pressure of 40 mmHg for ~90 min. At 20 h after crystalloid resuscitation, sepsis was induced by cecal ligation and puncture (CLP). Circulating cytokine levels were determined 5 h thereafter. For more details, see MATERIALS AND METHODS. The figure shows the comparison of sham-operated and HCLP rats (n = 7-9/group). ND, not detectable. *P < 0.05 vs. sham.

AMPhi cytokine and MIP-2 release. As shown in Fig. 2A, spontaneous TNF-alpha secretion in cultured AMPhi from sham-operated animals was 369 ± 120 pg/ml, and the secretion was significantly higher in AMPhi from HCLP animals (by 186%; P < 0.05). Unstimulated MIP-2 secretion in AMPhi from sham-operated animals was found to be 1,113 ± 246 pg/ml, and the secretion increased by 190% after HCLP (Fig. 2B; P < 0.05). Spontaneous, unstimulated IL-6 release was undetectable in both groups.


View larger version (10K):
[in this window]
[in a new window]
 
Fig. 2.   Effects of HCLP on spontaneous secretion of TNF-alpha (A) and macrophage inflammatory protein (MIP)-2 (B) in cultured alveolar macrophages (AMPhi ) over 4 h. AMPhi were collected from the bronchopulmonary lavage fluid obtained at 5 h after the induction of sepsis by CLP. AMPhi were plated at 106 cells/well, and TNF-alpha , IL-6, monocyte chemoattractant protein (MCP)-1, and MIP-2 were determined in supernatants by specific ELISA. However, only TNF-alpha and MIP-2 were present in measurable quantities. *P < 0.05 vs. sham.

Lung MPO activity and lung water content. MPO activity in lungs harvested from sham-operated animals was found to be 0.17 ± 0.06 U/mg protein, and this increased by 348% (P < 0.05) after HCLP (Fig. 3A). Water content in control animals was 77.3 ± 1.1%, and it increased to 79.7 ± 0.2% after HCLP (P < 0.05; Fig. 3B).


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 3.   Myeloperoxidase (MPO) activity (A) and water content (B) in the lungs of sham-operated animals and of animals in the HCLP group. A separate cohort of animals was used for this part of the experiments. MPO activity was determined with a colorimetric assay as described in MATERIALS AND METHODS. Lungs were excised, weighed, and dried for 24 h at 95°C. Tissue water content was calculated as (wet wt - dry wt)/(wet wt) × 100. The figure shows the comparison of sham-operated and HCLP rats (n = 4-5/group). *P < 0.05 vs. sham.

Histological alterations after HCLP. Representative histological lung biopsy findings in control and experimental animals are shown in Fig. 4. Figure 4A represents the normal lung architecture observed in sham controls. Figure 4B represents the histological findings in the lungs of rats subjected to trauma-hemorrhage and CLP. Diffuse alveolitis is observed with intense neutrophil accumulation, infiltrates, and widening of the alveolar septa by the inflammatory process.


View larger version (85K):
[in this window]
[in a new window]
 
Fig. 4.   In a separate group of animals, HCLP was induced as described in Fig 1. Lungs were harvested as described in MATERIALS AND METHODS and stained with hematoxylin and eosin. This figure shows the comparison between a sham-operated animal and one animal from the experimental group. Whereas in the control group, normal lung architecture is seen, the lung tissues after HCLP are characterized by neutrophil influx, edema, and wall thickening.

Activation of NF-kappa B in lung tissue. As shown in Fig. 5, the activity of NF-kappa B in nuclear extracts of whole lungs was significantly increased in HCLP animals compared with sham controls (P < 0.05). Supershift assays demonstrated that NF-kappa B complexes contain p65 and p50 subunits. Figure 5A shows representative blots of EMSA, whereas Fig. 5B shows cpm from three animals in each group. The subsequent supershift analysis is shown in Fig. 5C.


View larger version (46K):
[in this window]
[in a new window]
 
Fig. 5.   Effects of HCLP on the activation of whole lung tissue NF-kappa B DNA binding. As shown in A and B, after injury NF-kappa B activation was significantly increased compared with control animals. Moreover, supershift analysis using antibodies specific for the subunits p50 and p65 demonstrates that the NF-kappa B complex is predominantly composed of p65 (C). cpm, Counts/min; oligo, oligonucleotide. *P < 0.05 vs. sham.

Effects of NF-kappa B and MAPK inhibition on TNF-alpha release by AMPhi . In additional experiments, AMPhi were isolated from sham-operated animals and stimulated in vitro with LPS (10 µg/ml). Such AMPhi (106 cells/ml) released 2,120 ± 120 pg/ml of TNF-alpha (Fig. 6). The addition of the specific MAPK inhibitor SB-203508 (P38) and PD-985098 (P42/44) to the cell culture medium simultaneously with LPS significantly decreased TNF-alpha secretion (P < 0.05). In a similar fashion, the NF-kappa B inhibitor PDTC also decreased TNF-alpha release in the culture supernatant (P < 0.05) (Fig. 6).


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 6.   In additional experiments, AMPhi from control animals were harvested and stimulated with LPS. The addition of pyrrolidinedithiocarbamate (PDTC, blockade of NF-kappa B translocation) or the MAPK inhibitors SB-203580 (SB) and PD-98059 (PD) decreased TNF-alpha secretion significantly. *P < 0.05 vs. LPS.

Effects of NF-kappa B and MAPK inhibition on MIP-2 release by AMPhi . MIP-2 release by AMPhi (106 cells/ml) from sham-operated animals released 8,607 ± 955 pg/ml after in vitro stimulation with LPS (10 µg/ml; Fig. 7). The addition of the MAPK or NF-kappa B inhibitors SB-203580/PD-98059 and PDTC decreased MIP-2 production by 73.3 and 71.9%, respectively (P < 0.05).


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 7.   AMPhi from control animals were harvested and stimulated with LPS. PDTC or the MAPK inhibitors SB-203580 and PD-98059 markedly decreased LPS-stimulation MIP-2 secretion. *P < 0.05 vs. LPS.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Previous studies from our laboratory have shown that although rodents in the early stage of sepsis without undergoing prior trauma-hemorrhage show the characteristic signs of a systemic inflammatory response, activation of the AMPhi population is not detectable in the early stage of sepsis (2, 10). Our present results indicate that serum levels of the proinflammatory cytokines IL-6 and TNF-alpha were significantly elevated at 5 h after trauma-hemorrhage and CLP. Moreover, neutrophil activation as assessed by MPO activity in whole lung tissue, as well as lung water content, was significantly increased in this two-hit injury model compared with sham-operated animals. The accumulation of neutrophils was associated with the activation of NF-kappa B transcriptional activity in lung tissues as assessed by its binding to the consensus sequence. The activated NF-kappa B complex was supershifted with p65 antibodies, indicating that the complex was composed of both p50 and p65. These findings are in keeping with the fact that the p50/p65 heterodimer is responsible for the transcriptional activity (38), i.e., the inflammatory response, whereas p50/p50 homodimers have been associated with inhibition of stress gene transcription (6). These findings, indicating a local inflammatory response in the lungs, were associated with the histological alterations in trauma-hemorrhage and septic animals, which included edema formation, intra-alveolar hemorrhage, and PMN accumulation. Moreover, the release of TNF-alpha and MIP-2 in cultured AMPhi in the absence of any stimuli (e.g., LPS) was markedly increased 5 h after the induction of sepsis. Together, these results demonstrate that after a combination of trauma, hemorrhagic shock, and a subsequent sepsis, the local inflammatory response of the lung tissue is associated with an increased release of cytokines in the AMPhi .

Nwariaku et al. (34) reported a depression of the AMPhi activity for 5 days after hemorrhagic shock with a reduced release of TNF-alpha after the in vitro stimulation with LPS. In our two-hit model, the amount of spontaneous TNF-alpha release by isolated macrophages as well as in the bronchoalveolar lavage (BAL) fluid was significantly elevated after HCLP, indicating a different response of the AMPhi to in vitro stimulation with LPS compared with the in vivo situation of sepsis. The increase in MIP-2 levels in the BAL fluid and in the supernatant of cultured, isolated AMPhi associated with the increased PMN sequestration into the lung tissue suggests that activation of the local monocyte population contributes to the sequestration of PMNs and the sustained inflammatory reaction within the lung tissue under those conditions. However, in the present study, measurement of arterial blood gases was not performed, and thus it remains unknown whether pulmonary functional impairment occurred in our double-hit model of trauma-hemorrhage and subsequent sepsis.

To further examine the cellular mechanisms involved in the inflammatory activation of AMPhi , we assessed the effects of inhibitors of NF-kappa B activation (PDTC) and MAPK (SB-203580 and PD-98059) on the release of TNF-alpha and MIP-2 in isolated AMPhi stimulated with LPS. The combined inhibition of P38 and P42/44 was used, since our preliminary studies indicated that maximal suppression of cytokine release was obtained by the combination of both antagonists. These observations are supported by studies of Carter et al. (7), who have shown that the release of cytokines by AMPhi is regulated by both kinases. Our results indicate that inhibition of NF-kappa B translocation (PDTC) decreased TNF-alpha and MIP-2 release more than fourfold, although it has to be mentioned that PDTC, despite being repeatedly used as an NF-kappa B antagonist, has other effects that could contribute to the observed results, such as being a strong antioxidant (31). Similarly, inhibition of the upstream MAPK P38 and P42/44 resulted in a comparable decrease in cytokine and chemokine release. Thus these signal-transducing kinases appear to be upstream regulators of the proinflammatory cytokine release by AMPhi .

Perpetuation of the systemic inflammatory response syndrome is thought to be a major contributor to the ARDS (11, 12). Once ARDS is manifested, it appears that a vicious cycle of increased FIO2 demands and positive end-expiratory pressure to sustained acceptable peripheral oxygen delivery produces further lung damage (16). Understanding the inflammatory milieu might help to interrupt this cascade of events and improve outcome once a diagnosis of ARDS is made. Lentsch et al. (24) have recently shown that AMPhi play an essential role in recruiting neutrophils and perpetuating lung injury. Moreover, they confirmed that among other cytokines and chemokines, TNF-alpha plays a central role in recruiting PMN to the lung tissues. By depleting rat lungs of AMPhi , they were able to show that in whole lung tissue NF-kappa B was suppressed in a model of immunoglobulin G-induced lung injury. Furthermore, NF-kappa B activation was restored after instillation of TNF-alpha into the lungs (24). Studies by Lindsey et al. (25, 26) have shown that after pulmonary atelectasis in rats, cytokine production by isolated AMPhi was significantly increased. In contrast, polymicrobial sepsis per se in the absence of prior trauma-hemorrhage did not activate AMPhi to release inflammatory mediators (2). Moreover, Fan et al. (12) have demonstrated that hemorrhage per se does not activate AMPhi ; however, it primes this cell population for an exaggerated response to a subsequent stimulus. In light of these findings, our data suggest that priming by antecedent shock might be essential for an increased release of inflammatory mediators after subsequent stimuli, such as sepsis. This suggestion appears important, since even minor direct lung injuries that are commonly observed in critically ill patients, such as 1-h pulmonary atelectasis, can trigger significant activation of the lung immune cells (25, 26). The release of proinflammatory cytokines by AMPhi appears to involve the activation of the signal-transducing MAPK system and to be transcriptionally regulated by the activation of NF-kappa B. Recent studies have indicated that inhibition of those factors can reduce the inflammatory response and reduce lung injury in rats after LPS infusion or intratracheal allergen administration (13, 14, 27, 29, 43).

The second part of our studies using isolated AMPhi from control animals and inhibition of P38 and p44/42 as well as NF-kappa B, resulting in a depression of cytokine and chemokine release, suggests that both pathways are crucial for AMPhi activation. Indeed, several investigators have shown that MAPK act as upstream activators of NF-kappa B (5). However, Means et al. (30) have shown that distinct MAPK pathways are utilized in different macrophage populations. It therefore remains to be determined whether this mechanism of activation is specific for AMPhi without affecting other cell populations such as peritoneal macrophages.

In summary, our results support the hypothesis that, due to their release of MIP-2 and TNF-alpha , AMPhi play a key role in PMN recruitment in the lungs after multiple injuries, such as HCLP and subsequent sepsis. Because our data demonstrate that the production of MIP-2 and TNF-alpha is dependent on NF-kappa B and upstream kinases, inhibitions of these pathways by the administration of specific inhibitors could be a novel approach in the treatment or the prevention of ARDS in the critically ill patient.


    ACKNOWLEDGEMENTS

We thank Zheng F. Ba for superb technical assistance.


    FOOTNOTES

The National Institutes of Health (NIH) Award R37 GM-39519 (I. H. Chaudry) supported this investigation. P. Wang is the recipient of NIH Independent Scientist Award KO2 AI-01461.

Address for reprint requests and other correspondence: I. H. Chaudry, Center for Surgical Research and Dept. of Surgery, Univ. of Alabama at Birmingham, 1670 Univ. Blvd., VH G094, Birmingham, AL 35294-0019 (E-mail: Irshad.Chaudry{at}ccc.uab.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

10.1152/ajplung.00465.2001

Received 6 December 2001; accepted in final form 13 May 2002.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Abraham, E, Carmody A, Shenkar R, and Arcaroli J. Neutrophils as early immunologic effectors in hemorrhage- or endotoxemia-induced acute lung injury. Am J Physiol Lung Cell Mol Physiol 279: L1137-L1145, 2000[Abstract/Free Full Text].

2.   Ayala, A, Perrin MM, Kisala JM, Ertel W, and Chaudry IH. Polymicrobial sepsis selectively activates peritoneal but not alveolar macrophages to release inflammatory mediators (interleukins-1 and -6 and tumor necrosis factor). Circ Shock 36: 191-199, 1992[Web of Science][Medline].

3.   Barton, RG, and Cerra FB. Initial management of trauma. The first 5 minutes. Postgrad Med 88: 83-90, 1990[Medline].

4.   Baue, AE, Durham R, and Faist E. Systemic inflammatory response syndrome (SIRS), multiple organ dysfunction syndrome (MODS), multiple organ failure (MOF): are we winning the battle? Shock 10: 79-89, 1998[Web of Science][Medline].

5.   Birkenkamp, KU, Tuyt LM, Lummen C, Wierenga AT, Kruijer W, and Vellenga E. The p38 MAP kinase inhibitor SB203580 enhances nuclear factor-kappa B transcriptional activity by a non-specific effect upon the ERK pathway. Br J Pharmacol 131: 99-107, 2000[Web of Science][Medline].

6.   Bohuslav, J, Kravchenko VV, Parry GC, Erlich JH, Gerondakis S, Mackman N, and Ulevitch RJ. Regulation of an essential innate immune response by the p50 subunit of NF-kappaB. J Clin Invest 102: 1645-1652, 1998[Web of Science][Medline].

7.   Carter, AB, Monick MM, and Hunninghake GW. Both Erk and p38 kinases are necessary for cytokine gene transcription. Am J Respir Cell Mol Biol 20: 751-758, 1999[Abstract/Free Full Text].

8.   Chaudry, IH, Wichterman KA, and Baue AE. Effect of sepsis on tissue adenine nucleotide levels. Surgery 85: 205-211, 1979[Web of Science][Medline].

9.   Doherty, GM, Jensen JC, Alexander HR, Buresh CM, and Norton JA. Pentoxifylline suppression of tumor necrosis factor gene transcription. Surgery 110: 192-198, 1991[Web of Science][Medline].

10.   Ertel, W, Morrison MH, Wang P, Ba ZF, Ayala A, and Chaudry IH. The complex pattern of cytokines in sepsis. Association between prostaglandins, cachectin, and interleukins. Ann Surg 214: 141-148, 1991[Web of Science][Medline].

11.   Faist, E, Kupper TS, Baker CC, Chaudry IH, Dwyer J, and Baue AE. Depression of cellular immunity after major injury. Its association with posttraumatic complications and its reversal with immunomodulation. Arch Surg 121: 1000-1005, 1986[Abstract/Free Full Text].

12.   Fan, J, Kapus A, Li YH, Rizoli S, Marshall JC, and Rotstein OD. Priming for enhanced alveolar fibrin deposition after hemorrhagic shock: role of tumor necrosis factor. Am J Respir Cell Mol Biol 22: 412-421, 2000[Abstract/Free Full Text].

13.   Fan, J, Ye RD, and Malik AB. Transcriptional mechanisms of acute lung injury. Am J Physiol Lung Cell Mol Physiol 281: L1037-L1050, 2001[Abstract/Free Full Text].

14.   Feng, L, Jang BC, and Hwang D. Inhibitor of protein tyrosine kinase, radicicol, suppresses the expression of cyclooxygenase and pro-inflammatory cytokines in LPS-stimulated rat alveolar macrophage in part by accelerating degradation of mRNA. Adv Exp Med Biol 407: 281-288, 1997[Web of Science][Medline].

15.   Heckbert, SR, Vedder NB, Hoffman W, Winn RK, Hudson LD, Jurkovich GJ, Copass MK, Harlan JM, Rice CL, and Maier RV. Outcome after hemorrhagic shock in trauma patients. J Trauma 45: 545-549, 1998[Web of Science][Medline].

16.   Held, HD, Boettcher S, Hamann L, and Uhlig S. Ventilation-induced chemokine and cytokine release is associated with activation of nuclear factor-kappaB and is blocked by steroids. Am J Respir Crit Care Med 163: 711-716, 2001[Abstract/Free Full Text].

17.   Huber, TS, Gaines GC, Welborn MB, III, Rosenberg JJ, Seeger JM, and Moldawer LL. Anticytokine therapies for acute inflammation and the systemic inflammatory response syndrome: IL-10 and ischemia/reperfusion injury as a new paradigm. Shock 13: 425-434, 2000[Web of Science][Medline].

18.   Jarrar, D, Chaudry IH, and Wang P. Organ dysfunction following hemorrhage and sepsis: mechanisms and therapeutic approaches (Review). Int J Mol Med 4: 575-583, 1999[Web of Science][Medline].

19.   Jarrar, D, Wang P, and Chaudry IH. Hepatocellular dysfunction: "Basic considerations." In: Surgical Treatment-Evidence-Based and Problem-Oriented, edited by Holzheimer RG, and Mannick JA.. Munich: Zuckschwerdt, 2001, p. 763-767.

20.   Kang, JL, Lee HW, Lee HS, Pack IS, Chong Y, Castranova V, and Koh Y. Genistein prevents nuclear factor-kappa B activation and acute lung injury induced by lipopolysaccharide. Am J Respir Crit Care Med 164: 2206-2212, 2001[Abstract/Free Full Text].

21.   Kirkpatrick, AW, Meade MO, Mustard RA, and Stewart TE. Strategies of invasive ventilatory support in ARDS. Shock 6 Suppl 1: S17-S22, 1996[Medline].

22.   Le Tulzo, Y, Shenkar R, Kaneko D, Moine P, Fantuzzi G, Dinarello CA, and Abraham E. Hemorrhage increases cytokine expression in lung mononuclear cells in mice: involvement of catecholamines in nuclear factor-kappa B regulation and cytokine expression. J Clin Invest 99: 1516-1524, 1997[Web of Science][Medline].

23.   Leeper-Woodford, SK, and Detmer K. Acute hypoxia increases alveolar macrophage tumor necrosis factor activity and alters NF-kappaB expression. Am J Physiol Lung Cell Mol Physiol 276: L909-L916, 1999[Abstract/Free Full Text].

24.   Lentsch, AB, Czermak BJ, Bless NM, Van Rooijen N, and Ward PA. Essential role of alveolar macrophages in intrapulmonary activation of NF-kappaB. Am J Respir Cell Mol Biol 20: 692-698, 1999[Abstract/Free Full Text].

25.   Lindsey, HJ, Kisala JM, Ayala A, and Chaudry IH. Alveolar macrophages exposed to hyperoxia demonstrate early enhanced cytokine productive capacity. Surg Forum 43: 66-67, 1992.

26.   Lindsey, HJ, Kisala JM, Ayala A, Lehman D, Herdon CD, and Chaudry IH. Pentoxifylline attenuates oxygen-induced lung injury. J Surg Res 56: 543-548, 1994[Web of Science][Medline].

27.   Liu, SF, Ye X, and Malik AB. In vivo inhibition of nuclear factor-kappa B activation prevents inducible nitric oxide synthase expression and systemic hypotension in a rat model of septic shock. J Immunol 159: 3976-3983, 1997[Abstract].

28.   Lukaszewicz, GC, Souba WW, and Abcouwer SF. Induction of cytokine-induced neutrophil chemoattractant (CINC) mRNA in the lungs of septic rats. J Trauma 41: 222-228, 1996[Web of Science][Medline].

29.   Massberg, S, Enders G, Matos FC, Tomic LI, Leiderer R, Eisenmenger S, Messmer K, and Krombach F. Fibrinogen deposition at the postischemic vessel wall promotes platelet adhesion during ischemia-reperfusion in vivo. Blood 94: 3829-3838, 1999[Abstract/Free Full Text].

30.   Means, TK, Pavlovich RP, Roca D, Vermeulen MW, and Fenton MJ. Activation of TNF-alpha transcription utilizes distinct MAP kinase pathways in different macrophage populations. J Leukoc Biol 67: 885-893, 2000[Abstract].

31.   Meyer, M, Schreck R, and Baeuerle PA. H2O2 and antioxidants have opposite effects on activation of NF-kappa B and AP-1 in intact cells: AP-1 as secondary antioxidant-responsive factor. EMBO J 12: 2005-2015, 1993[Web of Science][Medline].

32.   Mizgerd, JP, Spieker MR, and Doerschuk CM. Early response cytokines and innate immunity: essential roles for TNF receptor 1 and type I IL-1 receptor during Escherichia coli pneumonia in mice. J Immunol 166: 4042-4048, 2001[Abstract/Free Full Text].

33.   Moine, P, McIntyre R, Schwartz MD, Kaneko D, Shenkar R, Le Tulzo Y, Moore EE, and Abraham E. NF-kappaB regulatory mechanisms in alveolar macrophages from patients with acute respiratory distress syndrome. Shock 13: 85-91, 2000[Web of Science][Medline].

34.   Nwariaku, FE, McIntyre KL, Sikes PJ, and Mileski WJ. Alterations in alveolar macrophage tumor necrosis factor (TNF) response following hemorrhagic shock. Shock 4: 200-203, 1995[Web of Science][Medline].

35.   Reynolds, HN, McCunn M, Borg U, Habashi N, Cottingham C, and Bar-Lavi Y. Acute respiratory distress syndrome: estimated incidence and mortality rate in a 5 million-person population base. Crit Care (Lond) 2: 29-34, 1998[Medline].

36.   Rijneveld, AW, van den Dobbelsteen GP, Florquin S, Standiford TJ, Speelman P, van Alphen L, and van der Poll T. Roles of interleukin-6 and macrophage inflammatory protein-2 in pneumolysin-induced lung inflammation in mice. J Infect Dis 185: 123-126, 2002[Web of Science][Medline].

37.   Roupie, E, Lepage E, Wysocki M, Fagon JY, Chastre J, Dreyfuss D, Mentec H, Carlet J, Brun-Buisson C, Lemaire F, and Brochard L. Prevalence, etiologies and outcome of the acute respiratory distress syndrome among hypoxemic ventilated patients. SRLF Collaborative Group on Mechanical Ventilation Societe de Reanimation de Langue Francaise. Intensive Care Med 25: 920-929, 1999[Web of Science][Medline].

38.   Schmitz, ML, and Baeuerle PA. The p65 subunit is responsible for the strong transcription activating potential of NF-kappa B. EMBO J 10: 3805-3817, 1991[Web of Science][Medline].

39.   Shanley, TP, Davidson BA, Nader ND, Bless N, Vasi N, Ward PA, Johnson KJ, and Knight PR. Role of macrophage inflammatory protein-2 in aspiration-induced lung injury. Crit Care Med 28: 2437-2444, 2000[Web of Science][Medline].

40.   Wang, P, and Chaudry IH. Crystalloid resuscitation restores but does not maintain cardiac output following severe hemorrhage. J Surg Res 50: 163-169, 1991[Web of Science][Medline].

41.   Wang, P, and Chaudry IH. A single hit model of polymicrobial sepsis: cecal ligation and puncture. Sepsis 2: 227-233, 1998.

42.   Yang, L, Cohn L, Zhang DH, Homer R, Ray A, and Ray P. Essential role of nuclear factor kappaB in the induction of eosinophilia in allergic airway inflammation. J Exp Med 188: 1739-1750, 1998[Abstract/Free Full Text].

43.   You, M, Flick LM, Yu D, and Feng GS. Modulation of the nuclear factor kappa B pathway by Shp-2 tyrosine phosphatase in mediating the induction of interleukin (IL)-6 by IL-1 or tumor necrosis factor. J Exp Med 193: 101-110, 2001[Abstract/Free Full Text].


Am J Physiol Lung Cell Mol Physiol 283(4):L799-L805
1040-0605/02 $5.00 Copyright © 2002 the American Physiological Society



This article has been cited by other articles:


Home page
J. Leukoc. Biol.Home page
P. Pan, J. Cardinal, R. Dhupar, M. R. Rosengart, M. T. Lotze, D. A. Geller, T. R. Billiar, and A. Tsung
Low-dose cisplatin administration in murine cecal ligation and puncture prevents the systemic release of HMGB1 and attenuates lethality
J. Leukoc. Biol., September 1, 2009; 86(3): 625 - 632.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
Y. Nawa, K.-i. Kawahara, S. Tancharoen, X. Meng, H. Sameshima, T. Ito, Y. Masuda, H. Imaizumi, T. Hashiguchi, and I. Maruyama
Nucleophosmin may act as an alarmin: implications for severe sepsis
J. Leukoc. Biol., September 1, 2009; 86(3): 645 - 653.
[Abstract] [Full Text] [PDF]


Home page
J. Thorac. Cardiovasc. Surg.Home page
P. S. Wolf, H. E. Merry, A. S. Farivar, A. S. McCourtie, and M. S. Mulligan
Stress-activated protein kinase inhibition to ameliorate lung ischemia reperfusion injury
J. Thorac. Cardiovasc. Surg., March 1, 2008; 135(3): 656 - 665.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
P. R. Crisostomo, Y. Wang, T. A. Markel, M. Wang, T. Lahm, and D. R. Meldrum
Human mesenchymal stem cells stimulated by TNF-{alpha}, LPS, or hypoxia produce growth factors by an NF{kappa}B- but not JNK-dependent mechanism
Am J Physiol Cell Physiol, March 1, 2008; 294(3): C675 - C682.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
Y.-C. Hsieh, M. Frink, C.-H. Hsieh, M. A. Choudhry, M. G. Schwacha, K. I. Bland, and I. H. Chaudry
Downregulation of migration inhibitory factor is critical for estrogen-mediated attenuation of lung tissue damage following trauma-hemorrhage
Am J Physiol Lung Cell Mol Physiol, May 1, 2007; 292(5): L1227 - L1232.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
H. Zhang, L. Zhi, S. Moochhala, P. K. Moore, and M. Bhatia
Hydrogen sulfide acts as an inflammatory mediator in cecal ligation and puncture-induced sepsis in mice by upregulating the production of cytokines and chemokines via NF-{kappa}B
Am J Physiol Lung Cell Mol Physiol, April 1, 2007; 292(4): L960 - L971.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
M. Lehnert, T. Uehara, B. U. Bradford, H. Lind, Z. Zhong, D. A. Brenner, I. Marzi, and J. J. Lemasters
Lipopolysaccharide-binding protein modulates hepatic damage and the inflammatory response after hemorrhagic shock and resuscitation
Am J Physiol Gastrointest Liver Physiol, September 1, 2006; 291(3): G456 - G463.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
H.-P. Yu, S. Yang, Y.-C. Hsieh, M. A. Choudhry, K. I. Bland, and I. H. Chaudry
Maintenance of lung myeloperoxidase activity in proestrus females after trauma-hemorrhage: upregulation of heme oxygenase-1
Am J Physiol Lung Cell Mol Physiol, September 1, 2006; 291(3): L400 - L406.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R.-F. Guo, N. C. Riedemann, L. Sun, H. Gao, K. X. Shi, J. S. Reuben, V. J. Sarma, F. S. Zetoune, and P. A. Ward
Divergent Signaling Pathways in Phagocytic Cells during Sepsis
J. Immunol., July 15, 2006; 177(2): 1306 - 1313.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
H.-P. Yu, Y.-C. Hsieh, T. Suzuki, T. Shimizu, M. A. Choudhry, M. G. Schwacha, and I. H. Chaudry
Salutary effects of estrogen receptor-beta agonist on lung injury after trauma-hemorrhage
Am J Physiol Lung Cell Mol Physiol, May 1, 2006; 290(5): L1004 - L1009.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
C. P. Schneider, M. G. Schwacha, and I. H. Chaudry
Influence of gender and age on T-cell responses in a murine model of trauma-hemorrhage: differences between circulating and tissue-fixed cells
J Appl Physiol, March 1, 2006; 100(3): 826 - 833.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
C. J. Lang, P. Dong, E. K. Hosszu, and I. R. Doyle
Effect of CO2 on LPS-induced cytokine responses in rat alveolar macrophages
Am J Physiol Lung Cell Mol Physiol, July 1, 2005; 289(1): L96 - L103.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
W. A. Altemeier, G. Matute-Bello, C. W. Frevert, Y. Kawata, O. Kajikawa, T. R. Martin, and R. W. Glenny
Mechanical ventilation with moderate tidal volumes synergistically increases lung cytokine response to systemic endotoxin
Am J Physiol Lung Cell Mol Physiol, September 1, 2004; 287(3): L533 - L542.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
M. Severgnini, S. Takahashi, L. M. Rozo, R. J. Homer, C. Kuhn, J. W. Jhung, G. Perides, M. Steer, P. M. Hassoun, B. L. Fanburg, et al.
Activation of the STAT pathway in acute lung injury
Am J Physiol Lung Cell Mol Physiol, June 1, 2004; 286(6): L1282 - L1292.
[Abstract] [Full Text] [PDF]


Home page
Arch SurgHome page
J. F. Kuebler, Y. Yokoyama, D. Jarrar, B. Toth, L. W. Rue III, K. I. Bland, P. Wang, and I. H. Chaudry
Administration of Progesterone After Trauma and Hemorrhagic Shock Prevents Hepatocellular Injury
Arch Surg, July 1, 2003; 138(7): 727 - 734.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (38)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jarrar, D.
Right arrow Articles by Chaudry, I. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jarrar, D.
Right arrow Articles by Chaudry, I. H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online