|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Section of Pulmonary and Critical Care Medicine, Yale University School of Medicine, New Haven, Connecticut 06520; 2 Department of Surgery, University of Western Ontario, London Ontario, Canada N6A 5A5; 3 Department of Molecular Genetics, Alton Ochsner Medical Foundation and Department of Biochemistry and Molecular Biology, Louisiana State University Medical Center, New Orleans, Louisiana 70121; and 4 Division of Pulmonary, Allergy, and Critical Care, University of Pittsburgh, Pittsburgh, Pennsylvania 15213
| |
ABSTRACT |
|---|
|
|
|---|
Lung ischemia-reperfusion (I-R) is an important model of oxidant-mediated acute lung and vascular injury. Heme oxygenase-1 (HO-1) is a cytoprotective gene that is markedly induced by lung I-R injury. HO-1 mRNA is increased in mouse lung after 30 min of lung hilar clamping (ischemia) followed by 2-6 h of unclamping (reperfusion) compared with control mice. In a variety of vascular cell types, HO-1 mRNA is induced after 24 h of anoxia followed by 30 min-1 h of reoxygenation (A-R). Transfection studies reveal that the promoter and 5'-distal enhancer E1 are necessary and sufficient for increased HO-1 gene transcription after A-R. Immunoblotting studies show all three subfamilies of MAPKs (ERK, JNK, and p38) are activated by 15 min of reperfusion. We also demonstrate that HO-1 gene transcription after A-R involves ERK, JNK, and p38 MAPK pathways. Together, our data show that I-R not only induces HO-1 gene expression in mouse lungs and vascular cells but that gene transcription occurs via the promoter and E1 enhancer and involves upstream MAPK pathways.
oxidant injury; gene regulation; heme oxygenase; mitogen-activated protein kinases
| |
INTRODUCTION |
|---|
|
|
|---|
ISCHEMIA-REPERFUSION (I-R) injury generates systemic reactive oxygen species (ROS) during the reperfusion phase and subsequent oxidant-mediated tissue injury. Oxidant injury in the lung causes diffuse parenchymal and vascular damage and is a relevant model for studying the pathogenesis of acute respiratory failure as well as lung transplantation injury. Heme oxygenase (HO)-1, a ubiquitous heme-degrading enzyme, has generated much interest as a novel stress protein that is highly induced by and protects against oxidative stress. HO catalyzes the initial and rate-limiting step in the oxidative degradation of heme to biliverdin with the release of the catalytic by-products carbon monoxide and iron (71). HO exists in three isoforms: whereas HO-2 and HO-3 are primarily constitutive, HO-1 is highly inducible (50, 52). HO-1 induction in models of oxidative stress has been shown to protect against noxious stimuli, including ultraviolet irradiation (73), hyperoxia (21, 47, 58), LPS (56), and heme-induced injury (1, 9) in vitro and in vivo. The increased susceptibility of HO-1 null knockout mice to oxidative stress (62) and a similar pattern in the one case of human HO-1 deficiency (79) further attest to the physiological importance of HO-1 and strengthens the emerging paradigm that HO-1 is indeed an important molecule in the host defense against oxidant injury. Several investigators have used I-R animal models to confirm that increased expression of HO-1, or its reaction product carbon monoxide (CO), correlates with improved survival and organ function in the brain, kidney, liver, heart, and lungs (7, 29, 36, 60, 66).
Despite the accumulating evidence that HO-1 induction significantly
ameliorates tissue injury after I-R, the molecular mechanisms and
signaling pathways leading to HO-1 induction are unknown. The mouse
HO-1 gene is 7.3 kb long with five exons and four introns (3). Previous studies using heme and heavy metals have
identified important cis-regulatory elements in the HO-1
gene (2, 4, 6). In addition, HO-1 gene regulation in
response to LPS, hypoxia, and hyperoxia has also been elucidated
(12, 48, 49). In the previous models tested, such as LPS,
heavy metals, and heme, mouse HO-1 induction is primarily regulated at
the level of gene transcription and is mediated by one or both of two
distal enhancer regions termed E1 and E2 (previously described as SX2
and AB1, respectively), located at approximately
4 and
10 kb pairs,
respectively (2, 3, 13). In our recent study of
hyperoxia-induced HO-1 gene transcription, both the proximal promoter
and E1 distal enhancer were necessary and sufficient for full HO-1 gene
transcription and likely involved one or more members of the activator
protein (AP)-1 and signal transducer and activator of transcription
(STAT) families of transcription factors (48).
Candidate upstream signaling pathways for HO-1 regulation are the mitogen-activated protein kinases (MAPKs). The MAPKs are a group of protein kinases that mediate the nuclear response of cells to a wide variety of extracellular stresses such as inflammatory cytokines, growth factors, ultraviolet light, and osmotic stress (10, 19, 20, 72). Although three distinct subfamilies have been described, extracellular signal-regulated kinase (ERK), c-Jun NH2-terminal kinase (JNK), and p38, there is significant cross talk between the pathways as well as common downstream targets (26, 76). The potential role for MAPKs in HO-1 signaling after oxidant stress such as I-R is supported by the following: 1) other oxidant stresses such as LPS and ultraviolet light activate MAPKs (34, 35, 72); 2) MAPKs regulate AP-1 and STAT (17, 30, 41, 44, 77), which have been shown to be important in HO-1 regulation (48); and 3) cadmium- and sodium arsenite-induced HO-1 expression and an end product of HO-1, CO, utilize the MAPK pathway (5, 11, 27, 57).
Given ample evidence for the importance role of HO-1 in defense against I-R-induced oxidant injury and the fact that very little information exists regarding the molecular regulation of HO-1 gene expression in response to I-R, our laboratory investigated the molecular regulation of HO-1 gene expression after I-R. In the current study, we confirm marked HO-1 mRNA and protein induction in mouse lungs and vascular cells after I-R or anoxia-reoxygenation (A-R), respectively. We focused our in vitro studies on pulmonary artery endothelial cells (PAEC) because they showed high expression of HO-1 mRNA after A-R, are an important target of A-R injury, and modulate vascular responses to injury. Using reporter gene analyses, we show that increased HO-1 gene expression after A-R in pulmonary endothelial cells is transcriptionally regulated and dependent upon the HO-1 promoter and a 5'-distal enhancer region, E1. Furthermore, the MAPK pathways appear to be important for HO-1 gene induction after A-R in pulmonary endothelial cells.
| |
METHODS |
|---|
|
|
|---|
Cell culture. Rat primary PAEC, rat primary pulmonary artery smooth muscle cells (PASMC), and rat primary aortic vascular smooth muscle cells (aVSM) were maintained in Dulbecco's modified Eagle's medium (Gibco-BRL, Rockville, MD) with 10% FBS (Hyclone, Logan, Utah) and 0.1% gentamicin (Gibco-BRL). Dr. Troy Stevens (University of Alabama) generously provided the PAEC. A. M. K. Choi provided the PASMC and aVSM. All data using primary cell cultures were collected before passage 20. Cells were exposed to anoxia (95% N2-5% CO2) in a sealed modular chamber (Billup-Rothberg, Del Mar, CA) with continuous monitoring and automated adjustments to maintain chamber O2 <0.5% during anoxia (Biospherix, Redfield, NY).
Animal exposures. The mouse lung I-R studies were a collaborative effort with E. L. Bedard, R. Potter, and R. Zhong. After anesthesia, mice were intubated via tracheostomy and ventilated with a Harvard ventilator (rate 75-100, peak inspiratory pressure 10-12 cmH2O, positive end-expiratory pressure 1.5 cmH2O). A hilar clamp was placed for 30 min of unilateral ischemia to the left lung, and then the clamp was released for 2-24 h of reperfusion before left lungs were extracted for total RNA. The Animal Care and Use Committee at the University of Western Ontario approved this protocol in accordance with the guidelines.
RT-PCR.
Total tissue RNA was extracted by using Trizol reagent (Gibco-BRL),
according to the manufacturer's instructions. Primers used for mouse
HO-1 were: sense, TCCAGACACCGCTCCTCCAG; antisense, GGATTTGGGGCTGCTGGTTTC; and for loading control mouse
-actin: sense,
GTGGGCCGCTCTAGGCACCAA; antisense, CTCTTTGATGTCACGCACGATTTC. The size of
the HO-1 product is 314 bp and 540 bp for
-actin. The DNA-free DNase
treatment and removal reagents (Ambion, Austin, Texas) were used to
remove contamination with DNA from total RNA samples. A reaction
mixture (50 µl) was made according to Access RT-PCR System and Access
RT-PCR Introductory Systems (Promega, Madison, WI), which consisted of
0.8 µg total RNA, 10 µl avian myeloblastosis virus (AMV)/Tfl 5×
reaction buffer, 1 µl 2-deoxynucleotide 5'-triphosphate (dNTP) mix
(10 mM each dNTP), 50 pmol antisense primer, 50 pmol sense primer, 2 µl 25 mM MgSO4, 1 µl AMV reverse transcriptase (5 U/µl), and 1 µl Tfl DNA polymerase (5 U/µl). Then 20 µl
of nuclease-free mineral oil were overlaid on the reaction mixture.
Conditions for RT-PCR were 1 cycle at 48°C for 45 min; 1 cycle at
95°C for 2 min; 30 cycles at 95°C for 30 s, 60°C for 1 min,
and 68°C for 1 min 30 s; and 1 cycle at 68°C for 5 min. Each
reaction product (10 µl) was then separated on a 1% agarose gel
containing 0.5 µg/ml of ethidium bromide. The density of the bands
was quantitated with Alpha imager 2000 (Alpha Innotech, San Leandro,
CA), and the ratio of HO-1 to the corresponding control
-actin band
was calculated for each sample.
Immunohistochemistry. The ImmunoCruz Staining System (Santa Cruz Biotechnology, Santa Cruz, CA) was used according to the manufacturer's instructions. Briefly, formalin-fixed, paraffin-embedded lung tissue sections were deparaffinized with xylene, rehydrated gradually with graded alcohols, washed in deionized water for 1 min, and then blocked with 10% nonimmune goat serum for 30 min before incubation with a 1:1,000 dilution of the primary antibody anti-rat HO-1 (StressGen, Victoria, Canada) overnight at 4°C. Sections were washed three times with PBS (5 min each). The secondary antibody, a biotinylated goat anti-rabbit IgG, was incubated at 37°C for 30 min, and peroxidase-conjugated streptavidin-biotin complex was incubated at 37°C for 30 min. After further washing the sections with PBS, we applied diaminobenzidine substrate as the chromogen, giving a brown reaction product, and counterstained the sections with Mayer's hematoxylin (Zymed, South San Francisco, CA). Negative controls for the nonspecific binding included PBS and normal rat IgG instead of the primary antibody.
RNA extraction and Northern blot analysis for HO-1. Plated cells were homogenized and scraped in Trizol reagent (Gibco-BRL) followed by chloroform extraction per Gibco-BRL Trizol protocol. After spectrophotometric RNA quantitation, 10 µg of total RNA were loaded into a 1% agarose-formaldehyde gel and then transferred to a Hybond-N Plus nylon membrane (Amersham, Piscataway, NJ) by capillary action. The nylon membrane was then prehybridized in a buffer containing 1% BSA, 7% SDS, 0.5 M phosphate buffer, pH 7.0, and 1 mM EDTA at 65°C for 2 h followed by hybridization in the same buffer containing 32P-labeled rat HO-1 cDNA for 16 h. Membranes were then washed twice in 0.5% BSA; 5% SDS; 40 mM phosphate buffer, pH 7.0; and 1 mM EDTA) for 15 min followed by three washes in 1% SDS; 40 mM phosphate buffer, pH 7.0; and 1 mM EDTA. To control for variations in RNA amount or loading, we stripped the same blots in 0.1% SDS and hybridized with a housekeeping cDNA, aldolase (obtained from Dr. Paul Noble, Yale University). The density of the bands was quantitated using Alpha imager 2000 (Alpha Innotech), and the ratio of HO-1 to the corresponding aldolase band was calculated for each sample.
Protein extraction and Western blot analysis for HO-1.
Frozen lung tissues were homogenized in Tris-containing buffer, and
plated cells were scraped in cold PBS. Samples were all lysed in
Nonidet P-40 (10%) containing lysis buffer. Protein concentrations of
the lysates were determined by Coomassie blue dye-binding assay (Bio-Rad, Hercules, CA). Equal volumes of 2× SDS sample buffer (125 mM
Tris · HCl, pH 6.8; 4% SDS; 20% glycerol; 100 mM DTT, and
0.2% bromphenol blue) were added, and the samples were boiled for 5 min. Samples were electrophoresed in a 12% ready-made
Tris · HCl gel (Bio-Rad). The gel was electrophoretically
transferred onto a nitrocellulose membrane (Bio-Rad) and incubated for
1 h in 5% nonfat powdered milk containing 1× Tris-buffered
saline and 0.1% Tween 20 (TTBS). The membranes were then incubated for 2 h with mouse anti-HO-1 monoclonal antibody (1:1,000 dilution; Stressgen). After three washes in TTBS, the membranes were incubated with horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG antibody (Cell Signaling Technology, Beverly, MA) for 2 h. The membranes were then washed three times in TTBS followed by detection of
signal with a chemiluminescence LumiGLO detection kit (New England
Biolabs, Beverly, MA). To control for protein loading, we stripped the
membranes at 60°C in stripping solution (10 mM
-mercaptoethanol,
2% SDS, and 62.5 mM Tris · HCl, pH 6.8) before reprobing with
antibody to
-tubulin (Santa Cruz Biotechnology).
Plasmid constructs.
Plasmid (p) RL-CMV was obtained from Promega. Roger Davis (University
of Massachusetts, Worchester, MA) generously provided the
dominant-negative mutants (DNM) of JNK1, JNK2, and p38
. Melanie Cobb
at University of Texas, Southwestern, generously provided the DNM of
ERK1 and ERK2. A dose response of 0.25 µg to 2 µg of MAPK DNMs was
used. pHO15luc and its deletions were constructed by cloning a 15-kb
pair promoter fragment from the mouse HO-1 gene into the luciferase
reporter gene vector pSKluc as previously described (5).
The dose used for all HO-1 plasmid transfections was 0.5 µg. Plasmid
enhanced green fluorescent protein (pEGFP) was purchased from Clontech
Laboratories (Palo Alto, CA).
MAPK immunoblotting.
MAP or ERK kinase (MEK), ERK1/2, p38, and JNK1/2 kits were
purchased from Cell Signaling Technology and conducted per
manufacturer's protocol. Briefly, after A-R, cells were lysed directly
in 1× SDS sample buffer containing 62.5 mM Tris · HCl (pH
6.8), 2% SDS, 10% glycerol, 50 mM DTT, 0.1% bromphenol blue. Cell
lysates were sonicated for 5 s to shear DNA and reduce sample
viscosity. After boiling the cell lysates for 5 min, we loaded equal
amounts of cell lysates (~100 µg of protein) onto 12% ready-made
Tris · HCl gels (Bio-Rad) and transferred them to a
nitrocellulose membrane. Blots were stained with Ponceau S (Sigma, St.
Louis, MO) to monitor the transfer of proteins. Membranes were blocked
for 1 h at room temperature in blocking buffer (20 mM Tris, 500 mM
NaCl, 0.1% Tween 20, and 5% nonfat milk) and incubated with specific
polyclonal antibodies for anti-phospho-MEK, ERK1/2, p38, and JNK1/2
(Cell Signaling Technology) at 1:1,000 dilution in primary antibody dilution buffer (20 mM Tris, 500 mM NaCl, 0.1% Tween 20, and 5% BSA)
with gentle agitation overnight at 4°C. After being washed, the blots
were incubated for 1 h with a 1:2,000 dilution of HRP-conjugated anti-rabbit secondary antibody (Cell Signaling Technology) and visualized with a chemiluminescence LumiGLO detection kit (New England
Biolabs). To verify equivalent sample loading, we stripped blots in
stripping solution (10 mM
-mercaptoethanol, 2% SDS, 62.5 mM
Tris · HCl, pH 6.8) at 60°C for 40-60 min and reprobed with anti-MEK, ERK1/2, JNK1/2, and p38 (Cell Signaling Technology) antibodies, respectively.
MAPK activity.
MAPK activities were measured in immune complex protein kinase assays
according to manufacturer's kit protocol (Cell Signaling). Briefly,
after A-R, cells were lysed in ice-cold cell lysis buffer (20 mM Tris,
pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 2.5 mM
sodium pyrophosphate, 1 mM
-glycerol phosphate, 1 mM
Na3VO4, 1 µg/ml leupeptin, and 1 mM PMSF).
Equal volumes of cell lysates were incubated with immobilized
phospho-ERK kinase monoclonal antibody, c-Jun fusion protein beads, and
immobilized phospho-p38 monoclonal antibody for ERK, JNK, and p38,
respectively, at 4°C for overnight. After centrifugation, pellets
were suspended by kinase buffer (25 mM Tris, pH 7.5, 5 mM
-glycerol
phosphate, 2 mM DTT, 0.1 mM Na3VO4, 10 mM
MgCl2, and 200 µM ATP) and then immunoprecipitated with
specific fusion proteins Elk-1, c-Jun, and activating transcription
factor (ATF)-2 for ERK, JNK, and p38, respectively, at 30°C for 30 min. The activities of ERK, p38, and JNK were then measured by Western
blot. Primary antibodies (rabbit polyclonal phospho-Elk-1,
phospho-c-Jun, and phospho-ATF-2 antibodies) were used at 1:1,000
dilution followed by HRP-conjugated anti-rabbit secondary antibody
(1:2,000). LumiGLO (New England Biolabs) reagent was used to detect
protein signals. The density of the bands was quantitated with Alpha
imager 2000 (Alpha Innotech).
Transfections and luciferase assays. Cells were seeded (7 × 104 per well of a six-well plate) 16 h before transient transfection. Cells were incubated for 6 h with DNA mixtures containing serum-free media, FuGENE 6 transfection reagent (Roche, Indianapolis, IN), 2 µg empty vehicle plasmid or the plasmid of interest (see Plasmid constructs) and 0.025 µg internal control plasmid, Renilla, pRL-CMV [obtained from the dual luciferase reporter assay kit (Promega)]. After incubation, cells were washed with serum-free medium and cultured for an additional 16 h in complete medium. Cells were exposed to 24 h of anoxia alone or 24 h of anoxia followed by 8 h of reoxygenation at 37°C. Cells were lysed and substrate added according to manufacturer's protocol (Promega). Luciferase activity was normalized to Renilla activity. All conditions were done in triplicate wells, and a mean of 3-5 independent experiments was represented.
Chemicals. MAPK inhibitors, PD-98059, and SB-203580, were purchased from Calbiochem (San Diego, CA).
Statistical analysis. Data are expressed as means ± SE and were analyzed with one-way ANOVA. Statistical calculations were performed on an IBM personal computer using SPSS 8.0 for Windows software. Statistically significant difference was accepted at P < 0.05.
| |
RESULTS |
|---|
|
|
|---|
Induction of HO-1 expression in mouse lungs after I-R.
RT-PCR and Western blot analysis were used to examine steady-state
levels of HO-1 mRNA and protein, respectively, in mouse lungs after
I-R. Lungs were removed from mice after 0 (naïve and
ventilated-only mice) or 30 min of ischemia (left hilar
clamping) alone or 30 min of ischemia followed by 2-24 h
of reperfusion in normoxia. As shown in Fig.
1A, an increase of mRNA was
observed after 30 min of left lung ischemia (threefold,
P < 0.05), which increased to sixfold
(P < 0.01) after 2-6 h of reperfusion in the left
lung of all three animals compared with naïve and ventilated mice. There appears to be a decrease in HO-1 mRNA by 24 h of
reperfusion, although this was performed on only one animal. The
intensity of HO-1 signals was normalized to the corresponding control
gene
-actin after densitometric quantitation, and the mean induction graphically represented as percent induction with SE bars. The increase
of HO-1 mRNA after 30 min of left lung ischemia alone is
consistent with the 3.4-fold increase in HO-1 protein after 30 min of
ischemia (Fig. 1B). However, after 6 h of
reperfusion, the increase in HO-1 protein was significantly higher
(30-fold). Figure 1B is a representative Western blot of
mouse lung subjected to ventilation only, 30 min of ischemia
alone, or 30 min of ischemia followed by 6 h of
reperfusion. Similar results were obtained from three mice.
|
Immunohistochemical analysis of HO-1 expression in mouse lungs
after I-R.
Tissue mRNA and protein analyses by RT-PCR and Western blots,
respectively, gave us information only from homogenized lung samples.
Therefore, we sought to localize the lung cell type(s)/structure(s) that may be responsible for the I-R induced HO-1 expression we observed
in Fig. 1 before selecting a particular cell type to focus subsequent
in vitro studies. We used a polyclonal HO-1 antibody to detect HO-1
protein in mouse lung sections. Figure
2A shows naïve mouse
lung with anti-rat HO-1 antibody illustrating scant, brown, basal
levels of HO-1 expression. Figure 2B is after 30 min of lung
ischemia, showing a minimal increase in HO-1 protein staining,
and Fig. 2C is after 30 min of ischemia followed by 6 h of reperfusion, showing intense brown HO-1 protein staining throughout all lung structures. The three lower panels (Fig. 2, D-F) represent the corresponding section at higher
magnification (×40). Figure 2D is naïve mouse lung
at ×40 original magnification, Fig. 2E is the left lung
after 30 min of ischemia at ×40 original magnification, and
Fig. 2F is the left lung after 30 min of ischemia followed by 6 h of reperfusion at ×40 original magnification. Figure 2F (30 min of ischemia, 6 h of
reperfusion) shows that vasculature (arrow 1), alveoli
(arrow 2), and lower airways (arrow 3) all have
increased HO-1 protein staining compared with naïve lungs.
|
HO-1 mRNA induction in vascular cells after A-R.
Although there was parenchymal and vascular staining for HO-1 protein
in mouse lung after I-R injury, the fact that I-R is a prominent
vascular injury model led us to select vascular cell types as the focus
of our subsequent in vitro studies. Figure 3A shows the time course of
HO-1 steady-state mRNA expression in rat primary PAEC, rat aVSM, and
rat PASMC. The same blots were stripped and probed with the control
housekeeping gene aldolase, and the normalized values were expressed as
percent induction compared with room air. PAEC showed a 6.6-fold HO-1
mRNA induction by 1 h of reoxygenation (bar 4), which
decreases to approximately fivefold by 4 h of reoxygenation
(bar 6) compared with room air control; aVSM show a 3.5-fold
HO-1 mRNA induction by 30 min of reoxygenation (bar 3),
which persists for at least 8 h of reoxygenation; PASMC show a
2.2-fold induction of HO-1 mRNA by 30 min of reoxygenation (bar
3), which also persists for at least 8 h of reoxygenation.
|
HO-1 mRNA induction correlates with increased HO-1 protein in PAEC
after A-R.
Given the high level of HO-1 mRNA induction in PAEC and the
well-recognized role of endothelial cells in vascular responses to
injury, we used PAEC for subsequent in vitro studies. Western blot
analysis of cellular extracts from PAEC exposed to anoxia or A-R shows
peak HO-1 protein (sevenfold) by 8 h of reoxygenation with
detectable HO-1 protein even at 24 h (Fig. 3B). The
same blot was stripped and probed with the loading control
-tubulin.
Full HO-1 gene transcription requires both the promoter and the 5'
distal enhancer element E1 in PAEC after A-R.
In previous studies, we determined HO-1 to be transcriptionally
regulated and dependent upon cooperation between the 5' distal enhancer
E1 and the proximal promoter pMHO1 in hyperoxia, another model of
oxidant injury (48). Given our previous data, we examined the transcriptional regulation of HO-1 in A-R using luciferase reporter
analysis with plasmid constructs encompassing different 5' regulatory
regions of the HO-1 promoter (Fig.
4A). Figure 4B shows an 8.6 ± 0.7-fold induction of luciferase activity in
transiently transfected PAEC with the full 5' regulatory region
(construct 1) after A-R (24 h of anoxia, 8 h of
reoxygenation) compared with room air. Deletion of the E1 distal
enhancer (construct 2) significantly decreases HO-1 gene
transcription after A-R (to 3.2 ± 0.9-fold over room air),
indicating that at least some of the A-R responsive element(s)
reside(s) within the E1 distal enhancer. The deletion of the E2 distal
enhancer (construct 3) diminishes the level of induction to
5.2 ± 1-fold over room air, but this is not statistically significant from construct 1. Simultaneous deletion of both
distal enhancers (construct 4) completely abolishes HO-1
gene transcription after A-R. Together, these results indicate that
optimal activation of the HO-1 gene by A-R requires both enhancers and
that E1 can more efficiently compensate for the loss of E2 than the
reverse situation. In isolation (i.e., in the context of a minimal HO-1 promoter), either E1 (construct 6) or E2 (construct
7) mediates a fourfold induction in HO-1 gene transcription,
providing support for the role of both regulatory regions in
A-R-dependent HO-1 gene regulation. Similar to hyperoxia-induced HO-1
gene transcription, full transcription activity can be reconstituted
with a construct containing the full proximal promoter (1,287 bp)
(construct 1) and the E1 distal enhancer (construct
5). The difference in fold induction of construct 1 (8.6 ± 0.7) and construct 5 (11.5 ± 0.5) is not
statistically significant.
|
Activation of MAPKs in PAEC after A-R.
The MAPK pathways are important candidates for signal transduction in
A-R for the following reasons: 1) ROS, which are generated during the reoxygenation phase of A-R injury, activate the MAPK pathway
(55); 2) oxidant stressors such as ultraviolet
irradiation and hyperoxia have been shown to activate the MAPK
(61, 72); 3) oxidant stressors activate the
transcription factors STAT and AP-1 (68), which have been
shown to have important roles in HO-1 regulation (48); and
4) the MAPK pathway regulates other oxidant-induced HO-1
gene expression (5, 27). MAPKs are activated by dual
phosphorylation of threonine and tyrosine residues located in the
conserved core kinase sequence (10, 19). Activated kinases
can be detected by using antibodies directed against the phosphorylated
peptides encompassing these residues. To determine the role, if any, of
MAPK in PAEC after A-R, we performed immunoblotting studies with
specific phospho-antibodies for MEK, ERK1/2, JNK1/2, and p38 MAPKs
(Fig. 5). Cells were exposed to room air,
anoxia alone, or A-R; proteins were extracted; and immunoblots were
performed using anti-phospho MEK, ERK1/2, JNK1/2, and p38. As seen in
Fig. 5, phosphorylated MEK, ERK1/2, JNK1/2, and p38, indicating
activation, were all increased by 15 min of reoxygenation after 24 h of anoxia compared with room air and anoxia controls. The same blots
were probed with antibody to total MEK, ERK1/2, JNK1/2, or p38 as
protein loading controls.
|
MEK/ERK inhibitor PD-98059 and p38 inhibitor SB-203580 attenuate
HO-1 mRNA levels in PAEC after A-R.
After having determined by MAPK immunoblotting that all three MAPK were
activated during reoxygenation, we were interested in determining the
role of individual MAPK pathways in HO-1 gene regulation in response to
A-R. PD-98059, a selective cell-permeable inhibitor of MEK, and
SB-203580, a highly specific cell-permeable inhibitor of p38 activity,
are the best-characterized and most widely used MAPK inhibitors
(18). PD-98059's selective inhibition of MEK activation
and subsequent ERK1/2 phosphorylation in doses of 2-10 µM have
been previously published (25, 46). SB-203580 is a
pyridinyl imidazole that inhibits p38 kinase activity, without effects
on other kinases, at usual doses of 50 nM (even up to 100 µM)
(8, 18, 32). We pretreated PAEC for 1 h with PD-98059 (2 or 10 µM) or SB-203580 (50 or 100 nM) before A-R exposure (Fig. 6A). Total cell RNA was
extracted, and HO-1 mRNA was detected by Northern blot analysis as
described in METHODS. The same blot was stripped and probed
with the control gene aldolase, and the HO-1 mRNA band intensity was
normalized to that of aldolase. The graph in Fig. 6A shows
that the ninefold increase in HO-1 mRNA after 1 h of reoxygenation
is attenuated to levels comparable with room air or anoxia alone, even
at low doses of PD-98059 or SB-203580 pretreatment. To confirm the
specificity of PD-98059 and SB-203580, we show that even at the higher
doses of PD-98059 (10 µM) or SB-203580 (100 nM), PD-98059 has no
effect on JNK1/2 or p38 phosphorylation or activity, whereas SB-203580
has no effect on ERK1/2 or JNK1/2 phosphorylation or activity
(Fig. 6B).
|
Dominant-negative MAPK mutants inhibit HO-1 gene transcription in
PAEC after A-R.
To confirm our findings that MAPK inhibition attenuates HO-1 mRNA
expression and the fact that a selective, well-validated pharmacological JNK inhibitor is not available, we further examined the
role of specific MAPKs in HO-1 gene regulation after A-R using kinase-deficient DNM. PAEC were transiently transfected, according to
METHODS, with the internal control gene pRL-CMV, pHO1+E1,
which was shown to be sufficient for full HO-1 gene transcription after A-R in Fig. 4B, and either a DNM or empty vehicle. We
performed a dose response (0.25-2 µg), which is in the range of
commonly published doses, for each MAPK DNM, while keeping the doses of the control gene pRL-CMV and pHO1+E1 constant (0.025 and 0.5 µg, respectively). The cells were then exposed to room air, anoxia, or
anoxia followed by reoxygenation, and luciferase activity was expressed
as fold induction after we normalizd values to the internal control,
Renilla activity. Figure
7A shows an 11.5 ± 0.5 mean fold increase in HO-1 luciferase activity with pHO1+E1. The
fact that pRL-CMV plus pHO1+E1 plus empty vehicle (at varying doses) does not suppress HO-1 luciferase activity makes it unlikely that merely the presence of multiple DNA constructs suppresses gene transcription. ERK1, ERK2, and p38 DNMs at low doses (0.25 µg) do not
significantly decrease HO-1 luciferase activity. JNK1 and JNK2 DNMs at
0.25 µg, however, lead to 8 ± 0.8 and 7.8 ± 0.7 mean fold
increase, respectively, in HO-1 luciferase activity, which is a
statistically significant decrease compared with the 11.5 ± 0.5 mean fold induction observed with pHO1+E1 (P < 0.05).
The fact that JNK DNMs begins to suppress HO-1 luciferase activity at
low doses may reflect the relative importance of the JNK pathway (compared with ERK and p38) to HO-1 gene transcription, the presence of
other, non-MAPK signaling pathways that converge with the JNK pathway or simply more efficient translation and accumulation of the
JNK DNM proteins after transfection.
|
| |
DISCUSSION |
|---|
|
|
|---|
I-R is a well-established model of oxidant-mediated injury that is
particularly pertinent to the highly vascular lungs. The lungs harbor
multiple calibers of vessels from the large pulmonary arteries, which
are clamped and released during surgical procedures, to the lace-like
alveolar capillaries that are constantly subjected to oxygen radicals
via the inspired air in the alveoli. During stress states, such as
inflammation, therapeutic doses of inhaled oxygen, or surgically
imposed I-R, the lung vasculature and parenchyma are barraged with an
excess of reactive oxidants that overwhelm the fine balance between
oxidants and antioxidants. Therefore, it is not surprising that the
lungs have evolved a complex, sophisticated, and redundant network of
antioxidant defenses. An important arm of the antioxidant response
consists of antioxidant enzymes and stress-response proteins (15,
16). One such stress-response protein is HO-1, the rate-limiting
enzyme in heme catabolism that oxidatively cleaves the
-meso carbon
bridge of b-type heme molecules (70). During HO-1
activity, equimolar quantities of biliverdin IX
, CO, and iron are
released, potentially contributing to HO-1's cytoprotective effects.
For instance, in mammals, biliverdin is subsequently converted to
bilirubin, which is a potent scavenger of lipid peroxidation products
(69) and offers protection in a rat liver I-R model
(80). In addition, the by-product CO is multifaceted and
can substitute for many of the protective effects of HO-1 expression
(11, 29, 45, 59). Finally, iron, which is released during
HO-1 catalysis, is sequestered into ferritin, which has been shown to
possess protective properties (9, 63, 74).
Various investigators have demonstrated the importance of HO-1 in vessels and endothelial cells. Gene transfer of HO-1 into pig arteries protects against vascular constriction and proliferation in angioplasty-induced injury (24). During I-R injury of the heart, brain, kidney, liver, and most recently, lung, HO-1 expression is necessary for preserved organ function and animal survival (7, 29, 36, 60, 66). Despite the preponderance of evidence of HO-1's protective effects in vascular injury models, further details are required as to the precise actions of HO-1 in the vasculature. Morita et al. (54) have shown in a coculture system that vascular smooth muscle (VSM)-derived CO via HO-1 exerts a paracrine effect on endothelial cells, which presumably should decrease vascular tone due to CO's vasodilatory effects, yet VSM HO-1 transgenic mice exhibit systemic hypertension (40). More recent evidence points to an antiproliferative role of HO-1 in HO-1 transgenic mice (lung specific) that were protected from hypoxia-induced hypertension and vessel hypertrophy (53). Given the overall consistency of data that show HO-1 expression is generally a protective response, it is unlikely that the various data are contradictory. However, the range of HO-1 effects alerts us to the importance of cell specificity and the need to further define the underlying mechanisms of HO-1 induction.
Despite the accumulating evidence for the physiological importance of HO-1 and its by-products in vascular injury, little is known regarding the precise molecular mechanisms regulating HO-1 gene expression after lung I-R and the signaling mechanisms utilized by endothelial cells to induce HO-1. Therefore, in this current study, we focus upon PAEC expression and regulation studies. Mouse lungs as well as various vascular cell types markedly express HO-1 mRNA and protein after I-R (or the in vitro counterpart, A-R) injury. In addition, the full proximal promoter pHO1 and distal enhancer E1 are sufficient for full HO-1 gene activation after A-R. This cooperative effect between the HO-1 promoter and distal enhancer element is not surprising, given our previous finding that another oxidant stress, hyperoxia, requires both sites with specific involvement of AP-1 and STAT transactivators (48). This is in contrast to HO-1 induction by heme, heavy metals, and LPS, which require the E1 enhancer alone (2, 6, 12).
To extend our HO-1 transcriptional studies to upstream signaling events, we used the knowledge that HO-1 induction after oxidants, such as hyperoxia, involves transcription factors such as AP-1 and STAT members (48). Both STATs and AP-1, a heterodimer of c-Fos and c-Jun, are phosphorylated and thus activated by MAPKs (41, 43). In addition, I-R injury has been shown to activate Rac, a small G protein upstream of JNK and p38 MAPKs (42). Further links between HO-1 and MAPK have been established in studies that show p38 MAPK activation is necessary for cadmium-induced HO-1 gene expression and the antiapoptotic and anti-inflammatory effects of CO, a HO-1 by-product (5, 11, 57). A variety of cellular stresses activate the MAPKs that then exert transcriptional changes within cells. The cascade of biological effects initiated by MAPK signaling subsequently allows cells to respond and eventually adapt to noxious stimuli. The ERK pathway prototypically transduces critical mitogenic signals from growth factors to the nucleus (19, 51). Both JNK and p38 MAPK respond to stresses, such as inflammatory cytokines and genotoxic stress, and play pivotal roles in differentiation, survival, and apoptosis (20, 22, 64). The role of MAPK in pulmonary endothelial cells after A-R has not been previously described. We show that all three subfamilies of MAPK, ERK, JNK, and p38, are activated during the reperfusion phase of A-R in PAEC. A previous study of myocardial ischemia shows in vivo activation of ERK, JNK, and p38, but this likely represents MAPK activation in multiple cell types (67). Another paper documents ERK and JNK activation during the reperfusion phase of myocardial ischemia in vivo, but again, the responsible cell type(s) is not delineated (55). Cadmium, a potent inducer of HO-1, activates all three MAPK pathways, but only p38 is involved in HO-1 gene transcription (5).
Our current data show that not only are all three MAPK pathways activated during the reoxygenation phase of A-R but that all are also involved in HO-1 gene transcription. DNMs of ERK1, JNK, and p38 significantly inhibited HO-1 gene activation after A-R at doses >0.25 µg, with ERK2 DNM showing less, though still significant, suppression of HO-1 gene activation (Fig. 7A). Interestingly, JNK1 and JNK2 DNMs inhibit HO-1 gene activation even at low doses (0.25 µg). This may be due to the critical role the JNK pathway has in HO-1 signal transduction after A-R, or the more efficient translation and accumulation of JNK DNM proteins after transfection, or JNK DNM's inhibition of other signaling pathways. Our data in Fig. 7B show that JNK DNM does not affect ERK or p38 activation. The convergence of JNK with non-MAPK signaling pathways has not been described and, although an interesting possibility, is beyond the scope of our current studies.
The importance of all three subfamilies of MAPKs in HO-1 transcription has been noted in mouse hepatoma cells by sodium arsenite (J. Alam, personal communication) and likely reflects the complexity of HO-1 regulation. Elbirt et al. (27) implicate both ERK and p38 MAPK pathways in chicken HO-1 induction by sodium arsenite. The presence of multiple signaling pathways in HO-1 regulation likely reflects the fact that there are a variety of HO-1 inducers and multiple transcription factors that, in cooperation, can activate the mouse HO-1 gene. For instance, AP-1, Maf, cAMP response element binding protein/ATF, and cap "N" collar basic region/leucine zipper (CNC-bZIP) families of transcription factors can all recognize a 10-bp sequence in the HO-1 gene called the stress response element (StRE) (14). Despite the multiple inducers and transactivators involved in HO-1 expression, there is likely convergence onto this StRE, which is present in multiple copies throughout the 5' regulatory region and is essential for inducer-dependent gene activation (5). Gong et al. (31) recently published a study showing that cobalt induces HO-1 expression via Nrf2, a member of the CNC-bZIP family, and MafG. He et al. (37) also identified binding interaction between Nrf2 and ATF-4. In addition, despite the delineation of three MAPK subfamilies, it is well established that there is significant cross talk among the pathways, because they respond to common upstream activators and phosphorylate common downstream targets (26, 76). A possible scenario is that, depending on the extracellular stress or signal, specific sets of signaling pathways (in the case of A-R, the MAPK superfamily) are activated, which in turn activate specific homo- and heterodimers of transcription factors, which converge upon critical HO-1 consensus sequences that potentiate HO-1 gene upregulation and thereby confer protection. The induction of HO-1 in response to A-R may require absolute cooperation among several transcription factors bound at different sites (for instance within E1). Diverse signaling pathways may activate the different transcription factors, and thus if one transcription factor is inhibited, the entire HO-1 response may be ablated.
It is beyond the scope of this current study to delineate the precise transcription factors involved in I-R, but given the importance of the HO-1 promoter and distal enhancer E1 that contains the multirepeat StRE, potential candidate transcription factors include STAT, AP-1, ATF, and CNC-bZIP proteins. In addition, future studies will attempt to delineate the relative contribution of each MAPK subfamily to HO-1 gene activation by examining signaling proteins further upstream of the MEK, ERK, JNK, and p38 MAPKs. Determining how the MAPK kinases, c-Raf, Ras, Rac, Rho, and Cdc proteins contribute to HO-1 transcription after A-R may indicate points of convergence or further specificity. Our data thus far delineate the marked upregulation in lungs and vascular cells after I-R or A-R, respectively, and this induction is under transcriptional control. The critical cis-acting elements include both the proximal promoter in conjunction with the E1 distal enhancer site, and upstream signaling involves all three MAPK subfamilies.
| |
ACKNOWLEDGEMENTS |
|---|
P. J. Lee was supported by the National Institutes of Health (NIH) K08 Award and the American Lung Association of Connecticut. A. M. K. Choi was supported by NIH Grants HL-55330, AI-42365, and HL-60234 and an American Heart Association Established Investigator Award. J. Alam was supported by NIH Grant DK-43135.
| |
FOOTNOTES |
|---|
Address for reprint requests and other correspondence: P. J. Lee, Section of Pulmonary and Critical Care Medicine, Yale Univ. School of Medicine, 333 Cedar St., LCI 105, New Haven, CT 06520 (E-mail: patty.lee{at}yale.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
May 24, 2002;10.1152/ajplung.00485.2001
Received 17 December 2001; accepted in final form 17 May 2002.
| |
REFERENCES |
|---|
|
|
|---|
1.
Abraham, NG,
Lavrovsky Y,
Schwartzman ML,
Stoltz RA,
Levere RD,
Gerritsen ME,
Shibahara S,
and
Kappas A.
Transfection of the human heme oxygenase gene into rabbit coronary microvessel endothelial cells: protective effect against heme and hemoglobin toxicity.
Proc Natl Acad Sci USA
92:
6798-6802,
1995
2.
Alam, J.
Multiple elements within the 5' distal enhancer of the mouse heme oxygenase-1 gene mediate induction by heavy metals.
J Biol Chem
269:
25049-25056,
1994
3.
Alam, J,
Cai J,
and
Smith A.
Isolation and characterization of the mouse heme oxygenase-1 gene.
J Biol Chem
269:
1001-1009,
1994
4.
Alam, J,
Camhi S,
and
Choi AMK
Identification of a second region upstream of the mouse heme oxygenase-1 gene that functions as a basal level and inducer-dependent transcription enhancer.
J Biol Chem
270:
11977-11984,
1995
5.
Alam, J,
Wicks C,
Stewart D,
Gong P,
Touchard C,
Otterbein S,
Choi AMK,
Burow ME,
and
Tou J.
Mechanism of heme oxygenase-1 gene activation by cadmium in MCF-7 mammary epithelial cells.
J Biol Chem
275:
27694-27702,
2000
6.
Alam, J,
and
Zhining D.
Distal AP-1 binding sites mediate basal level enhancement and TPA induction of the mouse heme oxygenase-1 gene.
J Biol Chem
267:
21894-21900,
1992
7.
Amersi, F,
Buelow R,
Kato H,
Ke B,
Coito AJ,
Shen XD,
Zhao D,
Zakyk J,
Melinek J,
Lassman CR,
Kolls JK,
Alam J,
Ritter T,
Volk HD,
Farmer DG,
Ghobrial RM,
Busuttil RW,
and
Kupiec-Weglinski JW.
Upregulation of heme oxygenase-1 protects genetically fat Zucker rat livers from ischemia/reperfusion injury.
J Clin Invest
104:
1631-1639,
1999[Web of Science][Medline].
8.
Badger, AM,
Bradbeer JN,
Votta B,
Lee JC,
Adams JL,
and
Griswold DE.
Pharmacological profile of SB 203580, a selective inhibitor of cytokine suppressive binding protein/p38 kinase, in animal models of arthritis, bone resorption, endotoxin shock, and immune function.
J Pharmacol Exp Ther
279:
1453-1461,
1996
9.
Balla, G,
Jacob HS,
Balla J,
Rosenberg M,
Nath K,
Apple F,
Eaton JW,
and
Vercellotti GM.
Ferritin: a cytoprotective antioxidant strategem of endothelium.
J Biol Chem
267:
18148-18153,
1992
10.
Blenis, J.
Signal transduction via the MAP kinases: proceed at your own RSK.
Proc Natl Acad Sci USA
90:
5889-25892,
1993
11.
Brouard, S,
Otterbein LE,
Anrather J,
Tobiasch E,
Bach FH,
Choi AMK,
and
Soares MP.
Carbon monoxide generated by heme oxygenase 1 suppresses endothelial cell apoptosis.
J Exp Med
192:
1015-1025,
2000
12.
Camhi, S,
Alam J,
Otterbein L,
Sylvester SL,
and
Choi AMK
Induction of heme oxygenase-1 gene expression by lipopolysaccharide is mediated by AP-1 activation.
Am J Respir Cell Mol Biol
13:
387-398,
1995[Abstract].
13.
Camhi, SL,
Alam J,
Wiegand GW,
Chin BY,
and
Choi AMK
Transcriptional activation of the HO-1 gene by lipopolysaccharide is mediated by 5' distal enhancers: role of reactive oxygen intermediates and AP-1.
Am J Respir Cell Mol Biol
18:
226-234,
1998
14.
Choi, AMK,
and
Alam J.
Heme oxygenase-1: function, regulation, and implication of a novel stress-inducible protein in oxidant-induced lung injury.
Am J Respir Cell Mol Biol
15:
9-19,
1996[Abstract].
15.
Choi, AMK,
Sylvester SL,
Otterbein L,
and
Holbrook NJ.
Molecular responses to hyperoxia in vivo: relationship to increased tolerance in aged rats.
Am J Respir Cell Mol Biol
13:
74-82,
1995[Abstract].
16.
Clerch, LB,
and
Massaro DJ.
Tolerance of rats to hyperoxia.
J Clin Invest
91:
499-508,
1993[Web of Science][Medline].
17.
David, M,
Petricoin E, III,
Benjamin C,
Pine R,
Weber MJ,
and
Larner AC.
Requirement for MAP Kinase (ERK2) activity in interferon
- and interferon
-stimulated gene expression through STAT proteins.
Science
269:
1721-1723,
1995
18.
Davies, SP,
Reddy H,
Caivano M,
and
Cohen P.
Specificity and mechanism of action of some commonly used protein kinase inhibitors.
Biochem J
351:
95-105,
2000[Web of Science][Medline].
19.
Davis, RJ.
The mitogen-activated protein kinase signal transduction pathway.
J Biol Chem
268:
14553-14556,
1993
20.
Davis, RJ.
MAPKs: new JNK expands the group.
Trends Biochem Sci
19:
470-473,
1994[Web of Science][Medline].
21.
Dennery, PA,
Wong HE,
Sridhar KJ,
Rodgers PA,
Sim JE,
and
Spitz DR.
Differences in basal and hyperoxia-associated HO expression in oxidant-resistant hamster fibroblasts.
Am J Physiol Lung Cell Mol Physiol
271:
L672-L679,
1996
22.
Derijard, B,
Hibi M,
Wu IH,
Barrett T,
Su B,
Deng T,
Karin M,
and
Davis RJ.
JNK1: a protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun activation domain.
Cell
76:
1025-1037,
1994[Web of Science][Medline].
23.
Dougherty, CJ,
Kubasiak LA,
Prentice H,
Andreka P,
Bishopric NA,
and
Webster KA.
Activation of c-Jun N-terminal kinase promotes survival of cardiac myocytes after oxidative stress.
Biochem J
362:
561-571,
2002[Web of Science][Medline].
24.
Duckers, HJ,
Boehm M,
True AL,
Yet S-F,
San H,
Park JL,
Webb RC,
Lee M-E,
Nabel GJ,
and
Nabel EG.
Heme oxygenase-1 protects against vascular constriction and proliferation.
Nat Med
7:
693-698,
2001[Web of Science][Medline].
25.
Dudley, DT,
Pang L,
Decker SJ,
Bridges AJ,
and
Saltiel AR.
A synthetic inhibitor of the mitogen-activated protein kinase cascade.
Proc Natl Acad Sci USA
92:
7686-7689,
1995
26.
Egan, SE,
and
Weinberg RA.
The pathway to signal achievement.
Nature
365:
781-783,
1993[Medline].
27.
Elbirt, KK,
Whitmarsh AJ,
Davis RJ,
and
Bonkovsky A.
Mechanism of sodium arsenite-mediated induction of heme oxygenase-1 in hepatoma cells: involvement of MAP kinases.
J Biol Chem
273:
8922-8931,
1999.
28.
Frost, J,
Geppert T,
Cobb M,
and
Feramisco J.
A requirement for extracellular signal-regulated kinase (ERK) function in the activation of AP-1 by Ha-Ras, phorbol 12-myristate 13-acetate, and serum.
Proc Natl Acad Sci USA
91:
3844-3848,
1994
29.
Fugita, T,
Toda K,
Karimova A,
Yan S-F,
Naka Y,
Yet S-F,
and
Pinsky DJ.
Paradoxical rescue from ischemic lung injury by inhaled carbon monoxide by derepression of fibrinolysis.
Nat Med
7:
598-604,
2001[Web of Science][Medline].
30.
Goh, KC,
Haque SJ,
and
Williams BRG
p38 MAP kinase is required for STAT1 serine phosphorylation and transcriptional activation induced by interferons.
EMBO J
18:
5601-5608,
1999[Web of Science][Medline].
31.
Gong, PF,
Hu B,
Stewart D,
Ellerbe M,
Figueroa YG,
Blank V,
Beckman BS,
and
Alam J.
Cobalt induces heme oxygenase-1 expression by a hypoxia-inducible factor-independent mechanism in Chinese hamster ovary cells-regulation by Nrf2 and MafG transcription factors.
J Biol Chem
276:
27018-27025,
2001
32.
Gum, RJ,
McLaughlin MM,
Kumar S,
Wang Z,
Bower MJ,
Lee JC,
Adams JL,
Livi GP,
Goldsmith EJ,
and
Young PR.
Acquisition of sensitivity of stress-activated protein kinases to the p38 inhibitor, SB 203580, by alteration of one or more amino acids within the ATP binding pocket.
J Biol Chem
273:
15605-15610,
1998
33.
Gupta, S,
Campbell D,
Derijard B,
and
Davis RJ.
Transcription factor ATF2 regulation by the JNK signal transduction pathway.
Science
276:
389-393,
1995.
34.
Han, J,
Lee J-D,
Bibbs L,
and
Ulevitch RJ.
A MAP kinase targeted by endotoxin and hyperosmolarity in mammalian cells.
Science
265:
808-811,
1994
35.
Han, ZS,
Enslen H,
Hu X,
Meng X,
Wu I-H,
Barrett T,
Davis RJ,
and
Ip YT.
A conserved p38 mitogen-activated protein kinase pathway regulates Drosophila immunity gene expression.
Mol Cell Biol
18:
3527-3539,
1998
36.
Hangaishi, M,
Ishizaka N,
Aizawa T,
Kurihara Y,
Taguchi J,
Nagai R,
Kimura S,
and
Ohno M.
Induction of heme oxygenase-1 can act protectively against cardiac ischemia/reperfusion in vivo.
Biochem Biophys Res Commun
279:
582-588,
2000[Web of Science][Medline].
37.
He, CH,
Gong PF,
Hu B,
Stewart D,
Choi ME,
Choi AMK,
and
Alam J.
Identification of activating transcription factor 4 (ATF4) as an Nrf2-interacting protein-implication for heme oxygenase-1 gene regulation.
J Biol Chem
276:
20858-20865,
2001
38.
Huang, S,
Jiang Y,
Li Z,
Nishida E,
Mathias P,
Lin S,
Ulevitch RJ,
Nemerow GR,
and
Han J.
Apoptosis signaling pathway in T cells is composed of ICE/Ced-3 family proteases and MAPK kinase kinase 6b.
Immunity
6:
739-749,
1997[Web of Science][Medline].
39.
Hur, E,
Chang KY,
Lee EJ,
Lee S-K,
and
Park HY.
Mitogen-activated protein kinase kinase inhibitor PD98059 blocks the trans-activation but not the stabilization or DNA binding ability of hypoxia-inducible factor-1
.
Mol Pharmacol
59:
1216-1224,
2001
40.
Imai, T,
Morita T,
Shindo T,
Nagai R,
Yazaki Y,
Kurihara H,
Suematsu M,
and
Katayama S.
Vascular smooth muscle cell-directed overexpression of heme oxygenase-1 elevates blood pressure through attenuation of nitric oxide-induced vasodilation in mice.
Circ Res
89:
55-62,
2001
41.
Karin, M.
The regulation of AP-1 activity by mitogen-activated protein kinases.
J Biol Chem
270:
16483-16486,
1995
42.
Kim, K-S,
Takeda K,
Sethi R,
Pracyk JB,
Koichi T,
Zhou YF,
Yu Z-X,
Victor J,
Bruder JT,
Kovesdi I,
Irani K,
Goldschmidt-Clermont P,
and
Finkel T.
Protection from reoxygenation injury by inhibition of rac1.
J Clin Invest
101:
1821-1826,
1998[Web of Science][Medline].
43.
Koh, KC,
Haque SJ,
and
Williams BRB
p38 MAP kinase is required for STAT1 serine phosphorylation and transcriptional activation induced by interferons.
EMBO J
18:
5601-5608,
1999[Web of Science][Medline].
44.
Korzus, E,
Nagase H,
Rydell R,
and
Travis J.
The mitogen-activated protein kinase and Jak-STAT signaling pathways are required for an Oncostatin M-responsive element-mediated activation of matrix metalloproteinase 1 gene expression.
J Biol Chem
272:
1188-1196,
1997
45.
Kyokane, T,
Norimizu S,
Hisashi T,
Yamaguchi T,
Takeoka S,
Tsuchida E,
Naito M,
Nimura Y,
Ishimura Y,
and
Suematsu M.
Carbon monoxide from heme catabolism protects against hepatobiliary dysfunction in endotoxin-treated rat liver.
Gastroenterology
120:
1227-1240,
2001[Web of Science][Medline].
46.
Langlois, WJ,
Sasaoka T,
Saltiel AR,
and
Olefsky JM.
Negative feedback regulation and desensitization of insulin-and epidermal growth factor-stimulated p21 ras activation.
J Biol Chem
270:
25320-25323,
1995
47.
Lee, PJ,
Alam J,
Wiegand GW,
and
Choi AMK
Overexpression of heme oxygenase-1 in human pulmonary epithelial cells results in cell growth arrest and increased resistance to hyperoxia.
Proc Natl Acad Sci USA
93:
10393-10398,
1996
48.
Lee, PJ,
Camhi SL,
Chin BY,
Alam J,
and
Choi AMK
AP-1 and STAT mediate hyperoxia-induced gene transcription of heme oxygenase-1.
Am J Physiol Lung Cell Mol Physiol
279:
L175-L182,
2000
49.
Lee, PJ,
Jiang B-H,
Chin BY,
Iyer NV,
Alam JA,
Semenza GL,
and
Choi AMK
Hypoxia-inducible factor-1 mediates transcriptional activation of the heme oxygenase-1 gene in response to hypoxia.
J Biol Chem
272:
5375-5381,
1997
50.
Maines, MD.
Heme oxygenase: function, multiplicity, regulatory mechanisms, and clinical applications.
FASEB J
2:
2557-2568,
1988[Abstract].
51.
Marshall, CJ.
Specificity of receptor tyrosine kinase signaling: transient versus sustained extracellular signal-regulated kinase activation.
Cell
80:
179-185,
1995[Web of Science][Medline].
52.
McCoubrey, WKJ,
Huang TJ,
and
Maines MD.
Isolation and characterization of a cDNA from the rat brain that encodes hemoprotein heme oxygenase-3.
Eur J Biochem
247:
725-732,
1997[Web of Science][Medline].
53.
Minamino, T,
Christou H,
Hsieh C-M,
Liu Y,
Dhawan V,
Abraham NG,
Perella MA,
Mitsialis SA,
and
Kourembanas S.
Targeted expression of heme oxygenase-1 prevents the pulmonary inflammatory and vascular responses to hypoxia.
Proc Natl Acad Sci USA
98:
8798-8803,
2001
54.
Morita, T,
Perrella MS,
Lee M,
and
Kourembanas S.
Smooth muscle cell-derived carbon monoxide is a regulator of vascular cGMP.
Proc Natl Acad Sci USA
92:
1475-1479,
1995
55.
Omura, T,
Yoshiyama M,
Shimada T,
Shimizu N,
Kim S,
Iwao H,
Takeuchi K,
and
Yoshikawa J.
Activation of mitogen-activated protein kinases in in vivo ischemia/reperfused myocardium in rats.
J Mol Cell Cardiol
31:
1269-1279,
1999[Web of Science][Medline].
56.
Otterbein, L,
Sylvester SL,
and
Choi AMK
Hemoglobin provides protection against lethal endotoxemia in rats: The role of heme oxygenase-1.
Am J Respir Cell Mol Biol
13:
595-601,
1995[Abstract].
57.
Otterbein, LE,
Bach FH,
Alam J,
Soares M,
Lu HT,
Wysk M,
Davis RJ,
Flavell RA,
and
Choi AMK
Carbon monoxide has anti-inflammatory effects involving the mitogen-activated protein kinase pathway.
Nat Med
6:
422-428,
2000[Web of Science][Medline].
58.
Otterbein, LE,
Kolls JK,
Mantell LL,
Cook JL,
Alam J,
and
Choi AMK
Exogenous administration of heme oxygenase-1 by gene transfer provides protection against hyperoxia-induced lung injury.
J Clin Invest
103:
1047-1054,
1999[Web of Science][Medline].
59.
Otterbein, LE,
Mantell LL,
and
Choi AMK
Carbon monoxide provides protection against hyperoxic lung injury.
Am J Physiol Lung Cell Mol Physiol
276:
L688-L694,
1999
60.
Panahian, N,
Yoshiura M,
and
Maines MD.
Overexpression of heme oxygenase-1 is neuroprotective in a model of permanent middle cerebral artery occlusion in transgenic mice.
J Neurochem
72:
1187-11203,
1999[Web of Science][Medline].
61.
Petrache, I,
Choi ME,
Otterbein LE,
Chin BY,
Mantell LL,
Horowitz S,
and
Choi AMK
Mitogen-activated protein kinase pathway mediates hyperoxia-induced apoptosis in cultured macrophage cells.
Am J Physiol Lung Cell Mol Physiol
277:
L589-L595,
1999
62.
Poss, KD,
and
Tonegawa S.
Reduced stress defense in heme oxygenase-1 deficient cells.
Proc Natl Acad Sci USA
94:
10925-10930,
1997
63.
Primiano, T,
Kensler TW,
Kuppusamy P,
Zweier JL,
and
Sutter TR.
Induction of hepatic heme oxygenase-1 and ferritin in rats by cancer chemopreventive dithiolethiones.
Carcinogenesis
17:
2291-2296,
1996
64.
Raingeaud, J,
Gupta S,
Rogers JS,
Dickens M,
Han J,
Ulevitch RJ,
and
Davis RJ.
Pro-inflammatory cytokines and environmental stress cause p38 mitogen-activated protein kinase activation by dual phosphorylation on tyrosine and threonine.
J Biol Chem
270:
7420-7426,
1995
65.
Rincon, M,
Enslen H,
Raingeaud J,
Recht M,
Zapton T,
Su MS,
Penix LA,
Davis RJ,
and
Flavell RA.
Interferon-gamma expression by Th 1 effector T cells mediated by the p38 MAP kinase signaling pathway.
EMBO J
17:
2817-2829,
1998[Web of Science][Medline].
66.
Shimizu, H,
Takahashi T,
Tsutomu S,
Yamasaki A,
Fujiwara T,
Odaka Y,
Hirakawa M,
Fujita H,
and
Akagi R.
Protective effects of heme oxygenase induction in ischemic acute renal failure.
Crit Care Med
28:
809-817,
2000[Web of Science][Medline].
67.
Shimizu, N,
Yoshinaya M,
Omura T,
Hanatani A,
Kim S,
Takeuchi K,
Iwao H,
and
Yoshikawa J.
Activation of mitogen-activated protein kinases and activator protein-1 in myocardial infarction in rats.
Cardiovasc Res
38:
116-124,
1998
68.
Simon, AR,
Rai U,
Fanburg B,
and
Cochran B.
Activation of JAK-STAT pathway by reactive oxygen species.
Am J Physiol Cell Physiol
275:
C1640-C1652,
1998
69.
Stocker, R,
Yamamoto Y,
McDonagh AF,
Glazer AN,
and
Ames BN.
Bilirubin is an antioxidant of possible physiological importance.
Science
235:
1043-1046,
1987
70.
Tenhunen, R,
Marver HS,
and
Schmid R.
The enzymatic conversion of heme to bilirubin by microsomal heme oxygenase.
Proc Natl Acad Sci USA
61:
748-755,
1968
71.
Tenhunen, R,
Marver HS,
and
Schmid R.
Microsomal heme oxygenase.
J Biol Chem
244:
6388-6394,
1969
72.
Tournier, C,
Hess P,
Yang DD,
Xu J,
Turner TK,
Nimnual A,
Bar-Sagi D,
Jones SN,
Flavell RA,
and
Davis RJ.
Requirement of JNK for stress-induced activation of the cytochrome c-mediated death pathway.
Science
288:
870-874,
2000
73.
Vile, GF,
Basu-Modak S,
Waltner C,
and
Tyrrell RM.
Heme oxygenase 1 mediates an adaptive response to oxidative stress in human skin fibroblasts.
Proc Natl Acad Sci USA
91:
2607-2610,
1994
74.
Vile, GF,
and
Tyrrell RM.
Oxidative stress resulting from ultraviolet A irradiation of human skin fibroblasts leads to a heme oxygenase-dependent increase in ferritin.
J Biol Chem
268:
14678-14681,
1994.
75.
Wang, Y,
Huang S,
Sah VP,
Ross J,
Brown JH,
Han J,
and
Chien KR.
Cardiac muscle cell hypertrophy and apoptosis induced by distinct members of the p38 mitogen-activated protein kinase family.
J Biol Chem
273:
2161-2168,
1998
76.
Whitmarsh, AJ,
Shore P,
Sharrocks AD,
and
Davis RJ.
Integration of MAP kinase signal transduction pathways at the serum response element.
Science
269:
403-407,
1995
77.
Whitmarsh, WJ,
and
Davis RJ.
Transcription factor AP-1 regulation by mitogen-activated protein kinase signal transduction pathways.
J Mol Med
74:
589-607,
1996[Web of Science][Medline].
78.
Xi, X,
Han J,
and
Zhang J-Z.
Stimulation of glucose transport by AMP-activated protein kinase via activation of p38 mitogen-activated protein kinase.
J Biol Chem
276:
41029-41034,
2001
79.
Yachie, A,
Niida Y,
Wada T,
Igarashi N,
and
Kaneda H.
Oxidative stress causes enhanced endothelial cell injury in human heme oxygenase-1 deficiency.
J Clin Invest
103:
129-135,
1999[Web of Science][Medline].
80.
Yamaguchi, T,
Terakado N,
Horio F,
Aoki K,
Tanaka M,
and
Nakajima H.
Role of bilirubin as an antioxidant in an ischemia-reperfusion of rat liver and induction of heme oxygenase.
Biochem Biophys Res Commun
223:
129-135,
1996[Web of Science][Medline].
This article has been cited by other articles:
![]() |
M. A. Alaoui-Jamali, T. A. Bismar, A. Gupta, W. A. Szarek, J. Su, W. Song, Y. Xu, B. Xu, G. Liu, J. Z. Vlahakis, et al. A Novel Experimental Heme Oxygenase-1-Targeted Therapy for Hormone-Refractory Prostate Cancer Cancer Res., October 15, 2009; 69(20): 8017 - 8024. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Casiraghi, J. R. Tatreau, J. B. Abano, J. W. Blackwell, L. Watson, K. Burridge, S. H. Randell, and T. M. Egan In vitro modeling of nonhypoxic cold ischemia-reperfusion simulating lung transplantation J. Thorac. Cardiovasc. Surg., September 1, 2009; 138(3): 760 - 767. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Alam and J. L. Cook How Many Transcription Factors Does It Take to Turn On the Heme Oxygenase-1 Gene? Am. J. Respir. Cell Mol. Biol., February 1, 2007; 36(2): 166 - 174. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. W. Ryter, J. Alam, and A. M. K. Choi Heme Oxygenase-1/Carbon Monoxide: From Basic Science to Therapeutic Applications Physiol Rev, April 1, 2006; 86(2): 583 - 650. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. H. Ng, S. Wan, and A. P. C. Yim Pulmonary ischaemia-reperfusion injury: role of apoptosis Eur. Respir. J., February 1, 2005; 25(2): 356 - 363. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Powell, M. M. Wright, and R. M. Jackson p38mapk and MEK1/2 inhibition contribute to cellular oxidant injury after hypoxia Am J Physiol Lung Cell Mol Physiol, April 1, 2004; 286(4): L826 - L833. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Song, M. Kubo, D. Morse, Z. Zhou, X. Zhang, J. H. Dauber, J. Fabisiak, S. M. Alber, S. C. Watkins, B. S. Zuckerbraun, et al. Carbon Monoxide Induces Cytoprotection in Rat Orthotopic Lung Transplantation via Anti-Inflammatory and Anti-Apoptotic Effects Am. J. Pathol., July 1, 2003; 163(1): 231 - 242. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ohlmann, S. Giffhorn-Katz, I. Becker, N. Katz, and S. Immenschuh Regulation of Heme Oxygenase-1 Gene Expression by Anoxia and Reoxygenation in Primary Rat Hepatocyte Cultures Exp Biol Med, May 1, 2003; 228(5): 584 - 589. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |