AJP - Lung Watch the video to see how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 284: L990-L996, 2003. First published February 28, 2003; doi:10.1152/ajplung.00415.2002
1040-0605/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
284/6/L990    most recent
00415.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (13)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kotton, D. N.
Right arrow Articles by Fine, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kotton, D. N.
Right arrow Articles by Fine, A.
Vol. 284, Issue 6, L990-L996, June 2003

Stem cell antigen-1 expression in the pulmonary vascular endothelium

Darrell N. Kotton, Ross S. Summer, Xi Sun, Bei Yang Ma, and Alan Fine

The Pulmonary Center, Boston University School of Medicine, Boston, Massachusetts 02118


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Although the function of the cell surface protein stem cell antigen-1 (Sca-1) has not been identified, expression of this molecule is a characteristic of bone marrow-derived hematopoietic stem cell populations. Expression of Sca-1, however, is not restricted to hematopoietic tissue. By RT-PCR and Western analysis, we found that Sca-1 is expressed in the adult mouse lung. Sca-1 immunohistochemistry revealed a linear staining pattern on the endothelial surface of large and small pulmonary arteries and veins and alveolar capillaries. Expression of Sca-1 in the pulmonary endothelium was confirmed by dual fluorescent microscopy on lung sections and by fluorescence-activated cell sorting analysis of digested lung tissue; each of these methods showed colocalization with the endothelial marker platelet/endothelial cell adhesion molecule-1. In the kidney, Sca-1 expression was also noted in large vessels, but, in contrast to the lung, was not observed in capillaries. Overall, our data indicate that Sca-1 expression helps define the surface phenotype of endothelial cells throughout the pulmonary vasculature.

lung; endothelial cell marker


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

STEM CELL ANTIGEN-1 (Sca-1) is a phosphatidylinositol-anchored glycoprotein found on the surface of several murine marrow stem cell subtypes, including hematopoietic stem cells (HSCs) (28, 30), mesenchymal stem cells, multipotent adult progenitor cells (14), and Hoechst side population (SP) cells (9, 11). Each of these cell types displays a capacity for multilineage differentiation and self-renewal. Notably, the characterization and purification of bone marrow-derived stem cells are often based on the expression of selective cell surface markers, such as Sca-1 (30).

Expression of Sca-1, like other stem cell markers, is not restricted to the bone marrow. Cells expressing this antigen can be found in murine peripheral lymphocyte subpopulations, within the thymic medulla, and in the spleen (21, 22, 30). Sca-1 expression is also present in the parenchyma of nonhematopoietic tissues such as the tubular epithelium of the kidney and the vasculature of the brain, heart, and liver (30). Recently, Sca-1-positive cells in murine muscle interstitium have been identified; these cells are able to serve as progenitors for muscle and endothelium (29). In breast tissue, epithelial progenitors with a Hoechst-negative staining profile express Sca-1 (31). Despite these observations, it remains unclear whether Sca-1 expression in nonhematopoietic tissue connotes cells with stem and progenitor cell capacity or marks cells of bone marrow origin. Indeed, the function of Sca-1 in stem cells remains uncertain, although it appears to have a role in lymphocyte activation and has also been referred to as T cell-activating protein (20, 25).

In the adult murine lung, Sca-1 mRNA and protein can be detected, but whether this expression is restricted to circulating cells present in lung blood vessels or differentiated parenchymal cells is not currently known (24, 30). In this paper, we sought to identify cell types expressing Sca-1 in the adult lung. Our findings indicate that Sca-1 expression is localized to the surface of endothelial cells throughout the pulmonary vasculature.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Mice. Protein and RNA extracts, single cell suspensions, and sections for immunohistochemistry were prepared from 2-mo-old C57Bl/6j mice (Jackson Laboratories, Bar Harbor, ME) euthanized by isoflurane anesthesia followed by cervical dislocation and perfusion of lungs with cold saline irrigated through the right ventricle. Animal studies were conducted according to protocols approved by the Boston University Animal Use Committee and adhered strictly to National Institutes of Health guidelines for the use and care of experimental animals.

Western blot analysis. SDS-PAGE (15% polyacrylamide) was performed under nonreducing conditions on protein extracts from homogenized murine lungs. Proteins were transferred onto a polyvinylidene fluoride membrane (Immobilon-P; Millipore, Bedford, MA; 300 mA, 4°C, 1 h). This membrane was blocked with 5% nonfat dry milk in Tris-buffered saline with Tween 20 (TBST; 20 mM Tris · HCl, pH 8.0, 150 mM NaCl, 0.1% Tween 20, 1 h, 22°C). After being washed in TBST, monoclonal rat anti-mouse Sca-1 was applied (eBioscience no. 14-5981, San Diego, CA; diluted 1:250 in TBST overnight at 4°C) followed by further washes and incubation with a horseradish peroxidase (HRP)-conjugated goat anti-rat IgG secondary antibody (Santa Cruz no. 2065, Santa Cruz, CA; diluted 1:4,000 in 1% milk TBST for 1 h at 22°C). Bound antibody was detected with a Western blotting chemiluminescence kit (ECL, Amersham) according to the manufacturer's instructions.

RT-PCR. RNA extracts from lung and marrow samples were analyzed by generating cDNA using a reverse transcription kit (Promega, Madison, WI) followed by PCR using primers for Sca-1 (forward primer: CTCTGAGGATGGACACTTCT, reverse primer: GGTCTGCAGGAGGACTGAGC; 94°C for 1 min, 56°C for 1 min, 72°C for 1 min, 35 cycles).

Fluorescence-activated cell sorting. To prepare single cell suspensions of lung tissue, euthanized mice underwent perfusion of their lungs via the right ventricle with ice-cold PBS (pH 7.4). Whole lungs were then dissected free from the thorax, finely minced by razor blade, and enzymatically digested for 50 min at 37°C with a solution consisting of 0.1% collagenase A (Roche Diagnostics, Indianapolis, IN) in 2.4 U/ml of dispase II (Roche). Lung digests were then filtered (70-µm Falcon cell strainer; Becton Dickinson, Franklin Lakes, NJ) and washed twice in Hanks' balanced salt solution+ (2% fetal bovine serum, 10 mM HEPES in Hanks' buffer) before resuspending at 5 × 106 cells/ml for antibody staining. Flow cytometric analysis of immunolabeled cell surface markers was performed by simultaneous staining with three antibodies: phycoerythrin (PE)-, FITC-, and allophycocyanin (APC)-conjugated monoclonal rat anti-mouse IgGs against Sca-1, CD45, and platelet/endothelial cell adhesion molecule-1 (PECAM-1), respectively (BD Pharmingen, San Diego, CA). In addition, cells were exposed to propidium iodide (PI; 1 µg/ml in PBS) to identify dead cells, which were excluded from analysis. Only experiments in which >85% of cells were alive (PI negative) were included. Nonspecific control rat IgG antibodies of identical isotype (IgG2a,kappa -PE, IgG2b,kappa -FITC, IgG2a,kappa -APC, Pharmingen) were included in all experiments and were used to set fluorescence-activated cell sorting (FACS) gates for analysis. Fluorescent antibody-exposed live cells were analyzed by flow cytometry (MoFlo; Cytomation, Fort Collins, CO), and data were processed using FlowJo software (Treestar, San Carlos, CA). Lungs from each adult mouse were analyzed separately, and experiments were repeated on 12 C57Bl/6j mice from 6 separate litters and 3 FVB/NJ male mice (Jackson Laboratories). FACS analysis for Sca-1 expression in a pulmonary endothelial cell line was similarly performed using the MFLM-4 cell line (generous gift of Dr. Ann Akeson, Children's Hospital Medical Center, Cincinnati, OH), which was grown and harvested under established conditions (2, 3).

Sca-1 and PECAM-1 immunohistochemistry of tissue sections. Formalin-fixed lungs and kidneys were prepared for frozen or paraffin sectioning through standard methods. Paraffin sections (5-µm-thick) were rehydrated by exposure to solvent (Citrisolv; Fisher Scientific, Hanover Park, IL), graded alcohols, and distilled water. Antigen retrieval was performed by heating sections to 90°C in a citric acid buffer (Antigen Retrieval Solution; Vector Laboratories, Burlingame, CA) for 20 min and slowly cooling to room temperature. Before being stained, sections were treated with hydrogen peroxide in methanol (3%, 15 min, 22°C) to quench endogenous peroxidases. Sections were blocked with 1% goat serum in PBS (60 min) and incubated overnight (4°C) with the appropriate antibody: biotinylated monoclonal rat anti-mouse Sca-1 diluted 1:100 (Pharmingen no. 553334), biotinylated rat IgG2a,kappa isotype control (Pharmingen), or polyclonal goat anti-mouse PECAM-1 diluted 1:4,000 (Santa Cruz no. sc-1506). Biotinylated anti-Sca-1 antibody was detected using an ABC kit (Vector Laboratories) followed by tyramide signal amplification (TSA-Biotin System; NEN, Boston, MA) according to the manufacturer's protocol before exposure to diaminobenzadine. Anti-PECAM-1 antibody was detected using an anti-goat secondary antibody kit (Vector Laboratories) before tyramide signal amplification. For fluorescent immunostaining, 5-µm-thick frozen sections were quenched with 1% sodium borohydride for 30 min before identical immunostaining conditions. 7-Amino-4-methylcoumarin-3-acetic acid- or Texas red-conjugated avidin (5 µg/ml, Vector Laboratories) were substituted for HRP-streptavidin during tyramide signal amplification to achieve fluorescent signals. To ensure specificity of immunostaining, for each analysis, adjacent control sections in each experiment underwent identical and simultaneous staining with isotype control antibody (biotinylated rat IgG2a,kappa isotype control, Pharmingen) in place of anti-Sca-1, and secondary antibody alone substituted for anti-PECAM-1. Immunohistochemistry was repeated on tissue from three C57Bl/6j mice.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Sca-1 mRNA and protein expression in lung tissue. We found by RT-PCR that Sca-1 mRNA is present in adult lung tissue (Fig. 1). For positive controls, we employed RNA derived from fresh bone marrow cells or cultured marrow-derived mesenchymal stem cells known to express Sca-1. To examine this further, we next performed a Western blot analysis on whole lung extracts for Sca-1 protein expression. In this study, we detected an ~8 kDa protein; this is the expected weight of Sca-1 protein when analyzed by SDS-PAGE under nonreducing conditions (21, 30).


View larger version (43K):
[in this window]
[in a new window]
 
Fig. 1.   Stem cell antigen-1 (Sca-1) expression in adult murine lung. A: RT-PCR showing expression of Sca-1 mRNA in adult murine tissues, including lung extracts. Fresh whole marrow (BM), cultured plastic-adherent marrow (MSC), and lung RNA extracts are shown. Water was used as a negative control (Neg). B: Western blot analysis of lung protein extracts using an anti-Sca-1 antibody. C: fluorescence-activated cell sorting (FACS) analysis of lung digests using nonspecific fluorescence-conjugated control antibodies of identical isotypes to those employed in D. D: FACS analysis of lung digests using phycoerythrin (PE)-conjugated anti-Sca-1 and FITC-conjugated anti-CD45 antibodies. CD45- and CD45+ populations of Sca-1-positive cells are illustrated. The percentage of cells in each quadrant is indicated. FACS images and percentages are representative of experiments repeated individually on 12 C57Bl/6j and 3 FVB/NJ mice.

We next sought to determine whether Sca-1 expression in lung was restricted to circulating hematopoietic cells contained within vessels. We prepared single cell suspensions by enzymatically digesting saline-perfused lungs and performed flow cytometry to detect cells expressing Sca-1 and the hematopoietic lineage marker CD45. With this method, we found that, on average, 60% of Sca-1-positive lung cells were CD45 negative (Fig. 1). These results established that Sca-1 is expressed in a nonhematopoietic cell type in the lung.

Localization of Sca-1-expressing cells by immunohistochemistry and FACS. To identify and localize Sca-1-expressing cells, we performed Sca-1 immunohistochemistry on paraffin and frozen sections of adult murine lungs (Fig. 2). We found linear Sca-1 immunostaining in a pattern consistent with expression in endothelial cells of large and small pulmonary arteries, alveolar capillaries, and pulmonary veins. No Sca-1 staining was present in airway epithelium or type I or II alveolar epithelial cells.


View larger version (130K):
[in this window]
[in a new window]
 
Fig. 2.   Sca-1 and platelet/endothelial cell adhesion molecule-1 (PECAM-1) immunoperoxidase staining of adult lung paraffin sections. A: low-power view of lung tissue showing Sca-1 linear staining (brown) of pulmonary artery (PA) endothelium and alveolar septae of lung parenchyma. Bronchial epithelium (BR) shows no staining. B: high-power view of lung alveoli showing Sca-1 immunostaining in a pattern characteristic of flat alveolar capillary endothelium. Charcoal arrows indicate 2 Sca-1-positive alveolar capillary vessels shown in cross section, one surrounding a single red blood cell. Type II pneumocytes are Sca-1 negative (red arrow). C: high-power view of a small pulmonary vessel, filled with red blood cells, illustrating Sca-1 immunostaining of the endothelial wall. An adjacent Sca-1-negative type I pneumocyte is shown (arrow). Inset: phase-contrast view of boxed region. D: PECAM-1 immunostaining of lung endothelium showing identical pattern to the Sca-1 pattern shown in A. Simultaneous control sections stained with isotype control antibody (substituted for anti-Sca-1) or secondary antibody alone (substituted for anti-PECAM-1) showed no brown labeling. Sections were counterstained with methyl green. A-D is representative of immunohistochemical analyses from 40 sections taken from 3 C57Bl/6j mice.

We utilized PECAM-1 immunostaining to determine whether the pattern of expression of this endothelial marker was similar to Sca-1. We found that the staining pattern of PECAM-1 and Sca-1 matched; colocalization of PECAM-1 and Sca-1 staining was confirmed by dual fluorescent staining (Fig. 3). To examine this further, we analyzed single cell suspensions of lung tissue by FACS for Sca-1, CD45, and PECAM-1 expression. With this method, we found that PECAM-1-positive cells were Sca-1 positive (Fig. 4). To further ensure that all blood cells were excluded from analysis of the Sca-1 status of lung endothelial cells, we analyzed PECAM-1-positive/CD45-negative lung cells; 97% of these cells were Sca-1 positive (Fig. 4).


View larger version (81K):
[in this window]
[in a new window]
 
Fig. 3.   PECAM-1 (red) and Sca-1 (blue) dual fluorescence microscopy of a single lung frozen section. A: high-power view of phase-contrast microscopy of a frozen section showing a single pulmonary vessel wall with adjacent vessel lumen (*). B: Texas red fluorescence labeling of the apical surface membrane of vessel endothelium using anti-PECAM-1 antibody. C: 7-Amino-4-methylcoumarin-3-acetic acid (AMCA, blue) fluorescence labeling using anti-Sca-1 antibody. D: merged image of B and C. E: enlarged merged image of A-C revealing endothelial cells lining the vessel lumen expressing PECAM-1 and Sca-1.



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 4.   A: FACS analysis of live lung cells in single cell suspension showing PECAM-1, CD45, and Sca-1 surface staining. A: anti-Sca-1-PE antibody vs. anti-PECAM-1-allophycocyanin (APC) antibody staining of lung cells. PECAM-1-positive cells are Sca-1 positive. B: anti-PECAM-1-APC antibody vs. CD45-FITC antibody staining. PECAM-1-positive/CD45-negative cells are gated for analysis in C (10% of all cells). C: histogram showing Sca-1 surface staining of lung endothelial cells (PECAM-1 positive/CD45 negative). 97% of PECAM-1-positive/CD45-negative cells are Sca-1 positive. Shown for comparison is histogram of cells stained with isotype control IgG2a,kappa -PE antibody. D: MFLM-4 mouse lung endothelial cell line FACS analysis with anti-Sca-1-PE and isotype control IgG2a,kappa -PE antibodies. This endothelial cell line is Sca-1 positive. FL-PE, fluorescence intensity of phycoerythrin. A-C is representative of FACS data from 12 C57Bl/6j and 3 FVB/NJ mice.

We also examined Sca-1 expression in the mouse pulmonary fetal endothelial cell line MFLM-4 during in vitro culturing. This cell type expresses features of differentiated endothelial cells (2, 3). RT-PCR demonstrated expression of Sca-1 mRNA in this cell line (data not shown). With the use of FACS, we found that these cells are Sca-1 positive (Fig. 4).

Localization of Sca-1 in kidney. The kidney and lung microvasculature share common antigens, as evidenced by autoimmune diseases that preferentially involve the vascular beds of these two organs. We, therefore, examined Sca-1 localization in the kidney. As has been reported (30), we found intense Sca-1 staining in the distal tubule epithelium and in large and small renal vessels (Fig. 5). Unlike the lung, however, Sca-1 expression was not detected by immunostaining in capillaries.


View larger version (140K):
[in this window]
[in a new window]
 
Fig. 5.   Sca-1 immunostaining in the adult murine kidney. A: low-power view indicating Sca-1 immunostaining (brown) in the tubule epithelium. B: high-power view of glomerulus (*) and adjacent distal tubule illustrating Sca-1-positive tubule epithelium and Sca-1-negative glomerulus. C: high-power view of Sca-1-positive distal tubule epithelium shown in longitudinal section with phase-contrast image (D) for comparison. E: Sca-1-positive endothelium (arrow) lining a renal vessel. Adjacent glomerulus (*) shows no Sca-1 labeling in glomerular capillaries. F: in contrast, PECAM-1-immunostained glomerulus (*) illustrates the typical endothelial marker staining pattern of glomerular capillaries. Nuclei have been counterstained with methyl green.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

These findings demonstrate that expression of Sca-1 in the lung is localized to the surface of endothelial cells in large and small pulmonary vessels. Although we found that >97% of lung endothelial cells (PECAM-1 positive/CD45 negative) express Sca-1, we cannot exclude the possibility that additional rare cells present in the lung express Sca-1. Indeed, of Sca-1-positive/CD45-negative lung cells, 90% were PECAM-1 positive; on histological sections, nonendothelial lung cell types that stained for Sca-1 were not identified. Specifically, bronchial ciliated and nonciliated cells, type I and II pneumocytes, and vascular and bronchial smooth muscle cells all lacked Sca-1 immunostaining. Together, these observations add to the growing number of antigens available for immunotyping lung endothelium and raise intriguing questions about the significance of shared gene expression patterns between endothelium and stem or progenitor cells of hematopoietic and nonhematopoietic tissues.

Importantly, a variety of recent studies detail a common embryonic origin of endothelial cells and HSCs and demonstrate the ability of bone marrow-derived cells to participate in angiogenesis and neovascularization during adult life. During fetal development, endothelial progenitor cells and hematopoietic stem cells are believed to arise from a common flk-1+ embryonic ancestor, the hemangioblast (26). Moreover, many marrow stem cell markers are present in both endothelial cells and HSCs in adults, including CD34, c-kit, MDR-1, and tie-2 (5, 8, 12, 16, 23, 26). Although no single marker has been found that is specific to adult mouse stem cells, the combination of surface markers shared between endothelial cells and HSCs suggests a relationship between these two cell lineages. The finding that Sca-1 is expressed in HSCs and lung endothelial cells further supports such a relationship.

Whether there is any contribution of Sca-1-positive bone marrow-derived circulating cells to the lung endothelium in the adult remains to be established. To date, marrow-derived cells in adults have been demonstrated to contribute to the endothelium in models of cardiac and skeletal muscle injury, wound healing, synthetic graft endothelialization, retinal neovasularization, and tumor angiogenesis (4, 5, 10, 13, 15, 17, 19, 27). Interestingly, Sca-1-positive HSCs purified from marrow by Hoechst side population staining (SP cells) express the endothelial marker, PECAM-1, and can engraft in recipient hearts as endothelial cells and cardiac myocytes (13).

In the nonhematopoietic compartment of adult bone marrow, Sca-1-positive multipotent adult progenitor cells can form differentiated endothelium both in vitro and in vivo during transplantation studies (26). The possibility that lung endothelium may be marrow derived has been proposed by Asahara et al. (4) using a bone marrow transplant model. In that study, RT-PCR of lung RNA showed expression of an endothelial marker that was derived from the donor's marrow. Careful histological analysis of lungs derived from chimeric animals and humans may provide additional data that support a role for bone marrow in pulmonary endothelial reconstitution. Contribution of bone marrow-derived cells to lung endothelium, if definitively proven, could be relevant to pulmonary vascular disease pathogenesis and treatment.

The capacity of endothelial cells to serve as progenitors for differentiated cells of some tissues has been proposed by several studies. For example, during culture of lung endothelial cells, cardiomyocyte markers have been detected (6, 18). Moreover, endothelial cells from the fetal dorsal aorta have been suggested to give rise to blood, cartilage, bone, and smooth, skeletal, and cardiac muscle after injection into embryos (18). Findings from these studies, if confirmed, would suggest unrecognized plasticity in endothelial cells. Whether Sca-1-positive lung endothelial cells can give rise to other cell types needs further study.

Ultimately, in vivo transplantation studies that employ highly purified lung endothelial cell populations are needed to establish the stem cell potential of Sca-1-positive lung cells. These models will likely require tissue-specific injuries in transplant recipients. The use of cell-specific lineage labels instead of ubiquitously expressed green fluorescent protein or lacZ along with rigorous immunohistochemical and FACS analyses should be used to evaluate engrafted phenotypes. Moreover, single cell transplantation will be necessary to verify pluripotency or clonal expansion of donor cells.

It is noteworthy that endothelial cells display phenotypic heterogeneity on the basis of their organ of residence, developmental stage (embryonic vs. adult), vessel type (arterial, venous, or capillary), and exposure to injury (1). Within the lung, few endothelial surface markers have been extensively characterized (7), and most lung endothelial antigens are not present in both pulmonary arteries, veins, and microvasculature. Despite this phenotypic heterogeneity, some antigens, such as PECAM-1 and Sca-1, appear to be expressed throughout the pulmonary endothelium. As has been reported (30), we also found Sca-1 immunostaining in the vasculature of other organs, such as renal arteries and veins. In contrast to pulmonary alveolar endothelium, the absence of Sca-1 immunostaining in glomerular capillaries may reflect the unique phenotype of the fenestrated filtration bed formed by the glomerular endothelium. We cannot exclude the possibility, however, that glomerular endothelial cells express Sca-1 at low levels below the sensitivity of our staining procedure.

Our data show that Sca-1 expression can be utilized as a reliable marker for the study and analysis of the pulmonary lung endothelium. Finally, our findings suggest novel strategies for the isolation of lung endothelial cells; importantly, we found that Sca-1 is resistant to proteolytic lung digestion and is expressed on the cell surface. These two observations could form the basis for lung endothelial purification protocols that employ anti-Sca-1 antibodies during high-speed flow cytometry or immunobead-based sorting.


    ACKNOWLEDGEMENTS

We thank Drs. Yu Xia Cao for assistance with protein analysis and Mary C. Williams for guidance in histology studies.


    FOOTNOTES

This work was supported by National Heart, Lung, and Blood Institute Grants 1RO1-HL-069148-01A1, 1K08-HL-71640-01, National Research Service Award 1F32 HL-67578-01, and a Research Fellowship Training Award from the Massachusetts Thoracic Society and the American Lung Associations of Massachusetts (to D. N. Kotton).

Address for reprint requests and other correspondence: D. N. Kotton, The Pulmonary Center, Boston Univ. School of Medicine, 715 Albany St., R-304, Boston, MA 02118 (E-mail: dkotton{at}lung.bumc.bu.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

First published February 28, 2003;10.1152/ajplung.00415.2002

Received 4 December 2002; accepted in final form 9 February 2003.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Aird, WC, Edelberg JM, Weiler-Guettler H, Simmons WW, Smith TW, and Rosenberg RD. Vascular bed-specific expression of an endothelial cell gene is programmed by the tissue microenvironment. J Cell Biol 138: 1117-1124, 1997[Abstract/Free Full Text].

2.   Akeson, AL, Brooks SK, Thompson FY, and Greenberg JM. In vitro model for developmental progression from vasculogenesis to angiogenesis with a murine endothelial precursor cell line, MFLM-4. Microvasc Res 61: 75-86, 2001[Web of Science][Medline].

3.   Akeson, AL, Wetzel B, Thompson FY, Brooks SK, Paradis H, Gendron RL, and Greenberg JM. Embryonic vasculogenesis by endothelial precursor cells derived from lung mesenchyme. Dev Dyn 217: 11-23, 2000[Web of Science][Medline].

4.   Asahara, T, Masuda H, Takahashi T, Kalka C, Pastore C, Silver M, Kearne M, Magner M, and Isner J. Bone marrow origin of endothelial progenitor cells responsible for postnatal vasculogenesis in physiological and pathological neovascularization. Circ Res 85: 221-228, 1999[Abstract/Free Full Text].

5.   Asahara, T, Murohara T, Sullivan A, Silver M, van der Zee R, Li T, Witzenbichler B, Schatteman G, and Isner JM. Isolation of putative progenitor endothelial cells for angiogenesis. Science 275: 964-967, 1997[Abstract/Free Full Text].

6.   Condorelli, G, Borello U, De Angelis L, Latronico M, Sirabella D, Coletta M, Galli R, Balconi G, Follenzi A, Frati G, Cusella De Angelis MG, Gioglio L, Amuchastegui S, Adorini L, Naldini L, Vescovi A, Dejana E, and Cossu G. Cardiomyocytes induce endothelial cells to trans-differentiate into cardiac muscle: implications for myocardium regeneration. Proc Natl Acad Sci USA 98: 10733-10738, 2001[Abstract/Free Full Text].

7.   Danilov, SM, Gavrilyuk VD, Franke FE, Pauls K, Harshaw DW, McDonald TD, Miletich DJ, and Muzykantov VR. Lung uptake of antibodies to endothelial antigens: key determinants of vascular immunotargeting. Am J Physiol Lung Cell Mol Physiol 280: L1335-L1347, 2001[Abstract/Free Full Text].

8.   Demeule, M, Labelle M, Regina A, Berthelet F, and Beliveau R. Isolation of endothelial cells from brain, lung, and kidney: expression of the multidrug resistance P-glycoprotein isoforms. Biochem Biophys Res Commun 281: 827-834, 2001[Web of Science][Medline].

9.   Goodell, MA, Brose K, Paradis G, Conner AS, and Mulligan RC. Isolation and functional properties of murine hematopoietic stem cells that are replicating in vivo. J Exp Med 183: 1797-1806, 1996[Abstract/Free Full Text].

10.   Grant, MB, May WS, Caballero S, Brown GA, Guthrie SM, Mames RN, Byrne BJ, Vaught T, Spoerri PE, Peck AB, and Scott EW. Adult hematopoietic stem cells provide functional hemangioblast activity during retinal neovascularization. Nat Med 8: 607-612, 2002[Web of Science][Medline].

11.   Gussoni, E, Soneoka Y, Strickland CD, Buzney EA, Khan MK, Flint AF, Kunkel LM, and Mulligan RC. Dystrophin expression in the mdx mouse restored by stem cell transplantation. Nature 401: 390-394, 1999[Medline].

12.   Ivanova, NB, Dimos JT, Schaniel C, Hackney JA, Moore KA, and Lemischka IR. A stem cell molecular signature. Science 298: 601-604, 2002[Abstract/Free Full Text].

13.   Jackson, KA, Majka SM, Wang H, Pocius J, Hartley CJ, Majesky MW, Entman ML, Michael LH, Hirschi KK, and Goodell MA. Regeneration of ischemic cardiac muscle and vascular endothelium by adult stem cells. J Clin Invest 107: 1395-1402, 2001[Web of Science][Medline].

14.   Jiang, Y, Jahagirdar BN, Reinhardt RL, Schwartz RE, Keene CD, Ortiz-Gonzalez XR, Reyes M, Lenvik T, Lund T, Blackstad M, Du J, Aldrich S, Lisberg A, Low WC, Largaespada DA, and Verfaillie CM. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature 418: 41-49, 2002[Medline].

15.   Kalka, C, Masuda H, Takahashi T, Kalka-Moll WM, Silver M, Kearney M, Li T, Isner JM, and Asahara T. Transplantation of ex vivo expanded endothelial progenitor cells for therapeutic neovascularization. Proc Natl Acad Sci USA 97: 3422-3427, 2000[Abstract/Free Full Text].

16.   Konig, A, Corbacioglu S, Ballmaier M, and Welte K. Downregulation of c-kit expression in human endothelial cells by inflammatory stimuli. Blood 90: 148-155, 1997[Abstract/Free Full Text].

17.   Lin, Y, Weisdorf DJ, Solovey A, and Hebbel RP. Origins of circulating endothelial cells and endothelial outgrowth from blood. J Clin Invest 105: 71-77, 2000[Web of Science][Medline].

18.   Minasi, MG, Riminucci M, De Angelis L, Borello U, Berarducci B, Innocenzi A, Caprioli A, Sirabella D, Baiocchi M, De Maria R, Boratto R, Jaffredo T, Broccoli V, Bianco P, and Cossu G. The meso-angioblast: a multipotent, self-renewing cell that originates from the dorsal aorta and differentiates into most mesodermal tissues. Development 129: 2773-2783, 2002[Abstract/Free Full Text].

19.   Orlic, D, Kajstura J, Chimenti S, Jakoniuk I, Anderson SM, Li B, Pickel J, McKay R, Nadal-Ginard B, Bodine DM, Leri A, and Anversa P. Bone marrow cells regenerate infarcted myocardium. Nature 410: 701-705, 2001[Medline].

20.   Ortega, G, Korty PE, Shevach EM, and Malek TR. Role of Ly-6 in lymphocyte activation. I. Characterization of a monoclonal antibody to a nonpolymorphic Ly-6 specificity. J Immunol 137: 3240-3246, 1986[Abstract].

21.   Palfree, RG, Dumont FJ, and Hammerling U. Ly-6A.2 and Ly-6E.1 molecules are antithetical and identical to MALA-1. Immunogenetics 23: 197-207, 1986[Web of Science][Medline].

22.   Palfree, RG, and Hammerling U. Biochemical characterization of the murine activated lymphocyte alloantigen Ly-6E.1 controlled by the Ly-6 locus. J Immunol 136: 594-600, 1986[Abstract].

23.   Ramalho-Santos, M, Yoon S, Matsuzaki Y, Mulligan RC, and Melton DA. "Stemness": transcriptional profiling of embryonic and adult stem cells. Science 298: 597-600, 2002[Abstract/Free Full Text].

24.   Reiser, H, Coligan J, Palmer E, Benacerraf B, and Rock KL. Cloning and expression of a cDNA for the T cell-activating protein TAP. Proc Natl Acad Sci USA 85: 2255-2259, 1988[Abstract/Free Full Text].

25.   Reiser, H, Oettgen H, Yeh ET, Terhorst C, Low MG, Benacerraf B, and Rock KL. Structural characterization of the TAP molecule: a phosphatidylinositol-linked glycoprotein distinct from the T cell receptor/T3 complex and Thy-1. Cell 47: 365-370, 1986[Web of Science][Medline].

26.   Reyes, M, Dudek A, Jahagirdar B, Koodie L, Marker PH, and Verfaillie CM. Origin of endothelial progenitors in human postnatal bone marrow. J Clin Invest 109: 337-346, 2002[Web of Science][Medline].

27.   Shi, Q, Rafii S, Wu MH, Wijelath ES, Yu C, Ishida A, Fujita Y, Kothari S, Mohle R, Sauvage LR, Moore MA, Storb RF, and Hammond WP. Evidence for circulating bone marrow-derived endothelial cells. Blood 92: 362-367, 1998[Abstract/Free Full Text].

28.   Spangrude, GJ, Heimfeld S, and Weissman IL. Purification and characterization of mouse hematopoietic stem cells. Science 241: 58-62, 1988[Abstract/Free Full Text]. [Corrigenda. Science 244: June 1989, p. 1030.]

29.   Tamaki, T, Akatsuka A, Ando K, Nakamura Y, Matsuzawa H, Hotta T, Roy R, and Edgerton VR. Identification of myogenic-endothelial progenitor cells in the interstitial spaces of skeletal muscle. J Cell Biol 157: 571-577, 2002[Abstract/Free Full Text].

30.   Van de, RM, Heimfeld S, Spangrude GJ, and Weissman IL. Mouse hematopoietic stem cell antigen Sca-1 is a member of the Ly-6 antigen family. Proc Natl Acad Sci USA 86: 4634-4638, 1989[Abstract/Free Full Text].

31.   Welm, BE, Tepera SB, Venezia T, Graubert TA, Rosen JM, and Goodell MA. Sca-1(pos) cells in the mouse mammary gland represent an enriched progenitor cell population. Dev Biol 245: 42-56, 2002[Web of Science][Medline].


Am J Physiol Lung Cell Mol Physiol 284(6):L990-L996
1040-0605/03 $5.00 Copyright © 2003 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
S. Rastogi, M. Imai, V. G. Sharov, S. Mishra, and H. N. Sabbah
Darbepoetin-{alpha} prevents progressive left ventricular dysfunction and remodeling in nonanemic dogs with heart failure
Am J Physiol Heart Circ Physiol, December 1, 2008; 295(6): H2475 - H2482.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
B. Dekel, L. Zangi, E. Shezen, S. Reich-Zeliger, S. Eventov-Friedman, H. Katchman, J. Jacob-Hirsch, N. Amariglio, G. Rechavi, R. Margalit, et al.
Isolation and Characterization of Nontubular Sca-1+Lin- Multipotent Stem/Progenitor Cells from Adult Mouse Kidney
J. Am. Soc. Nephrol., December 1, 2006; 17(12): 3300 - 3314.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
S. Meindl, U. Schmidt, C. Vaculik, and A. Elbe-Burger
Characterization, isolation, and differentiation of murine skin cells expressing hematopoietic stem cell markers
J. Leukoc. Biol., October 1, 2006; 80(4): 816 - 826.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
C. Tso, G. Martinic, W.-H. Fan, C. Rogers, K.-A. Rye, and P. J. Barter
High-Density Lipoproteins Enhance Progenitor-Mediated Endothelium Repair in Mice
Arterioscler Thromb Vasc Biol, May 1, 2006; 26(5): 1144 - 1149.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. Zentilin, S. Tafuro, S. Zacchigna, N. Arsic, L. Pattarini, M. Sinigaglia, and M. Giacca
Bone marrow mononuclear cells are recruited to the sites of VEGF-induced neovascularization but are not incorporated into the newly formed vessels
Blood, May 1, 2006; 107(9): 3546 - 3554.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
M. P.A. van Bragt, N. Ciliberti, W. L. Stanford, D. G. de Rooij, and A. M.M. van Pelt
LY6A/E (SCA-1) Expression in the Mouse Testis
Biol Reprod, October 1, 2005; 73(4): 634 - 638.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
R. Summer, D. N. Kotton, S. Liang, K. Fitzsimmons, X. Sun, and A. Fine
Embryonic Lung Side Population Cells Are Hematopoietic and Vascular Precursors
Am. J. Respir. Cell Mol. Biol., July 1, 2005; 33(1): 32 - 40.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
R. Summer, D. N. Kotton, X. Sun, K. Fitzsimmons, and A. Fine
Origin and phenotype of lung side population cells
Am J Physiol Lung Cell Mol Physiol, September 1, 2004; 287(3): L477 - L483.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
284/6/L990    most recent
00415.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (13)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kotton, D. N.
Right arrow Articles by Fine, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kotton, D. N.
Right arrow Articles by Fine, A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2003 by the American Physiological Society.