|
|
||||||||
1 National Health and Environmental Effects Research Laboratory, Office of Research and Development, Environmental Protection Agency, Research Triangle Park 27711; 2 Center for Environmental Medicine and Lung Biology, University of North Carolina, Chapel Hill 27599; 3 Department of Biochemistry, State University of New York, Buffalo, New York 14214; 4 Department of Internal Medicine, Duke University Medical Center, Durham, North Carolina 27710; and 5 Department of Cellular and Structural Biology, University of Texas Health Science Center, San Antonio, Texas 78284
| |
ABSTRACT |
|---|
|
|
|---|
Despite a lack of transferrin,
hypotransferrinemic (Hp) mice demonstrate an accumulation of iron in
peripheral organs including the lungs. One potential candidate for such
transferrin-independent uptake of iron is divalent metal transporter-1
(DMT1), an established iron transporter. We tested the hypothesis that
increased concentrations of iron in the lungs of Hp mice are associated
with elevations in DMT1 expression. With the use of inductively coupled
plasma emission spectroscopy, measurements of nonheme iron confirmed significantly elevated concentrations in the lung tissue of Hp mice
relative to the wild-type mice. Western blot analyses for the
expression of two isoforms of DMT1 in the Hp mice relative to the
wild-type animals demonstrated an elevation for the isoform that lacks
an iron-responsive element (IRE) with significant decrements in the
expression of +IRE DMT1. With the use of immunohistochemistry,
IRE
DMT1 was localized to both airway epithelial cells and alveolar macrophages in wild-type mice. Staining appeared increased in both
types of cells in the Hp mice. Elevated concentrations of both tissue
nonheme iron and expression of
IRE DMT1 in the Hp mice were
associated with increased quantities of
IRE mRNA. There was no
difference between wild-type and homozygotic Hp mice in the amount of
mRNA for DMT1 +IRE. We conclude that differences between Hp and
wild-type mice in nonheme iron concentrations were accompanied by
increases in the expression of
IRE DMT1. Increased expression of
IRE DMT1 in the lungs of the Hp mice could be responsible for
elevated concentrations of the metal in these tissues.
iron transport; transferrin; membrane transporters
| |
INTRODUCTION |
|---|
|
|
|---|
HOMOZYGOUS HYPOTRANSFERRINEMIC (gene symbol hpx) mice have greatly diminished concentrations of serum transferrin. Their phenotype therefore informs us where that glycoprotein is most critical in transporting iron into cells. For example, the severe anemia (19) demonstrates that the erythron relies on transferrin. In hpx/hpx mice, a point mutation that alters an invariant nucleotide in the splice donor site after exon 16 of the transferrin gene (23) causes defective splicing (15). As a result, the hpx/hpx mice produce <1% of the normal levels of transferrin. This condition is lethal unless supplementation is accomplished with weekly injections of either transferrin or serum.
Despite this lack of transferrin, hpx/hpx mice demonstrate an accumulation of iron in peripheral organs (e.g., the liver, pancreas, and heart) (5, 16) with the lung (10) to be the focus of the present study. Many types of mammalian cells exhibit an alternative means of mobilizing and transporting non-transferrin-bound iron (NTBI), a transport system yet to be fully characterized. Natural resistance-associated macrophage proteins are a group of transporters in vertebrates that are representative of a small family of structurally and functionally related polypeptides conserved across numerous species, with homologues identified in yeasts, bacteria, worms, flies, and plants (9). Evolutionary conservation suggests that a fundamental function may be common to all of these proteins. Natural resistance-associated macrophage protein type 2, now more frequently referred to as divalent metal transporter 1 (DMT1), is expressed in many tissues and cell types as an integral membrane protein modified by glycosylation (molecular weight of 90-100 kDa) (24). This protein functions to transport divalent metal cations including Fe2+ (13). A G185R mutation that occurs in both the microcytic mouse (8) and the Belgrade rat (7) affects both gastrointestinal iron uptake and endosomal exit of iron after transferrin uptake; hence DMT1 is responsible for both processes. The Belgrade rat is also defective in NTBI transport (6, 12); thus at least one form of NTBI transport also relies on DMT1.
DMT1 generates two alternatively spliced mRNAs (7, 13,
18) that differ at their 3' untranslated region by either the presence or absence of an iron-response element (+IRE and
IRE isoforms, respectively). The two isoforms also differ in the
COOH-terminal 18 or 25 amino acids. IREs are found in noncoding
portions of mRNA for specific proteins that can be
posttranscriptionally regulated in response to cellular iron levels
(17). The presence of IRE suggested that DMT1 levels may
also be modulated by iron via an IRE-dependent pathway. Exposure of
respiratory epithelial cells to iron increases expression of
IRE DMT1
(25); however, it indicates that there is also an
IRE-independent iron-regulatory pathway for control of DMT1
expression. Despite the response of the
IRE form, there was
little effect of the metal on the +IRE isoform.
Because iron accumulation in the lung is increased in
hpx/hpx mice (10), we tested the hypothesis
that increased concentrations of iron in the lungs of these mice are
associated with elevations in DMT1 expression and found such an
elevation. We also investigated whether the
IRE isoform or the +IRE
isoform increased in level and found that the former increased, whereas
the latter decreased.
| |
METHODS |
|---|
|
|
|---|
Animal model. Homozygous (hpx/hpx) mice were obtained from matings between hpx/+ and hpx/+ animals (originally derived from BALB/c mice). Newborn hpx/hpx pups were small, anemic, and pale at birth. They were maintained by weekly intraperitoneal injections of mouse serum (up to 0.3 ml) (2). Homozygous hpx/hpx and +/+ mice were distinguished by their serum concentrations of transferrin. All animals were kept in pathogen-free facilities and routinely monitored for pathogens and viruses. All procedures were approved by the Institutional Animal Care and Use Committee at the University of Texas Health Science Center and complied with federal regulations.
Nonheme iron concentrations in lung. Nonheme iron concentrations in mouse lungs were measured after precipitation of hemoglobin (22). Lung tissue (0.10 g wet weight) was hydrolyzed in a solution of 3 N HCl and 10.0% trichloroacetic acid (0.10 g lung: 1.0 ml) at 70oC for 16 h. The hydrolyzed tissue was centrifuged at 1,200 g for 10 min. Iron in the supernatant was measured in duplicate using inductively coupled plasma emission spectroscopy (ICPES; = 238.204). Standards included ferric chloride in 3 N HCl and 10% trichloroacetic acid.
Western blot analysis for DMT1.
Preparation of isoform-specific antibodies has been previously
described (20). Although directed against peptides based on the rat ±IRE DMT1 sequences, each antibody cross-reacts in an
isoform-specific manner with the homologous mouse DMT1 protein. Frozen
lung tissue was homogenized on ice in buffer containing 1% Nonidet
P-40, 0.5% deoxycholate, 0.1% SDS, 10 mM sodium fluoride, 1 mM
vanadyl sulfate oxide, 1 mM phenylmethylsulfonyl fluoride, and
antiprotease cocktail composed of 1 mM 4-(2-aminoethyl)benzenesulfonyl fluoride, 0.8 µM aprotinin, 20 µM leupeptin, 50 µM bestatin, 10 µM pepstatin A, 15 µM E-64 cocktail set III (cat. no. 539134; Calbiochem, La Jolla, CA) in phosphate-buffered saline (PBS) at pH 7.4. Homogenates were centrifuged at 10,000 g for 10 min at 4oC, and the supernatants were aliquoted and stored at
80oC.
Immunohistochemistry. Tissue sections were cut, floated on a protein-free water bath, mounted on silane-treated slides (Fisher, Raleigh, NC), and air dried overnight. The slides were heat fixed at 60°C in a slide dryer (Shandon Lipshaw, Pittsburgh, PA) for 10 min and cooled to room temperature. Sections were then deparaffinized and hydrated to 95% alcohol (xylene for 10 min, absolute alcohol for 5 min, and 95% alcohol for 5 min). Endogenous peroxidase activity was blocked with H2O2 in absolute methanol (30% H2O2 in 30 ml of methanol) for 8 min. Slides were rinsed in 95% alcohol for 2 min, placed in deionized H2O, and washed in PBS. After treatment with Cyto Q Background Buster (Innovex Biosciences) for 10 min, slides were incubated with the primary antibody diluted in 1% bovine serum albumin for 45 min at 37°C in PBS at a dilution of 1:100. Slides were incubated with biotinylated linking antibody from Stat-Q Staining System (Innovex Biosciences) for 10 min at room temperature and washed with PBS, and a peroxidase enzyme label from Stat-Q Staining System was applied. After being incubated for 10 min at room temperature and being washed with PBS, tissue sections were developed with 3,3'-diaminobenzidine-tetrahydrochloride for 3 min at room temperature. The sections were counterstained with hematoxylin, dehydrated through alcohols, cleared in xylene, and coverslipped with the use of a permanent mounting media.
Reverse transcriptase-polymerase chain reaction.
Mouse lung tissue was collected and snap frozen in liquid nitrogen.
Total RNA was extracted from the lung tissue homogenates using TRIzol
reagent (Life Technologies, Bethesda, MD). Lysates were sheared with
four passes through a 22-gauge syringe. First-strand cDNAs were
synthesized from 0.4 g of total RNA in 100 µl of a buffer
containing 5 µM random hexaoligonucleotide primers, 10 U/µl Moloney
murine leukemia virus reverse transcriptase, 1 U/µl RNasin, 0.5 mM
dNTP, 50 mM KCl, 3 mM MgCl2, and 10 mM
Tris · HCl (pH 9.3). After a 1-h incubation at
39°C, the reverse transcriptase was heat inactivated at 94°C for 4 min. Quantitative PCR was performed by using polymerase with
detection of Taqman fluorescence on an sequence detector (ABI Prism
7700; PE Biosystems, Foster City, CA). DMT1 mRNA levels were
normalized by using the expression of GAPDH as a housekeeping gene.
Relative quantitation of both DMT1 and GAPDH mRNA was based on standard
curves prepared from serially diluted mouse mast cell cDNA. The
following primer sequences were used. DMT1 (
IRE): sense,
CGTACCGCCTGGGACTGA; antisense, GTCATCTGGACACCACTGAGTCA; Taqman probe,
CAGCCTGAACTCTATCTTCTGAACACCGTGG. DMT1 (+IRE): sense,
TGGGCCAGGCACGTCTAC; antisense, GCTGCCTAATGCTACAGGGTAAG; Taqman probe,
CTCATCTTAAGCATACATGACAGCCAGGCA. GAPDH: sense, CATGGCCTTCCGTGTTCCTA; antisense, TGTCATCATACTTGGCAGGTTTCT; Taqman probe, TCGTGGATCTGACGTGCCGCC.
Uptake of iron by alveolar macrophages.
After being anesthetized with metafane, animals were euthanized by
exsanguination through the abdominal aorta. Lungs from +/+ and
hpx/hpx mice were then lavaged with 1.0 ml of normal saline (0.9% NaCl). The lavage was repeated four times, and the cells were
pooled. Alveolar macrophages (1.0 × 106/ml RPMI 1640)
were exposed to 50 µg oil fly ash containing a high
concentration of iron compounds soluble in aqueous solution (8,154 ppm)
(5). Cell suspensions were collected at 0, 15, 30, and 60 min. After centrifugation at 600 g, the concentration of
iron in the supernatant was measured with the use of ICPES (
= 238.204).
Ferritin concentrations in alveolar macrophages. Alveolar macrophages (1.0 × 106/ml RPMI 1640) were again exposed to 50 µg oil fly ash. Cell suspensions were collected at 0 and 60 min, centrifuged at 600 g for 10 min, washed in PBS, and sonicated. L-ferritin concentrations were measured with a commercially available kit (an enzyme immunoassay), controls, and standards from Microgenics (Concord, CA). These assays were modified for use in the Cobas Fara II centrifugal spectrophotometer (Hoffman-LaRoche, Branchburg, NJ).
Statistics. Values are means ± SE. Differences between the homozygotes and wild-type mice were analyzed employing t-test of independent means. Differences between multiple groups were compared with one-way ANOVA. Duncan's multiple-range test was used as a post hoc test. Two-tailed tests of significance were employed. Significance was assumed at P < 0.05.
| |
RESULTS |
|---|
|
|
|---|
hpx/hpx mice can exhibit a siderosis of peripheral
organs (16). ICPES measurements of nonheme iron confirmed
significantly elevated concentrations in the lung tissue of
hpx/hpx mice relative to +/+ controls (Fig.
1). Explaining these increased quantities of metal in this tissue is a challenge because concentrations of
transferrin are extremely low in serum, so one must postulate an
alternative pathway of iron uptake. DMT1 is a second transporter that
could possibly contribute to elevated quantities of the metal in the
lungs (25). Western blot analyses demonstrated an
elevation in the expression of
IRE DMT1 in hpx/hpx mice
relative to the controls (Fig.
2A). Densitometry supported a
ninefold increase in the expression of this isoform in the
hpx/hpx mice (Fig. 2B). In contrast, there
were significant decrements in the expression of +IRE DMT1 in the Hp
mouse relative to the controls (Fig.
3A). This decrement in the
+IRE isoform of DMT1 was similarly confirmed by densitometry (Fig.
3B).
|
|
|
Lungs of both Hp and wild-type mice were excised and embedded in
paraffin. An increased expression of
IRE DMT1 was evident on
immunohistochemistry in the hpx/hpx mice relative to a +/+ control. DMT1 (
IRE) was localized to both airway epithelial cells and
alveolar macrophages in wild-type mice. Staining appeared increased in
both epithelial and phagocytic cells in the Hp mice, with the most
obvious elevation in expression being in the alveolar epithelium (Fig.
4); much of the intracellular staining
was in the nuclei. Staining with antibody for the +IRE isoform in the lungs of either hpx/hpx or +/+ mice was very weak (not
shown), rendering disparities between genotypes not discernible.
|
Comparable with cultured airway epithelial cell (25), mRNA
for
IRE DMT1 was more abundant in the lungs of both types of mice
relative to +IRE DMT1. In vitro investigation has led to the suggestion
that iron can affect
IRE DMT1 through a mechanism that alters
polyadenylation and/or transcription (25). Thus Hp mice
were investigated for their mRNA levels (Fig.
5). Elevated concentrations of both
tissue nonheme iron and expression of this protein in the Hp mice were
associated with increased quantities of
IRE DMT1 mRNA relative to
GAPDH mRNA (Fig. 5A). There was little difference between
+/+ and hpx/hpx mice in the amount of mRNA for +IRE DMT1
(Fig. 5B).
|
It was also of value to ask whether the increased expression of
IRE
DMT1 in cells resident in the lower respiratory tract led to increased
function with respect to iron uptake. Therefore, alveolar macrophages
were collected from both +/+ and hpx/hpx mice and exposed to
an emission source air pollution particle with high concentrations of
metals, including iron (i.e., oil fly ash). Phagocytes obtained from
both types of mice rapidly transported the metal. The time-dependent
uptake of this metal, however, was significantly accelerated for cells
obtained from hpx/hpx mice compared with +/+ mice,
confirming increased functional expression of
IRE DMT1 (Fig.
6). This increased transport of the metal
was associated with elevated concentrations of ferritin in the
macrophages (Fig. 7; global F value = 188, P < 0.0001). All comparisons with those
alveolar macrophages obtained from wild-type animals exposed to media
were significant. The comparison between ferritin concentrations in
alveolar macrophages obtained from hpx/hpx mice
exposed to media and oil fly ash was also significant.
|
|
| |
DISCUSSION |
|---|
|
|
|---|
Iron is an essential micronutrient utilized in many aspects of
normal cell function. To transfer iron across a membrane, mammalian cells frequently rely on the glycoprotein transferrin in a cyclic mechanism dependent on the transferrin receptor (21). One
alternative mechanism of iron transport employs lactoferrin, a
monomeric, cationic metal-binding glycoprotein commonly found in human
mucosal secretions (e.g., milk, tears, semen, and plasma) and in the
specific granules of polymorphonuclear leukocytes (11).
Nevertheless, respiratory epithelial cells demonstrate a rapid (within
60 min) transport of metal from buffer that does not contain either
transferrin or lactoferrin (25). This absence suggests a
transport pathway of iron independent of both glycoproteins. The
capacity of DMT1 to carry out NTBI uptake (6, 12)
immediately indicts this transporter. Elevations in both the mRNA and
protein levels for
IRE DMT1 correlated with increased metal uptake
after exposure to iron, supporting a potential participation of this
protein in a detoxification of iron by a cell (25).
Consequently, increased uptake of iron by elevated concentrations of
DMT1 was investigated as one potential pathway for an accumulation of
nontransferrin-bound iron in the lower respiratory tract of
hpx/hpx mice.
Western blot analysis and immunohistochemistry both reveal an increased
expression of DMT1 in hpx/hpx relative to +/+ mice, but this
increase was specific for the
IRE isoform only. Relative to the
wild-type mice, there was an actual decrease in expression of +IRE DMT1
protein. In human airway epithelial cells, there appears to be less
+IRE protein relative to
IRE (25). The relative abundance of the
IRE form in airways is in contrast to data for the
duodenum in which the +IRE isoform exceeds the
IRE isoform in
expression (3). The significance of these disparities in the expression of one isoform relative to the other is unknown. It may
reflect dissimilar functions, with the purpose of the +IRE isoform
being to provide metal for nutritional requirements and that of
IRE
DMT1 to diminish availability of catalytically active iron and
associated reactive oxygen species. In support of dissimilar roles for
the isoforms, hpx/hpx mice also exhibit an increased expression of DMT1 in the duodenum but the elevation is in the +IRE
isoform (4).
Comparable with protein levels, there were increases in the level of
IRE DMT1 mRNA in hpx/hpx mice relative to GAPDH mRNA compared with +/+ mice. In contrast, the +IRE mRNA levels changed little if at all relative to GAPDH mRNA in hpx/hpx mice
compared with +/+ mice. However, the level of +IRE DMT1 protein
decreased in hpx/hpx mice. Quantitative interpretation of
these comparisons depends on the assumption that GAPDH mRNA levels
remain unchanged. This assumption is frequently made, but it can be
incorrect when iron is involved (M. Muckenthaler and M. W. Hentze,
personal communication). If GAPDH mRNA levels go up with
IRE DMT1
mRNA levels but to a lesser degree, then the apparent constancy for
+IRE mRNA is actually a decrement and the changes in ±IRE protein
would reflect changes in ±IRE mRNA. No differences between the control
and hpx/hpx mice in the ratio of GAPDH mRNA to total mRNA
could be detected. This suggests that GAPDH mRNA did not demonstrate
significant differences in the hpx/hpx mice relative to the
control animals. Therefore, it can be concluded that transcriptional
control affects expression of
IRE DMT1. This relationship between the
mRNA for
IRE DMT1 and iron is similar to that described for
respiratory epithelial cells where elevated iron correlated with
increases in both mRNA and protein for
IRE DMT1 in cultured BEAS-2B
cells (25). This supports a control at the transcriptional
level or via alternative polyadenylation. However, some other mechanism
appears to be responsible for decrements in +IRE DMT1 protein in the
hpx/hpx mice. Clearly, some form of translational or
posttranslational control of DMT1 expression may contribute to
differences in the +IRE isoform between the two types of mice. ±IRE
isoforms differ in their COOH terminals; the
IRE isoform substitutes
25 amino acids for the COOH-terminal 18 amino acids of the +IRE form.
This difference could affect the levels of the two proteins and the
relative stability of ±IRE DMT1 mRNAs. The effect of iron on this
stability is not known, and further investigation is warranted.
Increased expression of
IRE isoform of DMT1 in hpx/hpx
mice is associated with a decreased susceptibility of the lower
respiratory tract to metal-abundant particles and hyperoxia (10,
26). Tissue injury resulting from an oxidative stress can be
mediated by an increased availability of catalytically reactive metal
(14). In addition to antioxidants in the lung, cells
resident in the lower respiratory tract can contain such an oxidative
stress by transporting the metal and ultimately storing it in a
chemically less reactive form within ferritin (1). After
disruption of iron homeostasis leading to elevation of available,
catalytically active metal, one means of diminishing the
metal-catalyzed oxidant generation would be an increased cellular
uptake with storage within ferritin. It is possible that
IRE DMT1
delivers this iron to intracellular ferritin in the lower respiratory
tract. This increased transport activity probably contributes to
improved amelioration of lung injury in hpx/hpx mice after
the challenges noted above (10, 26).
Alternatively, rather than causing the elevated quantities of nonheme
iron in the lower respiratory tract of a Hp animal, increased
concentrations of
IRE DMT1 could result from a greater availability
of the metal. Iron could be transported into respiratory cells through
some pathway other than transferrin, lactoferrin, or DMT1. The elevated
concentrations of metal could then stimulate expression of the
IRE
isoform. Therefore, rather than mediating the elevation of iron, the
increased expression of DMT1
IRE in these animals would be the result
of accumulated metal. Future experiments should help to distinguish
cause and effect. For example, Belgrade rats have a G185R mutation in
DMT1 that severely reduces iron transport (7).
Experimental analyses that use the Belgrade model in a fashion similar
to the hypotransferrinemic mouse test cause/effect relationships under
conditions where DMT1 is not responsible for most residual iron
transport. Airway tissue of b/b rats increases
(inactive)
IRE DMT1 levels but is more susceptible to damage than
airway tissue of +/b control rats after exposure to a
challenge with an iron-containing agent, supporting the argument that
the increase in this isoform is ordinarily protective (authors' unpublished observations).
We conclude that differences between hpx/hpx and +/+ mice in
nonheme iron concentrations correlated with parallel differences in
expression of
IRE DMT1. Increased expression of the
IRE DMT1 in the
lungs of hpx/hpx mice could be responsible for elevated concentrations of the metal in these tissues. In addition, elevations in this transporter could decrease susceptibility of these mice to
exposure challenges involving oxidative stress associated with increased availability of catalytically active metal.
| |
ACKNOWLEDGEMENTS |
|---|
This research was supported in part by National Institutes of Health Grant DK-59794.
| |
FOOTNOTES |
|---|
This report has been reviewed by the National Health and Environmental Effects Research Laboratory, United States Environmental Protection Agency and approved for publication. Approval does not signify that the contents necessarily reflect the views and policies of the Agency nor does mention of trade names or commercial products constitute endorsement or recommendation for use.
Address for reprint requests and other correspondence: A. J. Ghio, National Health and Environmental Effects Research Laboratory, Office of Research and Development, Environmental Protection Agency, 104 Mason Farm Rd., Research Triangle Park, NC 27711 (E-mail: ghio.andy{at}epa.gov).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
First published February 7, 2003;10.1152/ajplung.00225.2002
Received 12 July 2002; accepted in final form 13 January 2003.
| |
REFERENCES |
|---|
|
|
|---|
1.
Balla, G,
Jacob HS,
Balla J,
Rosenberg M,
Nath K,
Apple F,
Eaton JW,
and
Vercellotti GM.
Ferritin: a cytoprotective antioxidant strategem of endothelium.
J Biol Chem
267:
18148-18153,
1992
2.
Bernstein, SE.
Hereditary hypotransferrinemia with hemosiderosis, a murine disorder resembling human atransferrinemia.
J Lab Clin Med
110:
690-705,
1987[Web of Science][Medline].
3.
Canonne-Hergaux, F,
Fleming MD,
Levy JE,
Gauthier S,
Ralph T,
Picard V,
Andrews NC,
and
Gros P.
The Nramp2/DMT1 iron transporter is induced in the duodenum of microcytic anemia mk mice but is not properly targeted to the intestinal brush border.
Blood
96:
3964-3970,
2000
4.
Canonne-Hergaux, F,
Levy JE,
Fleming MD,
Montross LK,
Andrews NC,
and
Gros P.
Expression of the DMT1 (NRAMP2/DCT1) iron transporter in mice with genetic iron overload disorders.
Blood
97:
1138-1140,
2001
5.
Dickinson, TK,
and
Connor JR.
Cellular distribution of iron, transferrin, and ferritin in the hypotransferrinemic (Hp) mouse brain.
J Comp Neurol
355:
67-80,
1995[Web of Science][Medline].
6.
Farcich, EA,
and
Morgan EH.
Uptake of transferrin-bound and nontransferrin-bound iron by reticulocytes from the Belgrade laboratory rat: comparison with Wistar rat transferrin and reticulocytes.
Am J Hematol
39:
9-14,
1992[Web of Science][Medline].
7.
Fleming, MD,
Romano MA,
Su MA,
Garrick LM,
Garrick MD,
and
Andrews NC.
Nramp2 is mutated in the anemic Belgrade (b) rat: evidence of a role for Nramp2 in endosomal iron transport.
Proc Natl Acad Sci USA
95:
1148-1153,
1998
8.
Fleming, MD,
Trenor CI,
Su MA,
Foernzler D,
Beier DR,
Dietrich WF,
and
Andrews NC.
Microcytic anaemia mice have a mutation in Nramp2, a candidate iron transporter gene.
Nat Genet
16:
383-386,
1997[Web of Science][Medline].
9.
Forbes, JR,
and
Gros P.
Divalent-metal transport by NRAMP proteins at the interface of host-pathogen interactions.
Trends Microbiol
9:
397-403,
2001[Web of Science][Medline].
10.
Ghio, AJ,
Carter JD,
Richards JH,
Crissman KM,
Bobb HH,
and
Yang F.
Diminished injury in hypotransferrinemic mice after exposure to a metal-rich particle.
Am J Physiol Lung Cell Mol Physiol
278:
L1051-L1061,
2000
11.
Ghio, AJ,
Carter JD,
Samet JM,
Reed W,
Quay J,
Dailey LA,
Richards JH,
and
Devlin RB.
Metal-dependent expression of ferritin and lactoferrin by respiratory epithelial cells.
Am J Physiol Lung Cell Mol Physiol
274:
L728-L736,
1998
12.
Garrick, LM,
Dolan KG,
Romano MA,
and
Garrick MD.
Non-transferrin-bound iron uptake in Belgrade and normal rat erythroid cells.
J Cell Physiol
178:
349-358,
1999[Web of Science][Medline].
13.
Gunshin, H,
Mackenzie B,
Berger UV,
Gunshin Y,
Romero MF,
Boron WF,
Nussberger S,
Gollan JL,
and
Hediger MA.
Cloning and characterization of a mammalian proton-coupled metal-ion transporter.
Nature
388:
482-488,
1997[Medline].
14.
Halliwell, B,
and
Gutteridge JMC
The importance of free radicals and catalytic metal ions in human diseases.
Mol Aspects Med
8:
89-193,
1985[Web of Science][Medline].
15.
Huggenvik, JI,
Craven CM,
Idzerda RL,
Bernstein S,
Kaplan J,
and
McKnight GS.
A splicing defect in the mouse transferrin gene leads to congenital atransferrinemia.
Blood
74:
482-486,
1989
16.
Kaplan, J,
Craven C,
Alexander J,
Kushner J,
Lamb J,
and
Bernstein S.
Regulation of the distribution of tissue iron. Lessons learned from the hypotransferrinemic mouse.
Ann NY Acad Sci
526:
124-135,
1988[Web of Science][Medline].
17.
Lash, A,
and
Saleem A.
Iron metabolism and its regulation.
Ann Clin Lab Sci
25:
20-30,
1995[Abstract].
18.
Lee, PL,
Gelbart T,
Halloran C,
and
Beutler E.
The human Nramp2 gene: characterization of the gene structure, alternative splicing, promoter region and polymorphisms.
Blood Cells Mol Dis
24:
199-215,
1998[Web of Science][Medline].
19.
Raja, KB,
Pountney DJ,
Simpson RJ,
and
Peters TJ.
Importance of anemia and transferrin levels in the regulation of intestinal iron absorption in hypotransferrinemic mice.
Blood
94:
3185-3192,
1999
20.
Roth, JA,
Horbinski C,
Feng L,
Dolan KG,
Higgins D,
and
Garrick MD.
Differential localization of divalent metal transporter 1 with and without iron response element in rat PC12 and sympathetic neuronal cells.
J Neurosci
20:
7595-7601,
2000
21.
Thorstensen, K,
and
Romslo I.
The role of transferrin in the mechanism of cellular iron uptake.
Biochem J
271:
1-9,
1990[Web of Science][Medline].
22.
Torrance, JD,
and
Bothwell TH.
Tissue iron stores.
In: Iron, edited by Cook JD.. New York: Churchill Livingstone, 1980, p. 90-115.
23.
Trenor, CI,
Campagna DR,
Sellers VM,
Andrews NC,
and
Fleming MD.
The molecular defect in hypotransferrinemic mice.
Blood
96:
1113-1118,
2000
24.
Vidal, S,
Belouchi AM,
Cellier M,
Beatty B,
and
Gros P.
Cloning and characterization of a second human NRAMP gene on chromosome 12q13.
Mamm Genome
6:
224-230,
1995[Web of Science][Medline].
25.
Wang, X,
Ghio AJ,
Yang F,
Dolan KG,
Garrick MD,
and
Piantadosi CA.
Iron uptake and Nramp-2/DMT1/DCT1in human bronchial epithelial cells.
Am J Physiol Lung Cell Mol Physiol
282:
L987-L995,
2002
26.
Yang, F,
Coalson JJ,
Bobb HH,
Banu J,
and
Ghio AJ.
Resistance of hypotransferrinemic mice to hyperoxia-induced lung injury.
Am J Physiol Lung Cell Mol Physiol
277:
L1214-L1223,
1999
This article has been cited by other articles:
![]() |
A. J. Ghio, C. A. Piantadosi, X. Wang, L. A. Dailey, J. D. Stonehuerner, M. C. Madden, F. Yang, K. G. Dolan, M. D. Garrick, and L. M. Garrick Divalent metal transporter-1 decreases metal-related injury in the lung Am J Physiol Lung Cell Mol Physiol, September 1, 2005; 289(3): L460 - L467. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Yang, D. J. Haile, X. Wang, L. A. Dailey, J. G. Stonehuerner, and A. J. Ghio Apical location of ferroportin 1 in airway epithelia and its role in iron detoxification in the lung Am J Physiol Lung Cell Mol Physiol, July 1, 2005; 289(1): L14 - L23. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |