AJP - Lung Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 284: L533-L540, 2003. First published November 22, 2002; doi:10.1152/ajplung.00277.2002
1040-0605/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
284/3/L533    most recent
00277.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (30)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gilmour, P. S.
Right arrow Articles by MacNee, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gilmour, P. S.
Right arrow Articles by MacNee, W.
Vol. 284, Issue 3, L533-L540, March 2003

Histone acetylation regulates epithelial IL-8 release mediated by oxidative stress from environmental particles

Peter S. Gilmour1, Irfan Rahman1, Kenneth Donaldson1,2, and William MacNee1

1 Edinburgh Lung and the Environment Group Initiative/Colt Laboratory, The University of Edinburgh, Department of Medicine and Radiological Sciences, Medical School, Edinburgh EH8 9AG; and 2 The School of Life Sciences, Napier University, Edinburgh EH10 5DT, United Kingdom


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Increases in the levels of environmental particulate matter with a diameter of <10 µm diameter (PM10) in the air are associated with a variety of adverse health effects, particularly chronic lung and cardiovascular diseases. The expression of many inflammatory genes involves the remodeling of the chromatin structure provided by histone proteins. Histone acetylation causes the unwinding of chromatin structure, therefore allowing transcription factor access to promoter sites. Acetylation is reversible and is regulated by histone acetyltransferases (HATs), which promote acetylation, and deacetylases, which promote deacetylation. PM10 and H2O2 increased IL-8 protein release from A549 cells after 24-h treatment, and this was enhanced by histone deacetylase inhibition by trichostatin A (cotreatment). PM10 and H2O2 treatment also increased HAT activity as well as the level of acetylated histone 4 (H4). PM10 enhanced H4 acetylation that was mediated by oxidative stress as shown by thiol antioxidant inhibition. Acetylation of H4 mediated by PM10 was associated with the promoter region of the IL-8 gene. These data suggest that remodeling of chromatin by histone acetylation plays a role in PM10-mediated responses in the lungs.

interleukin-8; histone acetylation; particulate matter with diameter of <10 µm; transcription


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

INCREASED CONCENTRATIONS of environmental particles [particulate matter with <10 µm diameter (PM10)] are associated with a variety of adverse health effects including increased hospital admissions for exacerbations of asthma and chronic obstructive pulmonary disease (16, 24); however, the mechanisms are not well understood.

PM10 particles have been shown to produce free radicals and are likely to exert an oxidative stress on lung cells (6). Oxidative stress induces the activation and translocation, to the nucleus, of transcription factors such as nuclear factor-kappa B (NF-kappa B) and activator protein-1 (AP-1) (12, 14, 22). We have previously shown that PM10 can activate these transcription factors in macrophages and lung type II alveolar epithelial cells (6, 13). PM10 treatment has also been shown to enhance interleukin (IL)-8 gene expression and protein release from lung alveolar epithelial cells and macrophages in vitro by a mechanism involving oxidative stress and transcription factor activation (6, 13).

The transcription of many genes is known to correlate with levels of acetylated nuclear histone proteins (7). The acetylation of core histones is critical in the remodeling of chromatin and therefore gene expression (35) and is thought to be a necessary event for transcription to occur (20). There are four core histone proteins that comprise the central chromatin core (H2A, H2B, H3, and H4) around which DNA is tightly coiled (20). Acetylation of the histone core of the chromatin promotes unwinding of DNA, allowing access of transcription factors and coactivators to target gene promoter sites, thus initiating transcription (20). Conversely, the deacetylation of the histone core enhances DNA winding, so decreasing the access of transcription factors to the target sites on DNA and therefore inhibiting gene transcription (20). Histone acetylation is mediated by compounds with histone acetyltransferase (HAT) activity and a family of histone deacetylase (HDAC) enzymes that inhibit acetylation (15). There are many nucleus-associated proteins that possess intrinsic HAT activity, including transcription factors and coactivators and several HDAC enzymes (15).

Proinflammatory gene transcription regulation is a multifaceted process that requires a combination of nuclear factors and coactivators for maximal gene transcription to occur. For example, the tumor necrosis factor-alpha (TNF-alpha )-induced activation of a cytokine IL-6 transcription is reliant on the activation of NF-kappa B (33). The recruitment of coactivators such as cAMP response element-binding protein-binding protein (CBP) and p300 by transcription factors AP-1 and NF-kappa B is important in linking promoter activation to transcriptional machinery (33). Moreover, the coactivator proteins involved in NF-kappa B transcription factor complexes are associated with chromatin remodeling. These facilitate gene transcription via the inhibition of HDAC enzymes (9). Activation of specific gene expression by coactivator proteins associated with transcription factors may be aided by specific coactivator binding sites to different transcription factors that affect the HAT activity of the coactivators (23). Therefore, the signal transduction pathways that activate transcription factors, pathways that are activated by PM10, oxidative stress, and proinflammatory cytokines (6, 25, 31), may be responsible for stimulus-specific chromatin remodeling, leading to gene transcription, via coactivator HAT activity. The role of chromatin remodeling in the regulation of IL-8 by environmental stimuli is as yet unknown.

Oxidative stress mediated by cigarette smoke-induced oxidative stress has been associated with changes in HDAC1 and -2 in lung phagocytic cells (11). Histone acetylation induced by the butyrate inhibition of HDAC enzymes is associated with an increase in gene expression of inflammatory cytokines (3). Therefore, we hypothesize that the proximal proinflammatory effects of PM10 are mediated by oxidative stress. This causes alterations in the histone acetylation/deacetylation balance that facilitate enhanced gene transcription for proinflammatory mediators. We therefore studied the effects of PM10 and the oxidant hydrogen peroxide (H2O2) on histone acetylation and gene transcription in alveolar epithelial (A549) cells.


