|
|
||||||||
The Pulmonary Center, Boston University School of Medicine, Boston, Massachusetts 02118
| |
ABSTRACT |
|---|
|
|
|---|
Although the function of the cell surface protein stem cell antigen-1 (Sca-1) has not been identified, expression of this molecule is a characteristic of bone marrow-derived hematopoietic stem cell populations. Expression of Sca-1, however, is not restricted to hematopoietic tissue. By RT-PCR and Western analysis, we found that Sca-1 is expressed in the adult mouse lung. Sca-1 immunohistochemistry revealed a linear staining pattern on the endothelial surface of large and small pulmonary arteries and veins and alveolar capillaries. Expression of Sca-1 in the pulmonary endothelium was confirmed by dual fluorescent microscopy on lung sections and by fluorescence-activated cell sorting analysis of digested lung tissue; each of these methods showed colocalization with the endothelial marker platelet/endothelial cell adhesion molecule-1. In the kidney, Sca-1 expression was also noted in large vessels, but, in contrast to the lung, was not observed in capillaries. Overall, our data indicate that Sca-1 expression helps define the surface phenotype of endothelial cells throughout the pulmonary vasculature.
lung; endothelial cell marker
| |
INTRODUCTION |
|---|
|
|
|---|
STEM CELL ANTIGEN-1 (Sca-1) is a phosphatidylinositol-anchored glycoprotein found on the surface of several murine marrow stem cell subtypes, including hematopoietic stem cells (HSCs) (28, 30), mesenchymal stem cells, multipotent adult progenitor cells (14), and Hoechst side population (SP) cells (9, 11). Each of these cell types displays a capacity for multilineage differentiation and self-renewal. Notably, the characterization and purification of bone marrow-derived stem cells are often based on the expression of selective cell surface markers, such as Sca-1 (30).
Expression of Sca-1, like other stem cell markers, is not restricted to the bone marrow. Cells expressing this antigen can be found in murine peripheral lymphocyte subpopulations, within the thymic medulla, and in the spleen (21, 22, 30). Sca-1 expression is also present in the parenchyma of nonhematopoietic tissues such as the tubular epithelium of the kidney and the vasculature of the brain, heart, and liver (30). Recently, Sca-1-positive cells in murine muscle interstitium have been identified; these cells are able to serve as progenitors for muscle and endothelium (29). In breast tissue, epithelial progenitors with a Hoechst-negative staining profile express Sca-1 (31). Despite these observations, it remains unclear whether Sca-1 expression in nonhematopoietic tissue connotes cells with stem and progenitor cell capacity or marks cells of bone marrow origin. Indeed, the function of Sca-1 in stem cells remains uncertain, although it appears to have a role in lymphocyte activation and has also been referred to as T cell-activating protein (20, 25).
In the adult murine lung, Sca-1 mRNA and protein can be detected, but whether this expression is restricted to circulating cells present in lung blood vessels or differentiated parenchymal cells is not currently known (24, 30). In this paper, we sought to identify cell types expressing Sca-1 in the adult lung. Our findings indicate that Sca-1 expression is localized to the surface of endothelial cells throughout the pulmonary vasculature.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Mice. Protein and RNA extracts, single cell suspensions, and sections for immunohistochemistry were prepared from 2-mo-old C57Bl/6j mice (Jackson Laboratories, Bar Harbor, ME) euthanized by isoflurane anesthesia followed by cervical dislocation and perfusion of lungs with cold saline irrigated through the right ventricle. Animal studies were conducted according to protocols approved by the Boston University Animal Use Committee and adhered strictly to National Institutes of Health guidelines for the use and care of experimental animals.
Western blot analysis. SDS-PAGE (15% polyacrylamide) was performed under nonreducing conditions on protein extracts from homogenized murine lungs. Proteins were transferred onto a polyvinylidene fluoride membrane (Immobilon-P; Millipore, Bedford, MA; 300 mA, 4°C, 1 h). This membrane was blocked with 5% nonfat dry milk in Tris-buffered saline with Tween 20 (TBST; 20 mM Tris · HCl, pH 8.0, 150 mM NaCl, 0.1% Tween 20, 1 h, 22°C). After being washed in TBST, monoclonal rat anti-mouse Sca-1 was applied (eBioscience no. 14-5981, San Diego, CA; diluted 1:250 in TBST overnight at 4°C) followed by further washes and incubation with a horseradish peroxidase (HRP)-conjugated goat anti-rat IgG secondary antibody (Santa Cruz no. 2065, Santa Cruz, CA; diluted 1:4,000 in 1% milk TBST for 1 h at 22°C). Bound antibody was detected with a Western blotting chemiluminescence kit (ECL, Amersham) according to the manufacturer's instructions.
