AJP - Lung Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 284: L260-L269, 2003. First published September 6, 2002; doi:10.1152/ajplung.00226.2002
1040-0605/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
284/2/L260    most recent
00226.2002v2
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (18)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vargaftig, B. B.
Right arrow Articles by Singer, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vargaftig, B. B.
Right arrow Articles by Singer, M.
Vol. 284, Issue 2, L260-L269, February 2003

Leukotrienes, IL-13, and chemokines cooperate to induce BHR and mucus in allergic mouse lungs

B. Boris Vargaftig and Monique Singer

Unité de Pharmacologie Cellulaire, Unité Associée Institut Pasteur-Institut National de la Santé et de la Recherche Médicale U485, Institut Pasteur, 75015 Paris, France


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

In mice, intratracheal challenges with antigen (ovalbumin) or recombinant murine interleukin-13 (IL-13) induce lung inflammation, bronchial hyperreactivity (BHR), and mucus accumulation as independent events (Singer M, Lefort J, and Vargaftig BB. Am J Respir Cell Mol Biol 26: 74-84, 2002), largely mediated by leukotrienes (LT). We previously showed that LTC4 was released 15 min after ovalbumin, and we show that it induces the expression of monocyte chemoattractant proteins 1 and 5 and KC in the lungs, as well as IL-13 mRNA. Instilled intratracheally, these chemokines induced BHR and mucus accumulation, which were inhibited by the 5-lipoxygenase inhibitor zileuton and by the cysteinyl-LT receptor antagonist MK-571, suggesting mediation by cysteinyl-LT. Because these chemokines also induced release of LT into the bronchoalveolar lavage fluid and IL-13 into the lungs, we hypothesize that LT- and chemokine-based loops for positive-feedback regulations cooperate to maintain and amplify BHR and lung mucus accumulation after allergic challenge and in situations where IL-13, LT, or chemokines are generated.

inflammation; asthma; MUC; leukotriene; cytokine/chemokine; bronchial hyperreactivity


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

DIFFERENT MEDIATORS, including cytokines (17, 34, 38, 39, 42), chemokines (2, 10; unpublished observations), leukotrienes (LT) (20, 21, 25; unpublished observations), and growth factors, can induce the asthma phenotype in mice, with bronchopulmonary hyperresponsiveness (BHR), inflammation, and mucus overproduction (16, 20, 21; unpublished observations), but the underlying mechanisms remain unclear (27). Murine models of lung allergy are widely used to unravel these mechanisms, and much attention has been devoted to the mediator role of interleukin-13 (IL-13), which, on administration into the airways, duplicates the characteristic features of asthma (12, 17, 18, 20, 21, 34, 38, 42; unpublished observations). We demonstrated that neither inflammation (34, 42) nor a T helper 1-T helper 2 imbalance (34) is required for BHR and mucus accumulation. Because the effects of recombinant murine (rm) IL-13 are inhibited by dexamethasone and, accordingly, may involve secondary mediators (34), we investigated the role of LT as potential mediators of the effects of ovalbumin and rmIL-13 on inflammation, BHR, mucus accumulation, and lung remodeling (20, 21; unpublished observations). Because some chemokines also exert intense proinflammatory effects reminiscent of asthma, we extended our investigations to chemokines that are expressed and involved in these models (2, 11, 22; unpublished observations). Monocyte chemoattractant protein (MCP)-1, MCP-5, and KC were selected because they were expressed after ovalbumin, rmIL-13, or LT challenges and, once instilled into the trachea, induced BHR and mucus accumulation more than did eotaxin, regulated upon activation, normal T cell expressed, and presumably secreted (RANTES), and macrophage inflammatory protein (MIP)-1alpha . Our results point out a major role for cysteinyl-LT (Cys-LT) in mediating the pulmonary effects of the relevant chemokines. Cys-LT, IL-13, and LT cooperate in inducing the asthma phenotype. In addition, because of suggestions that activation of the epidermal growth factor receptor (EGFR) (3, 31, 33, 35, 40) may trigger the final common pathway leading to BHR and mucus production, its expression was also studied. Our results indicate that the different mediators, which have been considered individually to account for the phenotype observed, interact positively, reinforcing their respective release. Those positive-feedback loops may explain why drugs that interfere specifically with single receptors or suppress selectively the production of a given mediator show some, but limited, therapeutic effectiveness and suggest that new therapeutic targets should downregulate the common pathway.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Animals, immunization, and materials. Male BP2 mice (Centre d'Elevage R. Janvier), aged 6-7 wk, were immunized (or not) subcutaneously twice at 1-wk intervals with 0.4 ml of 0.9% NaCl containing 1 µg of ovalbumin (Immunobiologicals, Lisle, IL) and 1.6 mg of aluminum hydroxide (Merck, Darmstadt, Germany). One week after the second immunization, i.e., on day 14, mice were anesthetized with xylazine and ketamine (20 and 45 mg/kg, respectively; Sigma, St. Louis, MO), and groups of five animals were instilled intratracheally with 10 µg of ovalbumin, 4 µg of rmIL-13 [kindly provided by Dr. A. Minty, Sanofi Elf Biorecherches, Labége, France; diluted in 50 µl of endotoxin-free 0.9% NaCl (saline)], chemokines (1 µg/day for 3 days), or 1 µg of LTC4 (Cayman Chemical, Ann Arbor, MI). rmMCP-1, rmMCP-5, and rmKC were purchased from Immugenex (Los Angeles, CA).

Groups of five mice were challenged and treated separately with different drugs. The specific 5-lipoxygenase (5-LO) inhibitor zileuton (Zyflo, Abbott, Chicago, IL) (6, 29, 34, 38; unpublished observations) was given orally 1 h before and 6 h after challenge, and then three times a day at 50 mg/kg for up to 72 h (for BHR and mucus accumulation). The receptor antagonist for Cys-LT, MK-571 (24) (Cayman Chemical), was instilled intratracheally at 660 or 2,200 µg (15 or 50 mg/kg, respectively) (38; unpublished observations), and LY-171883 (14) was instilled at 375 or 1,250 µg (15 or 50 mg/kg, respectively) (38; unpublished observations).

Evaluation of BHR. Basal resistance of the airways and BHR were assessed in unrestrained conscious animals by barometric plethysmography (Buxco Electronics, Troy, NY). Bronchial reactivity was evaluated using noncumulative methacholine challenges (18, 19, 34, 38). Briefly, mice were placed in a Buxco chamber, and respiratory parameters were measured after aerosol inhalation of 60 mM methacholine for 90 s. Resistance was calculated according to the manufacturer's recommendations as follows: enhanced pause = [(expiratory time/relaxation time) - 1] × (peak expiratory flow/peak inspiratory flow).

For the graphic representation, cumulative areas under the curve were used.

Bronchoalveolar lavage fluid. Mice were anesthetized with urethane (45 mg/30 g body wt, ip), and the trachea was cannulated. For collection of bronchoalveolar lavage fluid (BALF), samples were washed three times with 1 ml of saline containing 0.005 M EDTA and 0.005 M phenylmethylsulfonyl fluoride (both from Sigma). The total number of nucleated cells was determined automatically with a Coulter counter, and cytospins were prepared and colored with Diff Quick (Baxter Dade, Duedingen, Switzerland) for differential cell count.

Determination of Cys-LT and LTB4 in BALF by ELISA. Fresh cell-free BALF or nitrogen-frozen cell-free BALF kept for <72 h were used. In some samples, a known quantity of the specific LT (LTC4 or LTB4 used as internal standard) was added before freezing to verify the integrity of the samples over time. The quantification (pg/ml) was achieved by enzyme immunoassay according to the manufacturer's instructions (enzyme immunoassay kit for Cys-LT or LTB4; Cayman Chemicals) compared with a standard curve for LTB4 or Cys-LT.

Quantitative RT-PCR. Lungs were isolated and washed with saline via the pulmonary artery. Dispersion was performed with an Ultraturrax (model T25, Janke and Kunkel, IKA-Labortechnik) for 30 s in RTL buffer (RNeasy Mini-kit, Qiagen, Hilden, Germany) for RNA extraction.

Intron-differential RT-PCR was performed for lungs using specific primers: 5' TGCTACTCATTCACCAGCAAG and 3' GCATTAGCTTCAGATTTACGG (nt 191-468) for MCP-1, 5' TAAGCAGAAGATTCACGTCCGGAA and 3' AGGATGAAGGTTTGAGACGTCTTA for MCP-5, 5' CAGCCACCCGCTC- GCTTCTC and 3' TCAAGGCAAGCCTCGCGACCAT (nt 91-315) for KC, 5' CCAGTCCCGGCCGGGGGTA and 3' CCTCCTCATAGGGGCTACGCTT (nt 1610-1815) for MUC1, 5' CGACACCAGGGCTTTCGCTTAAT and 3' CACTTCCACCCTCCCGGCAAAC (nt 510-967) for MUC2, 5' TCTGTAAGGAAGCCACGCTAAC and 3' AAAGGGCAGGTCTTCGGTATA (nt 1643-2058) for MUC5AC, 5' CTGGAAACCG- AAATTTGTGCTACG and 3' GGCGTAGTGTACGCTTTCGAAC for EGFR, and 5' ACTCCTATGTGGGTGACGAGG and 3' GGGAGAGCATAGCCCTCGTAGAT for beta -actin as a control.

The cDNAs were synthesized, and PCR was performed as described elsewhere (8, 34), with annealing at 63°C. Standards were prepared as described previously (8) when cloned plasmids were available, or the specific PCR product was checked on an agarose gel and purified as described elsewhere (8, 38). The copy number was calculated according to the optical density; then the purified DNA was serially diluted to obtain the appropriate standard containing 0-106 copies. The copy number of the sample was calculated relative to the standard after PCR amplification on the LightCycler System (Roche Molecular Biochemicals, Mannheim, Germany) for the chemokine and for beta -actin independently on the same cDNA preparation. The results are given as a ratio of chemokine to beta -actin copies.

Histology. The lungs were flushed to remove blood; then they were inflated with optimum cutting temperature medium (Sakura Finetck, Torrance, CA) that was diluted 1:2 in saline. For paraffin inclusion, the lungs were immersed in 10% formaldehyde in PBS overnight at 4°C and processed to paraffin wax. Sections (5 µm) were stained with periodic acid-Schiff (PAS) or hematoxylin for mucins. To assess the frequency of staining, the ratio of stained cells to total cells was evaluated by counting the epithelial cells under the microscope with a grid as described elsewhere (34), and results are given as percentages.

Statistical analysis. Values are means ± SD (n = 5). Significance levels were calculated using one-way ANOVA followed by Scheffé's test, using the SPSS 6.1 software, with a threshold of P < 0.05 for statistical significance (n = 5).


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

We recently demonstrated that LT mediate BHR and mucus overproduction in the mouse airways after provocations with ovalbumin or rmIL-13 (unpublished observations). To investigate the interactions between chemokines and LT for inducing those changes, we first studied mRNA expression for MCP-1, MCP-5, and KC, which are chemokines involved in allergy. Because Cys-LT are the first LT released, as early as 10 min after challenge (38), we also evaluated chemokine synthesis and IL-13 expression after the intratracheal instillation of LTC4. In addition, because these chemokines were expressed after challenge with ovalbumin, rmIL-13, or LTC4, they were instilled directly into the airways, and the release of LT, as well as their effects on BHR and mucus production, was studied. Then, to understand the mediator role of LT after chemokine challenge, the 5-LO inhibitor zileuton and the Cys-LT receptor antagonist MK-571 were used against BHR, MUC genes, and mucus induction. Finally, because EGFR may be involved in the signaling pathway for BHR and mucus, its expression was studied.

Ovalbumin or rmIL-13 challenges induce chemokine mRNA expression. After ovalbumin instillation, a time-dependent progressive induction of mRNAs for MCP-1 (Fig. 1A) was observed. Expression of MCP-5 was high after 15 min (Fig. 1B), remained elevated for 3-6 h, and then decreased. Expression of KC mRNA was high after 15 min, decreased, and increased again progressively from 3 to 48 h (Fig. 1C).


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 1.   Time-dependent expression of mRNAs for the chemokines monocyte chemoattractant protein (MCP)-1, MCP-5, and KC after intratracheal instillation of ovalbumin (O; A-C) or recombinant murine (rm) interleukin-13 (rmIL-13; L13; D-F) into lungs of BP2 mice. Values are means ± SD (n = 5).* Significant difference between ovalbumin/rmIL-13 and saline (S), P < 0.05.

After instillation of rmIL-13, expression of chemokines was constant at all time points (Fig. 1, D-F), but a slight reduction was observed at 1-3 h for MCP-1 and KC (Fig. 1, D and F).

LTC4 challenge induces expression of mRNA for MCP-1, MCP-5, KC, and IL-13. Intratracheal instillation of LTC4 also induced the expression of mRNA for chemokines, with an early peak at 15 min for MCP-1 and MCP-5 and a late peak at 72 h (Fig. 2, A and B), or a more progressive increase of KC (Fig. 2C). LTC4 induced IL-13 mRNA at all time points (Fig. 2D).


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 2.   Time-dependent expression of mRNAs for MCP-1 (A), MCP-5 (B), KC (C), and IL-13 (D) after intratracheal instillation of leukotriene (LT) C4 (C4) into lungs of BP2 mice. Values are means ± SD (n = 5). * Significant difference between saline (S) and LTC4, P < 0.05.

Chemokines induce LT release into the BALF. Release of Cys-LT into the BALF after challenge with MCP-1, MCP-5, or KC peaked at 1 h and then decreased progressively until a plateau was reached after 48 h (Fig. 3B). LTB4 release was more constant and elevated at all time points (Fig. 3A) after the challenges.


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 3.   Time-dependent expression of cysteinyl-LT (LTC4, LTD4, and LTE4) and LTB4 after intratracheal instillation of rmMCP-1, rmMCP-5, or rmKC. Sal, saline. Values are means ± SD (n = 5). * Statistically significant difference, P < 0.05.

To study the role of LT after challenge with the chemokines, we inhibited their synthesis with zileuton or antagonized their receptor with the Cys-LT receptor antagonist MK-571 (38; unpublished observations). Oral administration of zileuton at 50 mg/kg three times a day (38; unpublished observations) inhibited Cys-LT and LTB4 release after intratracheal challenge with MCP-1, MCP-5, and KC (Fig. 4).


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 4.   5-Lipoxygenase inhibitor zileuton (Z, 50 mg/kg, 3 times a day for 3 days) interferes with LT release [Cys-LT (A) or LTB4 (B)] in bronchoalveolar lavage fluid of BP2 mice 72 h after intratracheal challenge with 1 µg of rmMCP-1, rmMCP-5, and rmKC. Values are means ± SD (n = 5). * Statistically significant difference, P < 0.05.

LT mediate chemokine-induced BHR. At 72 h after intratracheal challenge with 1 µg of MCP-1, MCP-5, or KC, an intense BHR to methacholine was induced. Zileuton drastically abolished BHR by MCP-1 or KC and reduced it after MCP-5 (Fig. 5A). MK-571 also abolished BHR, indicating that Cys-LT are largely involved in BHR induced by the chemokines, but to a lesser extent in the case of MCP-5 (Fig. 5B).


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 5.   Zileuton (Zil, A) and MK-571 (B) interfere with bronchopulmonary hyperreactivity (BHR) induced 72 h after intratracheal instillation of rmMCP-1, rmMCP-5, and rmKC (1 µg/day for 3 days). Values [areas under the curve (AUC)] are means ± SD (n = 5). * Statistically significant difference, P < 0.05.

Chemokines induce expression of MUC gene mRNAs. Expression of the MUC1 gene was stable after the different challenges, confirming that it is constitutive (Fig. 6A). MUC2 mRNAs were induced from 24 to 72 h after rmIL-13, and the chemokines MCP-1, MCP-5, and KC were poorly induced after ovalbumin (Fig. 6B at 24 h). MUC5AC mRNAs were intensely induced in all cases (Fig. 6C at 24 h).


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 6.   Expression of mRNAs for MUC1 (A), MUC2 (B), and MUC5AC (C) 24 h after intratracheal challenge with rmMCP-1, rmMCP-5, and rmKC (1 µg/day for 3 days) in lungs of BP2 mice. Time-dependent expression of epidermal growth factor receptor (EGFR) after intratracheal challenge with 10 µg of ovalbumin (OVA, D), 4 µg of rmIL-13 (E), or 1 µg of LTC4 (F). Values are means ± SD (n = 5). * Statistically significant difference, P < 0.05.

EGFR expression is increased after ovalbumin, rmIL-13, or LTC4 challenges. EGFR, which is implicated in MUC gene induction (33, 35), was time dependently increased after challenge with ovalbumin (Fig. 6D) or rmIL-13 (Fig. 6E), with an early peak at 15 min and a later peak at 6-72 h. LTC4 induced a marked expression of EGFR from 6 to 72 h (Fig. 6F).

LT mediate chemokine-induced mucous cell metaplasia in the airway epithelium. At 72 h after intratracheal instillation of 1 µg of MCP-1, MCP-5, or KC, a strong mucous cell metaplasia of airway epithelial cells was observed. Elevated ratios of PAS-positive cells to total cells of the epithelium were obtained after challenges: 62 ± 4% with MCP-1, 51 ± 3% with MCP-5, and 66 ± 4% with KC compared with saline (0-1%; P < 0.05, n = 5). Other chemokines (MIP-1alpha , eotaxin, and RANTES) induced only traces of mucus (not shown).

The 5-LO inhibitor zileuton reduced mucus induced by the chemokines: the ratios of PAS-positive cells to total cells were 12 ± 3% for rmMCP-1, 23 ± 5% for rmMCP-5, and 15 ± 3% for rmKC. Instilled at 15 mg/kg (38), the Cys-LT receptor antagonist MK-571 reduced these values to 15 ± 3% for rmMCP-1, 20 ± 4% for rmMCP-5, and 19 ± 4% for rmKC. Complete inhibition was obtained at 50 mg/kg MK-571 (Fig. 7, C, F, and I) and LY-171883 (Fig. 7D for MCP-1 and Fig. 7G for KC). This demonstrates the involvement of LT, particularly Cys-LT, in the mucous cell metaplasia induced by rmMCP-1, rmMCP-5, or rmKC (Table 1).


View larger version (86K):
[in this window]
[in a new window]
 
Fig. 7.   Periodic acid-Schiff staining of lung sections 72 h after intratracheal instillation of saline (A), rmMCP-1 (B), rmMCP-5 (E), and rmKC (H) at 1 µg/day for 3 days and inhibition by the LTD4 receptor antagonist MK-571 (C, F, and I, respectively) at 50 mg/kg (400 µg/mouse) administered intratracheally 1 h before challenge, 6 h after challenge, and then once a day (5) or by LY-171883 (D and G) at the same dose.


                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Interference of zileuton or LTD4 receptor antagonist with chemokine-induced mucus production


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

We previously showed that LT are released in the BALF of mice after intratracheal instillation of ovalbumin or rmIL-13 and that they mediate some of the resulting effects (38; unpublished observations). Here we show that LT also largely mediate the stimulating effects of the chemokines MCP-1, MCP-5, and KC on BHR and mucus accumulation. LT induce these chemokines, as well as IL-13, in a positive-feedback regulation, which perpetuates and amplifies the phenomenon in vivo.

Accordingly, the initial release of Cys-LT 10 min after ovalbumin or rmIL-13 (38; unpublished observations) may constitute a first step for further cytokine and chemokine induction, as in the case of IL-13 generation after instillation of LTC4 (Fig. 2, A-D).

Chemokines cooperate with LT and IL-13 to induce BHR and mucus. The potential role of chemokines for mediating inflammation is largely documented (2, 10, 22, 38, 40; unpublished observations). Our concept is that C-C chemokines, such as MCP-1 and MCP-5 (5, 11, 23, 28), and C-X-C chemokines, such as KC (4), which are expressed after ovalbumin, rmIL-13, or LTC4 challenges in mice (Fig. 1), induce at least part of their effects, such as BHR and mucus production, via the Cys-LT, because their inhibition or antagonism abolished these effects.

LT are associated with or induce cytokines and chemokines in other models, for instance, in mast cells (30). They potentiate chemoattraction by eotaxin (25). In a mouse model of septic peritonitis, cross talk between MCP-1 and LT has been highlighted: MCP-1 stimulated the production of LTB4 from peritoneal macrophages. LTB4 attracts and activates protective neutrophils and macrophages to the site of challenge, thus extending survival (28). Neutralization of MCP-1 resulted in a significant decrease in LTB4 production. In this model, MCP-1 cooperates with LT to exert defensive effects, probably when an appropriate ratio of MCP-1 to LTB4 is maintained, or induces deleterious effects by enhancing inflammation via the accumulation of cells and mediators, as may occur in the allergic lung model. MCP-1 is expressed in the lungs at high levels after ovalbumin challenge, and its neutralization drastically diminishes BHR and inflammation (5, 16). Using MK-571, we have shown that MCP-1 induced Cys-LT release in the BALF and that Cys-LT mediate MCP-1-induced BHR. Subsequently, Cys-LT induced BHR (38). Thus, in situations where MCP-1 is generated, BHR may increase via LT.

IL-13 also induced MCP-1, and the latter induced IL-13 mRNA (Fig. 2), showing a loop of positive regulation when IL-13 is generated. After ovalbumin challenge, we have shown the early release of Cys-LT (38), which induced IL-13 and MCP-1, which release Cys-LT. These reiterative relationships are summarized in Fig. 8.


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 8.   Biological loops after ovalbumin challenge or LT, IL-13, or chemokine generation. Ovalbumin induced LT, IL-13, and then chemokines (and in reverse), and each of them induced BHR and mucus production.

MCP-5 differed from the other C-C chemokines, in that it is expressed earlier, i.e., 3-6 h after ovalbumin. In mice, MCP-5 protein is mainly expressed in alveolar macrophages and smooth muscle cells (SMC) and weakly expressed in leukocytes within the large perivascular and peribronchiolar infiltrates (23). It is expressed at the site of inflammation in macrophages where LT is produced (23) and in the SMC that are responsible for BHR, supporting the involvement of LT in MCP-5-induced BHR and mucus accumulation. MCP-5 promotes IL-13 mRNA and is also induced after IL-13. It is possibly implicated in the effects of IL-13, suggesting another positive loop of regulation. MCP-5 also induced LT release and, therefore, joins the loop described in Fig. 8.

KC (4) is the murine counterpart of human growth-related protein (GRO)-alpha (IL-8 family, KC/GRO 65% sequence identity, receptor CXCR1). In addition to its recognized implication in inflammation, we demonstrate here that KC induces a strong BHR and mucus accumulation in the airways, also mediated by LT, because BHR and mucus production were inhibited by zileuton and MK-571. KC was also induced after rmIL-13 and after ovalbumin and probably mediates a part of their effect. Moreover, KC induced LT release into the BALF and IL-13 mRNA into the lungs. Because IL-13 induced KC, it joins the loop described in Fig. 8 for MCP-1 and MCP-5.

Coordinated action of the different mediators perpetuates and amplifies the asthma-like phenotype in mice. Biological loops, leading to increased basal levels of the relevant mediators, seem to emerge from this analysis (16, 22, 28, 34, 38). Their coordinated effects should lead to signal transduction for BHR via LT (2, 16, 22, 25, 28, 38) and mucus accumulation, in addition to inflammation. Even single molecules (MCP-1, MCP-5, KC, and IL-13 in vivo) were able to induce an effect. Indeed, high levels of the relevant mediators, expressed at the same time, are observed in mouse models (16, 21, 28) as well as in asthmatic patients (22).

Other biological loops have been suggested in which chemokines induce their further production via G protein-coupled receptors as an autocrine regulatory mechanism that enhances the effects of chemokines (40).

Regulatory molecules such as interferon-gamma , which downregulates mucin expression (7), may also interfere with IL-13 (15). However, this downregulation may fail under some conditions, because interferon-gamma can induce MCP-1 (36, 41), which promotes BHR and mucus production, as well as Cys-LT1 receptor expression and BHR (2). This may explain why BHR and mucus accumulation have a propensity to amplify without efficient downregulation.

Which pathway links LT, IL-13, and chemokines? Different receptors are involved in the effects of the mediators we studied (CCR2-CCR4 for MCP-1, MCP-5-CXCR1/2 for KC, and IL-4Ralpha for IL-13). The common feature is that C-C chemokines (MCP-1 and MCP-5), the GROalpha -KC, and chemoattractants including LT (LTB4) bind to and transactivate the G protein-coupled receptors, such as EGFR (33, 40), which mediate activation of nuclear factor-kappa B and, thus, induce MUC gene expression.

Studies on vascular SMC (10) suggested that EGFR may be important in the regulation of SMC (contractile) function via heparin-binding epidermal growth factor, which is also implicated in EGFR transactivation and mucin induction (3, 33). SMC from the airways, where BHR is ultimately expressed, may be regulated by a similar EGFR pathway (3, 32, 35). Indeed, using the EGFR tyrosine kinase inhibitor AG-1478 (3), we inhibited BHR after challenge with MCP-1 and rmIL-13 (not shown). Accordingly, under conditions to be defined, activation of SMC and epithelial cells occurs concurrently, allowing for BHR and mucus production, or as an independent event, as we suggested previously (34).

The complexity of the interactions and pathways, as well as the genetic features (10, 13, 26), may explain why drugs directed against LT alone are insufficient to suppress BHR, inflammation, and mucus production and why glucocorticosteroids, which act on numerous genes via transcription factors, are the only class of molecules that downregulate the different mediators, showing redundant effects against BHR and mucus induction.

In conclusion, a large number of molecules are generated after allergic provocation, including LT, cytokines, and chemokines. We show here that Cys-LT, IL-13, and MCP-5, MCP-1, and KC are able, each on their own, to induce BHR and mucus production. These mediators are produced at the same time during the allergic reaction and may cooperate to amplify the responses. Moreover, Cys-LT, IL-13, and the chemokines each have the property to induce the others, thus generating loops of amplification and, consequently, an enhanced BHR and mucus accumulation, in addition to inflammation. This may explain why anti-LT strategies are useful, but often not sufficient, to control the phenomenon. It allows us to suggest a scenario for airway allergy modeled by ovalbumin or rmIL-13 challenges, where Cys-LT, which induce IL-13 (in addition to other arachidonic acid derivatives), and then chemokines are released, thus promoting BHR and mucus production and inducing higher levels of each molecule by a positive loop of regulation. This scenario may be extended to other disorders in which LT or IL-13 or the chemokines MCP-1, MCP-5, and KC are generated and may help identify new strategies for therapy.


    ACKNOWLEDGEMENTS

We thank Dr. M. Huerre, P. Ave, and N. Wusher (Unité d'Histopathologie, Institut Pasteur) for technical advice and Dr. L. Touqui for helpful discussions.


    FOOTNOTES

Address for reprint requests and other correspondence: M. Singer, Unité de Pharmacologie Cellulaire, Unité Associée Institut Pasteur-INSERM U485, Institut Pasteur, 25, rue du Dr Roux, 75015 Paris, France (E-mail: msinger{at}pasteur.fr).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

First published September 6, 2002;10.1152/ajplung.00226.2002

Received 15 July 2002; accepted in final form 24 July 2002.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Amrani, Y, Moore P, Hoffman R, Shore SA, and Panettieri JR. Interferon-gamma modulates cysteinyl leukotriene receptor-1 expression and function in human airway myocytes. Am J Respir Crit Care Med 164: 2098-2101, 2001[Abstract/Free Full Text].

2.   Basbaum, C, Lemjabbar H, Longphre M, Li D, Gensch E, and McNamara N. Control of mucin transcription by diverse injury-induced signalling pathways. Am J Respir Crit Care Med 160: S44-S48, 1999[Abstract/Free Full Text].

3.   Boot, BW, Adler KB, Bonner JC, Tournier F, and Martin L. Interleukin-13 induces proliferation of human airway epithelial cells in vitro via a mechanism mediated by transforming growth factor-alpha . Am J Respir Cell Mol Biol 25: 739-743, 2001[Abstract/Free Full Text].

4.   Bozic, C, Kolakowski LF, Gerard NP, Garcia-Rodriguez C, Von Uexkull-Guldenband C, Conklyn M, Breslow R, Showell HJ, and Gerard C. Expression and biologic characterization of the murine chemokine KC. J Immunol 154: 6048-6057, 1995[Abstract].

5.   Campbell, EM, Charo IF, Kunkel SL, Strieter RM, Boring L, Gosling J, and Lukacs NW. Monocyte chemoattractant protein-1 mediates cockroach allergen-induced bronchial hyperreactivity in normal but not CCR2-mice: the role of mast cells. J Immunol 163: 2160-2167, 1999[Abstract/Free Full Text].

6.   Carter, GW, Young PR, Albert DH, Bouska J, Dyer R, Bell RL, Summers JB, and Brooks DW. 5-Lipoxygenase inhibitory activity of zileuton. J Pharmacol Exp Ther 256: 929-937, 1991[Abstract/Free Full Text].

7.   Cohn, L, Homer RJ, Niu N, and Bottomly K. T helper 1 cells and IFN-gamma regulate allergic airway inflammation and mucus production. J Exp Med 190: 1309-1317, 1999[Abstract/Free Full Text].

8.   Colle, JH, Falanga P, Singer M, Hevin B, and Milon G. Quantification of messenger RNA by competitive RT-PCR: a simplified readout assay. J Immunol Methods 210: 175-184, 1997[Web of Science][Medline].

9.   Daser, A, Daheshia M, and De Sanctis GT. Genetics of allergen-induced asthma. J Allergy Clin Immunol 108: 167-174, 2001[Web of Science][Medline].

10.   Daum, KA, and Clowes AW. EGFR transactivation in the regulation of SMC function. Ann NY Acad Sci 947: 42-54, 2001[Web of Science][Medline].

11.   Dong Qu Louahed, J, Vink A, Sullivan CD, Messler CJ, Zhou Y, Haczku A, Huaux F, Arras M, Holroyd KJ, Renauld JC, Levitt RC, and Nicolaides NC. IL-9 induces chemokine expression in lung epithelial cells and baseline airway eosinophilia in transgenic mice. Eur J Immunol 29: 2130-2139, 1999[Web of Science][Medline].

12.   Eum, SY, Hailé S, Lefort J, Huerre M, and Vargaftig BB. Eosinophil recruitment into the respiratory epithelium following antigenic challenge in hyper-IgE mice is accompanied by interleukin 5-dependent bronchial hyperresponsiveness. Proc Natl Acad Sci USA 92: 12290-12294, 1995[Abstract/Free Full Text].

13.   Ewart, SL, Kuperman D, Schadt E, Tankersley C, Grupe A, Shubitowski DM, Peltz G, and Wills-Karp M. Quantitative trait loci controlling allergen-induced airway hyperresponsiveness in inbred mice. Am J Respir Cell Mol Biol 23: 537-545, 2000[Abstract/Free Full Text].

14.   Fleisch, JH, Rinkema LE, Haisch KD, Swanson-Bean D, Goodson T, Ho PPK, and Marshall WS. LY171883, 1-[2-hydroxy-3-propyl-4-(1H-tetrazol-5-yl) butoxy]phenyl]ethanone, an orally active leukotriene D4 antagonist. J Pharmacol Exp Ther 233: 148-157, 1984[Abstract/Free Full Text].

15.   Ford, JG, Rennick D, Donaldson DD, Venkayya R, McArthur C, Hansell E, Kurup VP, Warnock M, and Grünig G. IL-13 and IFN-gamma : interactions in lung inflammation. J Immunol 167: 1769-1777, 2001[Abstract/Free Full Text].

16.   Gonzalo, JA, Lloyd CM, Wen D, Albar JP, Wells TNC, Proudfoot A, Martinez-A C, Dorf M, Bjerke T, Coyle AJ, and Gutierrez-Ramos JC. The coordinated action of CC chemokines in the lung orchestrates allergic inflammation and airway hyperresponsiveness. J Exp Med 188: 157-167, 1998[Abstract/Free Full Text].

17.   Grünig, G, Warnock M, Wakil AE, Venkayya R, Brombacher F, Rennick DM, Sheppard D, Mohrs M, Donaldson DD, Locksley RM, and Corry DB. Requirement for IL-13 independently of IL-4 in experimental asthma. Science 282: 2261-2263, 1998[Abstract/Free Full Text].

18.   Hailé, S, Lefort J, Joseph D, Gounon P, Huerre M, and Vargaftig BB. Mucous cell metaplasia and inflammatory cell recruitment are dissociated in allergic mice after antibody- and drug-dependent cell depletion in a murine model of asthma. Am J Respir Cell Mol Biol 20: 1-12, 1999[Abstract/Free Full Text].

19.   Hammelmann, E, Takeda K, Haczku A, Cieslewicz G, Schultz L, Hamid Q, Xing Z, Gauldie J, and Gelfand EW. Interleukin-5 but not immunoglobulin E reconstitutes airway inflammation and airway hyperresponsiveness in IL-4-deficient mice. Am J Respir Cell Mol Biol 23: 327-334, 2000[Abstract/Free Full Text].

20.   Henderson, WR, Lewis DB, Albert RK, Zhang Y, Lamm WJE, Chiang GKS, Jones F, Eriksen P, Tien Y, Jonas M, and Chi E. The importance of leukotrienes in airway inflammation in a mouse model of asthma. J Exp Med 184: 1483-1494, 1996[Abstract/Free Full Text].

21.   Henderson, WR, Tang L, Chu SJ, Tsao H, Chiang GKS, Jones F, Jonas E, Pae C, Wang H, and Chi MY. Role of cysteinyl-leukotrienes in airway remodeling in a mouse asthma model. Am J Crit Care 165: 108-116, 2002.

22.   Holgate, ST, Bodey KS, Janezic A, Frew AJ, Kaplan AP, and Teran LM. Release of RANTES, MIP-1alpha and MCP-1 into asthmatic airways following endobronchial allergen challenge. Am J Respir Crit Care Med 156: 1377-1383, 1997[Abstract/Free Full Text].

23.   Jia, GQ, Gonzalo JA, Lloyd C, Kremer L, Lu L, Martinez-A C, Wershil BK, and Gutierrez-Ramos JC. Distinct expression and function of the novel mouse chemokine monocyte chemotactic protein-5 in lung allergic inflammation. J Exp Med 184: 1939-1951, 1996[Abstract/Free Full Text].

24.   Jones, TR, Zamboni R, Belley M, Champion E, Charette L, Ford-Hutchinson AW, Frenette R, Gauthier JY, Leger S, and Masson P. Pharmacology of L-600711 (MK-571): a novel potent and selective leukotriene D4 receptor antagonist. Can J Physiol Pharmacol 67: 17-28, 1989[Web of Science][Medline].

25.   Klein, A, Talvani A, Silva PMR, Martins MA, Wells TNC, Proudfoot A, Luckacs NW, and Teixeira MM. Stem cell factor-induced leukotriene B4 production cooperates with eotaxin to mediate the recruitment of eosinophils during allergic pleuresy in mice. J Immunol 167: 524-531, 2001[Abstract/Free Full Text].

26.   Lam, BK. Biochemical and molecular characterization of LTC4 synthase. ACI Int 9: 83-87, 1997.

27.   Lee, JH, Kaminski N, Dolganov G, Grunig G, Koth L, Solomon C, Erle DJ, and Sheppard D. Interleukin-13 induces dramatically different transcriptional programs in three human airway cell types. Am J Respir Cell Mol Biol 25: 474-485, 2001[Abstract/Free Full Text].

28.   Matsukawa, A, Hogaboam CM, Lukacs NW, Lincoln PM, Strieter RM, and Kunkel SL. Endogenous monocyte chemoattractant protein-1 (MCP-1) protects mice in a model of acute septic peritonitis: cross-talk between MCP-1 and leukotriene B4. J Immunol 163: 6148-6154, 1999[Abstract/Free Full Text].

29.   McGill, KA, and Busse WW. Zileuton. Lancet 348: 519-524, 1996[Web of Science][Medline].

30.   Mellor, E, Austen KF, and Boyce JA. Cysteinyl leukotrienes and uridine diphosphate induce cytokine generation by human mast cells through an interleukin 4-regulated pathway that is inhibited by leukotriene receptor antagonists. J Exp Med 195: 583-592, 2002[Abstract/Free Full Text].

31.   Puddicombe, SM, Polosa R, Richter A, Krishna MT, Howarth PH, Holgate ST, and Davies DE. Involvement of the epidermal growth factor receptor in epithelial repair in asthma. FASEB J 14: 1362-1374, 2000[Abstract/Free Full Text].

32.   Sadee, W, Hoeg E, Lucas J, and Wang D. Genetic variations in human G protein-coupled receptors: implications for drug therapy. AAPS PharmSci 3: E22, 2001[Medline].

33.   Shim, JJ, Dabbagh K, Ueki IF, Dao-Pick T, Burgel PR, Takeyama K, Cheng-Wei Tam D, and Nadel J. IL-13 induces mucin production by stimulating epidermal growth factor receptors and by activating neutrophils. Am J Physiol Lung Cell Mol Physiol 280: L134-L140, 2001[Abstract/Free Full Text].

34.   Singer, M, Lefort J, and Vargaftig BB. Granulocyte depletion and dexamethasone differentially modulate airways hyperreactivity, inflammation, mucus accumulation and secretion induced by rmIL-13 or antigen. Am J Respir Cell Mol Biol 26: 74-84, 2002[Abstract/Free Full Text].

35.   Takeyama, K, Dabbagh K, Lee HM, Agusti C, Lausier JA, Ueki IF, Grattan KM, and Nadel JA. Epidermal growth factor system regulates mucin production in airways. Proc Natl Acad Sci USA 96: 3081-3086, 1999[Abstract/Free Full Text].

36.   Van der Velden, VHG, Verheggen MM, Bernasconi S, Sozzani S, Naber BAE, Van der Linden-van Beurden C, Hoogsteden HC, Mantovani A, and Versnel M. Interleukin-1beta and interferon-gamma differentially regulate release of monocyte chemotactic protein-1 and interleukin-8 by human bronchial epithelial cells. Eur Cytokine Netw 9: 269-278, 1998[Web of Science][Medline].

38.  Vargaftig BB and Singer M. Leukotrienes mediate murine bronchopulmonary hyperreactvity, inflammation, and part of mucosal metaplasia and tissue injury induced by rmIL-13. Am J Respir Cell Mol Biol. In press.

39.   Wills-Karp, M, Luyimbazi J, Xu X, Schofield B, Neben TY, Karp CL, and Donaldson DD. Interleukin-13: central mediator of allergic asthma. Science 282: 2258-2261, 1998[Abstract/Free Full Text].

40.   Ye, RD. Regulation of nuclear factor-kappa B activation by G protein-coupled receptors. J Leukoc Biol 70: 839-848, 2001[Abstract/Free Full Text].

41.   Zhou, ZH, Chaturvedi P, Han YL, Aras S, Li YS, Kolattukudy PE, Ping D, Boss JM, and Ransohoff RM. IFN-gamma induction of the human monocyte chemoattractant protein (hMCP)-1 gene in astrocytoma cells: functional interaction between an IFN-gamma -activated site and a GC-rich element. J Immunol 160: 3908-3916, 1998[Abstract/Free Full Text].

42.   Zuany-Amorim, C, Ruffié C, Hailé S, Vargaftig BB, Pereira P, and Pretolani M. Requirement of gamma delta T cells in allergic airway inflammation. Science 280: 1265-1267, 1998[Abstract/Free Full Text].


Am J Physiol Lung Cell Mol Physiol 284(2):L260-L269
1040-0605/03 $5.00 Copyright © 2003 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
B. Moynihan, B. Tolloczko, M.-C. Michoud, M. Tamaoka, P. Ferraro, and J. G. Martin
MAP kinases mediate interleukin-13 effects on calcium signaling in human airway smooth muscle cells
Am J Physiol Lung Cell Mol Physiol, July 1, 2008; 295(1): L171 - L177.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
K. Inoue, H. Takano, K. Hiyoshi, T. Ichinose, K. Sadakane, R. Yanagisawa, S. Tomura, and Y. Kumagai
Naphthoquinone enhances antigen-related airway inflammation in mice
Eur. Respir. J., February 1, 2007; 29(2): 259 - 267.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
S. S. Wagers, H. C. Haverkamp, J. H. T. Bates, R. J. Norton, J. A. Thompson-Figueroa, M. J. Sullivan, and C. G. Irvin
Intrinsic and antigen-induced airway hyperresponsiveness are the result of diverse physiological mechanisms
J Appl Physiol, January 1, 2007; 102(1): 221 - 230.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
P. Thai, Y. Chen, G. Dolganov, and R. Wu
Differential Regulation of MUC5AC/Muc5ac and hCLCA-1/mGob-5 Expression in Airway Epithelium
Am. J. Respir. Cell Mol. Biol., December 1, 2005; 33(6): 523 - 530.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
J. Noguchi, E. Kuroda, and U. Yamashita
Strain difference of murine bone marrow-derived mast cell functions
J. Leukoc. Biol., September 1, 2005; 78(3): 605 - 611.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
G. Yang, L. Li, A. Volk, E. Emmell, T. Petley, J. Giles-Komar, P. Rafferty, M. Lakshminarayanan, D. E. Griswold, P. J. Bugelski, et al.
Therapeutic Dosing with Anti-Interleukin-13 Monoclonal Antibody Inhibits Asthma Progression in Mice
J. Pharmacol. Exp. Ther., April 1, 2005; 313(1): 8 - 15.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
B. B. Vargaftig and M. Singer
Leukotrienes mediate part of Ova-induced lung effects in mice via EGFR
Am J Physiol Lung Cell Mol Physiol, October 1, 2003; 285(4): L808 - L818.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
B. B. Vargaftig and M. Singer
Leukotrienes Mediate Murine Bronchopulmonary Hyperreactivity, Inflammation, and Part of Mucosal Metaplasia and Tissue Injury Induced by Recombinant Murine Interleukin-13
Am. J. Respir. Cell Mol. Biol., April 1, 2003; 28(4): 410 - 419.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
284/2/L260    most recent
00226.2002v2
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (18)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vargaftig, B. B.
Right arrow Articles by Singer, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vargaftig, B. B.
Right arrow Articles by Singer, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online