AJP - Lung Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 284: L938-L944, 2003. First published February 7, 2003; doi:10.1152/ajplung.00225.2002
1040-0605/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
284/6/L938    most recent
00225.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (13)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ghio, A. J.
Right arrow Articles by Yang, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ghio, A. J.
Right arrow Articles by Yang, F.
Vol. 284, Issue 6, L938-L944, June 2003

DMT1 expression is increased in the lungs of hypotransferrinemic mice

Andrew J. Ghio1, Xinchao Wang2, Robert Silbajoris1, Michael D. Garrick3, Claude A. Piantadosi4, and Funmei Yang5

1 National Health and Environmental Effects Research Laboratory, Office of Research and Development, Environmental Protection Agency, Research Triangle Park 27711; 2 Center for Environmental Medicine and Lung Biology, University of North Carolina, Chapel Hill 27599; 3 Department of Biochemistry, State University of New York, Buffalo, New York 14214; 4 Department of Internal Medicine, Duke University Medical Center, Durham, North Carolina 27710; and 5 Department of Cellular and Structural Biology, University of Texas Health Science Center, San Antonio, Texas 78284


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Despite a lack of transferrin, hypotransferrinemic (Hp) mice demonstrate an accumulation of iron in peripheral organs including the lungs. One potential candidate for such transferrin-independent uptake of iron is divalent metal transporter-1 (DMT1), an established iron transporter. We tested the hypothesis that increased concentrations of iron in the lungs of Hp mice are associated with elevations in DMT1 expression. With the use of inductively coupled plasma emission spectroscopy, measurements of nonheme iron confirmed significantly elevated concentrations in the lung tissue of Hp mice relative to the wild-type mice. Western blot analyses for the expression of two isoforms of DMT1 in the Hp mice relative to the wild-type animals demonstrated an elevation for the isoform that lacks an iron-responsive element (IRE) with significant decrements in the expression of +IRE DMT1. With the use of immunohistochemistry, -IRE DMT1 was localized to both airway epithelial cells and alveolar macrophages in wild-type mice. Staining appeared increased in both types of cells in the Hp mice. Elevated concentrations of both tissue nonheme iron and expression of -IRE DMT1 in the Hp mice were associated with increased quantities of -IRE mRNA. There was no difference between wild-type and homozygotic Hp mice in the amount of mRNA for DMT1 +IRE. We conclude that differences between Hp and wild-type mice in nonheme iron concentrations were accompanied by increases in the expression of -IRE DMT1. Increased expression of -IRE DMT1 in the lungs of the Hp mice could be responsible for elevated concentrations of the metal in these tissues.

iron transport; transferrin; membrane transporters


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

HOMOZYGOUS HYPOTRANSFERRINEMIC (gene symbol hpx) mice have greatly diminished concentrations of serum transferrin. Their phenotype therefore informs us where that glycoprotein is most critical in transporting iron into cells. For example, the severe anemia (19) demonstrates that the erythron relies on transferrin. In hpx/hpx mice, a point mutation that alters an invariant nucleotide in the splice donor site after exon 16 of the transferrin gene (23) causes defective splicing (15). As a result, the hpx/hpx mice produce <1% of the normal levels of transferrin. This condition is lethal unless supplementation is accomplished with weekly injections of either transferrin or serum.

Despite this lack of transferrin, hpx/hpx mice demonstrate an accumulation of iron in peripheral organs (e.g., the liver, pancreas, and heart) (5, 16) with the lung (10) to be the focus of the present study. Many types of mammalian cells exhibit an alternative means of mobilizing and transporting non-transferrin-bound iron (NTBI), a transport system yet to be fully characterized. Natural resistance-associated macrophage proteins are a group of transporters in vertebrates that are representative of a small family of structurally and functionally related polypeptides conserved across numerous species, with homologues identified in yeasts, bacteria, worms, flies, and plants (9). Evolutionary conservation suggests that a fundamental function may be common to all of these proteins. Natural resistance-associated macrophage protein type 2, now more frequently referred to as divalent metal transporter 1 (DMT1), is expressed in many tissues and cell types as an integral membrane protein modified by glycosylation (molecular weight of 90-100 kDa) (24). This protein functions to transport divalent metal cations including Fe2+ (13). A G185R mutation that occurs in both the microcytic mouse (8) and the Belgrade rat (7) affects both gastrointestinal iron uptake and endosomal exit of iron after transferrin uptake; hence DMT1 is responsible for both processes. The Belgrade rat is also defective in NTBI transport (6, 12); thus at least one form of NTBI transport also relies on DMT1.

DMT1 generates two alternatively spliced mRNAs (7, 13, 18) that differ at their 3' untranslated region by either the presence or absence of an iron-response element (+IRE and -IRE isoforms, respectively). The two isoforms also differ in the COOH-terminal 18 or 25 amino acids. IREs are found in noncoding portions of mRNA for specific proteins that can be posttranscriptionally regulated in response to cellular iron levels (17). The presence of IRE suggested that DMT1 levels may also be modulated by iron via an IRE-dependent pathway. Exposure of respiratory epithelial cells to iron increases expression of -IRE DMT1 (25); however, it indicates that there is also an IRE-independent iron-regulatory pathway for control of DMT1 expression. Despite the response of the -IRE form, there was little effect of the metal on the +IRE isoform.

Because iron accumulation in the lung is increased in hpx/hpx mice (10), we tested the hypothesis that increased concentrations of iron in the lungs of these mice are associated with elevations in DMT1 expression and found such an elevation. We also investigated whether the -IRE isoform or the +IRE isoform increased in level and found that the former increased, whereas the latter decreased.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Animal model. Homozygous (hpx/hpx) mice were obtained from matings between hpx/+ and hpx/+ animals (originally derived from BALB/c mice). Newborn hpx/hpx pups were small, anemic, and pale at birth. They were maintained by weekly intraperitoneal injections of mouse serum (up to 0.3 ml) (2). Homozygous hpx/hpx and +/+ mice were distinguished by their serum concentrations of transferrin. All animals were kept in pathogen-free facilities and routinely monitored for pathogens and viruses. All procedures were approved by the Institutional Animal Care and Use Committee at the University of Texas Health Science Center and complied with federal regulations.

Nonheme iron concentrations in lung. Nonheme iron concentrations in mouse lungs were measured after precipitation of hemoglobin (22). Lung tissue (0.10 g wet weight) was hydrolyzed in a solution of 3 N HCl and 10.0% trichloroacetic acid (0.10 g lung: 1.0 ml) at 70oC for 16 h. The hydrolyzed tissue was centrifuged at 1,200 g for 10 min. Iron in the supernatant was measured in duplicate using inductively coupled plasma emission spectroscopy (ICPES; = 238.204). Standards included ferric chloride in 3 N HCl and 10% trichloroacetic acid.

Western blot analysis for DMT1. Preparation of isoform-specific antibodies has been previously described (20). Although directed against peptides based on the rat ±IRE DMT1 sequences, each antibody cross-reacts in an isoform-specific manner with the homologous mouse DMT1 protein. Frozen lung tissue was homogenized on ice in buffer containing 1% Nonidet P-40, 0.5% deoxycholate, 0.1% SDS, 10 mM sodium fluoride, 1 mM vanadyl sulfate oxide, 1 mM phenylmethylsulfonyl fluoride, and antiprotease cocktail composed of 1 mM 4-(2-aminoethyl)benzenesulfonyl fluoride, 0.8 µM aprotinin, 20 µM leupeptin, 50 µM bestatin, 10 µM pepstatin A, 15 µM E-64 cocktail set III (cat. no. 539134; Calbiochem, La Jolla, CA) in phosphate-buffered saline (PBS) at pH 7.4. Homogenates were centrifuged at 10,000 g for 10 min at 4oC, and the supernatants were aliquoted and stored at -80oC.

Protein samples (150 µg/lane) were separated by electrophoresis on 15 wells of 8% SDS acrylamide gel and transferred to a nitrocellulose membrane (Bio-Rad). The membrane was blocked with 3% nonfat milk in PBS at pH 7.4 and incubated with one of the antibodies overnight at 4°C. It was stained with a horseradish peroxidase-conjugated goat anti-rabbit IgG antibody (1:2,000; Santa Cruz Biotechnology, Santa Cruz, CA) and developed using enhanced chemiluminescence (ECL kit; Amersham Pharmacia Biotech). Film images were captured and analyzed quantitatively with a Kodak DC120 digital camera with the use of the Digital Science Electrophoresis Documentation and Analysis System 120 (Eastman Kodak, Rochester, NY).

Immunohistochemistry. Tissue sections were cut, floated on a protein-free water bath, mounted on silane-treated slides (Fisher, Raleigh, NC), and air dried overnight. The slides were heat fixed at 60°C in a slide dryer (Shandon Lipshaw, Pittsburgh, PA) for 10 min and cooled to room temperature. Sections were then deparaffinized and hydrated to 95% alcohol (xylene for 10 min, absolute alcohol for 5 min, and 95% alcohol for 5 min). Endogenous peroxidase activity was blocked with H2O2 in absolute methanol (30% H2O2 in 30 ml of methanol) for 8 min. Slides were rinsed in 95% alcohol for 2 min, placed in deionized H2O, and washed in PBS. After treatment with Cyto Q Background Buster (Innovex Biosciences) for 10 min, slides were incubated with the primary antibody diluted in 1% bovine serum albumin for 45 min at 37°C in PBS at a dilution of 1:100. Slides were incubated with biotinylated linking antibody from Stat-Q Staining System (Innovex Biosciences) for 10 min at room temperature and washed with PBS, and a peroxidase enzyme label from Stat-Q Staining System was applied. After being incubated for 10 min at room temperature and being washed with PBS, tissue sections were developed with 3,3'-diaminobenzidine-tetrahydrochloride for 3 min at room temperature. The sections were counterstained with hematoxylin, dehydrated through alcohols, cleared in xylene, and coverslipped with the use of a permanent mounting media.

Reverse transcriptase-polymerase chain reaction. Mouse lung tissue was collected and snap frozen in liquid nitrogen. Total RNA was extracted from the lung tissue homogenates using TRIzol reagent (Life Technologies, Bethesda, MD). Lysates were sheared with four passes through a 22-gauge syringe. First-strand cDNAs were synthesized from 0.4 g of total RNA in 100 µl of a buffer containing 5 µM random hexaoligonucleotide primers, 10 U/µl Moloney murine leukemia virus reverse transcriptase, 1 U/µl RNasin, 0.5 mM dNTP, 50 mM KCl, 3 mM MgCl2, and 10 mM Tris · HCl (pH 9.3). After a 1-h incubation at 39°C, the reverse transcriptase was heat inactivated at 94°C for 4 min. Quantitative PCR was performed by using polymerase with detection of Taqman fluorescence on an sequence detector (ABI Prism 7700; PE Biosystems, Foster City, CA). DMT1 mRNA levels were normalized by using the expression of GAPDH as a housekeeping gene. Relative quantitation of both DMT1 and GAPDH mRNA was based on standard curves prepared from serially diluted mouse mast cell cDNA. The following primer sequences were used. DMT1 (-IRE): sense, CGTACCGCCTGGGACTGA; antisense, GTCATCTGGACACCACTGAGTCA; Taqman probe, CAGCCTGAACTCTATCTTCTGAACACCGTGG. DMT1 (+IRE): sense, TGGGCCAGGCACGTCTAC; antisense, GCTGCCTAATGCTACAGGGTAAG; Taqman probe, CTCATCTTAAGCATACATGACAGCCAGGCA. GAPDH: sense, CATGGCCTTCCGTGTTCCTA; antisense, TGTCATCATACTTGGCAGGTTTCT; Taqman probe, TCGTGGATCTGACGTGCCGCC.

Uptake of iron by alveolar macrophages. After being anesthetized with metafane, animals were euthanized by exsanguination through the abdominal aorta. Lungs from +/+ and hpx/hpx mice were then lavaged with 1.0 ml of normal saline (0.9% NaCl). The lavage was repeated four times, and the cells were pooled. Alveolar macrophages (1.0 × 106/ml RPMI 1640) were exposed to 50 µg oil fly ash containing a high concentration of iron compounds soluble in aqueous solution (8,154 ppm) (5). Cell suspensions were collected at 0, 15, 30, and 60 min. After centrifugation at 600 g, the concentration of iron in the supernatant was measured with the use of ICPES (lambda  = 238.204).

Ferritin concentrations in alveolar macrophages. Alveolar macrophages (1.0 × 106/ml RPMI 1640) were again exposed to 50 µg oil fly ash. Cell suspensions were collected at 0 and 60 min, centrifuged at 600 g for 10 min, washed in PBS, and sonicated. L-ferritin concentrations were measured with a commercially available kit (an enzyme immunoassay), controls, and standards from Microgenics (Concord, CA). These assays were modified for use in the Cobas Fara II centrifugal spectrophotometer (Hoffman-LaRoche, Branchburg, NJ).

Statistics. Values are means ± SE. Differences between the homozygotes and wild-type mice were analyzed employing t-test of independent means. Differences between multiple groups were compared with one-way ANOVA. Duncan's multiple-range test was used as a post hoc test. Two-tailed tests of significance were employed. Significance was assumed at P < 0.05.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

hpx/hpx mice can exhibit a siderosis of peripheral organs (16). ICPES measurements of nonheme iron confirmed significantly elevated concentrations in the lung tissue of hpx/hpx mice relative to +/+ controls (Fig. 1). Explaining these increased quantities of metal in this tissue is a challenge because concentrations of transferrin are extremely low in serum, so one must postulate an alternative pathway of iron uptake. DMT1 is a second transporter that could possibly contribute to elevated quantities of the metal in the lungs (25). Western blot analyses demonstrated an elevation in the expression of -IRE DMT1 in hpx/hpx mice relative to the controls (Fig. 2A). Densitometry supported a ninefold increase in the expression of this isoform in the hpx/hpx mice (Fig. 2B). In contrast, there were significant decrements in the expression of +IRE DMT1 in the Hp mouse relative to the controls (Fig. 3A). This decrement in the +IRE isoform of DMT1 was similarly confirmed by densitometry (Fig. 3B).


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 1.   Tissue was hydrolyzed in a solution of 3 N HCl and 10.0% trichloroacetic acid (0.10 g lung: 1.0 ml) at 70oC for 16 h before measurement of metal. The homozygotic hypotransferrinemic (Hp) mice exhibited higher concentrations of tissue nonheme iron relative to the wild-type animals. hpx, Genetic homozygous hypotransferrinemic. *P < 0.05, significantly increased relative to wild-type animals.



View larger version (34K):
[in this window]
[in a new window]
 
Fig. 2.   Western blot analyses for negative iron responsive element (-IRE) divalent metal transporter-1 (DMT1). A: the main band represents a protein with a molecular weight of ~90 kDa. Extracts of six separate lungs acquired from wild-type animals is shown at top, whereas the tissue at bottom is from hpx/hpx mice. Only one lung from a wild-type animal demonstrated higher levels of -IRE DMT1, whereas only one hpx/hpx had a low signal. The intensity of the band for -IRE DMT1 was greater in the Hp mice relative to the wild-type animals. B: densitometry. Quantitation supported a ninefold increase in -IRE DMT1 in hpx/hpx mice relative to +/+. *P < 0.05, significantly increased relative to wild-type animals.



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 3.   Western blot analyses for +IRE DMT1. A: extracts of six lungs acquired from +/+ animals are shown at top, whereas the tissue at bottom is from hpx/hpx mice. In contrast to -IRE data, Hp animals demonstrated a decrement in the expression of +IRE DMT1. B: densitometric quantitation confirmed an eight- to ninefold decrease in band intensity for +IRE DMT1 in the hpx/hpx mice relative to +/+. *P < 0.05, significantly decreased relative to wild-type animals.

Lungs of both Hp and wild-type mice were excised and embedded in paraffin. An increased expression of -IRE DMT1 was evident on immunohistochemistry in the hpx/hpx mice relative to a +/+ control. DMT1 (-IRE) was localized to both airway epithelial cells and alveolar macrophages in wild-type mice. Staining appeared increased in both epithelial and phagocytic cells in the Hp mice, with the most obvious elevation in expression being in the alveolar epithelium (Fig. 4); much of the intracellular staining was in the nuclei. Staining with antibody for the +IRE isoform in the lungs of either hpx/hpx or +/+ mice was very weak (not shown), rendering disparities between genotypes not discernible.


View larger version (78K):
[in this window]
[in a new window]
 
Fig. 4.   Immunohistochemistry for -IRE DMT1. A: +/+; B: hpx/hpx. Staining was stronger with -IRE DMT1 antibody in the lungs of hpx/hpx mice relative to the +/+ wild-type animals. The significant staining of the periphery of the lung in the hpx/hpx mice is reflected by the brown coloration of the tissue. The control mice demonstrate very little uptake of the antibody, and the counterstain dominates with blue coloration of the tissue.

Comparable with cultured airway epithelial cell (25), mRNA for -IRE DMT1 was more abundant in the lungs of both types of mice relative to +IRE DMT1. In vitro investigation has led to the suggestion that iron can affect -IRE DMT1 through a mechanism that alters polyadenylation and/or transcription (25). Thus Hp mice were investigated for their mRNA levels (Fig. 5). Elevated concentrations of both tissue nonheme iron and expression of this protein in the Hp mice were associated with increased quantities of -IRE DMT1 mRNA relative to GAPDH mRNA (Fig. 5A). There was little difference between +/+ and hpx/hpx mice in the amount of mRNA for +IRE DMT1 (Fig. 5B).


View larger version (10K):
[in this window]
[in a new window]
 
Fig. 5.   Levels of mRNA for DMT1 isoforms of IRE in the lung. A: -IRE; B: +IRE. Assuming that GAPDH mRNA levels are unchanged, there is more than twice as much -IRE mRNA in hpx/hpx mice as in +/+ mice; this difference is significant. Levels of mRNA for +IRE DMT1 relative to GAPDH mRNA demonstrate no disparities between the two types of mice. *P < 0.05, significantly increased relative to wild-type animals.

It was also of value to ask whether the increased expression of -IRE DMT1 in cells resident in the lower respiratory tract led to increased function with respect to iron uptake. Therefore, alveolar macrophages were collected from both +/+ and hpx/hpx mice and exposed to an emission source air pollution particle with high concentrations of metals, including iron (i.e., oil fly ash). Phagocytes obtained from both types of mice rapidly transported the metal. The time-dependent uptake of this metal, however, was significantly accelerated for cells obtained from hpx/hpx mice compared with +/+ mice, confirming increased functional expression of -IRE DMT1 (Fig. 6). This increased transport of the metal was associated with elevated concentrations of ferritin in the macrophages (Fig. 7; global F value = 188, P < 0.0001). All comparisons with those alveolar macrophages obtained from wild-type animals exposed to media were significant. The comparison between ferritin concentrations in alveolar macrophages obtained from hpx/hpx mice exposed to media and oil fly ash was also significant.


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 6.   Iron concentration remaining in supernatants of alveolar macrophages after exposure to oil fly ash. There was a rapid time-dependent uptake of the metal by the alveolar macrophages. This rate was significantly increased in phagocytes acquired from hpx/hpx mice relative to wild-type mice, with the difference significant for each point (n = 6 mice of each genotype/time point; plotted as means ± SD). *P < 0.05, significantly decreased relative to wild-type animals.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 7.   Concentrations of ferritin in alveolar macrophages from wild-type and hpx/hpx animals. Relative to the wild-type mouse, there was a significantly elevated concentration of ferritin in those cells derived from the hypotransferrinemic mice before any exposure. Ferritin concentrations in the alveolar macrophages increased significantly 1 h after exposure to the oil fly ash (n = 6 mice of each genotype/time point; plotted as means ± SD).


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Iron is an essential micronutrient utilized in many aspects of normal cell function. To transfer iron across a membrane, mammalian cells frequently rely on the glycoprotein transferrin in a cyclic mechanism dependent on the transferrin receptor (21). One alternative mechanism of iron transport employs lactoferrin, a monomeric, cationic metal-binding glycoprotein commonly found in human mucosal secretions (e.g., milk, tears, semen, and plasma) and in the specific granules of polymorphonuclear leukocytes (11). Nevertheless, respiratory epithelial cells demonstrate a rapid (within 60 min) transport of metal from buffer that does not contain either transferrin or lactoferrin (25). This absence suggests a transport pathway of iron independent of both glycoproteins. The capacity of DMT1 to carry out NTBI uptake (6, 12) immediately indicts this transporter. Elevations in both the mRNA and protein levels for -IRE DMT1 correlated with increased metal uptake after exposure to iron, supporting a potential participation of this protein in a detoxification of iron by a cell (25). Consequently, increased uptake of iron by elevated concentrations of DMT1 was investigated as one potential pathway for an accumulation of nontransferrin-bound iron in the lower respiratory tract of hpx/hpx mice.

Western blot analysis and immunohistochemistry both reveal an increased expression of DMT1 in hpx/hpx relative to +/+ mice, but this increase was specific for the -IRE isoform only. Relative to the wild-type mice, there was an actual decrease in expression of +IRE DMT1 protein. In human airway epithelial cells, there appears to be less +IRE protein relative to -IRE (25). The relative abundance of the -IRE form in airways is in contrast to data for the duodenum in which the +IRE isoform exceeds the -IRE isoform in expression (3). The significance of these disparities in the expression of one isoform relative to the other is unknown. It may reflect dissimilar functions, with the purpose of the +IRE isoform being to provide metal for nutritional requirements and that of -IRE DMT1 to diminish availability of catalytically active iron and associated reactive oxygen species. In support of dissimilar roles for the isoforms, hpx/hpx mice also exhibit an increased expression of DMT1 in the duodenum but the elevation is in the +IRE isoform (4).

Comparable with protein levels, there were increases in the level of -IRE DMT1 mRNA in hpx/hpx mice relative to GAPDH mRNA compared with +/+ mice. In contrast, the +IRE mRNA levels changed little if at all relative to GAPDH mRNA in hpx/hpx mice compared with +/+ mice. However, the level of +IRE DMT1 protein decreased in hpx/hpx mice. Quantitative interpretation of these comparisons depends on the assumption that GAPDH mRNA levels remain unchanged. This assumption is frequently made, but it can be incorrect when iron is involved (M. Muckenthaler and M. W. Hentze, personal communication). If GAPDH mRNA levels go up with -IRE DMT1 mRNA levels but to a lesser degree, then the apparent constancy for +IRE mRNA is actually a decrement and the changes in ±IRE protein would reflect changes in ±IRE mRNA. No differences between the control and hpx/hpx mice in the ratio of GAPDH mRNA to total mRNA could be detected. This suggests that GAPDH mRNA did not demonstrate significant differences in the hpx/hpx mice relative to the control animals. Therefore, it can be concluded that transcriptional control affects expression of -IRE DMT1. This relationship between the mRNA for -IRE DMT1 and iron is similar to that described for respiratory epithelial cells where elevated iron correlated with increases in both mRNA and protein for -IRE DMT1 in cultured BEAS-2B cells (25). This supports a control at the transcriptional level or via alternative polyadenylation. However, some other mechanism appears to be responsible for decrements in +IRE DMT1 protein in the hpx/hpx mice. Clearly, some form of translational or posttranslational control of DMT1 expression may contribute to differences in the +IRE isoform between the two types of mice. ±IRE isoforms differ in their COOH terminals; the -IRE isoform substitutes 25 amino acids for the COOH-terminal 18 amino acids of the +IRE form. This difference could affect the levels of the two proteins and the relative stability of ±IRE DMT1 mRNAs. The effect of iron on this stability is not known, and further investigation is warranted.

Increased expression of -IRE isoform of DMT1 in hpx/hpx mice is associated with a decreased susceptibility of the lower respiratory tract to metal-abundant particles and hyperoxia (10, 26). Tissue injury resulting from an oxidative stress can be mediated by an increased availability of catalytically reactive metal (14). In addition to antioxidants in the lung, cells resident in the lower respiratory tract can contain such an oxidative stress by transporting the metal and ultimately storing it in a chemically less reactive form within ferritin (1). After disruption of iron homeostasis leading to elevation of available, catalytically active metal, one means of diminishing the metal-catalyzed oxidant generation would be an increased cellular uptake with storage within ferritin. It is possible that -IRE DMT1 delivers this iron to intracellular ferritin in the lower respiratory tract. This increased transport activity probably contributes to improved amelioration of lung injury in hpx/hpx mice after the challenges noted above (10, 26).

Alternatively, rather than causing the elevated quantities of nonheme iron in the lower respiratory tract of a Hp animal, increased concentrations of -IRE DMT1 could result from a greater availability of the metal. Iron could be transported into respiratory cells through some pathway other than transferrin, lactoferrin, or DMT1. The elevated concentrations of metal could then stimulate expression of the -IRE isoform. Therefore, rather than mediating the elevation of iron, the increased expression of DMT1 -IRE in these animals would be the result of accumulated metal. Future experiments should help to distinguish cause and effect. For example, Belgrade rats have a G185R mutation in DMT1 that severely reduces iron transport (7). Experimental analyses that use the Belgrade model in a fashion similar to the hypotransferrinemic mouse test cause/effect relationships under conditions where DMT1 is not responsible for most residual iron transport. Airway tissue of b/b rats increases (inactive) -IRE DMT1 levels but is more susceptible to damage than airway tissue of +/b control rats after exposure to a challenge with an iron-containing agent, supporting the argument that the increase in this isoform is ordinarily protective (authors' unpublished observations).

We conclude that differences between hpx/hpx and +/+ mice in nonheme iron concentrations correlated with parallel differences in expression of -IRE DMT1. Increased expression of the -IRE DMT1 in the lungs of hpx/hpx mice could be responsible for elevated concentrations of the metal in these tissues. In addition, elevations in this transporter could decrease susceptibility of these mice to exposure challenges involving oxidative stress associated with increased availability of catalytically active metal.


    ACKNOWLEDGEMENTS

This research was supported in part by National Institutes of Health Grant DK-59794.


    FOOTNOTES

This report has been reviewed by the National Health and Environmental Effects Research Laboratory, United States Environmental Protection Agency and approved for publication. Approval does not signify that the contents necessarily reflect the views and policies of the Agency nor does mention of trade names or commercial products constitute endorsement or recommendation for use.

Address for reprint requests and other correspondence: A. J. Ghio, National Health and Environmental Effects Research Laboratory, Office of Research and Development, Environmental Protection Agency, 104 Mason Farm Rd., Research Triangle Park, NC 27711 (E-mail: ghio.andy{at}epa.gov).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

First published February 7, 2003;10.1152/ajplung.00225.2002

Received 12 July 2002; accepted in final form 13 January 2003.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Balla, G, Jacob HS, Balla J, Rosenberg M, Nath K, Apple F, Eaton JW, and Vercellotti GM. Ferritin: a cytoprotective antioxidant strategem of endothelium. J Biol Chem 267: 18148-18153, 1992[Abstract/Free Full Text].

2.   Bernstein, SE. Hereditary hypotransferrinemia with hemosiderosis, a murine disorder resembling human atransferrinemia. J Lab Clin Med 110: 690-705, 1987[Web of Science][Medline].

3.   Canonne-Hergaux, F, Fleming MD, Levy JE, Gauthier S, Ralph T, Picard V, Andrews NC, and Gros P. The Nramp2/DMT1 iron transporter is induced in the duodenum of microcytic anemia mk mice but is not properly targeted to the intestinal brush border. Blood 96: 3964-3970, 2000[Abstract/Free Full Text].

4.   Canonne-Hergaux, F, Levy JE, Fleming MD, Montross LK, Andrews NC, and Gros P. Expression of the DMT1 (NRAMP2/DCT1) iron transporter in mice with genetic iron overload disorders. Blood 97: 1138-1140, 2001[Abstract/Free Full Text].

5.   Dickinson, TK, and Connor JR. Cellular distribution of iron, transferrin, and ferritin in the hypotransferrinemic (Hp) mouse brain. J Comp Neurol 355: 67-80, 1995[Web of Science][Medline].

6.   Farcich, EA, and Morgan EH. Uptake of transferrin-bound and nontransferrin-bound iron by reticulocytes from the Belgrade laboratory rat: comparison with Wistar rat transferrin and reticulocytes. Am J Hematol 39: 9-14, 1992[Web of Science][Medline].

7.   Fleming, MD, Romano MA, Su MA, Garrick LM, Garrick MD, and Andrews NC. Nramp2 is mutated in the anemic Belgrade (b) rat: evidence of a role for Nramp2 in endosomal iron transport. Proc Natl Acad Sci USA 95: 1148-1153, 1998[Abstract/Free Full Text].

8.   Fleming, MD, Trenor CI, Su MA, Foernzler D, Beier DR, Dietrich WF, and Andrews NC. Microcytic anaemia mice have a mutation in Nramp2, a candidate iron transporter gene. Nat Genet 16: 383-386, 1997[Web of Science][Medline].

9.   Forbes, JR, and Gros P. Divalent-metal transport by NRAMP proteins at the interface of host-pathogen interactions. Trends Microbiol 9: 397-403, 2001[Web of Science][Medline].

10.   Ghio, AJ, Carter JD, Richards JH, Crissman KM, Bobb HH, and Yang F. Diminished injury in hypotransferrinemic mice after exposure to a metal-rich particle. Am J Physiol Lung Cell Mol Physiol 278: L1051-L1061, 2000[Abstract/Free Full Text].

11.   Ghio, AJ, Carter JD, Samet JM, Reed W, Quay J, Dailey LA, Richards JH, and Devlin RB. Metal-dependent expression of ferritin and lactoferrin by respiratory epithelial cells. Am J Physiol Lung Cell Mol Physiol 274: L728-L736, 1998[Abstract/Free Full Text].

12.   Garrick, LM, Dolan KG, Romano MA, and Garrick MD. Non-transferrin-bound iron uptake in Belgrade and normal rat erythroid cells. J Cell Physiol 178: 349-358, 1999[Web of Science][Medline].

13.   Gunshin, H, Mackenzie B, Berger UV, Gunshin Y, Romero MF, Boron WF, Nussberger S, Gollan JL, and Hediger MA. Cloning and characterization of a mammalian proton-coupled metal-ion transporter. Nature 388: 482-488, 1997[Medline].

14.   Halliwell, B, and Gutteridge JMC The importance of free radicals and catalytic metal ions in human diseases. Mol Aspects Med 8: 89-193, 1985[Web of Science][Medline].

15.   Huggenvik, JI, Craven CM, Idzerda RL, Bernstein S, Kaplan J, and McKnight GS. A splicing defect in the mouse transferrin gene leads to congenital atransferrinemia. Blood 74: 482-486, 1989[Abstract/Free Full Text].

16.   Kaplan, J, Craven C, Alexander J, Kushner J, Lamb J, and Bernstein S. Regulation of the distribution of tissue iron. Lessons learned from the hypotransferrinemic mouse. Ann NY Acad Sci 526: 124-135, 1988[Web of Science][Medline].

17.   Lash, A, and Saleem A. Iron metabolism and its regulation. Ann Clin Lab Sci 25: 20-30, 1995[Abstract].

18.   Lee, PL, Gelbart T, Halloran C, and Beutler E. The human Nramp2 gene: characterization of the gene structure, alternative splicing, promoter region and polymorphisms. Blood Cells Mol Dis 24: 199-215, 1998[Web of Science][Medline].

19.   Raja, KB, Pountney DJ, Simpson RJ, and Peters TJ. Importance of anemia and transferrin levels in the regulation of intestinal iron absorption in hypotransferrinemic mice. Blood 94: 3185-3192, 1999[Abstract/Free Full Text].

20.   Roth, JA, Horbinski C, Feng L, Dolan KG, Higgins D, and Garrick MD. Differential localization of divalent metal transporter 1 with and without iron response element in rat PC12 and sympathetic neuronal cells. J Neurosci 20: 7595-7601, 2000[Abstract/Free Full Text].

21.   Thorstensen, K, and Romslo I. The role of transferrin in the mechanism of cellular iron uptake. Biochem J 271: 1-9, 1990[Web of Science][Medline].

22.   Torrance, JD, and Bothwell TH. Tissue iron stores. In: Iron, edited by Cook JD.. New York: Churchill Livingstone, 1980, p. 90-115.

23.   Trenor, CI, Campagna DR, Sellers VM, Andrews NC, and Fleming MD. The molecular defect in hypotransferrinemic mice. Blood 96: 1113-1118, 2000[Abstract/Free Full Text].

24.   Vidal, S, Belouchi AM, Cellier M, Beatty B, and Gros P. Cloning and characterization of a second human NRAMP gene on chromosome 12q13. Mamm Genome 6: 224-230, 1995[Web of Science][Medline].

25.   Wang, X, Ghio AJ, Yang F, Dolan KG, Garrick MD, and Piantadosi CA. Iron uptake and Nramp-2/DMT1/DCT1in human bronchial epithelial cells. Am J Physiol Lung Cell Mol Physiol 282: L987-L995, 2002[Abstract/Free Full Text].

26.   Yang, F, Coalson JJ, Bobb HH, Banu J, and Ghio AJ. Resistance of hypotransferrinemic mice to hyperoxia-induced lung injury. Am J Physiol Lung Cell Mol Physiol 277: L1214-L1223, 1999[Abstract/Free Full Text].


Am J Physiol Lung Cell Mol Physiol 284(6):L938-L944



This article has been cited by other articles:


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
D. W. Reid, G. J. Anderson, and I. L. Lamont
Role of lung iron in determining the bacterial and host struggle in cystic fibrosis
Am J Physiol Lung Cell Mol Physiol, November 1, 2009; 297(5): L795 - L802.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
A. J. Ghio, C. A. Piantadosi, X. Wang, L. A. Dailey, J. D. Stonehuerner, M. C. Madden, F. Yang, K. G. Dolan, M. D. Garrick, and L. M. Garrick
Divalent metal transporter-1 decreases metal-related injury in the lung
Am J Physiol Lung Cell Mol Physiol, September 1, 2005; 289(3): L460 - L467.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
F. Yang, D. J. Haile, X. Wang, L. A. Dailey, J. G. Stonehuerner, and A. J. Ghio
Apical location of ferroportin 1 in airway epithelia and its role in iron detoxification in the lung
Am J Physiol Lung Cell Mol Physiol, July 1, 2005; 289(1): L14 - L23.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
284/6/L938    most recent
00225.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (13)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ghio, A. J.
Right arrow Articles by Yang, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ghio, A. J.
Right arrow Articles by Yang, F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2003 by the American Physiological Society.