|
|
||||||||
B inhibition by
-3 fatty acids modulates
LPS-stimulated macrophage TNF-
transcription
Laboratories of Surgical Metabolism, University of Illinois at Chicago, Chicago, Illinois 60612
| |
ABSTRACT |
|---|
|
|
|---|
-3 Fatty acid (FA) emulsions
reduce LPS-stimulated murine macrophage TNF-
production, but the
exact mechanism has yet to be defined. The purpose of this study was to
determine the mechanism for
-3 FA inhibition of macrophage TNF-
production following LPS stimulation. RAW 264.7 cells were pretreated
with isocaloric emulsions of
-3 FA (Omegaven),
-6 FA (Lipovenos),
or DMEM and subsequently exposed to LPS. I
B-
and
phospho-I
B-
were determined by Western blotting. NF-
B binding
was assessed using the electromobility shift assay, and activity was
measured using a luciferase reporter vector. RT-PCR and ELISA
quantified TNF-
mRNA and protein levels, respectively. Pretreatment
with
-3 FA inhibited I
B phosphorylation and significantly
decreased NF-
B activity. Moreover,
-3-treated cells demonstrated
significant decreases in both TNF-
mRNA and protein expression by 47 and 46%, respectively. These experiments demonstrate that a mechanism
for proinflammatory cytokine inhibition in murine macrophages by
-3
FA is mediated, in part, through inactivation of the NF-
B signal
transduction pathway secondary to inhibition of I
B phosphorylation.
eicosapentaenoic acid; nuclear factor-
B; signal transduction; tumor necrosis factor-
| |
INTRODUCTION |
|---|
|
|
|---|
FISH OIL EMULSIONS
rich in
-3 fatty acids (FA) have consistently demonstrated
anti-inflammatory properties primarily through their effects on the
macrophage (MØ) component of the inflammatory response (7,
10). However, studies examining the effects of
-3 FA on the
elaboration of proinflammatory cytokines (PIC) in MØ have been
reported with variable results, a likely occurrence from the lack of a
pure and consistent source of experimental
-3 FA substrate (7,
14, 16, 21). As pharmaceutical grade
-3 FA have not been
available, their true biological effects are obfuscated from EPA
oxidation, endotoxin contamination, and the inherent suppression of the
macrophage inflammatory response by albumin alone (25). A
commercially available pharmaceutical grade
-3 FA emulsion Omegaven
recently became available that enables the experimental evaluation of
specific mechanisms of
-3 FA action without the confounding
variables of impurity. This fish oil emulsion is currently used as an
anti-inflammatory agent for critically ill patients (19,
20). However, the mechanisms of action are not well defined.
Moreover, a pure and isoenergetic
-6 FA emulsion (Lipovenos) is also
available for use as a true experimental control, allowing exclusion of
the nonspecific effects of lipids on MØ in these experiments.
Previous studies in our laboratory have demonstrated that
-3 FA
emulsions inhibit LPS-mediated TNF-
expression in MØ, although the
mechanisms of action are still unknown (1). It is
hypothesized that
-3 FA may modulate NF-
B transcriptional
activator proteins, a principal pathway for MØ PIC elaboration
(4, 5).
NF-
Bs are dimers usually located in the cytoplasm associated with an
inhibitor protein (I
B) (2). Under basal conditions, I
B maintains NF-
B in the cytoplasm by preventing display of the
nuclear localization sequence (3, 6). When MØs are
activated by a large variety of inducers, including endotoxin via the
Tlr-4 receptor (18), I
B kinase-
phosphorylates I
B
at two serine residues (Ser 32 and 36) allowing dissociation from
NF-
B (8, 23, 24). Phosphorylated I
B is subsequently
targeted for polyubiquitination and degradation through the 26S
proteosome pathway. NF-
B is then free to localize to the nucleus
initiating transcription of various PIC genes, most notably TNF-
(14).
The activation of NF-
B plays a vital role in the elaboration of
TNF-
; therefore, we hypothesized that
-3 FA may exert inhibitory effects at a specific point along the NF-
B pathway. The purpose of
these experiments was to define a mechanism for
-3 FA inhibition of
MØ TNF-
production following LPS stimulation.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Materials.
Escherichia coli 0111:B4 LPS was purchased from Sigma (St.
Louis, MO). The murine MØ cell line RAW 264.7 was obtained from American Type Culture Collection (Rockville, MD). Omegaven (
-3 FA
emulsion) and Lipovenos (
-6 FA emulsion) were purchased from Fresenius-Kabi (Bad-Homburg, Germany).
Cell culture. RAW 264.7 cells were suspended in complete medium, DMEM (Mediatech, Herndon, VA) (supplemented with 10% FBS, 100 U/ml penicillin, and 100 U/ml streptomycin). In all experiments, cells were plated in 24-well plates (except transfections, 35-mm plates; nuclear extraction, 100-mm plates) at a density of 1 × 106 cells/well. All experiments were performed in a humidified atmosphere under 5% CO2 at 37°C.
Experimental design.
All experiments adhered to the following protocol unless otherwise
noted. Cells were randomly separated into three separate treatment
groups: media alone (DMEM),
-3 FA emulsion, or
-6 FA emulsion.
Cells were allowed to adhere for 2 h and then incubated in the
presence of Omegaven (12 mg%,
-3 FA emulsion), Lipovenos (10 mg%,
isoenergetic, isocaloric
-6 FA emulsion), or DMEM for 4 h.
Optimal concentrations for MØ TNF-
inhibition were determined in
previous studies (1). The cells were washed twice with
DMEM and then stimulated with LPS (1 µg/ml) for 3 h. After LPS
incubation, the cells were washed twice with DMEM and then examined as
described below.
Measurement of I
B phosphorylation.
To investigate the effects of
-3 FA on I
B phosphorylation, total
cellular protein from
-3-treated RAW cells was analyzed via Western
blotting. Cells were lysed with ×1 lysis buffer, 75 µg I
B, and
150 µg (phosphor-I
B) of total protein were separately loaded on
10% SDS-PAGE gels (Bio-Rad, Hercules, CA), along with 0.35 µg of
biotinylated protein standard (New England Biolabs, Beverly, MA), and
run at 100 V for 70 min. The gel was transblotted to a nitrocellulose
membrane (Bio-rad) at 300 mA for 70 min. The membrane was blocked with
5% nonfat dry milk in TBS containing 1% Tween 20 (TBST) for 90 min
and then incubated in the presence of the primary antibody specific for
I
B or phospho-I
B (New England Biolabs) (1:1,000 dilution, TBST
with 5% BSA) overnight at 4°C. The membrane was then washed three
times for 10 min each in TBST and subsequently exposed to an
anti-biotin antibody (1:1,000 dilution) and anti-rabbit-HRP antibody
(1:2,000 dilution) (New England Biolabs) for 1 h. The membrane was
then washed again three times with TBST. The protein was detected by
incubating the membrane with TMB Stabilized Substrate for HRP (Promega,
Madison, WI) for 5 min.
Nuclear protein extraction and EMSA.
Cells were grown to confluence (1 × 107 cells) in
100-mm plates and treated as described in Experimental
design. After endotoxin exposure, cells were washed twice with
ice-cold PBS, and total nuclear extract was prepared using the reagents
and protocol described by Active Motif LLC (Carlsbad, CA). For the
EMSA, T4 polynucleotide kinase, poly(dI-dC), [32P]ATP,
and the Sephadex G-50M column were purchased from Amersham Biosciences
(Piscataway, NJ). All other reagents for this experiment were obtained
from Sigma Chemical unless otherwise specified. The probe was a 24-bp
double-stranded construct of the NF-
B consensus sequence
(5'-AGGGACTTTCCGCTG GGACTTTCC-3'), which was end-labeled using T4
polynucleotide kinase and [32P]ATP. The labeled probe was
purified on a Sephadex G-50M column. For each sample, 5 µg of total
nuclear protein were incubated with the labeled double-stranded probe
(~50,000 cpm) and 5 µg of poly(dI-dC) in binding buffer (10 mM
Tris · HCl, pH 7.5, 100 mM NaCl, 1 mM EDTA, 0.2%
Nonidet P-40, and 0.5 mM dithiothreitol) for 20 min at 25°C. Specific
competition was done by adding 100 ng of unlabeled NF-
B
double-stranded binding probe to the reaction. The mixtures were run on
5% polyacrylamide gel electrophoresis in ×1 Tris-glycine-EDTA buffer.
The gels were then vacuum-dried and exposed to radiographic film
(Eastman Kodak, New Haven, CT).
Transfection of luciferase reporter vector.
When measuring NF-
B activity, RAW cells were first transfected,
before FA exposure, with a luciferase reporter vector (Clontech, Palo
Alto, CA) containing four tandem copies of the NF-
B consensus sequence fused to a TATA-like region from the Herpes simplex virus thymidine kinase (HSV-TK) promoter. All transfection media (exclusive of FBS) were supplemented with 1.0 µg/ml protamine sulfate. Protamine has been shown to increase lipid-mediated transfection of MØ by condensing DNA structure into a compact structure (9). In
addition, the nuclear localization amino acid signal of protamine
increases the nuclear translocation of DNA, thus enhancing luciferase
transcription (11). One microgram of NF-
B luciferase
vector was transfected with 8 µl of lipid in 200 µl of DMEM via the
LipofectAMINE method (Invitrogen, Carlsbad, CA) for 5 h into RAW
264.7 cells. Zero point one microgram Renilla
luciferase-positive control vector (pRL-SV40: Promega) was
cotransfected with the NF-
B luciferase vector to normalize the
transfection efficiency. pTAL-Luc (Clontech), substituting for the
NF-
B luciferase vector, was used as a negative control. After the
5-h incubation, 1 ml DMEM with ×2 FBS was overlaid onto the cells.
Transfection medium was replaced with complete medium at 18 h from
start of the transfection.
Measurement of NF-
B activity.
Transfected RAW cells were treated as described in Experimental
design and then lysed with 150 µl ×1 passive lysis buffer (Promega) for 15 min at room temperature. Firefly and
Renilla luciferase activities were obtained by analyzing 10 µl of protein lysate following the protocol provided by the Dual
Luciferase Reporter Assay System (Promega) in a TD-20/20 luminometer
(Turner Designs, Sunnyvale, CA) (2-s delay, 10-s count). To adjust for any variation in transfection efficiency, the results were reported as
firefly luciferase activity divided by Renilla luciferase activity.
RT-PCR analysis of TNF-
message.
Total RNA from 4 × 106 treated RAW cells was
extracted with 1 ml TRI reagent (Molecular Research Center, Cincinnati,
OH). The samples were spun at 16,000 g for 10 min at 4°C,
and then 700 µl of supernatant were removed and added to 70 µl
1-bromo-3-chloro-propane (Sigma). Samples were vortexed, incubated at
room temperature for 10 min, and then spun for 5 min at 4°C.
Three-hundred-fifty microliters of the resulting supernatant were added
to an equal volume of Phenol/Isoamyl Alcohol/Chloroform (Fischer
Scientific, Pittsburgh, PA), vortexed, and spun for 10 min at 4°C.
Three-hundred microliters of the resulting supernatant were added to an
equal volume of ice-cold isopropanol (Fischer) and precipitated at
20°C overnight. Samples were then spun at 16,000 g for
15 min at 4°C, washed with 75% ethanol, and the final RNA
precipitant was suspended in 10 µl DEPC-treated water. RNA
concentrations were determined spectrophotometrically at 260 nm, while
the A260/A280 ratio measured the purity of the
samples. The first strand cDNA synthesis containing 0.8 µg total RNA
was primed with oligo(dT) and 1 cycle was run: 15 min at 42°C, 5 min
at 99°C, and 10 min at 5°C. Specific primers (Invitrogen) were used
for TNF-
(sense, TCTCATCAGTTCTATGGCCC; antisense,
GGGAGTAGACAAGGTACAAC) and GAPDH (sense, AGCCTTCTCCATGGTGGTGAAGAC; antisense, CGGAGTCAACGGATTTGGTCGTAT). The PCR cycling conditions for
all reactions were as follows: 94°C for 1 min, 60°C for 35 s,
and a final extension period at 72°C for 7 min. Optimal amplification was achieved at 26 cycles for TNF-
and GAPDH. GAPDH served as an
internal control. The PCR products were run alongside 0.25 µg of
100-bp molecular standard ladder (Bio-rad) on a 1.5% agarose gel
containing ethidium bromide. After separation, the bands were visualized under UV light (Fischer Scientific) and analyzed with 1D
software (Eastman Kodak). The results were expressed as the relative
intensity vs. the control (GADPH).
ELISA for TNF-
.
Supernatants from treated RAW 264.7 cells were collected and
immediately frozen at
70°C. The samples were subsequently analyzed for TNF-
protein following the protocol provided by R&D Systems (Minneapolis, MN).
Statistical analysis.
TNF-
and NF-
B data are presented as means ± SE. The data
were analyzed by one-way ANOVA, as well as additional ANOVA post hoc
analysis (Tukey and Scheffé's). Statistical significance was
defined at the P < 0.05 level.
| |
RESULTS |
|---|
|
|
|---|
Effects of
-3 FA on I
B phosphorylation.
The amount of total I
B, phosphorylated and unphosphorylated,
did not deviate from baseline levels (DMEM + LPS) after 3-h LPS
exposure (Fig. 1A). The amount
of phospho-I
B, however, did change significantly depending on the
treatment (Fig. 1, B and C). A small amount of
I
B phosphorylation is evident in nonstimulated MØ for all three
treatments. DMEM and
-6 FA pretreatment, followed by LPS
stimulation, exhibited approximately the same moderate increase in
phospho-I
B. Conversely,
-3 FA treatment significantly decreased
the amount of I
B phosphorylation; the intensity is similar to the
nonstimulated cells.
|
Effects of
-3 FA on NF-
B binding and activity.
A low basal level of NF-
B binding to the TNF-
-specific consensus
sequence was observed in non-LPS-stimulated MØ, whereas LPS exposure
generated strong binding of NF-
B in both DMEM- and
-6-pretreated
cells but not after
-3 FA (Fig. 2).
Moreover, the effects of DMEM,
-3, and
-6 FAs on NF-
B binding
parallel the results seen in the activity studies (Fig.
3). A low level of NF-
B activity was
observed in non-LPS-stimulated MØ. Strong activation of NF-
B was
induced after LPS exposure, as shown by the large increase in
luciferase activity in both the DMEM- and
-6-pretreated cells.
Conversely,
-3 pretreatment significantly decreased NF-
B
activation by 63% under control levels following endotoxin exposure
(P < 0.01). It should be noted that transfecting with
protamine sulfate in the media did not alter basal luciferase activity
and that the pTAL vector (control) produced nominal luciferase activity
(data not shown).
|
|
-3 FA effects on TNF-
message transcription.
MØ incubated in the presence of DMEM,
-3 FA, and
-6 FA
demonstrated similar low levels of constitutive expression of TNF-
mRNA (Fig. 4). After LPS stimulation,
cells pretreated with DMEM and
-6 FA averaged greater than a 100%
increase in transcription over basal levels. Conversely, LPS-stimulated
cells first exposed to
-3 FA demonstrated a significant decrease
(47%) in TNF-
mRNA levels under the control; this value is only a
15% increase over the control media (DMEM) without LPS. This
difference is statistically significant with a P value of
<0.01.
|
-3 FA effects on TNF-
protein production.
Cells pretreated with either
-3 FA or
-6 FA without LPS
stimulation did not demonstrate a significant change in TNF-
production from baseline (DMEM). After LPS stimulation, TNF-
production from DMEM- and
-6 FA-treated cells increased similarly.
However,
-3-treated cells displayed a significant decrease in
TNF-
production after LPS stimulation, with a 46% decrease from
baseline (P < 0.01) (Fig.
5). In addition, it should be noted that
the decrease in TNF-
protein is congruent with the decrease in
TNF-
message after
-3 FA treatment, 46 and 47%, respectively.
|
| |
DISCUSSION |
|---|
|
|
|---|
The early inflammatory response is regulated predominately by the
MØ component of the immune system and is characterized by an increased
production of PIC, mediated, in part, through NF-
B activation
(4).
-3 FA have long been considered as an
anti-inflammatory agent. However, past studies have reported variable
PIC elaboration. Previously available
-3 FA sources for experimental
evaluation were potentially contaminated or consisted of compound
substances likely contributing to the observed experimental
discrepancies. For instance, Sato et al. (21) reported
that
-3 FA treatment of human monocytes increased TNF-
production
after LPS stimulation, yet Billiar et al. (7) demonstrated
a decrease in TNF-
. The recent availability of a pharmaceutical
grade
-3 FA source will now allow for assessment of the cellular
mechanisms that define the anti-inflammatory properties of
-3 FA.
This study investigated the effects of
-3 FA on the elaboration of
TNF-
in the context of a LPS-stimulated in vitro murine MØ model.
This report examined the effects of
-3 FA on the phosphorylation of
I
B at serine 32 as a requirement for both NF-
B translocation to
the nucleus and activation. The results demonstrate that following LPS
stimulation,
-3 FA pretreatment significantly decreases
phosphorylation at serine 32, thus providing a basis for the observed
decrease in NF-
B binding and activity following
-3 incubation.
Without the requisite I
B phosphorylation, NF-
B remains inactive
in the cytoplasm bound to I
B. Our data indicate that total levels of I
B (phosphorylated and unphosphorylated) do not deviate after a 3-h
LPS treatment. These results are consistent with previous reports on
the time course for I
B degradation through the ubiquitin-proteosome pathway. Shanley et al. (22) reported that I
B is
degraded rapidly after 5 min of LPS exposure but returns to baseline
levels within 30 min.
Subsequent experiments examining the effects of
-3 FA on the NF-
B
signal transduction cascade were initiated based on two observations:
1)
-3 FA decrease transcription of TNF-
suggesting modulation of an intercellular signal transduction pathway and 2) NF-
B is an essential transcriptional regulator of
inflammatory gene activation, including TNF-
. The experimental data
support that
-3 FA significantly decrease both NF-
B binding to
the TNF-
-specific consensus sequence and subsequent activity in
response to LPS stimulation compared with both DMEM and
-6 FA.
Moreover, MØ incubated in
-3 FA-rich media before LPS stimulation
produces significantly less TNF-
message elaboration. These data
implicate that a major anti-inflammatory mechanism for
-3 FA is
reduction of TNF-
gene transcription, mediated, in part, through
inhibition of NF-
B regulatory proteins. As TNF-
protein decreases
a proportional amount, the anti-inflammatory effects of
-3 FA on
TNF-
occur primarily at the level of gene transcription. These
results are consistent with previous studies examining the effects of
-3 FA on TNF-
production in an in vitro murine MØ model
(14).
The mechanisms modulating cellular events proximal to I
B
phosphorylation in the elaboration of TNF-
are still yet to be elucidated. Some studies have suggested that the incorporation of
-3
FA into the plasma membrane alters the composition of the phospholipid
pool, thus modifying the production of inflammatory lipid mediators
(e.g., PGE2) (15, 17). It is thought that
-3 FA displace arachidonic acid from plasma membranes decreasing its
availability as a precursor of inflammation-associated
prostanoids. Moreover, Kunkel et al. (13) reported a
clear autoregulatory relationship between TNF-
and proinflammatory
prostanglandins, particularly PGE2. Recent studies also
suggest that
-3 FA may act at the level of membrane-bound receptors.
Jordan and Stein (12) propose that
-3 FA may alter the
physical and chemical properties of the plasma membrane so that
receptor ligand binding is altered. On the basis of these observations,
it is possible that
-3 FA change the sensitivity of the Tlr-4
receptor for LPS, consequently inhibiting transduction of
proinflammatory signals into the interior of the MØ. Future
experiments are warranted in the investigation of the proximal
regulatory mechanisms of
-3 FA on I
B kinase-
inhibition,
specifically the interaction between
-3 FA, inflammatory
prostaglandin elaboration, and Tlr-4 receptor function.
In summary, the data demonstrate that treatment of murine MØ with
-3 FA significantly decreases I
B phosphorylation at serine 32 and
consequently reduces the ability of NF-
B to bind to the TNF-
-specific consensus sequence. As a result, the NF-
B signal transduction cascade is inhibited, and this decreased NF-
B activity is translated into a concomitant decrease in TNF-
mRNA
transcription. TNF-
protein elaboration is reduced accordingly.
Moreover, the
-6 FA-treated MØ exhibits similar effects as media
alone (DMEM) in all experiments, validating that the observed
anti-inflammatory effects on the MØ are exclusive to
-3 FA and not
a result of a general lipid effect. These experiments demonstrate that
a mechanism for proinflammatory cytokine transcription inhibition in
murine MØ by
-3 FA is mediated, in part, through inactivation of
the NF-
B signal transduction pathway secondary to inhibition of
I
B phosphorylation at serine 32.
| |
ACKNOWLEDGEMENTS |
|---|
We are profoundly grateful for the expert assistance of Dr. K. Anwar.
| |
FOOTNOTES |
|---|
This work was supported by the Warren and Clara Cole Foundation. T. Novak was supported in part by the Alpha Omega Alpha Student Research Fellowship.
Address for reprint requests and other correspondence: N. Joseph Espat, Dept. of Surgery M/C 958, Univ. of Illinois at Chicago, 840 South Wood St., Rm. 435E, Chicago, IL 60612 (E-mail: jespat{at}uic.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
August 30, 2002;10.1152/ajplung.00077.2002
Received 13 March 2002; accepted in final form 28 August 2002.
| |
REFERENCES |
|---|
|
|
|---|
1.
Babcock, TA,
Helton WS,
Hong D,
and
Espat NJ.
-3 Fatty acid lipid emulsion reduces LPS-stimulated macrophage TNF-
production.
Surg Inf
3:
145-149,
2002.
2.
Baeuerle, PA,
and
Baltimore D.
Activation of DNA-binding activity in an apparently cytoplasmic precursor of the NF-
B transcription factor.
Cell
53:
211-217,
1988[Web of Science][Medline].
3.
Baeuerle, PA,
and
Baltimore D.
I
B: a specific inhibitor of the NF-
B transcription factor.
Science
242:
540-546,
1988
4.
Baeuerle, PA,
and
Baltimore D.
NF-
B: ten years after.
Cell
87:
13-20,
1996[Web of Science][Medline].
5.
Baldwin, AS.
The NF
B and I
B proteins: new discoveries and insights.
Annu Rev Immunol
14:
649-683,
1996[Web of Science][Medline].
6.
Beg, AA,
and
Baldwin AS, Jr.
The I
B proteins: multifunctional regulators of Rel/NF-
B transcription factors.
Genes Dev
7:
2064-2070,
1993
7.
Billiar, TR,
Bankey PE,
Svingen BA,
Curran RD,
West MA,
Holman RT,
Simmons RL,
and
Cerra FB.
Fatty acid intake and Kupffer cell function: fish oil alters eicosanoid and monokine production to endotoxin stimulation.
Surgery
104:
343-349,
1988[Web of Science][Medline].
8.
Chen, ZJ,
Parent L,
and
Maniatis T.
Site-specific phosphorylation of I
B
by a novel ubiquitination-dependent protein kinase activity.
Cell
84:
853-862,
1996[Web of Science][Medline].
9.
Dokka, S,
Toledo D,
Shi X,
Ye J,
and
Rojanasakul Y.
High-efficiency gene transfection of macrophages by lipoplexes.
Int J Pharm
206:
97-104,
2000[Web of Science][Medline].
10.
Endres, S,
Ghorbani R,
Kelley VE,
Georgilis K,
Lonnemann G,
Van der Meer JW,
Cannon JG,
Rogers TS,
Klempner MS,
and
Weber PC.
The effect of dietary supplementation with n-3 polyunsaturated fatty acids on the synthesis of interleukin-1 and tumor necrosis factor by mononuclear cells.
N Engl J Med
320:
265-271,
1989[Abstract].
11.
Gao, X,
and
Huang L.
Protamine sulfate enhances lipid-mediated gene transfer.
Gene Ther
4:
961-968,
1997[Web of Science][Medline].
12.
Jordan, A,
and
Stein J.
Modulation of epidermal growth factor-induced cell proliferation by an
-3 fatty-acid-containing lipid emulsion on human pancreatic cancer cell line Mia Paca-2.
Nutrition
17:
474-475,
2001[Web of Science][Medline].
13.
Kunkel, SL,
Wiggins RC,
Chensue SW,
and
Larrick J.
Regulation of macrophage tumor necrosis factor production by prostaglandin E2.
Biochem Biophys Res Commun
137:
404-410,
1986[Web of Science][Medline].
14.
Lo, C,
Chiu KC,
Fu M,
Lo R,
and
Helton S.
Fish oil decreases macrophage tumor necrosis factor gene transcription by altering NF
B activity.
J Surg Res
82:
216-221,
1999[Web of Science][Medline].
15.
Lokesh, BR,
and
Kinsella JE.
Modulation of prostaglandin synthesis in mouse peritoneal macrophages by enrichment of lipids with either eicosapentaenoic or docosahexaenoic acids in vitro.
Immunobiology
175:
406-419,
1987[Web of Science][Medline].
16.
Lokesh, BR,
Sayer TJ,
and
Kinsella JE.
Interleukin-1 and tumor necrosis factor synthesis by mouse peritoneal macrophages is enhanced by dietary n-3 polyunsaturated fatty acids.
Immunol Lett
23:
281-285,
1990[Web of Science][Medline].
17.
Magrum, LJ,
and
Johnston PV.
Modulation of prostaglandin synthesis in rat peritoneal macrophages with
-3 fatty acids.
Lipids
18:
514-521,
1983[Web of Science][Medline].
18.
Medzhitov, R,
and
Janeway C.
Innate immunity.
N Engl J Med
343:
338-344,
2000
19.
Morlion, BJ,
Torwesten E,
Lessire H,
Sturm G,
Peskar BM,
Furst P,
and
Puchstein C.
The effect of parenteral fish oil on leukocyte membrane fatty acid composition and leukotriene-synthesizing capacity in patients with postoperative trauma.
Metabolism
45:
1208-1213,
1996[Web of Science][Medline].
20.
Roulet, M,
Frascarolo P,
Pilet M,
and
Chapuis G.
Effects of intravenously infused fish oil on platelet fatty acid phospholipid composition and on platelet function in postoperative trauma.
JPEN
21:
296-301,
1997
21.
Sato, TT,
Garcia IA,
and
Maier RV.
Immunomodulation of cultured human monocytes by
-3 fatty acid.
Surg Forum
43:
9-10,
1992.
22.
Shanley, TP,
Ryan MA,
Eaves-Pyles T,
and
Wong HR.
Heat shock inhibits phosphorylation of I-
B
.
Shock
14:
447-450,
2000[Web of Science][Medline].
23.
Traenckner, EB,
Pahl HL,
Henkel T,
Schmidt KN,
Wilk S,
and
Baeuerle PA.
Phosphorylation of human I
B-
on serines 32 and 36 controls I
B-
proteolysis and NF-
B activation in response to diverse stimuli.
EMBO J
14:
2876-2883,
1995[Web of Science][Medline].
24.
Zandi, E,
Rothwarf DM,
Delhase M,
Hayakawa M,
and
Karin M.
The I
B kinase complex (IKK) contains two kinase subunits, IKK
and IKK
, necessary for I
B phosphorylation and NF-
B activation.
Cell
91:
243-252,
1997[Web of Science][Medline].
25.
Zheng, ZM,
Specter SC,
and
Lancz G.
Bovine serum albumin preparations enhance in vitro production of tumor necrosis factor
by murine macrophages.
Immunol Invest
24:
737-756,
1995[Web of Science][Medline].
This article has been cited by other articles:
![]() |
I. Rudkowska, B. Marcotte, G. Pilon, C. Lavigne, A. Marette, and M.-C. Vohl Fish nutrients decrease expression levels of tumor necrosis factor-{alpha} in cultured human macrophages Physiol Genomics, February 1, 2010; 40(3): 189 - 194. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. E. de Meijer, K. M. Gura, H. D. Le, J. A. Meisel, and M. Puder Fish Oil-Based Lipid Emulsions Prevent and Reverse Parenteral Nutrition-Associated Liver Disease: The Boston Experience JPEN J Parenter Enteral Nutr, September 1, 2009; 33(5): 541 - 547. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Diaz Encarnacion, G. M. Warner, C. E. Gray, J. Cheng, H. K. H. Keryakos, K. A. Nath, and J. P. Grande Signaling pathways modulated by fish oil in salt-sensitive hypertension Am J Physiol Renal Physiol, June 1, 2008; 294(6): F1323 - F1335. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Gura, R. Strijbosch, S. Arnold, C. McPherson, and M. Puder The Role of an Intravenous Fat Emulsion Composed of Fish Oil in a Parenteral Nutrition-Dependent Patient With Hypertriglyceridemia Nutr Clin Pract, December 1, 2007; 22(6): 664 - 672. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Fontaine-Bisson, T. M. Wolever, J.-L. Chiasson, R. Rabasa-Lhoret, P. Maheux, R. G Josse, L. A Leiter, N W. Rodger, E. A Ryan, P. W Connelly, et al. Genetic polymorphisms of tumor necrosis factor-{alpha} modify the association between dietary polyunsaturated fatty acids and fasting HDL-cholesterol and apo A-I concentrations Am. J. Clinical Nutrition, September 1, 2007; 86(3): 768 - 774. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sharif, M. Broman, T. Babcock, E. Ong, D. Jho, M. Rudnicki, W. S. Helton, and N. J. Espat A Priori Dietary {Omega}-3 Lipid Supplementation Results in Local Pancreatic Macrophage and Pulmonary Inflammatory Response Attenuation in a Model of Experimental Acute Edematous Pancreatitis (AEP) JPEN J Parenter Enteral Nutr, July 1, 2006; 30(4): 271 - 276. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J Deckelbaum, T. S Worgall, and T. Seo n-3 Fatty acids and gene expression Am. J. Clinical Nutrition, June 1, 2006; 83(6): S1520 - 1525S. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Siddiqui, D. Pandya, K. Harvey, and G. P. Zaloga Nutrition Modulation of Cachexia/Proteolysis Nutr Clin Pract, April 1, 2006; 21(2): 155 - 167. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Li, D. Barnes, D. Butz, D. Bjorling, and M. E. Cook 10t,12c-conjugated linoleic acid inhibits lipopolysaccharide-induced cyclooxygenase expression in vitro and in vivo J. Lipid Res., October 1, 2005; 46(10): 2134 - 2142. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. A. Babcock, T. Dekoj, and N. J. Espat Experimental Studies Defining {omega}-3 Fatty Acid Antiinflammatory Mechanisms and Abrogation of Tumor-Related Syndromes Nutr Clin Pract, February 1, 2005; 20(1): 62 - 74. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Rouzer, P. J. Kingsley, H. Wang, H. Zhang, J. D. Morrow, S. K. Dey, and L. J. Marnett Cyclooxygenase-1-dependent Prostaglandin Synthesis Modulates Tumor Necrosis Factor-{alpha} Secretion in Lipopolysaccharide-challenged Murine Resident Peritoneal Macrophages J. Biol. Chem., August 13, 2004; 279(33): 34256 - 34268. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. F Leitzmann, M. J Stampfer, D. S Michaud, K. Augustsson, G. C Colditz, W. C Willett, and E. L Giovannucci Dietary intake of n-3 and n-6 fatty acids and the risk of prostate cancer Am. J. Clinical Nutrition, July 1, 2004; 80(1): 204 - 216. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. H. Jho, S. M. Cole, E. M. Lee, and N. J. Espat Role of Omega-3 Fatty Acid Supplementation in Inflammation and Malignancy Integr Cancer Ther, June 1, 2004; 3(2): 98 - 111. [Abstract] [PDF] |
||||
![]() |
Z. Ma, J. Li, L. Yang, Y. Mu, W. Xie, B. Pitt, and S. Li Inhibition of LPS- and CpG DNA-induced TNF-{alpha} response by oxidized phospholipids Am J Physiol Lung Cell Mol Physiol, April 1, 2004; 286(4): L808 - L816. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Pischon, S. E. Hankinson, G. S. Hotamisligil, N. Rifai, W. C. Willett, and E. B. Rimm Habitual Dietary Intake of n-3 and n-6 Fatty Acids in Relation to Inflammatory Markers Among US Men and Women Circulation, July 15, 2003; 108(2): 155 - 160. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |