AJP - Lung Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 283: L815-L829, 2002. First published May 24, 2002; doi:10.1152/ajplung.00485.2001
1040-0605/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
283/4/L815    most recent
00485.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (48)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, X.
Right arrow Articles by Lee, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, X.
Right arrow Articles by Lee, P. J.
Vol. 283, Issue 4, L815-L829, October 2002

Mitogen-activated protein kinases regulate HO-1 gene transcription after ischemia-reperfusion lung injury

Xuchen Zhang1, Eric L. Bedard2, Richard Potter2, Robert Zhong2, Jawed Alam3, Augustine M. K. Choi4, and Patty J. Lee1

1 Section of Pulmonary and Critical Care Medicine, Yale University School of Medicine, New Haven, Connecticut 06520; 2 Department of Surgery, University of Western Ontario, London Ontario, Canada N6A 5A5; 3 Department of Molecular Genetics, Alton Ochsner Medical Foundation and Department of Biochemistry and Molecular Biology, Louisiana State University Medical Center, New Orleans, Louisiana 70121; and 4 Division of Pulmonary, Allergy, and Critical Care, University of Pittsburgh, Pittsburgh, Pennsylvania 15213


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Lung ischemia-reperfusion (I-R) is an important model of oxidant-mediated acute lung and vascular injury. Heme oxygenase-1 (HO-1) is a cytoprotective gene that is markedly induced by lung I-R injury. HO-1 mRNA is increased in mouse lung after 30 min of lung hilar clamping (ischemia) followed by 2-6 h of unclamping (reperfusion) compared with control mice. In a variety of vascular cell types, HO-1 mRNA is induced after 24 h of anoxia followed by 30 min-1 h of reoxygenation (A-R). Transfection studies reveal that the promoter and 5'-distal enhancer E1 are necessary and sufficient for increased HO-1 gene transcription after A-R. Immunoblotting studies show all three subfamilies of MAPKs (ERK, JNK, and p38) are activated by 15 min of reperfusion. We also demonstrate that HO-1 gene transcription after A-R involves ERK, JNK, and p38 MAPK pathways. Together, our data show that I-R not only induces HO-1 gene expression in mouse lungs and vascular cells but that gene transcription occurs via the promoter and E1 enhancer and involves upstream MAPK pathways.

oxidant injury; gene regulation; heme oxygenase; mitogen-activated protein kinases


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

ISCHEMIA-REPERFUSION (I-R) injury generates systemic reactive oxygen species (ROS) during the reperfusion phase and subsequent oxidant-mediated tissue injury. Oxidant injury in the lung causes diffuse parenchymal and vascular damage and is a relevant model for studying the pathogenesis of acute respiratory failure as well as lung transplantation injury. Heme oxygenase (HO)-1, a ubiquitous heme-degrading enzyme, has generated much interest as a novel stress protein that is highly induced by and protects against oxidative stress. HO catalyzes the initial and rate-limiting step in the oxidative degradation of heme to biliverdin with the release of the catalytic by-products carbon monoxide and iron (71). HO exists in three isoforms: whereas HO-2 and HO-3 are primarily constitutive, HO-1 is highly inducible (50, 52). HO-1 induction in models of oxidative stress has been shown to protect against noxious stimuli, including ultraviolet irradiation (73), hyperoxia (21, 47, 58), LPS (56), and heme-induced injury (1, 9) in vitro and in vivo. The increased susceptibility of HO-1 null knockout mice to oxidative stress (62) and a similar pattern in the one case of human HO-1 deficiency (79) further attest to the physiological importance of HO-1 and strengthens the emerging paradigm that HO-1 is indeed an important molecule in the host defense against oxidant injury. Several investigators have used I-R animal models to confirm that increased expression of HO-1, or its reaction product carbon monoxide (CO), correlates with improved survival and organ function in the brain, kidney, liver, heart, and lungs (7, 29, 36, 60, 66).

Despite the accumulating evidence that HO-1 induction significantly ameliorates tissue injury after I-R, the molecular mechanisms and signaling pathways leading to HO-1 induction are unknown. The mouse HO-1 gene is 7.3 kb long with five exons and four introns (3). Previous studies using heme and heavy metals have identified important cis-regulatory elements in the HO-1 gene (2, 4, 6). In addition, HO-1 gene regulation in response to LPS, hypoxia, and hyperoxia has also been elucidated (12, 48, 49). In the previous models tested, such as LPS, heavy metals, and heme, mouse HO-1 induction is primarily regulated at the level of gene transcription and is mediated by one or both of two distal enhancer regions termed E1 and E2 (previously described as SX2 and AB1, respectively), located at approximately -4 and -10 kb pairs, respectively (2, 3, 13). In our recent study of hyperoxia-induced HO-1 gene transcription, both the proximal promoter and E1 distal enhancer were necessary and sufficient for full HO-1 gene transcription and likely involved one or more members of the activator protein (AP)-1 and signal transducer and activator of transcription (STAT) families of transcription factors (48).

Candidate upstream signaling pathways for HO-1 regulation are the mitogen-activated protein kinases (MAPKs). The MAPKs are a group of protein kinases that mediate the nuclear response of cells to a wide variety of extracellular stresses such as inflammatory cytokines, growth factors, ultraviolet light, and osmotic stress (10, 19, 20, 72). Although three distinct subfamilies have been described, extracellular signal-regulated kinase (ERK), c-Jun NH2-terminal kinase (JNK), and p38, there is significant cross talk between the pathways as well as common downstream targets (26, 76). The potential role for MAPKs in HO-1 signaling after oxidant stress such as I-R is supported by the following: 1) other oxidant stresses such as LPS and ultraviolet light activate MAPKs (34, 35, 72); 2) MAPKs regulate AP-1 and STAT (17, 30, 41, 44, 77), which have been shown to be important in HO-1 regulation (48); and 3) cadmium- and sodium arsenite-induced HO-1 expression and an end product of HO-1, CO, utilize the MAPK pathway (5, 11, 27, 57).

Given ample evidence for the importance role of HO-1 in defense against I-R-induced oxidant injury and the fact that very little information exists regarding the molecular regulation of HO-1 gene expression in response to I-R, our laboratory investigated the molecular regulation of HO-1 gene expression after I-R. In the current study, we confirm marked HO-1 mRNA and protein induction in mouse lungs and vascular cells after I-R or anoxia-reoxygenation (A-R), respectively. We focused our in vitro studies on pulmonary artery endothelial cells (PAEC) because they showed high expression of HO-1 mRNA after A-R, are an important target of A-R injury, and modulate vascular responses to injury. Using reporter gene analyses, we show that increased HO-1 gene expression after A-R in pulmonary endothelial cells is transcriptionally regulated and dependent upon the HO-1 promoter and a 5'-distal enhancer region, E1. Furthermore, the MAPK pathways appear to be important for HO-1 gene induction after A-R in pulmonary endothelial cells.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Cell culture. Rat primary PAEC, rat primary pulmonary artery smooth muscle cells (PASMC), and rat primary aortic vascular smooth muscle cells (aVSM) were maintained in Dulbecco's modified Eagle's medium (Gibco-BRL, Rockville, MD) with 10% FBS (Hyclone, Logan, Utah) and 0.1% gentamicin (Gibco-BRL). Dr. Troy Stevens (University of Alabama) generously provided the PAEC. A. M. K. Choi provided the PASMC and aVSM. All data using primary cell cultures were collected before passage 20. Cells were exposed to anoxia (95% N2-5% CO2) in a sealed modular chamber (Billup-Rothberg, Del Mar, CA) with continuous monitoring and automated adjustments to maintain chamber O2 <0.5% during anoxia (Biospherix, Redfield, NY).

Animal exposures. The mouse lung I-R studies were a collaborative effort with E. L. Bedard, R. Potter, and R. Zhong. After anesthesia, mice were intubated via tracheostomy and ventilated with a Harvard ventilator (rate 75-100, peak inspiratory pressure 10-12 cmH2O, positive end-expiratory pressure 1.5 cmH2O). A hilar clamp was placed for 30 min of unilateral ischemia to the left lung, and then the clamp was released for 2-24 h of reperfusion before left lungs were extracted for total RNA. The Animal Care and Use Committee at the University of Western Ontario approved this protocol in accordance with the guidelines.

RT-PCR. Total tissue RNA was extracted by using Trizol reagent (Gibco-BRL), according to the manufacturer's instructions. Primers used for mouse HO-1 were: sense, TCCAGACACCGCTCCTCCAG; antisense, GGATTTGGGGCTGCTGGTTTC; and for loading control mouse beta -actin: sense, GTGGGCCGCTCTAGGCACCAA; antisense, CTCTTTGATGTCACGCACGATTTC. The size of the HO-1 product is 314 bp and 540 bp for beta -actin. The DNA-free DNase treatment and removal reagents (Ambion, Austin, Texas) were used to remove contamination with DNA from total RNA samples. A reaction mixture (50 µl) was made according to Access RT-PCR System and Access RT-PCR Introductory Systems (Promega, Madison, WI), which consisted of 0.8 µg total RNA, 10 µl avian myeloblastosis virus (AMV)/Tfl 5× reaction buffer, 1 µl 2-deoxynucleotide 5'-triphosphate (dNTP) mix (10 mM each dNTP), 50 pmol antisense primer, 50 pmol sense primer, 2 µl 25 mM MgSO4, 1 µl AMV reverse transcriptase (5 U/µl), and 1 µl Tfl DNA polymerase (5 U/µl). Then 20 µl of nuclease-free mineral oil were overlaid on the reaction mixture. Conditions for RT-PCR were 1 cycle at 48°C for 45 min; 1 cycle at 95°C for 2 min; 30 cycles at 95°C for 30 s, 60°C for 1 min, and 68°C for 1 min 30 s; and 1 cycle at 68°C for 5 min. Each reaction product (10 µl) was then separated on a 1% agarose gel containing 0.5 µg/ml of ethidium bromide. The density of the bands was quantitated with Alpha imager 2000 (Alpha Innotech, San Leandro, CA), and the ratio of HO-1 to the corresponding control beta -actin band was calculated for each sample.

Immunohistochemistry. The ImmunoCruz Staining System (Santa Cruz Biotechnology, Santa Cruz, CA) was used according to the manufacturer's instructions. Briefly, formalin-fixed, paraffin-embedded lung tissue sections were deparaffinized with xylene, rehydrated gradually with graded alcohols, washed in deionized water for 1 min, and then blocked with 10% nonimmune goat serum for 30 min before incubation with a 1:1,000 dilution of the primary antibody anti-rat HO-1 (StressGen, Victoria, Canada) overnight at 4°C. Sections were washed three times with PBS (5 min each). The secondary antibody, a biotinylated goat anti-rabbit IgG, was incubated at 37°C for 30 min, and peroxidase-conjugated streptavidin-biotin complex was incubated at 37°C for 30 min. After further washing the sections with PBS, we applied diaminobenzidine substrate as the chromogen, giving a brown reaction product, and counterstained the sections with Mayer's hematoxylin (Zymed, South San Francisco, CA). Negative controls for the nonspecific binding included PBS and normal rat IgG instead of the primary antibody.

RNA extraction and Northern blot analysis for HO-1. Plated cells were homogenized and scraped in Trizol reagent (Gibco-BRL) followed by chloroform extraction per Gibco-BRL Trizol protocol. After spectrophotometric RNA quantitation, 10 µg of total RNA were loaded into a 1% agarose-formaldehyde gel and then transferred to a Hybond-N Plus nylon membrane (Amersham, Piscataway, NJ) by capillary action. The nylon membrane was then prehybridized in a buffer containing 1% BSA, 7% SDS, 0.5 M phosphate buffer, pH 7.0, and 1 mM EDTA at 65°C for 2 h followed by hybridization in the same buffer containing 32P-labeled rat HO-1 cDNA for 16 h. Membranes were then washed twice in 0.5% BSA; 5% SDS; 40 mM phosphate buffer, pH 7.0; and 1 mM EDTA) for 15 min followed by three washes in 1% SDS; 40 mM phosphate buffer, pH 7.0; and 1 mM EDTA. To control for variations in RNA amount or loading, we stripped the same blots in 0.1% SDS and hybridized with a housekeeping cDNA, aldolase (obtained from Dr. Paul Noble, Yale University). The density of the bands was quantitated using Alpha imager 2000 (Alpha Innotech), and the ratio of HO-1 to the corresponding aldolase band was calculated for each sample.

Protein extraction and Western blot analysis for HO-1. Frozen lung tissues were homogenized in Tris-containing buffer, and plated cells were scraped in cold PBS. Samples were all lysed in Nonidet P-40 (10%) containing lysis buffer. Protein concentrations of the lysates were determined by Coomassie blue dye-binding assay (Bio-Rad, Hercules, CA). Equal volumes of 2× SDS sample buffer (125 mM Tris · HCl, pH 6.8; 4% SDS; 20% glycerol; 100 mM DTT, and 0.2% bromphenol blue) were added, and the samples were boiled for 5 min. Samples were electrophoresed in a 12% ready-made Tris · HCl gel (Bio-Rad). The gel was electrophoretically transferred onto a nitrocellulose membrane (Bio-Rad) and incubated for 1 h in 5% nonfat powdered milk containing 1× Tris-buffered saline and 0.1% Tween 20 (TTBS). The membranes were then incubated for 2 h with mouse anti-HO-1 monoclonal antibody (1:1,000 dilution; Stressgen). After three washes in TTBS, the membranes were incubated with horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG antibody (Cell Signaling Technology, Beverly, MA) for 2 h. The membranes were then washed three times in TTBS followed by detection of signal with a chemiluminescence LumiGLO detection kit (New England Biolabs, Beverly, MA). To control for protein loading, we stripped the membranes at 60°C in stripping solution (10 mM beta -mercaptoethanol, 2% SDS, and 62.5 mM Tris · HCl, pH 6.8) before reprobing with antibody to beta -tubulin (Santa Cruz Biotechnology).

Plasmid constructs. Plasmid (p) RL-CMV was obtained from Promega. Roger Davis (University of Massachusetts, Worchester, MA) generously provided the dominant-negative mutants (DNM) of JNK1, JNK2, and p38alpha . Melanie Cobb at University of Texas, Southwestern, generously provided the DNM of ERK1 and ERK2. A dose response of 0.25 µg to 2 µg of MAPK DNMs was used. pHO15luc and its deletions were constructed by cloning a 15-kb pair promoter fragment from the mouse HO-1 gene into the luciferase reporter gene vector pSKluc as previously described (5). The dose used for all HO-1 plasmid transfections was 0.5 µg. Plasmid enhanced green fluorescent protein (pEGFP) was purchased from Clontech Laboratories (Palo Alto, CA).

MAPK immunoblotting. MAP or ERK kinase (MEK), ERK1/2, p38, and JNK1/2 kits were purchased from Cell Signaling Technology and conducted per manufacturer's protocol. Briefly, after A-R, cells were lysed directly in 1× SDS sample buffer containing 62.5 mM Tris · HCl (pH 6.8), 2% SDS, 10% glycerol, 50 mM DTT, 0.1% bromphenol blue. Cell lysates were sonicated for 5 s to shear DNA and reduce sample viscosity. After boiling the cell lysates for 5 min, we loaded equal amounts of cell lysates (~100 µg of protein) onto 12% ready-made Tris · HCl gels (Bio-Rad) and transferred them to a nitrocellulose membrane. Blots were stained with Ponceau S (Sigma, St. Louis, MO) to monitor the transfer of proteins. Membranes were blocked for 1 h at room temperature in blocking buffer (20 mM Tris, 500 mM NaCl, 0.1% Tween 20, and 5% nonfat milk) and incubated with specific polyclonal antibodies for anti-phospho-MEK, ERK1/2, p38, and JNK1/2 (Cell Signaling Technology) at 1:1,000 dilution in primary antibody dilution buffer (20 mM Tris, 500 mM NaCl, 0.1% Tween 20, and 5% BSA) with gentle agitation overnight at 4°C. After being washed, the blots were incubated for 1 h with a 1:2,000 dilution of HRP-conjugated anti-rabbit secondary antibody (Cell Signaling Technology) and visualized with a chemiluminescence LumiGLO detection kit (New England Biolabs). To verify equivalent sample loading, we stripped blots in stripping solution (10 mM beta -mercaptoethanol, 2% SDS, 62.5 mM Tris · HCl, pH 6.8) at 60°C for 40-60 min and reprobed with anti-MEK, ERK1/2, JNK1/2, and p38 (Cell Signaling Technology) antibodies, respectively.

MAPK activity. MAPK activities were measured in immune complex protein kinase assays according to manufacturer's kit protocol (Cell Signaling). Briefly, after A-R, cells were lysed in ice-cold cell lysis buffer (20 mM Tris, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 2.5 mM sodium pyrophosphate, 1 mM beta -glycerol phosphate, 1 mM Na3VO4, 1 µg/ml leupeptin, and 1 mM PMSF). Equal volumes of cell lysates were incubated with immobilized phospho-ERK kinase monoclonal antibody, c-Jun fusion protein beads, and immobilized phospho-p38 monoclonal antibody for ERK, JNK, and p38, respectively, at 4°C for overnight. After centrifugation, pellets were suspended by kinase buffer (25 mM Tris, pH 7.5, 5 mM beta -glycerol phosphate, 2 mM DTT, 0.1 mM Na3VO4, 10 mM MgCl2, and 200 µM ATP) and then immunoprecipitated with specific fusion proteins Elk-1, c-Jun, and activating transcription factor (ATF)-2 for ERK, JNK, and p38, respectively, at 30°C for 30 min. The activities of ERK, p38, and JNK were then measured by Western blot. Primary antibodies (rabbit polyclonal phospho-Elk-1, phospho-c-Jun, and phospho-ATF-2 antibodies) were used at 1:1,000 dilution followed by HRP-conjugated anti-rabbit secondary antibody (1:2,000). LumiGLO (New England Biolabs) reagent was used to detect protein signals. The density of the bands was quantitated with Alpha imager 2000 (Alpha Innotech).

Transfections and luciferase assays. Cells were seeded (7 × 104 per well of a six-well plate) 16 h before transient transfection. Cells were incubated for 6 h with DNA mixtures containing serum-free media, FuGENE 6 transfection reagent (Roche, Indianapolis, IN), 2 µg empty vehicle plasmid or the plasmid of interest (see Plasmid constructs) and 0.025 µg internal control plasmid, Renilla, pRL-CMV [obtained from the dual luciferase reporter assay kit (Promega)]. After incubation, cells were washed with serum-free medium and cultured for an additional 16 h in complete medium. Cells were exposed to 24 h of anoxia alone or 24 h of anoxia followed by 8 h of reoxygenation at 37°C. Cells were lysed and substrate added according to manufacturer's protocol (Promega). Luciferase activity was normalized to Renilla activity. All conditions were done in triplicate wells, and a mean of 3-5 independent experiments was represented.

Chemicals. MAPK inhibitors, PD-98059, and SB-203580, were purchased from Calbiochem (San Diego, CA).

Statistical analysis. Data are expressed as means ± SE and were analyzed with one-way ANOVA. Statistical calculations were performed on an IBM personal computer using SPSS 8.0 for Windows software. Statistically significant difference was accepted at P < 0.05.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Induction of HO-1 expression in mouse lungs after I-R. RT-PCR and Western blot analysis were used to examine steady-state levels of HO-1 mRNA and protein, respectively, in mouse lungs after I-R. Lungs were removed from mice after 0 (naïve and ventilated-only mice) or 30 min of ischemia (left hilar clamping) alone or 30 min of ischemia followed by 2-24 h of reperfusion in normoxia. As shown in Fig. 1A, an increase of mRNA was observed after 30 min of left lung ischemia (threefold, P < 0.05), which increased to sixfold (P < 0.01) after 2-6 h of reperfusion in the left lung of all three animals compared with naïve and ventilated mice. There appears to be a decrease in HO-1 mRNA by 24 h of reperfusion, although this was performed on only one animal. The intensity of HO-1 signals was normalized to the corresponding control gene beta -actin after densitometric quantitation, and the mean induction graphically represented as percent induction with SE bars. The increase of HO-1 mRNA after 30 min of left lung ischemia alone is consistent with the 3.4-fold increase in HO-1 protein after 30 min of ischemia (Fig. 1B). However, after 6 h of reperfusion, the increase in HO-1 protein was significantly higher (30-fold). Figure 1B is a representative Western blot of mouse lung subjected to ventilation only, 30 min of ischemia alone, or 30 min of ischemia followed by 6 h of reperfusion. Similar results were obtained from three mice.


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 1.   Time course of heme oxygenase (HO)-1 mRNA and protein expression in mouse lungs after ischemia reperfusion (I-R). A: time course of HO-1 mRNA expression in mouse lungs after I-R injury. Total RNA was extracted from the left lung after ventilation with room air only (Vent) or 30 min of left hilar clamping (Ischemia), or 30 min of ischemia and reperfusion for 2 (30" Isch-2 h Reper) to 24 h of reperfusion. The left lungs of 3 mice for all conditions, except 30" Isch-24 h Reper, were used. Top: HO-1 mRNA signals; bottom: control beta -actin signals. HO-1 mRNA was normalized to beta -actin mRNA, and mean %induction over naïve is graphically represented. *P < 0.05, **P < 0.01. B: time course of HO-1 protein expression in left mouse lung after left lung I-R injury. Total protein was extracted from the left lung after ventilation only (Vent), 30 min of ischemia (Isch), or 30 min of ischemia and 6 h of reperfusion (I-R). The blot is representative of 3 mice.

Immunohistochemical analysis of HO-1 expression in mouse lungs after I-R. Tissue mRNA and protein analyses by RT-PCR and Western blots, respectively, gave us information only from homogenized lung samples. Therefore, we sought to localize the lung cell type(s)/structure(s) that may be responsible for the I-R induced HO-1 expression we observed in Fig. 1 before selecting a particular cell type to focus subsequent in vitro studies. We used a polyclonal HO-1 antibody to detect HO-1 protein in mouse lung sections. Figure 2A shows naïve mouse lung with anti-rat HO-1 antibody illustrating scant, brown, basal levels of HO-1 expression. Figure 2B is after 30 min of lung ischemia, showing a minimal increase in HO-1 protein staining, and Fig. 2C is after 30 min of ischemia followed by 6 h of reperfusion, showing intense brown HO-1 protein staining throughout all lung structures. The three lower panels (Fig. 2, D-F) represent the corresponding section at higher magnification (×40). Figure 2D is naïve mouse lung at ×40 original magnification, Fig. 2E is the left lung after 30 min of ischemia at ×40 original magnification, and Fig. 2F is the left lung after 30 min of ischemia followed by 6 h of reperfusion at ×40 original magnification. Figure 2F (30 min of ischemia, 6 h of reperfusion) shows that vasculature (arrow 1), alveoli (arrow 2), and lower airways (arrow 3) all have increased HO-1 protein staining compared with naïve lungs.


View larger version (88K):
[in this window]
[in a new window]
 
Fig. 2.   Immunohistochemical studies of mouse lung after I-R. Formalin-fixed lung sections were processed for immunohistochemical staining using anti-rat HO-1 antibody in lung tissue after 30 min of ischemia and 6 h of reperfusion. A: naïve control mice. B: mouse lung (left) after 30 min of ischemia. C: mouse lung (left) after 30 min of ischemia and 6 h of reperfusion. Original magnification in A-C, ×10. D: naïve control mice (original magnification ×40). E: mouse lung (left) after 30 min of ischemia (original magnification ×40). F: mouse lung (left) after 30 min of ischemia and 6 h of reperfusion. Arrow 1, vessel; arrow 2, alveolar epithelium; arrow 3, airway. Original magnification in D-F, ×40. All sections were counterstained with hematoxylin.

HO-1 mRNA induction in vascular cells after A-R. Although there was parenchymal and vascular staining for HO-1 protein in mouse lung after I-R injury, the fact that I-R is a prominent vascular injury model led us to select vascular cell types as the focus of our subsequent in vitro studies. Figure 3A shows the time course of HO-1 steady-state mRNA expression in rat primary PAEC, rat aVSM, and rat PASMC. The same blots were stripped and probed with the control housekeeping gene aldolase, and the normalized values were expressed as percent induction compared with room air. PAEC showed a 6.6-fold HO-1 mRNA induction by 1 h of reoxygenation (bar 4), which decreases to approximately fivefold by 4 h of reoxygenation (bar 6) compared with room air control; aVSM show a 3.5-fold HO-1 mRNA induction by 30 min of reoxygenation (bar 3), which persists for at least 8 h of reoxygenation; PASMC show a 2.2-fold induction of HO-1 mRNA by 30 min of reoxygenation (bar 3), which also persists for at least 8 h of reoxygenation.


View larger version (43K):
[in this window]
[in a new window]
 
Fig. 3.   Time course of HO-1 expression in vascular cells after anoxia-reoxygenation (A-R). A: time course of HO-1 mRNA expression in vascular cells after A-R. Total RNA was extracted from the indicated primary rat vascular cell types, as described in METHODS, after 24 h of 0% oxygen (anoxia) followed by the noted time course in 21% oxygen (reoxygenation). The same membrane was stripped (as noted in METHODS) and reprobed with the housekeeping gene aldolase, and the HO-1 band intensity was normalized to aldolase as depicted in the graphs. 1, room air (RA); 2, 24-h anoxia; 3, 30-min reoxygenation; 4, 1-h reoxygenation; 5, 2-h reoxygenation; 6, 4-h reoxygenation; 7, 8-h reoxygenation. B: time course of HO-1 protein expression in pulmonary artery endothelial cells (PAEC) after A-R. Total protein was isolated from PAEC, as described in METHODS, after 24 h of 0% oxygen (anoxia) followed by the noted time course in 21% oxygen (reoxygenation). For protein loading, the same blot was stripped (as noted in METHODS) and reprobed with antibody to beta -tubulin. The results are representative of 3-4 independent experiments.

HO-1 mRNA induction correlates with increased HO-1 protein in PAEC after A-R. Given the high level of HO-1 mRNA induction in PAEC and the well-recognized role of endothelial cells in vascular responses to injury, we used PAEC for subsequent in vitro studies. Western blot analysis of cellular extracts from PAEC exposed to anoxia or A-R shows peak HO-1 protein (sevenfold) by 8 h of reoxygenation with detectable HO-1 protein even at 24 h (Fig. 3B). The same blot was stripped and probed with the loading control beta -tubulin.

Full HO-1 gene transcription requires both the promoter and the 5' distal enhancer element E1 in PAEC after A-R. In previous studies, we determined HO-1 to be transcriptionally regulated and dependent upon cooperation between the 5' distal enhancer E1 and the proximal promoter pMHO1 in hyperoxia, another model of oxidant injury (48). Given our previous data, we examined the transcriptional regulation of HO-1 in A-R using luciferase reporter analysis with plasmid constructs encompassing different 5' regulatory regions of the HO-1 promoter (Fig. 4A). Figure 4B shows an 8.6 ± 0.7-fold induction of luciferase activity in transiently transfected PAEC with the full 5' regulatory region (construct 1) after A-R (24 h of anoxia, 8 h of reoxygenation) compared with room air. Deletion of the E1 distal enhancer (construct 2) significantly decreases HO-1 gene transcription after A-R (to 3.2 ± 0.9-fold over room air), indicating that at least some of the A-R responsive element(s) reside(s) within the E1 distal enhancer. The deletion of the E2 distal enhancer (construct 3) diminishes the level of induction to 5.2 ± 1-fold over room air, but this is not statistically significant from construct 1. Simultaneous deletion of both distal enhancers (construct 4) completely abolishes HO-1 gene transcription after A-R. Together, these results indicate that optimal activation of the HO-1 gene by A-R requires both enhancers and that E1 can more efficiently compensate for the loss of E2 than the reverse situation. In isolation (i.e., in the context of a minimal HO-1 promoter), either E1 (construct 6) or E2 (construct 7) mediates a fourfold induction in HO-1 gene transcription, providing support for the role of both regulatory regions in A-R-dependent HO-1 gene regulation. Similar to hyperoxia-induced HO-1 gene transcription, full transcription activity can be reconstituted with a construct containing the full proximal promoter (1,287 bp) (construct 1) and the E1 distal enhancer (construct 5). The difference in fold induction of construct 1 (8.6 ± 0.7) and construct 5 (11.5 ± 0.5) is not statistically significant.


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 4.   Transcriptional activation of HO-1 in PAEC after A-R. PAEC were transiently transfected, as described in METHODS, with a DNA mixture consisting of the control reporter construct, pRL-CMV (0.025 µg), and empty vector (Vehicle) or various 5' flanking regions of the mouse HO-1 gene (0.5 µg) as depicted in the map of the HO-1 gene. A: map of the mouse HO-1 5' flanking region indicating the various constructs used for transcriptional studies after A-R. Gray lines and boxes represent deleted sequences. Bold lines and boxes depict intact sequences. B: after transfection with the plasmid of interest, cells were exposed to room air, 24 h of anoxia alone, or 24 h of anoxia followed by 8 h of reperfusion. Cellular protein was extracted and assayed for firefly and Renilla assays as described in METHODS. Full HO-1 gene transcription requires the presence of the full proximal promoter, pHO1, and the distal enhancer, E1 (construct 5). Firefly luciferase activity was normalized to the control reporter construct Renilla luciferase in the same cell extract and expressed as fold induction compared with room air controls. Each data bar represents the average ± SE from 4-5 independent experiments with triplicate wells used for each transfection. *P < 0.01 compared with pHO15 A-R, #P < 0.01 compared with corresponding room air.

Activation of MAPKs in PAEC after A-R. The MAPK pathways are important candidates for signal transduction in A-R for the following reasons: 1) ROS, which are generated during the reoxygenation phase of A-R injury, activate the MAPK pathway (55); 2) oxidant stressors such as ultraviolet irradiation and hyperoxia have been shown to activate the MAPK (61, 72); 3) oxidant stressors activate the transcription factors STAT and AP-1 (68), which have been shown to have important roles in HO-1 regulation (48); and 4) the MAPK pathway regulates other oxidant-induced HO-1 gene expression (5, 27). MAPKs are activated by dual phosphorylation of threonine and tyrosine residues located in the conserved core kinase sequence (10, 19). Activated kinases can be detected by using antibodies directed against the phosphorylated peptides encompassing these residues. To determine the role, if any, of MAPK in PAEC after A-R, we performed immunoblotting studies with specific phospho-antibodies for MEK, ERK1/2, JNK1/2, and p38 MAPKs (Fig. 5). Cells were exposed to room air, anoxia alone, or A-R; proteins were extracted; and immunoblots were performed using anti-phospho MEK, ERK1/2, JNK1/2, and p38. As seen in Fig. 5, phosphorylated MEK, ERK1/2, JNK1/2, and p38, indicating activation, were all increased by 15 min of reoxygenation after 24 h of anoxia compared with room air and anoxia controls. The same blots were probed with antibody to total MEK, ERK1/2, JNK1/2, or p38 as protein loading controls.


View larger version (51K):
[in this window]
[in a new window]
 
Fig. 5.   MAPK activation in PAEC after A-R. MAPK immunoblots show increased phospho-MAP or ERK kinase (MEK), phospho-ERK, phospho-JNK, and phospho-p38 after 24 h of anoxia followed by 15 min of reoxygenation. Total MAPK proteins were detected in the same membranes as loading controls. Similar results were obtained in 3-4 independent experiments.

MEK/ERK inhibitor PD-98059 and p38 inhibitor SB-203580 attenuate HO-1 mRNA levels in PAEC after A-R. After having determined by MAPK immunoblotting that all three MAPK were activated during reoxygenation, we were interested in determining the role of individual MAPK pathways in HO-1 gene regulation in response to A-R. PD-98059, a selective cell-permeable inhibitor of MEK, and SB-203580, a highly specific cell-permeable inhibitor of p38 activity, are the best-characterized and most widely used MAPK inhibitors (18). PD-98059's selective inhibition of MEK activation and subsequent ERK1/2 phosphorylation in doses of 2-10 µM have been previously published (25, 46). SB-203580 is a pyridinyl imidazole that inhibits p38 kinase activity, without effects on other kinases, at usual doses of 50 nM (even up to 100 µM) (8, 18, 32). We pretreated PAEC for 1 h with PD-98059 (2 or 10 µM) or SB-203580 (50 or 100 nM) before A-R exposure (Fig. 6A). Total cell RNA was extracted, and HO-1 mRNA was detected by Northern blot analysis as described in METHODS. The same blot was stripped and probed with the control gene aldolase, and the HO-1 mRNA band intensity was normalized to that of aldolase. The graph in Fig. 6A shows that the ninefold increase in HO-1 mRNA after 1 h of reoxygenation is attenuated to levels comparable with room air or anoxia alone, even at low doses of PD-98059 or SB-203580 pretreatment. To confirm the specificity of PD-98059 and SB-203580, we show that even at the higher doses of PD-98059 (10 µM) or SB-203580 (100 nM), PD-98059 has no effect on JNK1/2 or p38 phosphorylation or activity, whereas SB-203580 has no effect on ERK1/2 or JNK1/2 phosphorylation or activity (Fig. 6B).


View larger version (46K):
[in this window]
[in a new window]
 
Fig. 6.   Chemical inhibitors of MEK/ERK and p38 inhibit HO-1 mRNA in PAEC after A-R. A: PAEC were pretreated with MEK/ERK inhibitor PD-98059 (PD) or p38 inhibitor SB-203580 (SB) for 1 h alone (RA) or 1 h of pretreatment followed by 24 h of anoxia and 1 h of reoxygenation (Reox). Total RNA was extracted as per METHODS, and Northern blot analysis was performed. The same membrane was stripped (as noted in METHODS), reprobed with the housekeeping gene aldolase, and HO-1 band intensity was normalized to aldolase as depicted in the graph. B: specificity of PD and SB for MEK/ERK and p38 MAPKs, respectively. Cells were pretreated with PD (10 µM) or SB (100 nM) before exposure to 24 h of anoxia and 30 min of reoxygenation. Left: immunoblot of phospho-ERK, phospho-JNK, and phospho-p38. The same membrane was probed for total MAPK for loading control according to METHODS. Right: phospho-ERK, JNK, and p38 activities were detected using the MAPK activity protocol described in METHODS.

Dominant-negative MAPK mutants inhibit HO-1 gene transcription in PAEC after A-R. To confirm our findings that MAPK inhibition attenuates HO-1 mRNA expression and the fact that a selective, well-validated pharmacological JNK inhibitor is not available, we further examined the role of specific MAPKs in HO-1 gene regulation after A-R using kinase-deficient DNM. PAEC were transiently transfected, according to METHODS, with the internal control gene pRL-CMV, pHO1+E1, which was shown to be sufficient for full HO-1 gene transcription after A-R in Fig. 4B, and either a DNM or empty vehicle. We performed a dose response (0.25-2 µg), which is in the range of commonly published doses, for each MAPK DNM, while keeping the doses of the control gene pRL-CMV and pHO1+E1 constant (0.025 and 0.5 µg, respectively). The cells were then exposed to room air, anoxia, or anoxia followed by reoxygenation, and luciferase activity was expressed as fold induction after we normalizd values to the internal control, Renilla activity. Figure 7A shows an 11.5 ± 0.5 mean fold increase in HO-1 luciferase activity with pHO1+E1. The fact that pRL-CMV plus pHO1+E1 plus empty vehicle (at varying doses) does not suppress HO-1 luciferase activity makes it unlikely that merely the presence of multiple DNA constructs suppresses gene transcription. ERK1, ERK2, and p38 DNMs at low doses (0.25 µg) do not significantly decrease HO-1 luciferase activity. JNK1 and JNK2 DNMs at 0.25 µg, however, lead to 8 ± 0.8 and 7.8 ± 0.7 mean fold increase, respectively, in HO-1 luciferase activity, which is a statistically significant decrease compared with the 11.5 ± 0.5 mean fold induction observed with pHO1+E1 (P < 0.05). The fact that JNK DNMs begins to suppress HO-1 luciferase activity at low doses may reflect the relative importance of the JNK pathway (compared with ERK and p38) to HO-1 gene transcription, the presence of other, non-MAPK signaling pathways that converge with the JNK pathway or simply more efficient translation and accumulation of the JNK DNM proteins after transfection.


View larger version (61K):
[in this window]
[in a new window]
 
Fig. 7.   MAPK dominant-negative mutants (DNM) inhibit HO-1 gene transcription after A-R. A: PAEC were transiently transfected, as described in METHODS, with a DNA mixture consisting of the control reporter construct pRL-CMV (0.025 µg), pHO1+E1 (0.5 µg), and vehicle (Veh, 0.25-2 µg) or pRL-CMV, pHO1+E1, and the MAPK DNM (0.25-2 µg) of interest as noted. After transfection, cells were exposed to room air, 24 h of anoxia alone, or 24 h of anoxia followed by 8 h of reoxygenation. Cellular protein was extracted and assayed for firefly and Renilla assays as described in METHODS. Firefly luciferase activity was normalized to the control reporter construct Renilla luciferase in the same cell extract and expressed as fold induction compared with room air controls. Each data bar represents the average ± SE from 3 independent experiments with triplicate wells used for each transfection. *P < 0.01, #P < 0.05 compared with pHO1+E1 A-R. B: specificity of the MAPK DNMs. PAEC were transfected with 0.25 or 2 µg of MAPK DNMs. After transfection, cells were exposed to room air, 24 h of anoxia alone, or 24 h of anoxia followed by 15 min of reoxygenation (Reoxy). Phospho-MAPKs were detected according to METHODS, and total MAPK proteins were detected in the same membrane for loading control. C: PAEC were transfected with plasmid enhanced green fluorescent protein (pEGFP), and fluorescence was detected (right). Phase contrast (left) shows total number of cells.

It is less likely that JNK DNMs simultaneously inhibit other MAPK pathways, given our data in Fig. 7B. However, all the DNMs at 0.5 µg significantly decrease HO-1 gene activity to fivefold or less (P < 0.01). ERK2 DNM, even at 2 µg, does not decrease the level of HO-1 gene activity to the extent that ERK1, JNK1/2, and p38 DNMs do. At 2 µg of ERK2 DNM, there is still a significant mean fold increase (4.3 ± 0.9) in HO-1 gene transcription compared with room air, whereas 2 µg of ERK1, JNK1, JNK2, or p38 decrease HO-1 luciferase activity to <1.5 mean fold induction. Of note, other than ERK2 DNM, all other DNM constructs (ERK1, JNK1, JNK2, and p38) show no significant induction in HO-1 luciferase activity compared with respective room air controls at doses >0.5 µg. ERK2 may contribute less to overall HO-1 gene transcription in PAEC after reoxygenation compared with the importance of JNK1/2, ERK1, and p38 MAPKs. Figure 7B demonstrates the specificity of each MAPK DNM for its respective MAPK target. These MAPK DNMs have been used extensively in the literature. The relative specificity of each DNM has been described in terms its downstream targets, JNK and c-Jun, for instance, or the inability of pathway-specific upstream kinases to activate the corresponding DNM (28, 33, 75). However, much remains unknown about the precise mechanisms of the MAPK DNMs, and little data exist as to whether an ERK DNM has effects on JNK or p38 pathways, although these data are well established for the pharmacological MAPK inhibitors. Therefore, the ability of p38 DNM to reproduce the biological effects of its specific pharmacological inhibitor, SB-203580, or the inability of SB-203580 to affect an established JNK-dependent process has been used as evidence for specificity (23, 65, 78). Our set of data in Fig. 7B may be one of the first to specifically address whether one MAPK DNM can prevent the phosphorylation of the two alternative MAPKs. PAEC were transiently transfected with low (0.25 µg) and high (2 µg) doses of ERK, JNK, or p38 DNMs. The cells were then exposed to room air, 24 h of anoxia alone, or anoxia followed by 15 min of reoxygenation, and immunoblots were performed for phosphorylated MAPK, per METHODS. The same membranes were stripped and probed with the corresponding total MAPK as loading controls (Fig. 7B, bottom). By 15 min of reoxygenation, there is increased phospho-ERK, -JNK, and -p38 (consistent with Fig. 5). At 2 µg, ERK DNM attenuates ERK phosphorylation without affecting JNK or p38, whereas JNK DNM attenuates only JNK phosphorylation and p38 DNM attenuates only p38 phosphorylation. The inability of low doses of JNK DNM (0.25 mg) to inhibit JNK phosphorylation while inhibiting HO-1 luciferase activity (Fig. 7A) may be due to differences in transfection efficiency, which we are able to control for in cotransfection luciferase assays but not in MAPK immunoblotting. For instance, 0.25 µg of JNK DNM likely transfects only a portion (perhaps 25%) of the cells, in which case the other untransfected cells still express activated JNK during reoxygenation, yielding a phospho-JNK band on immunoblotting.

At higher doses of JNK DNM (2 µg), we are approaching greater transfection efficiency (>50% as documented by EGFP transfection, Fig. 7C) and, therefore, effectively ablate detectable JNK activity. In the HO-1 luciferase assay, JNK DNM is present in 100% of the cells that exhibit luciferase activity, and therefore we can see the biological effect of suppressed HO-1 transcription in the luciferase-transfected cells. Alternatively, as we suggested earlier in this section, JNK DNM may inhibit other, non-MAPK signaling pathways involved in HO-1 gene transcription at doses that do not prevent JNK phosphorylation. Figure 7C confirms the high rate of transfection efficiency achieved in our experiments. PAEC were transfected with pEGFP (1 µg), according to METHODS, and 24 h later cells were photographed under phase-contrast microscopy in a light field (Fig. 7C, left) to show total number of cells or under fluorescence to show the transfected cells (Fig. 7C, right) using an Olympus microscope. More than 50-60% of the cells have incorporated the pEGFP, as noted by the significant number of green fluorescent cells. Despite this high level of transfection efficiency, the amount of total MAPK protein, detected in Fig. 7B, does not significantly increase with DNM transfection.

As described in the original publications of the MAPK DNMs, these mutants lack kinase activity and act to suppress endogenous MAPK phosphorylation by binding the respective upstream MAPK kinases. The ERK1/2 DNMs have point mutations that confer <1 and 5% wild-type kinase activity in vitro, respectively (28). The JNK1/2 DNMs are inactive by virtue of replacing the sites of activating Thr and Tyr phosphorylation with Ala and Phe, respectively (33), and the p38 DNM has a TGY180-182-to-AGF altered phosphorylation site (38). Neither the original papers nor the extensive subsequent publications of studies using the same DNMs describe the levels of total MAPK with DNM transfection; they essentially show transfection efficiency and confirm biological activity of the DNMs (23, 39, 75, 78). Theoretically, the antibody for total MAPK should detect the wild-type and DNM MAPKs, but we have consistently noted that there is no increase in total MAPK with DNM transfection and have confirmed this in independent experiments. A potential explanation may be that when the DNM binds the endogenous upstream MKKs, this nonproductive protein product may be unstable, rapidly degraded, and thus not detected on immunoblotting. This would have to occur for all the DNMs however. Other laboratories (Chuanju Liu, personal communication) have encountered similar issues of not detecting increased protein levels with DNM transfection despite high transfection efficiencies, and they postulate that perhaps the DNM may have other biological activity (such as suppressing endogenous wild-type protein expression) that is yet unknown. At this point, neither our laboratories nor the literature has fully addressed this issue, but it is certainly an issue that should be explored in the future.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

I-R is a well-established model of oxidant-mediated injury that is particularly pertinent to the highly vascular lungs. The lungs harbor multiple calibers of vessels from the large pulmonary arteries, which are clamped and released during surgical procedures, to the lace-like alveolar capillaries that are constantly subjected to oxygen radicals via the inspired air in the alveoli. During stress states, such as inflammation, therapeutic doses of inhaled oxygen, or surgically imposed I-R, the lung vasculature and parenchyma are barraged with an excess of reactive oxidants that overwhelm the fine balance between oxidants and antioxidants. Therefore, it is not surprising that the lungs have evolved a complex, sophisticated, and redundant network of antioxidant defenses. An important arm of the antioxidant response consists of antioxidant enzymes and stress-response proteins (15, 16). One such stress-response protein is HO-1, the rate-limiting enzyme in heme catabolism that oxidatively cleaves the alpha -meso carbon bridge of b-type heme molecules (70). During HO-1 activity, equimolar quantities of biliverdin IXalpha , CO, and iron are released, potentially contributing to HO-1's cytoprotective effects. For instance, in mammals, biliverdin is subsequently converted to bilirubin, which is a potent scavenger of lipid peroxidation products (69) and offers protection in a rat liver I-R model (80). In addition, the by-product CO is multifaceted and can substitute for many of the protective effects of HO-1 expression (11, 29, 45, 59). Finally, iron, which is released during HO-1 catalysis, is sequestered into ferritin, which has been shown to possess protective properties (9, 63, 74).

Various investigators have demonstrated the importance of HO-1 in vessels and endothelial cells. Gene transfer of HO-1 into pig arteries protects against vascular constriction and proliferation in angioplasty-induced injury (24). During I-R injury of the heart, brain, kidney, liver, and most recently, lung, HO-1 expression is necessary for preserved organ function and animal survival (7, 29, 36, 60, 66). Despite the preponderance of evidence of HO-1's protective effects in vascular injury models, further details are required as to the precise actions of HO-1 in the vasculature. Morita et al. (54) have shown in a coculture system that vascular smooth muscle (VSM)-derived CO via HO-1 exerts a paracrine effect on endothelial cells, which presumably should decrease vascular tone due to CO's vasodilatory effects, yet VSM HO-1 transgenic mice exhibit systemic hypertension (40). More recent evidence points to an antiproliferative role of HO-1 in HO-1 transgenic mice (lung specific) that were protected from hypoxia-induced hypertension and vessel hypertrophy (53). Given the overall consistency of data that show HO-1 expression is generally a protective response, it is unlikely that the various data are contradictory. However, the range of HO-1 effects alerts us to the importance of cell specificity and the need to further define the underlying mechanisms of HO-1 induction.

Despite the accumulating evidence for the physiological importance of HO-1 and its by-products in vascular injury, little is known regarding the precise molecular mechanisms regulating HO-1 gene expression after lung I-R and the signaling mechanisms utilized by endothelial cells to induce HO-1. Therefore, in this current study, we focus upon PAEC expression and regulation studies. Mouse lungs as well as various vascular cell types markedly express HO-1 mRNA and protein after I-R (or the in vitro counterpart, A-R) injury. In addition, the full proximal promoter pHO1 and distal enhancer E1 are sufficient for full HO-1 gene activation after A-R. This cooperative effect between the HO-1 promoter and distal enhancer element is not surprising, given our previous finding that another oxidant stress, hyperoxia, requires both sites with specific involvement of AP-1 and STAT transactivators (48). This is in contrast to HO-1 induction by heme, heavy metals, and LPS, which require the E1 enhancer alone (2, 6, 12).

To extend our HO-1 transcriptional studies to upstream signaling events, we used the knowledge that HO-1 induction after oxidants, such as hyperoxia, involves transcription factors such as AP-1 and STAT members (48). Both STATs and AP-1, a heterodimer of c-Fos and c-Jun, are phosphorylated and thus activated by MAPKs (41, 43). In addition, I-R injury has been shown to activate Rac, a small G protein upstream of JNK and p38 MAPKs (42). Further links between HO-1 and MAPK have been established in studies that show p38 MAPK activation is necessary for cadmium-induced HO-1 gene expression and the antiapoptotic and anti-inflammatory effects of CO, a HO-1 by-product (5, 11, 57). A variety of cellular stresses activate the MAPKs that then exert transcriptional changes within cells. The cascade of biological effects initiated by MAPK signaling subsequently allows cells to respond and eventually adapt to noxious stimuli. The ERK pathway prototypically transduces critical mitogenic signals from growth factors to the nucleus (19, 51). Both JNK and p38 MAPK respond to stresses, such as inflammatory cytokines and genotoxic stress, and play pivotal roles in differentiation, survival, and apoptosis (20, 22, 64). The role of MAPK in pulmonary endothelial cells after A-R has not been previously described. We show that all three subfamilies of MAPK, ERK, JNK, and p38, are activated during the reperfusion phase of A-R in PAEC. A previous study of myocardial ischemia shows in vivo activation of ERK, JNK, and p38, but this likely represents MAPK activation in multiple cell types (67). Another paper documents ERK and JNK activation during the reperfusion phase of myocardial ischemia in vivo, but again, the responsible cell type(s) is not delineated (55). Cadmium, a potent inducer of HO-1, activates all three MAPK pathways, but only p38 is involved in HO-1 gene transcription (5).

Our current data show that not only are all three MAPK pathways activated during the reoxygenation phase of A-R but that all are also involved in HO-1 gene transcription. DNMs of ERK1, JNK, and p38 significantly inhibited HO-1 gene activation after A-R at doses >0.25 µg, with ERK2 DNM showing less, though still significant, suppression of HO-1 gene activation (Fig. 7A). Interestingly, JNK1 and JNK2 DNMs inhibit HO-1 gene activation even at low doses (0.25 µg). This may be due to the critical role the JNK pathway has in HO-1 signal transduction after A-R, or the more efficient translation and accumulation of JNK DNM proteins after transfection, or JNK DNM's inhibition of other signaling pathways. Our data in Fig. 7B show that JNK DNM does not affect ERK or p38 activation. The convergence of JNK with non-MAPK signaling pathways has not been described and, although an interesting possibility, is beyond the scope of our current studies.

The importance of all three subfamilies of MAPKs in HO-1 transcription has been noted in mouse hepatoma cells by sodium arsenite (J. Alam, personal communication) and likely reflects the complexity of HO-1 regulation. Elbirt et al. (27) implicate both ERK and p38 MAPK pathways in chicken HO-1 induction by sodium arsenite. The presence of multiple signaling pathways in HO-1 regulation likely reflects the fact that there are a variety of HO-1 inducers and multiple transcription factors that, in cooperation, can activate the mouse HO-1 gene. For instance, AP-1, Maf, cAMP response element binding protein/ATF, and cap "N" collar basic region/leucine zipper (CNC-bZIP) families of transcription factors can all recognize a 10-bp sequence in the HO-1 gene called the stress response element (StRE) (14). Despite the multiple inducers and transactivators involved in HO-1 expression, there is likely convergence onto this StRE, which is present in multiple copies throughout the 5' regulatory region and is essential for inducer-dependent gene activation (5). Gong et al. (31) recently published a study showing that cobalt induces HO-1 expression via Nrf2, a member of the CNC-bZIP family, and MafG. He et al. (37) also identified binding interaction between Nrf2 and ATF-4. In addition, despite the delineation of three MAPK subfamilies, it is well established that there is significant cross talk among the pathways, because they respond to common upstream activators and phosphorylate common downstream targets (26, 76). A possible scenario is that, depending on the extracellular stress or signal, specific sets of signaling pathways (in the case of A-R, the MAPK superfamily) are activated, which in turn activate specific homo- and heterodimers of transcription factors, which converge upon critical HO-1 consensus sequences that potentiate HO-1 gene upregulation and thereby confer protection. The induction of HO-1 in response to A-R may require absolute cooperation among several transcription factors bound at different sites (for instance within E1). Diverse signaling pathways may activate the different transcription factors, and thus if one transcription factor is inhibited, the entire HO-1 response may be ablated.

It is beyond the scope of this current study to delineate the precise transcription factors involved in I-R, but given the importance of the HO-1 promoter and distal enhancer E1 that contains the multirepeat StRE, potential candidate transcription factors include STAT, AP-1, ATF, and CNC-bZIP proteins. In addition, future studies will attempt to delineate the relative contribution of each MAPK subfamily to HO-1 gene activation by examining signaling proteins further upstream of the MEK, ERK, JNK, and p38 MAPKs. Determining how the MAPK kinases, c-Raf, Ras, Rac, Rho, and Cdc proteins contribute to HO-1 transcription after A-R may indicate points of convergence or further specificity. Our data thus far delineate the marked upregulation in lungs and vascular cells after I-R or A-R, respectively, and this induction is under transcriptional control. The critical cis-acting elements include both the proximal promoter in conjunction with the E1 distal enhancer site, and upstream signaling involves all three MAPK subfamilies.


    ACKNOWLEDGEMENTS

P. J. Lee was supported by the National Institutes of Health (NIH) K08 Award and the American Lung Association of Connecticut. A. M. K. Choi was supported by NIH Grants HL-55330, AI-42365, and HL-60234 and an American Heart Association Established Investigator Award. J. Alam was supported by NIH Grant DK-43135.


    FOOTNOTES

Address for reprint requests and other correspondence: P. J. Lee, Section of Pulmonary and Critical Care Medicine, Yale Univ. School of Medicine, 333 Cedar St., LCI 105, New Haven, CT 06520 (E-mail: patty.lee{at}yale.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

May 24, 2002;10.1152/ajplung.00485.2001

Received 17 December 2001; accepted in final form 17 May 2002.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Abraham, NG, Lavrovsky Y, Schwartzman ML, Stoltz RA, Levere RD, Gerritsen ME, Shibahara S, and Kappas A. Transfection of the human heme oxygenase gene into rabbit coronary microvessel endothelial cells: protective effect against heme and hemoglobin toxicity. Proc Natl Acad Sci USA 92: 6798-6802, 1995[Abstract/Free Full Text].

2.   Alam, J. Multiple elements within the 5' distal enhancer of the mouse heme oxygenase-1 gene mediate induction by heavy metals. J Biol Chem 269: 25049-25056, 1994[Abstract/Free Full Text].

3.   Alam, J, Cai J, and Smith A. Isolation and characterization of the mouse heme oxygenase-1 gene. J Biol Chem 269: 1001-1009, 1994[Abstract/Free Full Text].

4.   Alam, J, Camhi S, and Choi AMK Identification of a second region upstream of the mouse heme oxygenase-1 gene that functions as a basal level and inducer-dependent transcription enhancer. J Biol Chem 270: 11977-11984, 1995[Abstract/Free Full Text].

5.   Alam, J, Wicks C, Stewart D, Gong P, Touchard C, Otterbein S, Choi AMK, Burow ME, and Tou J. Mechanism of heme oxygenase-1 gene activation by cadmium in MCF-7 mammary epithelial cells. J Biol Chem 275: 27694-27702, 2000[Abstract/Free Full Text].

6.   Alam, J, and Zhining D. Distal AP-1 binding sites mediate basal level enhancement and TPA induction of the mouse heme oxygenase-1 gene. J Biol Chem 267: 21894-21900, 1992[Abstract/Free Full Text].

7.   Amersi, F, Buelow R, Kato H, Ke B, Coito AJ, Shen XD, Zhao D, Zakyk J, Melinek J, Lassman CR, Kolls JK, Alam J, Ritter T, Volk HD, Farmer DG, Ghobrial RM, Busuttil RW, and Kupiec-Weglinski JW. Upregulation of heme oxygenase-1 protects genetically fat Zucker rat livers from ischemia/reperfusion injury. J Clin Invest 104: 1631-1639, 1999[ISI][Medline].

8.   Badger, AM, Bradbeer JN, Votta B, Lee JC, Adams JL, and Griswold DE. Pharmacological profile of SB 203580, a selective inhibitor of cytokine suppressive binding protein/p38 kinase, in animal models of arthritis, bone resorption, endotoxin shock, and immune function. J Pharmacol Exp Ther 279: 1453-1461, 1996[Abstract/Free Full Text].

9.   Balla, G, Jacob HS, Balla J, Rosenberg M, Nath K, Apple F, Eaton JW, and Vercellotti GM. Ferritin: a cytoprotective antioxidant strategem of endothelium. J Biol Chem 267: 18148-18153, 1992[Abstract/Free Full Text].

10.   Blenis, J. Signal transduction via the MAP kinases: proceed at your own RSK. Proc Natl Acad Sci USA 90: 5889-25892, 1993[Abstract/Free Full Text].

11.   Brouard, S, Otterbein LE, Anrather J, Tobiasch E, Bach FH, Choi AMK, and Soares MP. Carbon monoxide generated by heme oxygenase 1 suppresses endothelial cell apoptosis. J Exp Med 192: 1015-1025, 2000[Abstract/Free Full Text].

12.   Camhi, S, Alam J, Otterbein L, Sylvester SL, and Choi AMK Induction of heme oxygenase-1 gene expression by lipopolysaccharide is mediated by AP-1 activation. Am J Respir Cell Mol Biol 13: 387-398, 1995[Abstract].

13.   Camhi, SL, Alam J, Wiegand GW, Chin BY, and Choi AMK Transcriptional activation of the HO-1 gene by lipopolysaccharide is mediated by 5' distal enhancers: role of reactive oxygen intermediates and AP-1. Am J Respir Cell Mol Biol 18: 226-234, 1998[Abstract/Free Full Text].

14.   Choi, AMK, and Alam J. Heme oxygenase-1: function, regulation, and implication of a novel stress-inducible protein in oxidant-induced lung injury. Am J Respir Cell Mol Biol 15: 9-19, 1996[Abstract].

15.   Choi, AMK, Sylvester SL, Otterbein L, and Holbrook NJ. Molecular responses to hyperoxia in vivo: relationship to increased tolerance in aged rats. Am J Respir Cell Mol Biol 13: 74-82, 1995[Abstract].

16.   Clerch, LB, and Massaro DJ. Tolerance of rats to hyperoxia. J Clin Invest 91: 499-508, 1993[ISI][Medline].

17.   David, M, Petricoin E, III, Benjamin C, Pine R, Weber MJ, and Larner AC. Requirement for MAP Kinase (ERK2) activity in interferon alpha - and interferon beta -stimulated gene expression through STAT proteins. Science 269: 1721-1723, 1995[Abstract/Free Full Text].

18.   Davies, SP, Reddy H, Caivano M, and Cohen P. Specificity and mechanism of action of some commonly used protein kinase inhibitors. Biochem J 351: 95-105, 2000[ISI][Medline].

19.   Davis, RJ. The mitogen-activated protein kinase signal transduction pathway. J Biol Chem 268: 14553-14556, 1993[Free Full Text].

20.   Davis, RJ. MAPKs: new JNK expands the group. Trends Biochem Sci 19: 470-473, 1994[ISI][Medline].

21.   Dennery, PA, Wong HE, Sridhar KJ, Rodgers PA, Sim JE, and Spitz DR. Differences in basal and hyperoxia-associated HO expression in oxidant-resistant hamster fibroblasts. Am J Physiol Lung Cell Mol Physiol 271: L672-L679, 1996[Abstract/Free Full Text].

22.   Derijard, B, Hibi M, Wu IH, Barrett T, Su B, Deng T, Karin M, and Davis RJ. JNK1: a protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun activation domain. Cell 76: 1025-1037, 1994[ISI][Medline].

23.   Dougherty, CJ, Kubasiak LA, Prentice H, Andreka P, Bishopric NA, and Webster KA. Activation of c-Jun N-terminal kinase promotes survival of cardiac myocytes after oxidative stress. Biochem J 362: 561-571, 2002[ISI][Medline].

24.   Duckers, HJ, Boehm M, True AL, Yet S-F, San H, Park JL, Webb RC, Lee M-E, Nabel GJ, and Nabel EG. Heme oxygenase-1 protects against vascular constriction and proliferation. Nat Med 7: 693-698, 2001[ISI][Medline].

25.   Dudley, DT, Pang L, Decker SJ, Bridges AJ, and Saltiel AR. A synthetic inhibitor of the mitogen-activated protein kinase cascade. Proc Natl Acad Sci USA 92: 7686-7689, 1995[Abstract/Free Full Text].

26.   Egan, SE, and Weinberg RA. The pathway to signal achievement. Nature 365: 781-783, 1993[Medline].

27.   Elbirt, KK, Whitmarsh AJ, Davis RJ, and Bonkovsky A. Mechanism of sodium arsenite-mediated induction of heme oxygenase-1 in hepatoma cells: involvement of MAP kinases. J Biol Chem 273: 8922-8931, 1999.

28.   Frost, J, Geppert T, Cobb M, and Feramisco J. A requirement for extracellular signal-regulated kinase (ERK) function in the activation of AP-1 by Ha-Ras, phorbol 12-myristate 13-acetate, and serum. Proc Natl Acad Sci USA 91: 3844-3848, 1994[Abstract/Free Full Text].

29.   Fugita, T, Toda K, Karimova A, Yan S-F, Naka Y, Yet S-F, and Pinsky DJ. Paradoxical rescue from ischemic lung injury by inhaled carbon monoxide by derepression of fibrinolysis. Nat Med 7: 598-604, 2001[ISI][Medline].

30.   Goh, KC, Haque SJ, and Williams BRG p38 MAP kinase is required for STAT1 serine phosphorylation and transcriptional activation induced by interferons. EMBO J 18: 5601-5608, 1999[ISI][Medline].

31.   Gong, PF, Hu B, Stewart D, Ellerbe M, Figueroa YG, Blank V, Beckman BS, and Alam J. Cobalt induces heme oxygenase-1 expression by a hypoxia-inducible factor-independent mechanism in Chinese hamster ovary cells-regulation by Nrf2 and MafG transcription factors. J Biol Chem 276: 27018-27025, 2001[Abstract/Free Full Text].

32.   Gum, RJ, McLaughlin MM, Kumar S, Wang Z, Bower MJ, Lee JC, Adams JL, Livi GP, Goldsmith EJ, and Young PR. Acquisition of sensitivity of stress-activated protein kinases to the p38 inhibitor, SB 203580, by alteration of one or more amino acids within the ATP binding pocket. J Biol Chem 273: 15605-15610, 1998[Abstract/Free Full Text].

33.   Gupta, S, Campbell D, Derijard B, and Davis RJ. Transcription factor ATF2 regulation by the JNK signal transduction pathway. Science 276: 389-393, 1995.

34.   Han, J, Lee J-D, Bibbs L, and Ulevitch RJ. A MAP kinase targeted by endotoxin and hyperosmolarity in mammalian cells. Science 265: 808-811, 1994[Abstract/Free Full Text].

35.   Han, ZS, Enslen H, Hu X, Meng X, Wu I-H, Barrett T, Davis RJ, and Ip YT. A conserved p38 mitogen-activated protein kinase pathway regulates Drosophila immunity gene expression. Mol Cell Biol 18: 3527-3539, 1998[Abstract/Free Full Text].

36.   Hangaishi, M, Ishizaka N, Aizawa T, Kurihara Y, Taguchi J, Nagai R, Kimura S, and Ohno M. Induction of heme oxygenase-1 can act protectively against cardiac ischemia/reperfusion in vivo. Biochem Biophys Res Commun 279: 582-588, 2000[ISI][Medline].

37.   He, CH, Gong PF, Hu B, Stewart D, Choi ME, Choi AMK, and Alam J. Identification of activating transcription factor 4 (ATF4) as an Nrf2-interacting protein-implication for heme oxygenase-1 gene regulation. J Biol Chem 276: 20858-20865, 2001[Abstract/Free Full Text].

38.   Huang, S, Jiang Y, Li Z, Nishida E, Mathias P, Lin S, Ulevitch RJ, Nemerow GR, and Han J. Apoptosis signaling pathway in T cells is composed of ICE/Ced-3 family proteases and MAPK kinase kinase 6b. Immunity 6: 739-749, 1997[ISI][Medline].

39.   Hur, E, Chang KY, Lee EJ, Lee S-K, and Park HY. Mitogen-activated protein kinase kinase inhibitor PD98059 blocks the trans-activation but not the stabilization or DNA binding ability of hypoxia-inducible factor-1alpha . Mol Pharmacol 59: 1216-1224, 2001[Abstract/Free Full Text].

40.   Imai, T, Morita T, Shindo T, Nagai R, Yazaki Y, Kurihara H, Suematsu M, and Katayama S. Vascular smooth muscle cell-directed overexpression of heme oxygenase-1 elevates blood pressure through attenuation of nitric oxide-induced vasodilation in mice. Circ Res 89: 55-62, 2001[Abstract/Free Full Text].

41.   Karin, M. The regulation of AP-1 activity by mitogen-activated protein kinases. J Biol Chem 270: 16483-16486, 1995[Free Full Text].

42.   Kim, K-S, Takeda K, Sethi R, Pracyk JB, Koichi T, Zhou YF, Yu Z-X, Victor J, Bruder JT, Kovesdi I, Irani K, Goldschmidt-Clermont P, and Finkel T. Protection from reoxygenation injury by inhibition of rac1. J Clin Invest 101: 1821-1826, 1998[ISI][Medline].

43.   Koh, KC, Haque SJ, and Williams BRB p38 MAP kinase is required for STAT1 serine phosphorylation and transcriptional activation induced by interferons. EMBO J 18: 5601-5608, 1999[ISI][Medline].

44.   Korzus, E, Nagase H, Rydell R, and Travis J. The mitogen-activated protein kinase and Jak-STAT signaling pathways are required for an Oncostatin M-responsive element-mediated activation of matrix metalloproteinase 1 gene expression. J Biol Chem 272: 1188-1196, 1997[Abstract/Free Full Text].

45.   Kyokane, T, Norimizu S, Hisashi T, Yamaguchi T, Takeoka S, Tsuchida E, Naito M, Nimura Y, Ishimura Y, and Suematsu M. Carbon monoxide from heme catabolism protects against hepatobiliary dysfunction in endotoxin-treated rat liver. Gastroenterology 120: 1227-1240, 2001[ISI][Medline].

46.   Langlois, WJ, Sasaoka T, Saltiel AR, and Olefsky JM. Negative feedback regulation and desensitization of insulin-and epidermal growth facto