    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Reagents. All chemicals and reagents used in this study were obtained from Sigma Chemical (Poole, UK). Cell culture media and reagents were obtained from GIBCO-BRL (Paisley, UK). Human recombinant TNF-alpha (R&D Systems, Abingdon, UK) was stored at -70°C at a concentration of 10 µg/ml in sterile distilled water and was diluted in culture media to 10 ng/ml for cell treatment. H2O2 was prepared in a stock solution of 2 mM in PBS, and treatments were carried out at a concentration of 200 µM. Trichostatin A (TSA) was prepared as a 0.1 mg/ml solution in PBS and used at a concentration of 100 ng/ml. The thiol antioxidant N-acetyl-L-cysteine (NAC) and mannitol were stored at -20°C in PBS at a concentration of 0.5 M and used at 5 mM final concentration. NAC was added as a pretreatment to cells 6 h before the addition of PM10.

Cell culture. Human lung type II alveolar-like epithelial cells (A549) were cultured in Dulbecco's modified Eagle's medium supplemented with 10% heat-inactivated fetal calf serum, L-glutamine (2 mM), and penicillin-streptomycin solution in 5% CO2 at 37°C as previously described (6). All experiments were carried out with A549 cells between passages 90 and 110.

Cell treatments. For cell treatments, cells were plated at a density of 0.15 × 106 cells/well in 24-well plates and grown overnight to 80% confluency. The medium was removed from the cultures and was replaced with serum-free medium for a further 24-h incubation. Treatments were also added for specific times in serum-free medium.

Carbon black (Huber 990), which was used in the determination of PM10 concentration, was purchased from H. Haeffner and had a primary particle diameter of 260 nm.

Particulate matter of which 50% was PM10 was obtained, quantified, and used as previously described (6). Briefly, PM10 particles were collected on filters of the tapered element oscillating microbalance in the Marylebone and Bloomsbury London monitoring sites of the United Kingdom enhanced urban network. To remove PM10 into solution, filters were cut in half and each half was sonicated into 1 ml of PBS for 1 min and vortexed. Used filters were removed from the particle suspension. Particle concentration was determined by spectrophotometric comparison with a standard curve of serial dilutions of carbon black of turbidity at 340 nm. As well as allowing us to estimate the dose of PM10, the use of carbon black as a standard curve allowed the dose to be standardized relative to a toxicologically important component of PM10. For all PM10 treatments, cells were exposed to 100 µg/ml PM10 in culture medium unless stated. Cells were treated with 100 ng/ml TSA, 100 µg/ml PM10, 200 µM H2O2, 5 mM NAC, or 5 mM mannitol for 24 h.

Histone protein extraction. Nuclei were extracted as previously described (6). Briefly, following treatment, cells were washed twice with PBS, removed from the culture plate by incubation for 5 min with trypsin-EDTA solution, and harvested by centrifugation at 1,000 g for 5 min at 4°C. The cells were resuspended in 400 µl of buffer containing 10 mM HEPES, 10 mM KCl, 2 mM MgCl2, 1 mM DTT, 0.1 mM EDTA, 0.2 mM Na-orthovanadate, 0.2 mM NaF, 0.4 mM phenylmethylsulfonyl fluoride (PMSF), 0.3 µg/ml leupeptin, and 1 µg/ml aprotinin and incubated on ice for 15 min. Cell lysis was performed by the addition of 25 µl of 10% Nonidet P-40, and the mixture was vortexed for 20 s. After centrifugation for 5 min at 13,000 rpm, the resulting pellet containing nuclei was retained. Acid-soluble histones were purified, and acetone was precipitated by the method modified from Ito et al. (9). The nuclei were resuspended in 150 µl of H2O containing 6 µl of concentrated HCl and 3 µl of concentrated H2SO4 and were incubated for at least 6 h on ice to solublize the histone proteins. The mixture was centrifuged for 10 min at 13,000 rpm, and the histone-rich supernatant was retained. Proteins were removed from the acid solution by being twice precipitated with acetone for 24 h at -20°C and finally resuspended in 50 µl of H2O. The protein concentration was determined by the Bio-Rad protein determination kit (Bio-Rad, Hemmel Hempstead, UK).

HAT activity. Cells were incubated with 0.05 mCi [3H]acetic acid (Amersham Pharmacia Biotech, Bucks, UK) for 10 min followed by coincubation with test agents for 2 h. The [3H]acetic acid is the substrate for the acetylation reaction and becomes incorporated into acetylated histones. Acid-soluble proteins were separated by SDS-PAGE (20 µg) and stained with Coomassie brilliant blue; the H4 protein was identified by comparison with a standard H4 peptide. The H4 bands were removed from the gel, and the HAT activity (acetylation of H4) was determined by liquid scintillation counting of H4-incorporated [3H]acetic acid, producing an activity value of disintegrations per minute per microgram of histone protein.

Western blotting. Acid-extracted histones from treated cells were boiled in denaturing Laemmli buffer for 5 min, resolved in a 15% polyacrylamide gel, and transferred to a nitrocellulose membrane using a Bio-Rad electrophoretic transfer system at 400 mA for 90 min. Membranes were washed in water and blocked in 3% (wt/vol) Marvel in 1× PBS for 1 h. Membranes were washed 3× with 0.05% Tween 20 in PBS and were incubated with the primary antibody for either anti-acetyl lysine (Santa Cruz Biotechnology, Santa Cruz, CA) or antiacetylated H4 (Upstate Biotech/TCS Biologicals, Bucks, UK) overnight at 4°C. Washed membranes were then incubated in an appropriate detection secondary antibody for 60 min, washed again, and analyzed by enhanced chemiluminescence with an ECL detection kit (Amersham Pharmacia Biotech).

Immunocytochemistry of acetylated histone protein H4. Cells grown on coverslips after treatment were fixed in ice-cold methanol for 10 min before being blocked with 8% BSA. The cells were washed and incubated with goat polyclonal antiacetylated human H4 antibody as the primary antibody for 1 h at room temperature (Upstate Biotechnology/TCS Biologicals). The cells were incubated with goat anti-rabbit IgG Alexa red as a secondary antibody (Molecular Probes, Cambridge, UK) and finally stained with Hoechst dye. Images of cellular immunofluorescence were acquired using a high-resolution fluorescence microscope (Zeiss) with a digital camera (CoolSnap) attached to a G3 Apple MacIntosh computer, utilizing OpenLab software. Results were obtained as immunocytochemistry score in which at least 300 cells were counted, and the percentage of acetylated cells (Alexa red positive) to total cell number (Hoechst positive) was calculated.

RT-PCR. After treatment, RNA was isolated from PBS-washed and treated cells using the TRIzol reagent (GIBCO-BRL, Paisley, Scotland), according to the manufacturer's instructions, and dissolved in 50 µl of diethylpyrocarbonate (DEPC)-treated water. Moloney murine leukemia virus RT (Promega, Southampton, UK) was used to transcribe cDNA from 2 µg of mRNA according to the manufacturer's instructions. The genes tested were the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH), IL-8, and HDAC2 with the primer oligonucleotides purchased from MWG-Biotech (Milton Keynes, UK). The following primer pairs were used: GAPDH, sense CCACCCATGGCAAATTCCAT-GGCA and antisense TCTAGACGGCAGGTCAGGTCCACC; HDAC2, sense CCCTGAATTTGACAGTCTCACC and antisense CACAATAAAACTTG-CCCAGAAAAAC; IL-8, sense CGATGTCAGTGCATAAAGACA and antisense TGAATTCTCAGCCCTCTTCAAAAA. The primers were diluted to 100 pmol/µl with DEPC water. For each PCR reaction, 5 µl of reverse-transcribed RNA (cDNA) was added directly to a PCR reaction mixture set to a final volume of 50 µl, containing 1× Taq DNA polymerase reaction buffer (Promega), 2.5 mM MgCl2, 0.2 mM dNTP mixture, 1 unit Taq DNA polymerase (Promega), and 1 µM of the appropriate primer pair. The IL-8 PCR conditions were 27 thermal cycles of 94°C for 30 s, 60°C for 1 min, and 68°C for 2 min, followed by a final extension step of 68°C for 7 min, resulting in a product 180 base pairs in size. The conditions for GAPDH were 25 thermal cycles of 94°C for 45 s, 60°C for 45 s, and 72°C for 1 min 30 s, followed by a final extension step of 68°C for 7 min, resulting in a product 600 base pairs in size. The conditions for HDAC2 were 35 thermal cycles of 94°C for 1 min, 65°C for 1 min, and 72°C for 1 min 30 s, followed by a final extension step of 72°C for 7 min, resulting in a product 173 base pairs in size. The resulting amplified DNA fragments were separated by electrophoresis through a 1.5% agarose gel, and the resulting bands were visualized and scanned by a white/UV transilluminator (Ultra Violet Products, Cambridge, UK) and quantified by densitometry.

IL-8 measurement. IL-8 release was determined as previously described by ELISA (6) using an R&D Systems paired IL-8 antibody kit.

Nuclear NF-kappa B. The nuclear translocation of the transcription factor NF-kappa B was determined by electrophoretic mobility shift analysis as previously described (6). Briefly, nuclear proteins were extracted from the nuclear pellets isolated from cells, as described above, by resuspending the nuclei in 50 µl of buffer containing 10% glycerol, 50 mM HEPES, 50 mM KCl, 300 mM NaCl, 1 mM DTT, 0.1 mM EDTA, 0.2 mM Na-orthovanadate, 0.4 mM PMSF, 0.3 µg/ml leupeptin, and 1 µg/ml aprotinin and incubated for 20 min on ice. The suspension was centrifuged for 5 min at 13,000 rpm, and the resulting nuclear protein-rich supernatant was retained. Protein concentrations were determined by the Bio-Rad protein determination kit according to the manufacturer's instructions.

Chromatin immunoprecipitation. Chromatin immunoprecipitation (ChIP) assay using acetylated H4 (Upstate Biotech, Lake Placid, NY) was carried out according to the acetylated H4 ChIP kit manufacturer's instructions. Briefly, histone/DNA complexes were fixed with 10% formaldehyde for 10 min, and the treated cells scraped from plates were lysed in lysis buffer. The DNA was sheared by 4 × 10-s pulses of a probe sonicator (Ultrasonic Processor) set at 30% power. The histone/DNA complexes were precleared and incubated with 7.5 µg of antiacetylated H4 antibody (Upstate Biotech). The overnight immunoprecipitates were harvested with salmon sperm DNA/protein A-agarose beads, the protein was digested with proteinase K, and the DNA was isolated by phenol-chloroform extraction. PCR detection of the IL-8 promoter, which was associated with the acetylated H4, was carried out as described by Saccani et al. (27). The PCR reaction contained 1/20th of the extracted DNA, 100 ng each primer, 200 µM dNTP, 2.5 µl 10× Taq polymerase buffer, 1.25 units Taq DNA polymerase, and distilled H2O to a final volume of 25 µl. The reaction was 94°C for 3 min and 38 cycles of 94°C 45 s, 60°C for 60 s, 72°C for 60 s, and final extension at 72°C for 10 min. Primers for the IL-8 promoter were sense: 5'-GTTGTAGTATGCCCCTAAGAG-3' and antisense: 5'-CTCAGGGCAAAC CTGAGTCATC-3', producing a product 407 base pairs in length. PCR products (4 µl) were separated by PAGE using a 6% acrylamide gel and visualized by Silver Stain Plus (Bio-Rad).

Statistical analysis. The data are expressed as means ± SE. Treatment-related differences were evaluated using one-way ANOVA followed by Tukey's post hoc test for multigroup comparisons (30). Statistical significance is reported when P < 0.05, P < 0.01, and P < 0.001 and expressed in Figs. 1-5 as one, two, or three asterisks, respectively.


View larger version (9K):
[in this window]
[in a new window]
 
Fig. 1.   Effect of particulate matter of <10 µm in diameter (PM10) and H2O2 on IL-8 protein release following 24 h of exposure to trichostatin A (TSA, 100 ng/ml), PM10 (100 µg/ml), and H2O2 (200 µM), and H2O2 and PM10 with and without TSA compared with untreated cells. Expressed as percentage untreated control. ***P < 0.001, **P < 0.01, *P < 0.05 compared with untreated control.



View larger version (41K):
[in this window]
[in a new window]
 
Fig. 2.   Effect of PM10 and H2O2 on IL-8 gene expression. A549 IL-8 gene expression following 24-h exposure to TSA (10 ng/ml), PM10 (100 m/ml), H2O2 (200 µM), and H2O2 and PM10 with and without TSA compared with untreated cells. A: IL-8 band density. **P < 0.01, *P < 0.05 compared with untreated control. # P < 0.05 compared with indicated treatment. B: representative RT-PCR gel. -ve, a sample containing no mRNA in the RT-PCR reaction.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 3.   Effect of PM10 and H2O2 on acetylation of histone 4 (H4). A549 cells were treated with TSA (100 ng/ml), PM10 (100 µg/ml), N-acetyl-L-cysteine (NAC, 5 mM), and mannitol (5 mM) for 24 h and fixed with 1% paraformaldehyde, and immunohistochemical staining of acetylated H4 was carried out. A: red staining in panels at right shows acetylated H4; left panels show blue control staining of nuclei with Hoechst dye. B: the level of H4-positive staining as a percentage control is shown. **P < 0.01, *P < 0.05 compared with untreated control. ## P < 0.01 compared with PM10-only treatment.



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 4.   PM10-induced H4 acetylation is dose dependent. A549 cells were treated with doses of PM10 (25-200 µg/ml) for 24 h, and the H4 was stained by immunohistochemistry (A). The level of H4-positive staining as a percentage control is shown for doses of PM10 (B). Each bar represents the % of total cells (as determined by Hoechst dye staining) that display positive staining for nuclear acetylated H4, based on the means ± SE from 3 separate experiments.



View larger version (8K):
[in this window]
[in a new window]
 
Fig. 5.   Effect of PM10 and H2O2 on histone acetyltransferase (HAT) activity associated with H4. A549 cells were treated with TSA (100 ng/ml), PM10 (100 µg/ml), and H2O2 (200 µM) for 2 h in the presence of 0.05 mCi [3H]acetic acid. The nuclear histones were extracted and separated by SDS-PAGE. After Coomassie staining, the H4 band (identified compared with a lane of standard H4) was excised, and the incorporation of 0.05 mCi [3H]acetic acid was analyzed by scintillation counting to produce a disintegrations per min count for each sample. Each bar represents the % compared with control activity based on the means ± SE from 3 separate experiments. ***P < 0.001, **P < 0.01, *P < 0.05 compared with untreated control.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Role of histone acetylation in IL-8 expression induced by oxidative stress and PM10. To determine the role of histone acetylation on IL-8 protein release, we treated A549 cells with PM10 and H2O2. This resulted in increased amounts of IL-8 release after 24 h (Fig. 1). Furthermore, treatment of cells with the HDAC inhibitor TSA also increased the release of IL-8 (Fig. 1). Concomitant exposure of cells to TSA along with PM10 or H2O2 treatment significantly augmented the IL-8 release compared with PM10 or H2O2 alone (Fig. 1).

There was also significant increases in IL-8 mRNA expression following PM10 and H2O2 exposure, and TSA coincubation caused significant enhancement (Fig. 2, A and B). Inhibition of HDAC by TSA also increased IL-8 mRNA expression above control levels (Fig. 2, A and B).

PM10-mediated oxidative stress causes acetylation of H4. To determine whether PM10 exposure could alter the acetylation of H4, we seeded A549 cells on coverslips and treated them with PM10 and H2O2 for 24 h, and the acetylation of H4 was determined by immunocytochemistry. Inhibition of HDAC by TSA treatment caused an increase in acetylated H4 in nuclei (189% of untreated control), as shown by red fluorescent staining (Fig. 3A). PM10 exposure increased the acetylation levels of H4 (Fig. 3, A and B) to a greater extent (261% increase over control levels), indicating that cell stress has a more significant effect than inhibiting HDAC enzymes alone. Oxidative stress is the mechanism of PM10-induced H4 acetylation as shown by the amelioration of H4 acetylation by thiol antioxidant NAC (Fig. 3, A and B) and the radical scavenger mannitol (Fig. 3B).

The increase in acetylated H4 was mediated by PM10 in a dose-dependent manner (Fig. 4).

HAT activity associated with H4 is enhanced by PM10 and oxidative stress. Inhibition of HDAC activity with TSA increased the HAT activity associated with H4 as determined by the incorporation of tritiated [3H]acetic acid by 104% (Fig. 5). Similarly, treatment with PM10 and H2O2 for 2 h increased the HAT activity associated with H4 by 245 and 166%, respectively (Fig. 5).

PM10 and oxidative stress-mediated increase in nuclear acetylated proteins. There was a significant increase in the acetylation of H4 following treatment of cells with TSA, PM10, and H2O2 for 24 h as measured by Western blot (Fig. 6).


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 6.   Effect of PM10 and H2O2 on acetylated H4 and acetylated lysine nuclear proteins. A549 cells were treated with TSA (100 ng/ml), PM10 (100 µg/ml), and H2O2 (200 µM) for 24 h, and the nuclear histones were isolated by acid extraction. Proteins were separated on a SDS-PAGE gel, transferred to nitrocellulose paper, and immunoblotted for acetylated H4.

HDAC2 nuclear protein and gene expression is reduced by PM10 and oxidative stress. To determine whether the PM10- and oxidative stress-mediated increases in H4 acetylation were associated with decreases in HDAC2, we determined the presence of nuclear HDAC2 protein and HDAC2 gene expression. The nuclear presence of HDAC2 protein was significantly reduced by exposure to both the HDAC inhibitor and PM10 (Fig. 7A). Furthermore, there was a trend toward a decrease in HDAC2 gene expression following TSA and PM10 treatment (Fig. 7B).


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 7.   PM10 and TSA decrease histone deacetylase enzyme (HDAC) 2 nuclear protein. A549 cells were treated with TSA (100 ng/ml) and PM10 (100 µg/ml) for 24 h, and the nuclear proteins were isolated. Proteins were separated on a SDS-PAGE gel, transferred to nitrocellulose paper, and immunoblotted for HDAC2 protein. Both TSA and PM10 decreased the HDAC2 protein levels (A). HDAC2 gene expression was determined by RT-PCR on isolated mRNA (B). The mRNA expression was reduced by PM10, H2O2, and TSA treatment.

ChIP. The role of acetylation of H4 in the regulation of IL-8 gene expression was determined by detecting the presence of the IL-8 gene promoter DNA associated with acetylated H4 by ChIP assay and subsequent PCR. The silver staining of the PCR products indicates that the IL-8 gene promoter is associated with acetylated H4 following TSA, PM10, and TNF treatment for 24 h (Fig. 8).


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 8.   Chromatin immunoprecipitation analysis of IL-8 promoter. A549 cells were treated with TSA (100 ng/ml), PM10 (100 µg/ml), TNF-alpha (10 ng/ml), and H2O2 (200 µM) for 24 h, and the DNA-histone complexes were isolated. PCR products of the IL-8 promoter associated with acetylated H4 were separated by PAGE and silver stained. TSA, PM10, and TNF had IL-8 promoter DNA associated with acetylated H4. Control and H2O2 treatments did not have significant IL-8 promoter associated at this time point.

PM10 and TSA activate the nuclear presence of NF-kappa B. Many nuclear cofactors and transcription factors also have an associated HAT activity (15). We examined the translocation of NF-kappa B into the nucleus following treatment with TSA and PM10 as an indication of whether NF-kappa B plays a role in the IL-8 and histone acetylation response. The activation of the transcription factor NF-kappa B was enhanced following the inhibition of HDAC with TSA and by treatment with PM10 (Fig. 9).


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 9.   PM10 and TSA activate NF-kappa B translocation. A549 cells were treated with TSA (100 ng/ml) and PM10 (100 µg/ml) for 24 h, and the nuclear proteins were isolated. Seven micrograms of either HeLa cell nuclear protein (+ve control, Promega, Southampton, UK) or treated cell extract were incubated with P32-labeled NF-kappa B oligonucleotide and separated by PAGE. Any retardation of oligonucleotide by binding to consensus NF-kappa B protein was determined by autoradiography. Both TSA and PM10 treatment enhanced NF-kappa B nuclear translocation.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

We have shown that IL-8 protein release in epithelial cells treated with PM10 is associated with an increase in the presence of acetylated H4 in the nuclei. Furthermore, the same effect is caused by the oxidant H2O2, and an antioxidant blocks the effect of PM10 in causing H4 acetylation. The inhibition of HDACs by TSA also increased the levels of acetylated H4 and enhanced the release of IL-8. H4 was found to be acetylated at the promoter regions of the IL-8 gene. This is the first study to establish a link between the oxidant stress caused by PM10 and chromatin remodeling leading to proinflammatory gene transcription.

The role of the nucleosome remodeling in the control of gene transcription coactivator and transcription factor access to the target promoter sites of genes is increasingly viewed as vital for the transcriptional activation of genes. Levels of histone acetylation have been directly related to the levels of gene transcription (18). Shankaranarayanan et al. (29) have shown that, in A549 cells, acetylation of H3 is associated with 15-lox-1 gene expression induced by IL-4. In this model, deacetylation of H3 enabled promoter activation, leading to promoter-mediated gene expression, thus outlining the importance of specific acetylation in facilitating gene expression in the cell type used in the presented study. Histone acetylation has been reported to play a role in IL-8 and IL-6 gene expression (33, 34), where the IL-8 gene is silenced by increases in HDAC activity, which causes deacetylation of histones (1). Our study supports a key role for histone acetylation in inflammatory gene transcription in A549 cells caused by PM10; however, the role of oxidative stress in this PM10-mediated acetylation is yet to be established.

Histone acetylation has been reported in response to cytokines [IL-1, granulocyte colony-stimulating factor (G-CSF)] and cigarette smoke (11, 17), stimuli that activate cells by signal transduction and oxidative stress mechanisms. Miyata et al. (17) have shown that H3 and H4 are acetylated in murine epithelial cells in response to G-CSF at the myeloperoxidase gene promoter site, a response dependent on MAPK activation. Therefore the acetylation of H3 and H4 is important in the signal transduction-induced activation of target genes in response to stimuli. PM10 has been shown to exert an oxidative stress (5) via transition metals (13), and components of PM10, diesel particles metals, and polycyclic aromatic hydrocarbons (PAHs) can activate signal transduction and MAPKs in cells (8).

As MAPK activation has been associated with histone acetylation (17, 27), this cell signaling pathway may play a role in the histone-mediated proinflammatory effects seen in this study. Furthermore, a role for both MAPK activation and oxidative stress has been associated with changes in histone acetylation (32). The PM10-induced increase in H4 acetylation in this study was inhibited by thiol antioxidant NAC and the free radical scavenger mannitol, suggesting that PM10 produces its effect via oxidative stress. Oxidative stress causes depletion of antioxidants (glutathione) and can activate MAPK pathways (26), specifically ERK and JNK, and by activation of these pathways, these agents may regulate histone acetylation. Similar events may follow PM10-mediated oxidative stress, and, indeed, components of PM10, transition metals (28), and PAHs (21) have been identified as activating MAPK pathways. We show here that histone acetylation provides a plausible, newly described mechanism in the proinflammatory effects of PM10. The acetylation of genes may be the prerequisite for transcription inasfar as a role for acetylation may be linked to the passage of RNA polymerase II (20).

Cytokine and oxidative stress activation of signal transduction in cells frequently results in the activation of NF-kappa B. We have previously shown that NF-kappa B activation is an important feature of PM10-mediated cytokine expression (6, 13). In this study, we show that promotion of histone acetylation by TSA enhances NF-kappa B activation. Previous studies show that activation of NF-kappa B results in association of the molecule with coactivators, such as CBP/p300, which themselves promote the acetylation of histones (33). Furthermore, p65, a component of the NF-kappa B transcription factor, has intrinsic HAT activity (10). The TNF-alpha -stimulated expression of IL-6 is regulated by NF-kappa B by a mechanism that involves its intrinsic HAT activity (33). NF-kappa B interaction with HDAC proteins is a further mechanism whereby NF-kappa B can regulate transcription (1). Here we present data showing that PM10-mediated IL-8 expression and protein release are accompanied by NF-kappa B binding. This suggests that inhibition of HDAC allows NF-kappa B to be retained in the nucleus and triggers augmented PM-mediated gene transcription. Chen et al. (2) have shown that, in return, NF-kappa B itself is acetylated, which participates in active transcription machinery for prolonged transcription. The NF-kappa B activation that is known to occur in response to PM10 may therefore act as the mediator of histone acetylation in this model (2).

The activation of p38 has been shown to be required for NF-kappa B transactivation to gene promoters, as this increases transcription factor accessibility (27). This occurs through either phosphorylation or acetylation of histones that may characterize genes to be transcribed. We and others have shown that PM10 can transactivate NF-kappa B (13) by a process of p38 signal transduction, leading to proinflammatory gene expression (19). p38 may be important in the gene specificity of histone acetylation, and this study has shown that PM10, an activator of p38, has acetylated H4 at the promoter region of the IL-8 gene.

HDAC2 has been shown to be associated with the HAT activity of NF-kappa B (10), and it also plays a role in transcription repression by inhibiting the NF-kappa B complex acetylation of target promoter sites (9). The role of HDAC2 in inflammatory conditions is specifically highlighted by its role in activated glucocorticoid receptor (GR) inhibition of inflammation, which is mediated by recruitment of HDAC2 protein to NF-kappa B complexes (9). Initiation of transcription by NF-kappa B complex formation has been shown to involve CBP (4). Activation of the GR by glucocorticoids, used in the treatment of inflammatory conditions, inhibits transcription both by inhibiting CBP and NF-kappa B complex formation and associated histone acetylation and by recruiting HDAC2, which also inhibits HAT activity (9). HDAC2 may therefore play a key role in the lung inflammatory conditions that render people susceptible to the effects of PM10, and we show here that PM10 can affect both the levels of HDAC2 and the acetylation of H4. The effects of PM10 are shown in susceptible populations (6), although the mechanisms for this are unclear. There may therefore be a role for chronic suppression of HDAC2 and acetylation of histones mediated by inflammatory agents that may result in a susceptibility to PM10-mediated proinflammatory effects. Although these possible mechanisms have yet to be determined, therapeutic intervention targeting, such histone acetylation, may have a role to play in PM10-mediated disease.

In conclusion, we have shown that PM10- and H2O2-induced expression and release of IL-8 are associated with increased acetylation of histone proteins, specifically H4. This was associated with an increase in the HAT activity associated with H4 and activation of NF-kappa B. PM10-mediated activation of NF-kappa B may itself aid the acetylation of the histone proteins. The HDAC inhibitor TSA also increased IL-8 release. PM10 increased H4 acetylation by a mechanism involving oxidative stress, as shown by its inhibition with NAC and mannitol. These results indicate a mechanism, to our knowledge not previously reported, whereby oxidative stress and PM10 can increase their proinflammatory activity via alteration in the balance between histone acetylation and deacetylation in epithelial cells.


    ACKNOWLEDGEMENTS

We thank Drs. I. M. Adcock and K. Ito for technical assistance during this project.


    FOOTNOTES

This work was supported by the British Lung Foundation, the Medical Research Council (UK), and the Colt Foundation.

Address for reprint requests and other correspondence: W. MacNee, ELEGI/Colt Laboratory, Univ. of Edinburgh, Wilkie Bldg., Medical School, Teviot Pl., Edinburgh EH8 9AG, UK (E-mail: w.macnee{at}ed.ac.uk).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

First published November 22, 2002;10.1152/ajplung.00277.2002

Received 12 August 2002; accepted in final form 20 November 2002.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1.   Ashburner, BP, Westerheide SD, and Baldwin AS, Jr. The p65 (RelA) subunit of NF-kappa B interacts with the histone deacetylase (HDAC) corepressors HDAC1 and HDAC2 to negatively regulate gene expression. Mol Cell Biol 21: 7065-7077, 2001[Abstract/Free Full Text].

2.   Chen, LF, Fischle W, Verdin E, and Greene WC. Duration of nuclear NF-kappaB action regulated by reversible acetylation. Science 293: 1653-1657, 2001[Abstract/Free Full Text].

3.   Fusunyan, RD, Quinn JJ, Fujimoto M, MacDermott RP, and Sanderson IR. Butyrate switches the pattern of chemokine secretion by intestinal epithelial cells through histone acetylation. Mol Med 5: 631-640, 1999[ISI][Medline].

4.   Gerritsen, ME, Williams AJ, Neish AS, Moore S, Shi Y, and Collins T. CREB-binding protein/p300 are transcriptional coactivators of p65. Proc Natl Acad Sci USA 94: 2927-2932, 1997[Abstract/Free Full Text].

5.   Gilmour, PS, Brown DM, Lindsay TG, Beswick PH, MacNee W, and Donaldson K. Adverse health effects of PM10 particles: involvement of iron in generation of hydroxyl radical. Occup Environ Med 53: 817-822, 1996[Abstract].

6.   Gilmour, PS, Rahman I, Hayashi S, Hogg JC, Donaldson K, and MacNee W. Adenoviral E1A primes alveolar epithelial cells to PM10-induced transcription of interleukin-8. Am J Physiol Lung Cell Mol Physiol 281: L598-L606, 2001[Abstract/Free Full Text].

7.   Grunstein, M. Histone acetylation in chromatin structure and transcription. Nature 389: 349-352, 1997[Medline].

8.   Hashimoto, S, Gon Y, Takeshita I, Matsumoto K, Jibiki I, Takizawa H, Kudoh S, and Horie T. Diesel exhaust particles activate p38 MAP kinase to produce interleukin 8 and RANTES by human bronchial epithelial cells and N-acetylcysteine attenuates p38 MAP kinase activation. Am J Respir Crit Care Med 161: 280-285, 2000[Abstract/Free Full Text].

9.   Ito, K, Barnes PJ, and Adcock IM. Glucocorticoid receptor recruitment of histone deacetylase 2 inhibits interleukin-1beta-induced histone H4 acetylation on lysines 8 and 12. Mol Cell Biol 20: 6891-6903, 2000[Abstract/Free Full Text].

10.   Ito, K, Jazrawi E, Cosio B, Barnes PJ, and Adcock IM. p65-activated histone acetyltransferase activity is repressed by glucocorticoids: mifepristone fails to recruit HDAC2 to the p65-HAT complex. J Biol Chem 276: 30208-30215, 2001[Abstract/Free Full Text].

11.   Ito, K, Lim S, Caramori G, Chung KF, Barnes PJ, and Adcock IM. Cigarette smoking reduces histone deacetylase 2 expression, enhances cytokine expression, and inhibits glucocorticoid actions in alveolar macrophages. FASEB J 15: 1110-1112, 2001[Free Full Text].

12.   Jaspers, I, Samet JM, Erzurum S, and Reed W. Vanadium-induced kappaB-dependent transcription depends upon peroxide-induced activation of the p38 mitogen-activated protein kinase. Am J Respir Cell Mol Biol 23: 95-102, 2000[Abstract/Free Full Text].

13.   Jimenez, LA, Thompson J, Brown DA, Rahman I, Antonicelli F, Duffin R, Drost EM, Hay RT, Donaldson K, and MacNee W. Activation of NF-kappaB by PM(10) occurs via an iron-mediated mechanism in the absence of IkappaB degradation. Toxicol Appl Pharmacol 166: 101-110, 2000[ISI][Medline].

14.   Kiningham, KK, Xu Y, Daosukho C, Popova B, and St. Clair DK. Nuclear factor kappaB-dependent mechanisms coordinate the synergistic effect of PMA and cytokines on the induction of superoxide dismutase 2. Biochem J 353: 147-156, 2001[ISI][Medline].

15.   Kuo, MH, and Allis CD. Roles of histone acetyltransferases and deacetylases in gene regulation. Bioessays 20: 615-626, 1998[ISI][Medline].

16.   MacNee, W, Li XY, Gilmour PS, and Donaldson K. Systemic effects of particulate air pollution. Inhal Toxicol 12: 233-244, 2000.

17.   Miyata, Y, Towatari M, Maeda T, Ozawa Y, and Saito H. Histone acetylation induced by granulocyte colony-stimulating factor in a map kinase-dependent manner. Biochem Biophys Res Commun 283: 655-660, 2001[ISI][Medline].

18.   Mizuguchi, G, Vassilev A, Tsukiyama T, Nakatani Y, and Wu C. ATP-dependent nucleosome remodeling and histone hyperacetylation synergistically facilitate transcription of chromatin. J Biol Chem 276: 14773-14783, 2001[Abstract/Free Full Text].

19.   Mondal, K, Stephen HJ, and Becker S. Adhesion and pollution particle-induced oxidant generation is neither necessary nor sufficient for cytokine induction in human alveolar macrophages. Am J Respir Cell Mol Biol 22: 200-208, 2000[Abstract/Free Full Text].

20.   Myers, FA, Evans DR, Clayton AL, Thorne AW, and Crane-Robinson C. Targeted and extended acetylation of histones H4 and H3 at active and inactive genes in chicken embryo erythrocytes. J Biol Chem 276: 20197-20205, 2001[Abstract/Free Full Text].

21.   Ng, D, Kokot N, Hiura T, Faris M, Saxon A, and Nel A. Macrophage activation by polycyclic aromatic hydrocarbons: evidence for the involvement of stress-activated protein kinases, activator protein-1, and antioxidant response elements. J Immunol 161: 942-951, 1998[Abstract/Free Full Text].

22.   Pepperl, S, Dorger M, Ringel F, Kupatt C, and Krombach F. Hyperoxia upregulates the NO pathway in alveolar macrophages in vitro: role of AP-1 and NF-kappa B. Am J Physiol Lung Cell Mol Physiol 280: L905-L913, 2001[Abstract/Free Full Text].

23.   Perissi, V, Dasen JS, Kurokawa R, Wang Z, Korzus E, Rose DW, Glass CK, and Rosenfeld MG. Factor-specific modulation of CREB-binding protein acetyltransferase activity. Proc Natl Acad Sci USA 96: 3652-3657, 1999[Abstract/Free Full Text].

24.   Pope, CA, and Dockery DW. Epidemiology of particle effects. In: Air Pollution and Health, edited by Holgate ST, Samet JM, Koren HS, and Maynard RL.. San Diego, CA: Academic, 1999, p. 673-705.

25.   Rahman, I, Antonicelli F, and MacNee W. Molecular mechanism of the regulation of glutathione synthesis by tumor necrosis factor-alpha and dexamethasone in human alveolar epithelial cells. J Biol Chem 274: 5088-5096, 1999[Abstract/Free Full Text].

26.   Rahman, I, and MacNee W. Oxidative stress and regulation of glutathione in lung inflammation. Eur Respir J 16: 534-554, 2000[Abstract].

27.   Saccani, S, Pantano S, and Natoli G. p38-dependent marking of inflammatory genes for increased NF-kappa B recruitment. Nat Immun 3: 69-75, 2002[ISI][Medline].

28.   Samet, JM, Graves LM, Quay J, Dailey LA, Devlin RB, Ghio AJ, Wu W, Bromberg PA, and Reed W. Activation of MAPKs in human bronchial epithelial cells exposed to metals. Am J Physiol Lung Cell Mol Physiol 275: L551-L558, 1998[Abstract/Free Full Text].

29.   Shankaranarayanan, P, Chaitidis P, Kuhn H, and Nigam S. Acetylation by histone acetyltransferase CREB-binding protein/p300 of STAT6 is required for transcriptional activation of the 15-lipoxygenase-1 gene. J Biol Chem 276: 42753-42760, 2001[Abstract/Free Full Text].

30.   Snedecor, GW, and Cochran WG. Statistical Methods. Ames, IA: Iowa State University Press, 1974.

31.   Suzuki, T, Grand E, Bowman C, Merchant JL, Todisco A, Wang L, and Del Valle J. TNF-alpha and interleukin 1 activate gastrin gene expression via MAPK- and PKC-dependent mechanisms. Am J Physiol Gastrointest Liver Physiol 281: G1405-G1412, 2001[Abstract/Free Full Text].

32.   Tikoo, K, Lau SS, and Monks TJ. Histone H3 phosphorylation is coupled to poly-(ADP-ribosylation) during reactive oxygen species-induced cell death in renal proximal tubular epithelial cells. Mol Pharmacol 60: 394-402, 2001[Abstract/Free Full Text].

33.   Vanden Berghe, W, De Bosscher K, Boone E, Plaisance S, and Haegeman G. The nuclear factor-kappaB engages CBP/p300 and histone acetyltransferase activity for transcriptional activation of the interleukin-6 gene promoter. J Biol Chem 274: 32091-32098, 1999[Abstract/Free Full Text].

34.   Wen, X, and Wu GD. Evidence for epigenetic mechanisms that silence both basal and immune-stimulated transcription of the IL-8 gene. J Immunol 166: 7290-7299, 2001[Abstract/Free Full Text].

35.   Youn, HD, Grozinger CM, and Liu JO. Calcium regulates transcriptional repression of myocyte enhancer factor 2 by histone deacetylase 4. J Biol Chem 275: 22563-22567, 2000[Abstract/Free Full Text].


Am J Physiol Lung Cell Mol Physiol 284(3):L533-L540
1040-0605/03 $5.00 Copyright © 2003 the American Physiological Society



This article has been cited by other articles:


Home page
ThoraxHome page
I A Yang, K M Fong, P V Zimmerman, S T Holgate, and J W Holloway
Genetic susceptibility to the respiratory effects of air pollution
Thorax, June 1, 2008; 63(6): 555 - 563.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
J. Liu, M. Ballaney, U. Al-alem, C. Quan, X. Jin, F. Perera, L.-C. Chen, and R. L. Miller
Combined Inhaled Diesel Exhaust Particles and Allergen Exposure Alter Methylation of T Helper Genes and IgE Production In Vivo
Toxicol. Sci., March 1, 2008; 102(1): 76 - 81.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
H. Dombrowsky and S. Uhlig
Steroids and histone deacetylase in ventilation-induced gene transcription
Eur. Respir. J., November 1, 2007; 30(5): 865 - 877.
[Abstract] [Full Text] [PDF]


Home page
Occup. Environ. Med.Home page
C. Monteiller, L. Tran, W. MacNee, S. Faux, A. Jones, B. Miller, and K. Donaldson
The pro-inflammatory effects of low-toxicity low-solubility particles, nanoparticles and fine particles, on epithelial cells in vitro: the role of surface area
Occup. Environ. Med., September 1, 2007; 64(9): 609 - 615.
[Abstract] [Full Text] [PDF]


Home page
ThoraxHome page
F. W S Ko, W. Tam, T. W. Wong, D. P S Chan, A. H Tung, C. K W Lai, and D. S C Hui
Temporal relationship between air pollutants and hospital admissions for chronic obstructive pulmonary disease in Hong Kong
Thorax, September 1, 2007; 62(9): 780 - 785.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
B. R. Celli and P. J. Barnes
Exacerbations of chronic obstructive pulmonary disease
Eur. Respir. J., June 1, 2007; 29(6): 1224 - 1238.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
L. Cui, J. Miao, and L. Cui
Cytotoxic Effect of Curcumin on Malaria Parasite Plasmodium falciparum: Inhibition of Histone Acetylation and Generation of Reactive Oxygen Species
Antimicrob. Agents Chemother., February 1, 2007; 51(2): 488 - 494.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
I. Rahman and I. M. Adcock
Oxidative stress and redox regulation of lung inflammation in COPD.
Eur. Respir. J., July 1, 2006; 28(1): 219 - 242.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
P. Szulakowski, A. J. L. Crowther, L. A. Jimenez, K. Donaldson, R. Mayer, T. B. Leonard, W. MacNee, and E. M. Drost
The Effect of Smoking on the Transcriptional Regulation of Lung Inflammation in Patients with Chronic Obstructive Pulmonary Disease
Am. J. Respir. Crit. Care Med., July 1, 2006; 174(1): 41 - 50.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
H. Slevogt, B. Schmeck, C. Jonatat, J. Zahlten, W. Beermann, V. van Laak, B. Opitz, S. Dietel, P. D. N'Guessan, S. Hippenstiel, et al.
Moraxella catarrhalis induces inflammatory response of bronchial epithelial cells via MAPK and NF-{kappa}B activation and histone deacetylase activity reduction
Am J Physiol Lung Cell Mol Physiol, May 1, 2006; 290(5): L818 - L826.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
Y.-M. Kim, W. Reed, W. Wu, P. A. Bromberg, L. M. Graves, and J. M. Samet
Zn2+-induced IL-8 expression involves AP-1, JNK, and ERK activities in human airway epithelial cells
Am J Physiol Lung Cell Mol Physiol, May 1, 2006; 290(5): L1028 - L1035.
[Abstract] [Full Text] [PDF]


Home page
Am J EpidemiolHome page
M. Medina-Ramon, A. Zanobetti, and J. Schwartz
The Effect of Ozone and PM10 on Hospital Admissions for Pneumonia and Chronic Obstructive Pulmonary Disease: A National Multicity Study
Am. J. Epidemiol., March 15, 2006; 163(6): 579 - 588.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
J.-J. Chen, W.-C. Huang, and C.-C. Chen
Transcriptional Regulation of Cyclooxygenase-2 in Response to Proteasome Inhibitors Involves Reactive Oxygen Species-mediated Signaling Pathway and Recruitment of CCAAT/Enhancer-binding Protein {delta} and CREB-binding Protein
Mol. Biol. Cell, December 1, 2005; 16(12): 5579 - 5591.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
P. Vineis and K. Husgafvel-Pursiainen
Air pollution and cancer: biomarker studies in human populations
Carcinogenesis, November 1, 2005; 26(11): 1846 - 1855.
[Abstract] [Full Text]