RT-PCR. RNA extracts from lung and marrow samples were analyzed by generating cDNA using a reverse transcription kit (Promega, Madison, WI) followed by PCR using primers for Sca-1 (forward primer: CTCTGAGGATGGACACTTCT, reverse primer: GGTCTGCAGGAGGACTGAGC; 94°C for 1 min, 56°C for 1 min, 72°C for 1 min, 35 cycles).
Fluorescence-activated cell sorting.
To prepare single cell suspensions of lung tissue, euthanized mice
underwent perfusion of their lungs via the right ventricle with
ice-cold PBS (pH 7.4). Whole lungs were then dissected free from the
thorax, finely minced by razor blade, and enzymatically digested for 50 min at 37°C with a solution consisting of 0.1% collagenase A (Roche
Diagnostics, Indianapolis, IN) in 2.4 U/ml of dispase II (Roche). Lung
digests were then filtered (70-µm Falcon cell strainer; Becton
Dickinson, Franklin Lakes, NJ) and washed twice in Hanks' balanced
salt solution+ (2% fetal bovine serum, 10 mM HEPES in Hanks' buffer)
before resuspending at 5 × 106 cells/ml for antibody
staining. Flow cytometric analysis of immunolabeled cell surface
markers was performed by simultaneous staining with three antibodies:
phycoerythrin (PE)-, FITC-, and allophycocyanin (APC)-conjugated
monoclonal rat anti-mouse IgGs against Sca-1, CD45, and
platelet/endothelial cell adhesion molecule-1 (PECAM-1), respectively
(BD Pharmingen, San Diego, CA). In addition, cells were exposed to
propidium iodide (PI; 1 µg/ml in PBS) to identify dead cells, which
were excluded from analysis. Only experiments in which >85% of cells
were alive (PI negative) were included. Nonspecific control rat IgG
antibodies of identical isotype (IgG2a,
-PE, IgG2b,
-FITC, IgG2a,
-APC, Pharmingen) were
included in all experiments and were used to set fluorescence-activated
cell sorting (FACS) gates for analysis. Fluorescent antibody-exposed
live cells were analyzed by flow cytometry (MoFlo; Cytomation, Fort
Collins, CO), and data were processed using FlowJo software (Treestar,
San Carlos, CA). Lungs from each adult mouse were analyzed separately,
and experiments were repeated on 12 C57Bl/6j mice from 6 separate litters and 3 FVB/NJ male mice (Jackson Laboratories). FACS analysis for Sca-1 expression in a pulmonary endothelial cell line was similarly
performed using the MFLM-4 cell line (generous gift of Dr. Ann Akeson,
Children's Hospital Medical Center, Cincinnati, OH), which was grown
and harvested under established conditions (2, 3).
Sca-1 and PECAM-1 immunohistochemistry of tissue sections.
Formalin-fixed lungs and kidneys were prepared for frozen or paraffin
sectioning through standard methods. Paraffin sections (5-µm-thick)
were rehydrated by exposure to solvent (Citrisolv; Fisher Scientific,
Hanover Park, IL), graded alcohols, and distilled water. Antigen
retrieval was performed by heating sections to 90°C in a citric acid
buffer (Antigen Retrieval Solution; Vector Laboratories, Burlingame,
CA) for 20 min and slowly cooling to room temperature. Before being
stained, sections were treated with hydrogen peroxide in methanol (3%,
15 min, 22°C) to quench endogenous peroxidases. Sections were blocked
with 1% goat serum in PBS (60 min) and incubated overnight (4°C)
with the appropriate antibody: biotinylated monoclonal rat anti-mouse
Sca-1 diluted 1:100 (Pharmingen no. 553334), biotinylated rat
IgG2a,
isotype control (Pharmingen), or polyclonal goat
anti-mouse PECAM-1 diluted 1:4,000 (Santa Cruz no. sc-1506).
Biotinylated anti-Sca-1 antibody was detected using an ABC kit (Vector
Laboratories) followed by tyramide signal amplification (TSA-Biotin
System; NEN, Boston, MA) according to the manufacturer's protocol
before exposure to diaminobenzadine. Anti-PECAM-1 antibody was detected
using an anti-goat secondary antibody kit (Vector Laboratories) before tyramide signal amplification. For fluorescent immunostaining, 5-µm-thick frozen sections were quenched with 1% sodium borohydride for 30 min before identical immunostaining conditions.
7-Amino-4-methylcoumarin-3-acetic acid- or Texas red-conjugated avidin
(5 µg/ml, Vector Laboratories) were substituted for HRP-streptavidin
during tyramide signal amplification to achieve fluorescent signals. To
ensure specificity of immunostaining, for each analysis, adjacent
control sections in each experiment underwent identical and
simultaneous staining with isotype control antibody (biotinylated rat
IgG2a,
isotype control, Pharmingen) in place of
anti-Sca-1, and secondary antibody alone substituted for anti-PECAM-1.
Immunohistochemistry was repeated on tissue from three C57Bl/6j mice.
| |
RESULTS |
|---|
|
|
|---|
Sca-1 mRNA and protein expression in lung tissue.
We found by RT-PCR that Sca-1 mRNA is present in adult lung tissue
(Fig. 1). For positive controls, we
employed RNA derived from fresh bone marrow cells or cultured
marrow-derived mesenchymal stem cells known to express Sca-1.
To examine this further, we next performed a Western blot analysis on
whole lung extracts for Sca-1 protein expression. In this study, we
detected an ~8 kDa protein; this is the expected weight of Sca-1
protein when analyzed by SDS-PAGE under nonreducing conditions
(21, 30).
|
Localization of Sca-1-expressing cells by immunohistochemistry and
FACS.
To identify and localize Sca-1-expressing cells, we performed Sca-1
immunohistochemistry on paraffin and frozen sections of adult
murine lungs (Fig. 2). We found
linear Sca-1 immunostaining in a pattern consistent with expression in
endothelial cells of large and small pulmonary arteries, alveolar
capillaries, and pulmonary veins. No Sca-1 staining was present in
airway epithelium or type I or II alveolar epithelial cells.
|
|
|
Localization of Sca-1 in kidney.
The kidney and lung microvasculature share common antigens, as
evidenced by autoimmune diseases that preferentially involve the
vascular beds of these two organs. We, therefore, examined Sca-1
localization in the kidney. As has been reported (30), we
found intense Sca-1 staining in the distal tubule epithelium and in
large and small renal vessels (Fig. 5).
Unlike the lung, however, Sca-1 expression was not detected by
immunostaining in capillaries.
|
| |
DISCUSSION |
|---|
|
|
|---|
These findings demonstrate that expression of Sca-1 in the lung is localized to the surface of endothelial cells in large and small pulmonary vessels. Although we found that >97% of lung endothelial cells (PECAM-1 positive/CD45 negative) express Sca-1, we cannot exclude the possibility that additional rare cells present in the lung express Sca-1. Indeed, of Sca-1-positive/CD45-negative lung cells, 90% were PECAM-1 positive; on histological sections, nonendothelial lung cell types that stained for Sca-1 were not identified. Specifically, bronchial ciliated and nonciliated cells, type I and II pneumocytes, and vascular and bronchial smooth muscle cells all lacked Sca-1 immunostaining. Together, these observations add to the growing number of antigens available for immunotyping lung endothelium and raise intriguing questions about the significance of shared gene expression patterns between endothelium and stem or progenitor cells of hematopoietic and nonhematopoietic tissues.
Importantly, a variety of recent studies detail a common embryonic origin of endothelial cells and HSCs and demonstrate the ability of bone marrow-derived cells to participate in angiogenesis and neovascularization during adult life. During fetal development, endothelial progenitor cells and hematopoietic stem cells are believed to arise from a common flk-1+ embryonic ancestor, the hemangioblast (26). Moreover, many marrow stem cell markers are present in both endothelial cells and HSCs in adults, including CD34, c-kit, MDR-1, and tie-2 (5, 8, 12, 16, 23, 26). Although no single marker has been found that is specific to adult mouse stem cells, the combination of surface markers shared between endothelial cells and HSCs suggests a relationship between these two cell lineages. The finding that Sca-1 is expressed in HSCs and lung endothelial cells further supports such a relationship.
Whether there is any contribution of Sca-1-positive bone marrow-derived circulating cells to the lung endothelium in the adult remains to be established. To date, marrow-derived cells in adults have been demonstrated to contribute to the endothelium in models of cardiac and skeletal muscle injury, wound healing, synthetic graft endothelialization, retinal neovasularization, and tumor angiogenesis (4, 5, 10, 13, 15, 17, 19, 27). Interestingly, Sca-1-positive HSCs purified from marrow by Hoechst side population staining (SP cells) express the endothelial marker, PECAM-1, and can engraft in recipient hearts as endothelial cells and cardiac myocytes (13).
In the nonhematopoietic compartment of adult bone marrow, Sca-1-positive multipotent adult progenitor cells can form differentiated endothelium both in vitro and in vivo during transplantation studies (26). The possibility that lung endothelium may be marrow derived has been proposed by Asahara et al. (4) using a bone marrow transplant model. In that study, RT-PCR of lung RNA showed expression of an endothelial marker that was derived from the donor's marrow. Careful histological analysis of lungs derived from chimeric animals and humans may provide additional data that support a role for bone marrow in pulmonary endothelial reconstitution. Contribution of bone marrow-derived cells to lung endothelium, if definitively proven, could be relevant to pulmonary vascular disease pathogenesis and treatment.
The capacity of endothelial cells to serve as progenitors for differentiated cells of some tissues has been proposed by several studies. For example, during culture of lung endothelial cells, cardiomyocyte markers have been detected (6, 18). Moreover, endothelial cells from the fetal dorsal aorta have been suggested to give rise to blood, cartilage, bone, and smooth, skeletal, and cardiac muscle after injection into embryos (18). Findings from these studies, if confirmed, would suggest unrecognized plasticity in endothelial cells. Whether Sca-1-positive lung endothelial cells can give rise to other cell types needs further study.
Ultimately, in vivo transplantation studies that employ highly purified lung endothelial cell populations are needed to establish the stem cell potential of Sca-1-positive lung cells. These models will likely require tissue-specific injuries in transplant recipients. The use of cell-specific lineage labels instead of ubiquitously expressed green fluorescent protein or lacZ along with rigorous immunohistochemical and FACS analyses should be used to evaluate engrafted phenotypes. Moreover, single cell transplantation will be necessary to verify pluripotency or clonal expansion of donor cells.
It is noteworthy that endothelial cells display phenotypic heterogeneity on the basis of their organ of residence, developmental stage (embryonic vs. adult), vessel type (arterial, venous, or capillary), and exposure to injury (1). Within the lung, few endothelial surface markers have been extensively characterized (7), and most lung endothelial antigens are not present in both pulmonary arteries, veins, and microvasculature. Despite this phenotypic heterogeneity, some antigens, such as PECAM-1 and Sca-1, appear to be expressed throughout the pulmonary endothelium. As has been reported (30), we also found Sca-1 immunostaining in the vasculature of other organs, such as renal arteries and veins. In contrast to pulmonary alveolar endothelium, the absence of Sca-1 immunostaining in glomerular capillaries may reflect the unique phenotype of the fenestrated filtration bed formed by the glomerular endothelium. We cannot exclude the possibility, however, that glomerular endothelial cells express Sca-1 at low levels below the sensitivity of our staining procedure.
Our data show that Sca-1 expression can be utilized as a reliable marker for the study and analysis of the pulmonary lung endothelium. Finally, our findings suggest novel strategies for the isolation of lung endothelial cells; importantly, we found that Sca-1 is resistant to proteolytic lung digestion and is expressed on the cell surface. These two observations could form the basis for lung endothelial purification protocols that employ anti-Sca-1 antibodies during high-speed flow cytometry or immunobead-based sorting.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Drs. Yu Xia Cao for assistance with protein analysis and Mary C. Williams for guidance in histology studies.
| |
FOOTNOTES |
|---|
This work was supported by National Heart, Lung, and Blood Institute Grants 1RO1-HL-069148-01A1, 1K08-HL-71640-01, National Research Service Award 1F32 HL-67578-01, and a Research Fellowship Training Award from the Massachusetts Thoracic Society and the American Lung Associations of Massachusetts (to D. N. Kotton).
Address for reprint requests and other correspondence: D. N. Kotton, The Pulmonary Center, Boston Univ. School of Medicine, 715 Albany St., R-304, Boston, MA 02118 (E-mail: dkotton{at}lung.bumc.bu.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
First published February 28, 2003;10.1152/ajplung.00415.2002
Received 4 December 2002; accepted in final form 9 February 2003.
| |
REFERENCES |
|---|
|
|
|---|
1.
Aird, WC,
Edelberg JM,
Weiler-Guettler H,
Simmons WW,
Smith TW,
and
Rosenberg RD.
Vascular bed-specific expression of an endothelial cell gene is programmed by the tissue microenvironment.
J Cell Biol
138:
1117-1124,
1997
2.
Akeson, AL,
Brooks SK,
Thompson FY,
and
Greenberg JM.
In vitro model for developmental progression from vasculogenesis to angiogenesis with a murine endothelial precursor cell line, MFLM-4.
Microvasc Res
61:
75-86,
2001[Web of Science][Medline].
3.
Akeson, AL,
Wetzel B,
Thompson FY,
Brooks SK,
Paradis H,
Gendron RL,
and
Greenberg JM.
Embryonic vasculogenesis by endothelial precursor cells derived from lung mesenchyme.
Dev Dyn
217:
11-23,
2000[Web of Science][Medline].
4.
Asahara, T,
Masuda H,
Takahashi T,
Kalka C,
Pastore C,
Silver M,
Kearne M,
Magner M,
and
Isner J.
Bone marrow origin of endothelial progenitor cells responsible for postnatal vasculogenesis in physiological and pathological neovascularization.
Circ Res
85:
221-228,
1999
5.
Asahara, T,
Murohara T,
Sullivan A,
Silver M,
van der Zee R,
Li T,
Witzenbichler B,
Schatteman G,
and
Isner JM.
Isolation of putative progenitor endothelial cells for angiogenesis.
Science
275:
964-967,
1997
6.
Condorelli, G,
Borello U,
De Angelis L,
Latronico M,
Sirabella D,
Coletta M,
Galli R,
Balconi G,
Follenzi A,
Frati G,
Cusella De Angelis MG,
Gioglio L,
Amuchastegui S,
Adorini L,
Naldini L,
Vescovi A,
Dejana E,
and
Cossu G.
Cardiomyocytes induce endothelial cells to trans-differentiate into cardiac muscle: implications for myocardium regeneration.
Proc Natl Acad Sci USA
98:
10733-10738,
2001
7.
Danilov, SM,
Gavrilyuk VD,
Franke FE,
Pauls K,
Harshaw DW,
McDonald TD,
Miletich DJ,
and
Muzykantov VR.
Lung uptake of antibodies to endothelial antigens: key determinants of vascular immunotargeting.
Am J Physiol Lung Cell Mol Physiol
280:
L1335-L1347,
2001
8.
Demeule, M,
Labelle M,
Regina A,
Berthelet F,
and
Beliveau R.
Isolation of endothelial cells from brain, lung, and kidney: expression of the multidrug resistance P-glycoprotein isoforms.
Biochem Biophys Res Commun
281:
827-834,
2001[Web of Science][Medline].
9.
Goodell, MA,
Brose K,
Paradis G,
Conner AS,
and
Mulligan RC.
Isolation and functional properties of murine hematopoietic stem cells that are replicating in vivo.
J Exp Med
183:
1797-1806,
1996
10.
Grant, MB,
May WS,
Caballero S,
Brown GA,
Guthrie SM,
Mames RN,
Byrne BJ,
Vaught T,
Spoerri PE,
Peck AB,
and
Scott EW.
Adult hematopoietic stem cells provide functional hemangioblast activity during retinal neovascularization.
Nat Med
8:
607-612,
2002[Web of Science][Medline].
11.
Gussoni, E,
Soneoka Y,
Strickland CD,
Buzney EA,
Khan MK,
Flint AF,
Kunkel LM,
and
Mulligan RC.
Dystrophin expression in the mdx mouse restored by stem cell transplantation.
Nature
401:
390-394,
1999[Medline].
12.
Ivanova, NB,
Dimos JT,
Schaniel C,
Hackney JA,
Moore KA,
and
Lemischka IR.
A stem cell molecular signature.
Science
298:
601-604,
2002
13.
Jackson, KA,
Majka SM,
Wang H,
Pocius J,
Hartley CJ,
Majesky MW,
Entman ML,
Michael LH,
Hirschi KK,
and
Goodell MA.
Regeneration of ischemic cardiac muscle and vascular endothelium by adult stem cells.
J Clin Invest
107:
1395-1402,
2001[Web of Science][Medline].
14.
Jiang, Y,
Jahagirdar BN,
Reinhardt RL,
Schwartz RE,
Keene CD,
Ortiz-Gonzalez XR,
Reyes M,
Lenvik T,
Lund T,
Blackstad M,
Du J,
Aldrich S,
Lisberg A,
Low WC,
Largaespada DA,
and
Verfaillie CM.
Pluripotency of mesenchymal stem cells derived from adult marrow.
Nature
418:
41-49,
2002[Medline].
15.
Kalka, C,
Masuda H,
Takahashi T,
Kalka-Moll WM,
Silver M,
Kearney M,
Li T,
Isner JM,
and
Asahara T.
Transplantation of ex vivo expanded endothelial progenitor cells for therapeutic neovascularization.
Proc Natl Acad Sci USA
97:
3422-3427,
2000
16.
Konig, A,
Corbacioglu S,
Ballmaier M,
and
Welte K.
Downregulation of c-kit expression in human endothelial cells by inflammatory stimuli.
Blood
90:
148-155,
1997
17.
Lin, Y,
Weisdorf DJ,
Solovey A,
and
Hebbel RP.
Origins of circulating endothelial cells and endothelial outgrowth from blood.
J Clin Invest
105:
71-77,
2000[Web of Science][Medline].
18.
Minasi, MG,
Riminucci M,
De Angelis L,
Borello U,
Berarducci B,
Innocenzi A,
Caprioli A,
Sirabella D,
Baiocchi M,
De Maria R,
Boratto R,
Jaffredo T,
Broccoli V,
Bianco P,
and
Cossu G.
The meso-angioblast: a multipotent, self-renewing cell that originates from the dorsal aorta and differentiates into most mesodermal tissues.
Development
129:
2773-2783,
2002
19.
Orlic, D,
Kajstura J,
Chimenti S,
Jakoniuk I,
Anderson SM,
Li B,
Pickel J,
McKay R,
Nadal-Ginard B,
Bodine DM,
Leri A,
and
Anversa P.
Bone marrow cells regenerate infarcted myocardium.
Nature
410:
701-705,
2001[Medline].
20.
Ortega, G,
Korty PE,
Shevach EM,
and
Malek TR.
Role of Ly-6 in lymphocyte activation. I. Characterization of a monoclonal antibody to a nonpolymorphic Ly-6 specificity.
J Immunol
137:
3240-3246,
1986[Abstract].
21.
Palfree, RG,
Dumont FJ,
and
Hammerling U.
Ly-6A.2 and Ly-6E.1 molecules are antithetical and identical to MALA-1.
Immunogenetics
23:
197-207,
1986[Web of Science][Medline].
22.
Palfree, RG,
and
Hammerling U.
Biochemical characterization of the murine activated lymphocyte alloantigen Ly-6E.1 controlled by the Ly-6 locus.
J Immunol
136:
594-600,
1986[Abstract].
23.
Ramalho-Santos, M,
Yoon S,
Matsuzaki Y,
Mulligan RC,
and
Melton DA.
"Stemness": transcriptional profiling of embryonic and adult stem cells.
Science
298:
597-600,
2002
24.
Reiser, H,
Coligan J,
Palmer E,
Benacerraf B,
and
Rock KL.
Cloning and expression of a cDNA for the T cell-activating protein TAP.
Proc Natl Acad Sci USA
85:
2255-2259,
1988
25.
Reiser, H,
Oettgen H,
Yeh ET,
Terhorst C,
Low MG,
Benacerraf B,
and
Rock KL.
Structural characterization of the TAP molecule: a phosphatidylinositol-linked glycoprotein distinct from the T cell receptor/T3 complex and Thy-1.
Cell
47:
365-370,
1986[Web of Science][Medline].
26.
Reyes, M,
Dudek A,
Jahagirdar B,
Koodie L,
Marker PH,
and
Verfaillie CM.
Origin of endothelial progenitors in human postnatal bone marrow.
J Clin Invest
109:
337-346,
2002[Web of Science][Medline].
27.
Shi, Q,
Rafii S,
Wu MH,
Wijelath ES,
Yu C,
Ishida A,
Fujita Y,
Kothari S,
Mohle R,
Sauvage LR,
Moore MA,
Storb RF,
and
Hammond WP.
Evidence for circulating bone marrow-derived endothelial cells.
Blood
92:
362-367,
1998
28.
Spangrude, GJ,
Heimfeld S,
and
Weissman IL.
Purification and characterization of mouse hematopoietic stem cells.
Science
241:
58-62,
1988
29.
Tamaki, T,
Akatsuka A,
Ando K,
Nakamura Y,
Matsuzawa H,
Hotta T,
Roy R,
and
Edgerton VR.
Identification of myogenic-endothelial progenitor cells in the interstitial spaces of skeletal muscle.
J Cell Biol
157:
571-577,
2002
30.
Van de, RM,
Heimfeld S,
Spangrude GJ,
and
Weissman IL.
Mouse hematopoietic stem cell antigen Sca-1 is a member of the Ly-6 antigen family.
Proc Natl Acad Sci USA
86:
4634-4638,
1989
31.
Welm, BE,
Tepera SB,
Venezia T,
Graubert TA,
Rosen JM,
and
Goodell MA.
Sca-1(pos) cells in the mouse mammary gland represent an enriched progenitor cell population.
Dev Biol
245:
42-56,
2002[Web of Science][Medline].
This article has been cited by other articles:
![]() |
S. Rastogi, M. Imai, V. G. Sharov, S. Mishra, and H. N. Sabbah Darbepoetin-{alpha} prevents progressive left ventricular dysfunction and remodeling in nonanemic dogs with heart failure Am J Physiol Heart Circ Physiol, December 1, 2008; 295(6): H2475 - H2482. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Dekel, L. Zangi, E. Shezen, S. Reich-Zeliger, S. Eventov-Friedman, H. Katchman, J. Jacob-Hirsch, N. Amariglio, G. Rechavi, R. Margalit, et al. Isolation and Characterization of Nontubular Sca-1+Lin- Multipotent Stem/Progenitor Cells from Adult Mouse Kidney J. Am. Soc. Nephrol., December 1, 2006; 17(12): 3300 - 3314. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Meindl, U. Schmidt, C. Vaculik, and A. Elbe-Burger Characterization, isolation, and differentiation of murine skin cells expressing hematopoietic stem cell markers J. Leukoc. Biol., October 1, 2006; 80(4): 816 - 826. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Tso, G. Martinic, W.-H. Fan, C. Rogers, K.-A. Rye, and P. J. Barter High-Density Lipoproteins Enhance Progenitor-Mediated Endothelium Repair in Mice Arterioscler Thromb Vasc Biol, May 1, 2006; 26(5): 1144 - 1149. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zentilin, S. Tafuro, S. Zacchigna, N. Arsic, L. Pattarini, M. Sinigaglia, and M. Giacca Bone marrow mononuclear cells are recruited to the sites of VEGF-induced neovascularization but are not incorporated into the newly formed vessels Blood, May 1, 2006; 107(9): 3546 - 3554. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P.A. van Bragt, N. Ciliberti, W. L. Stanford, D. G. de Rooij, and A. M.M. van Pelt LY6A/E (SCA-1) Expression in the Mouse Testis Biol Reprod, October 1, 2005; 73(4): 634 - 638. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Summer, D. N. Kotton, S. Liang, K. Fitzsimmons, X. Sun, and A. Fine Embryonic Lung Side Population Cells Are Hematopoietic and Vascular Precursors Am. J. Respir. Cell Mol. Biol., July 1, 2005; 33(1): 32 - 40. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Summer, D. N. Kotton, X. Sun, K. Fitzsimmons, and A. Fine Origin and phenotype of lung side population cells Am J Physiol Lung Cell Mol Physiol, September 1, 2004; 287(3): L477 - L483. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |