|
|
||||||||
1Cystic Fibrosis/Pulmonary Treatment and Research Center; and 2Department of Cell and Molecular Physiology, University of North Carolina at Chapel Hill School of Medicine, Chapel Hill, North Carolina 27599-7248
Submitted 28 October 2002 ; accepted in final form 10 February 2003
| ABSTRACT |
|---|
|
|
|---|
S stimulate secretion with EC50 values of
3 µM.
PMA elicits mucin secretion with high EC50 (75 nM) and saturation
(300 nM) values. For the first time in airway mucin-secreting cells, the PKC
isoforms expressed and activated by a secretagogue were determined using
RT-PCR/restriction-enzyme mapping and Western blotting. Five isoforms were
expressed: cPKC
, nPKC
and -
, and aPKC
and
-
/
. PMA caused cPKC
and nPKC
to translocate to the
membrane fraction of SPOC1 cells; only nPKC
so responded to
ATP
S. Membrane-associated nPKC
and mucin secretion increased in
parallel with ATP
S concentration and yielded EC50 values of
23 µM and maximum values of 100 µM. Effects of PMA to increase
membrane-associated cPKC
and nPKC
saturated at 30 nM, whereas
mucin secretion saturated at 300 nM, which suggests a significant
PKC-independent effect of PMA on mucin secretion. A prime alternate phorbol
ester-receptor candidate is the C1-domain protein MUNC13. RT-PCR revealed the
expression of ubiquitous (ub)MUNC13-2 and its binding partner, DOC2-
.
Hence, P2Y2 agonists activate nPKC
in SPOC1 cells. PMA
activates cPKC
and nPKC
at high affinity and stimulates a lower
affinity PKC-independent pathway that leads to mucin secretion. exocytosis; mucus; airways; P2Y receptor
50 amino acids that in most isoforms is present
as a tandem repeat and functions to bind the kinase to phospholipid membranes
via diacylglycerol (DAG). C1 domains also bind phorbol esters such as PMA at
very high affinity. Conventional PKC isoforms (cPKC
, -
I,
-
II, and -
) possess a double C1 domain that is followed on the
COOH-terminal side by a C2, Ca2+-dependent phospholipid-binding
domain. Novel PKC isoforms (nPKC
, -
, -
, and -
)
possess a double C1 domain and a Ca2+-independent C2 domain on the
NH2-terminal side of the C1 domain. For novel PKC isoforms, being
bound to membranes by DAG or PMA is sufficient for activation. Atypical PKC
isoforms [aPKC
and -
/
(human and rodent, respectively)]
possess a single atypical C1 domain and are insensitive to DAG and
Ca2+. These isoforms are activated by phosphoinositide-dependent
kinase-1 (PDK-1; Ref. 58).
Despite decades of work on the molecular mechanisms of PKC activation and
action, there remain significant deficits in our knowledge of PKC function
regarding the specific roles in cell regulation played by the various PKC
isoforms. The number of agonist-mediated events for which the participating
PKC isoforms has been identified rigorously is too small to formulate
generalizations. For agonist-regulated exocytotic secretion, for instance,
only in GH4 (4) and rat
basophilic leukemia (RBL) cells
(11) have specific PKC
isoforms been identified as having a direct role in the secretory response to
agonist, namely, nPKC
and cPKC
I, respectively. Goblet cells in the superficial epithelium of the airways (15) and mucous cells in the submucosal glands (23) are secretory epithelial cells that exocytotically release mucin, which is a polymeric high-molecular-weight glycoconjugate that forms the mucus gel responsible for mucociliary clearance. In airway obstructive diseases, arachidonic acid metabolites, inflammatory mediators, bacterial byproducts, reactive oxygen-nitrogen species, and other agents cause mucin hypersecretion by stimulation of goblet cell and submucosal gland meta- and/or hyperplasia. The stimulation from these sources to secrete mucin in both health and disease appears to be controlled by other agents that emanate from the peripheral nervous system or from cells that effect control through local mediators. For mucous cells in submucosal glands, a vast array of agonists and mediators stimulate mucin secretion; in contrast, goblet cells respond to few signaling agents (18). Indeed, the only agents shown rigorously to stimulate goblet cells to secrete mucin consistently and across species and experimental models are ATP and UTP, which appear to act via luminal P2Y2 purinoceptors (P2Y2-R; Refs. 2, 16, 40).
In accord with the general notion that P2Y2-R couples through Gq to phospholipase C (26), inositol phosphate production is elevated in goblet cells by purinergic agonists (40, 41), and mucin secretion is stimulated by both the DAG mimic PMA and the Ca2+ ionophore ionomycin (16, 17). Additionally, membrane-associated PKC activity is enhanced by P2Y2 agonists in SPOC1 cells, and the actions of ionomycin and PMA are fully additive at maximal concentrations, which suggests that Ca2+ and PKC are potentially independent in their actions to effect mucin secretion (1). In agreement with this notion of independence, we recently reported for permeabilized SPOC1 cells that mucin secretion was activated by PMA when Ca2+ activity was buffered to 10 nM, which is a level well below normal resting levels of intracellular Ca2+ (70). Hence, the cumulative data support the participation of one or more Ca2+-independent novel PKC isoforms in the mucin secretory response to purinergic agonist. In this article, RT-PCR/restriction-enzyme mapping and Western blotting techniques were used to identify the PKC isoforms expressed in SPOC1 cells and those that respond uniquely to secretagogue activation of mucin secretion. Additionally, we identified proteins in SPOC1 cells other than PKC that potentially participate in PMA-stimulated mucin secretion by virtue of their DAG-interacting C1 domains (36).
| MATERIALS AND METHODS |
|---|
|
|
|---|
Culture medium was purchased from GIBCO-BRL (Gaithersburg, MD), and its supplements were from Collaborative Research (Bedford, MA); nucleotides were purchased from Boehringer-Mannheim (Indianapolis, IN). PKC isoform-specific polyclonal antibodies generated against synthetic peptides corresponding to unique COOH-terminal sequences and the corresponding synthetic peptides were purchased from Santa Cruz Biotechnology (Santa Cruz, CA), Promega (Madison, WI), Life Technologies (Gaithersburg, MD), Pan-Vera (Madison, WI), and Oxford Biomedical Research (Oxford, MI). All other chemicals were purchased from Sigma Chemical (St. Louis, MO).
SPOC1 Cell Culture and Mucin Assay
SPOC1 cells (65), passages 714, were seeded at 9 x 103 cells/cm2 in 100- or 60-mm tissue-culture plates, or in six-well cluster plates (Costar, Cambridge, MA) and were grown in a DMEM/F-12-based fully defined culture medium (34, 65). Except for cells that were grown solely for passaging, the medium contained 10 nM retinoic acid. Culture media were changed daily, and the cultures were used for experiments after differentiation of a mucin-secreting phenotype at 1421 days postconfluence.
Media samples were assessed for mucin content by enzyme-linked lectin assay as described previously (2). Briefly, 100-µl samples were added to the wells of 96-well high-binding microtiter plates (Costar no. 3590) with incubation either overnight at 4°C or for 2 h at 37°C. The unbound materials were removed by washing the plates with PBS that contained 0.05% Tween 20 and 0.02% Thimerosol, and the plates were then incubated with 15 µg/ml horseradish peroxidase-conjugated soybean agglutinin (SBA) for 1 h at 37°C. After the plates were washed and developed by incubation in 0.04% wt/vol of the substrate (O-phenylene diamine in 0.0175 M citrate-phosphate buffer, pH 5.0, that contained 0.01% hydrogen peroxide), the reaction was stopped by the addition of 4 M sulfuric acid and the optical density was determined at 490 nm (model MR5000 microtiter plate reader, Dynatech, Chantilly, VA). Optical density was converted to nanograms of mucin from standard curves using purified SPOC1 mucin applied to each microtiter plate (2).
RT-PCR and Restriction-Enzyme Mapping
Total RNA was isolated from SPOC1 cells using TRI reagent (Sigma) in accordance with manufacturer's procedures. In each such preparation used, rRNA bands that resulted from electrophoresis on agarose gels were intact, clearly identifiable, and correctly sized. First-strand cDNA was synthesized from 8 µg of total RNA using the SuperScript pre-amplification system (GIBCO) with oligo-dT as a primer. The subsequent PCR reactions used Taq polymerase (GIBCO) and PKC, the mammalian homolog of the uncoordinated (UNC) Caenorhabditis elegans mutants, MUNC13, or double-C2 (DOC2)-specific primers that were synthesized by the University of North Carolina Department of Pathology Nucleotide Synthesis Facility. Sequence data were analyzed with Genetics Computer Group (GCG, Madison, WI) or Vector-NTI (InforMax, Bethesda, MD) software.
For the PKC isoforms, the forward and reverse primers targeted conserved sequences at the 5' end of the C3 domain and in the middle of the C4 domain, respectively. The forward and reverse primers used for conventional and novel isoforms were AARGGSAGYTTTGGSAAG and GGRGCAAKASTCWGG; for atypical PKC isoforms, they were GGAAGTTATGCCAARGTMCT and GCCATCATCTCAAACATRAG. For each PKC isoform, the predicted sizes of the PCR products to result from the use of these primers are indicated in Table 1.
|
After separation by electrophoresis in 2% agarose gels, PCR products were
stained with ethidium bromide for analysis. Restriction maps of PKC isoform
sequences retrieved from GenBank were used to select combinations of
restriction enzymes that would cleave the PKC isoform cDNA fragments uniquely
within each subfamily (Table
1). Because the SPOC1 cells were derived from rat trachea, rat PKC
isoform sequences were used when available; where necessary, we used sequences
from the homologous mouse or human genes. Each analysis, i.e., a PCR plus its
associated restriction-enzyme digestion series for a specific PKC subfamily,
was conducted at least twice. In two instances, ambiguities in the results
warranted additional steps. For an isoform that proved to be nPKC
,
RT-PCR was used with the common forward primer specified for the conventional
and novel PKC isoforms along with the isoform-specific reverse primer
CATGAGGGCCGATGTGACCT. The resulting PCR product was cloned using a TA Cloning
Kit (Invitrogen) and sequenced (Univ. of North Carolina Automated DNA
Sequencing Facility). And for an isoform that proved to be
aPKC
/
, the original PCR products were cloned and the nucleotide
base sequences were determined. As controls, we used rat brain RNA and PTB
vectors that contained rat cPKC
, nPKC
, and aPKC
, which
were kindly provided by Dr. Yoshitaka Ono of the University of Kobe.
The isoforms of MUNC13 expressed in SPOC1 cells were identified in two steps. First, using primers to conserved sequences in the C1 and C2 domains (see Fig. 5), we tested for mRNA expression of MUNC13-1, -2, and -3 using the forward and reverse primers CCCACCTACTGCTAYGAGTGYGA and TGTATWGGGTCACTGGAYCCTGT, respectively. As for PKC isoforms, the PCR fragments were incubated with restriction enzymes selected for their predicted ability to cleave the possible cDNA fragments uniquely: DraIII for MUNC13-1, MscI for MUNC13-2, and RsaI for MUNC13-3. Second, specific primers were used to distinguish between the alternatively spliced mRNAs of MUNC13-2 and to test for MUNC13-4 expression. The MUNC13-2 common forward primer was TGCACGAGATGGGGTAGATTAA, and the specific reverse primers for the brain and ubiquitous spliceoforms were AACTCACCTCTTACAAACTCA and CTCCGTCAGACCTGATGCTGCA, respectively. For MUNC13-4, the forward and reverse primers were ACCATCCTCTTTCTCCACGCCA and TGAGGAGGGACTGCAGCCTGGA, respectively.
|
DOC2 mRNA expression in SPOC1 cells was determined using the following
isoform-specific forward and reverse primers, respectively: for
,
TATGATCAGGCTTCCTGCAT and AGCGCCGCAGACATTGAAGA; for
,
ACTGCACCATCAGCAAAGCC and ATAGTCCCAGACAGTGACCTCC; and for
,
CTGTCCCTGTGCTACAGTTC and CTGCACCCCACCAATGAAATC.
To verify the identity of MUNC13 and DOC2 isoforms indicated by positive RT/PCR-restriction-enzyme digestion results, the products were cloned and sequenced as described for PKC isoforms.
Western Blotting
The expression of PKC proteins was determined by Western blotting in SPOC1
cells. Whole cell lysates were prepared and protein concentrations were
estimated as previously described
(1). Briefly, after cultures
were washed and equilibrated, they were incubated for 40 min or for other time
periods as stated (see RESULTS, control conditions or with addition
of ATP
S or PMA at the concentrations indicated). At the end of the
incubation period, a sample of the medium was removed for mucin analysis when
appropriate to the experiment, and the cells were quickly washed with ice-cold
PBS after which they were lysed on ice using a hypotonic buffer (in mM: 20
Tris · HCl, 2 EGTA, 2 EDTA, 6
-mercaptoethanol, and 0.1 PMSF). At
4°C, the lysed cells were homogenized (15 strokes, Potter-Elvehjem tissue
grinder), the extract was centrifuged for 1 h at 100,000 g, and the
supernatant was taken as the cytosol fraction. The pellet was solubilized in
buffer supplemented with 0.1% Triton X-100, incubated 3060 min, and
centrifuged (14,000 rpm, Eppendorf 5415C microcentrifuge), and the supernatant
was taken as the membrane fraction. Samples of the two fractions were taken
for protein analysis (BCA Protein Assay Kit, Pierce Biotechnology, Rockford,
IL), and the remainder were frozen and stored at -70°C.
Within 48 h of the experiment, the cell fractions were thawed, and equivalent amounts of protein (1020 µg/lane) were resolved by 10% SDS-PAGE and electrophoretically transferred to polyvinylidene difluoride membranes. In many experiments, the lysates were first fractionated into cytosol and membrane pools of protein by centrifugation (100,000 g) as described. The blots were probed with PKC isoform-specific antibodies from commercial sources (Table 2) using dilutions appropriate to the respective analysis. Where possible, antibody specificity was tested by preabsorbing the antibody with the synthetic peptide antigen (50-fold excess). Immunoreactive proteins were detected using enhanced chemiluminescence (Amersham, Arlington Heights, IL). Films of the Western blots were imaged with a platform scanner at a resolution of 600 x 600 dpi and quantitated using MetaMorph image-processing software (Universal Imaging, Downingtown, PA).
|
| RESULTS |
|---|
|
|
|---|
Identification of SPOC1 Cell PKC Isoform mRNAs
From oligo-dT primed SPOC1 cell cDNA, the genes that represent PKC isoforms
within each subfamily (conventional, novel, and atypical; see Ref.
54) were amplified by PCR
using degenerate primers that were
94% identical to the nucleotide
sequences of the known subfamily members. The products of each PCR were
digested by restriction enzymes that were selected to cleave specific PKC
isoforms based on published nucleotide sequences (see
Table 1).
Conventional and novel PKC isoforms. The PCR reaction that
resulted from primers designed for conventional and novel PKC isoforms from
SPOC1 cDNA yielded a single prominent band on an agarose gel with a size
480 bp. The presence of cPKC
and cPKC
in this band was
indicated by the production of fragments of appropriate size produced by
following digestion with ApoI, MseI, and NcoI (see
Table 1) and a diminution in
signal strength of the original PCR band at
480 bp (data not shown). By
comparison with the band intensity of products judged to represent
cPKC
, those representing cPKC
were very weak; hence, the
abundance of cPKC
in the SPOC1 cell total RNA may be low, or this
isoform may have been amplified with low efficiency. SPOC1 cell cDNA did not
contain either of the cPKC
isoforms as is indicated by the failure of
NcoI and PstI to generate digestion products of any
size.
The presence of nPKC
and nPKC
in SPOC1 cell cDNA was indicated
by the generation of appropriately sized fragments (see
Table 1) after digestion of the
PCR products by NcoI and PstI (nPKC
) and by
BamHI and PstI (nPKC
); NPKC
was not
expressed. The data relevant to nPKC
, however, were equivocal: a very
faint band of appropriate size was apparent from a digestion with Xba
(data not shown), but appropriately sized bands in the Mse digestion
were not apparent (see Table
1). To resolve this issue, primers specific to nPKC
were
generated. The resulting RT-PCR resulted in a faint band of the proper size on
the agarose gel, and the product, after it was cloned, proved to possess the
proper sequence for the isoform.
Atypical PKC isoforms. PCR primers for isoforms in the atypical
PKC subfamily generated a single, prominent band that is consistent with the
predicted size of 557 bp. We identified aPKC
by the digestion of a
portion of this PCR product by MseI with the generation of
appropriately sized fragments (see Table
1). Digestion with MseI also generated a product pair of
460 and 100 bp that was inconsistent with any of the known PKC isoforms.
Hence, we suspected the existence of an undescribed isoform or, because the
rat sequence for aPKC
isoform is unknown, that rat aPKC
might
lack the MseI restriction site that is present in the mouse sequence.
To resolve this issue, the aPKC PCR product was cloned, and the nucleotide
sequence of four clones was determined. Three of the SPOC1 cell (rat) clones
possessed sequences 94% identical with mouse aPKC
/
, which lacked
one of the MseI restriction sites that is found in the mouse
sequence. Because of the high degree of identity, we conclude that the gene
that yields this clone is the rat homolog of aPKC
/
. The fourth
clone yielded a sequence consistent with aPKC
.
In summary, analysis of SPOC1 mRNA using a combination of PCR and
restriction-enzyme digestion indicated the expression of cPKC
and
-
(trace), nPKC
,-
(trace), and -
, and aPKC
and
-
/
.
Western Blot Analysis of SPOC1 Cell PKC Isoform Expression
PKC isoforms were judged to be expressed at the protein level in SPOC1 cells when the appropriate positive signals were present on Western blots (generally when antibodies from two or more independent vendors were used). Rat brain extract was used as a positive control for most isoforms, and specificity was tested with most antibodies by preabsorption with a 50-fold excess by weight of the synthetic peptide antigen. The experiments are summarized in Table 2.
Conventional PKC isoforms. We found that cPKC
appeared to
be the only member of the conventional PKC subfamily that was expressed
significantly at the protein level in SPOC1 cells (see
Table 2). Similar probes of
SPOC1 cell extracts with antibodies to cPKC
(Fig. 1) and to cPKC
were negative, whereas positive signals in both cases were obtained from rat
brain. Hence, SPOC1 cells do not appear to express significant amounts of
cPKC
or -
, even though for the latter isoform, we detected trace
amounts of cPKC
mRNA by PCR (see Atypical PKC isoforms in
Identification of SPOC1 Cell PKC Isoform mRNAs and
Table 1).
|
Novel PKC isoforms. We found that nPKC
and -
were
positively identified in extracts of SPOC1 cell and rat brain (see
Table 2). Like cPKC
,
antibodies against nPKC
tested against SPOC1 cell extracts yielded
negative results, whereas faint signals were observed via RT-PCR, and a
positive nPKC
signal was obtained by Western blotting from rat brain
extracts when the same antibody was used (see
Fig. 1).
Atypical PKC isoforms. As shown (see
Table 2), aPKC
and
-
/
were positively identified in extracts of SPOC1 cells.
In summary, Western blotting analysis confirmed the strong signals observed
by RT-PCR/restriction-enzyme mapping, which suggests that SPOC1 cells
expressed cPKC
, nPKC
and -
, and aPKC
and
-
/
at the protein level. However, cPKC
and nPKC
,
for which potentially weak expression was indicated by RT-PCR, were not
detected by Western blotting. We also found that cPKC
, which was not
detected by RT-PCR, was similarly undetectable by Western blotting.
Response of SPOC1 Cell PKC Isoforms to Secretagogues.
Conventional and novel PKC isoforms typically translocate from the cytosol
to a membrane surface upon activation by DAG or PMA
(32,
58). Hence, as an initial test
of the involvement of PKC isoforms in the mucin secretory response of SPOC1
cells, we probed cytosol and membrane fractions of SPOC1 cell extracts by
Western blotting using isoform-specific PKC antibodies before and after 40 min
of stimulation with PMA (300 nM) and the purinergic agonist ATP
S (100
µM), secretagogue concentrations of which elicit maximal mucin secretory
responses from SPOC1 cells (1,
2). [ATP
S was used as a
P2Y2-R agonist to minimize potential extracellular metabolism of
the nucleotide; it is equipotent with ATP and UTP in stimulating SPOC1 cell
mucin secretion (2).] The
immunoblots for nPKC
, aPKC
, and aPKC
/
indicated that
neither PMA nor ATP
S had effects on their respective distributions
between cytosol and membrane fractions (data not shown). In contrast,
immunoblots for cPKC
indicated a translocation to the membrane fraction
induced by PMA; for nPKC
, both PMA and ATP
S induced a
cytosol-to-membrane translocation. Hence, we evaluated the time courses of the
secretagogue-induced translocation of these two isoforms.
The time courses of the individual responses of cPKC
and nPKC
to PMA are depicted in Fig. 2.
For both isoforms, a significant translocation of PKC from the cytosol to the
membrane fraction occurred within the first 15 min of the PMA challenge. The
peak translocation of cPKC
(approximately a threefold increase)
occurred at 30 min, after which the amount of protein in the membrane
declined. At 4 h, the amount of cPKC
in the membrane exceeded control
levels, but the signal at 16 h approximated the control. The relative amounts
of nPKC
in the membrane fraction, in contrast, were relatively constant
at
1.75-fold above the control from 15 to 60 min after PMA addition.
Subsequently, the amounts declined sharply: at 4 h after PMA addition, <25%
of the control levels of nPKC
remained in the membrane fractions, and
undetectable amounts were present at 16 h.
|
ATP
S caused a different pattern of translocation responses
(Fig. 3) from PMA. There was no
elevation of cPKC
in the membrane fraction in response to ATP
S:
the relative amounts of cPKC
in the cytosol and membrane fractions were
essentially unchanged from control over the entire 16-h period of the
experiment. The relative amounts of nPKC
in the membrane fraction,
however, were elevated in response to ATP
S with a peak of
1.75-fold over the control occurring at 30 min. Correspondingly, the
amounts of nPKC
in the cytosol fraction were diminished by ATP
S
over time; the minimum,
0.4-fold of the control, also occurred 30 min
after the agonist challenge. Finally, and in contrast to the longer-term
effects of PMA to downregulate nPKC
to negligible levels (see
Fig. 2), the amount of
nPKC
in the membrane and cytosol fractions returned approximately to
control levels following the peak response to ATP
S
(Fig. 3).
|
Relationships between Secretagogue-Induced PKC Translocation and Mucin Secretion
The observation that nPKC
but not cPKC
translocated to the
membrane fraction after purinergic stimulation suggests that this isoform may
be involved selectively in regulation of the SPOC1 cell mucin secretory
responses to agonist. As a more direct test of the causal relationships
between nPKC
and mucin secretion, we determined the
concentration-effect relationships for both PMA and ATP
S on the
translocations of cPKC
and nPKC
to the membrane fraction and
compared these results with the respective concentration-effect relations on
mucin release in the same set of SPOC1 cell cultures. The concentration-effect
relationships for ATP
S on cPKC
and nPKC
translocation and
mucin secretion are depicted in Fig.
4A. Consistent with the time-course experiments,
ATP
S had no effect on the distribution of cPKC
in the membrane.
The relative amount of nPKC
in the membrane fraction, however,
increased with increasing ATP
S with a maximal translocation, 1.7
± 0.1-fold over the control, occurring with 100 µM ATP
S.
Interestingly, the effects of ATP
S on mucin release
(Fig. 4A, dashed line)
closely paralleled the effects of agonist on membrane-associated nPKC
:
both maxima occurred at 100 µM, and the EC50 value for each
event was
23 µM.
|
Figure 4B shows
that PMA induced the translocation of both cPKC
and nPKC
to the
membrane fraction but only at low concentrations. There was a significant
elevation in the amount of each membrane-associated isoform at 10 nM PMA, and
they saturated at concentrations >30 nM, at levels of 3.6 ± 0.8- and
3.2 ± 0.8-fold above control, respectively. The pattern of mucin
release in this experiment (Fig.
4B, dashed line) paralleled the translocation of
cPKC
and nPKC
to the membrane fraction at low PMA concentrations
but continued to increase at higher concentrations with an apparent saturation
in the range of 3001,000 nM PMA. This responsiveness of mucin release
to PMA is consistent with our previous studies, which showed that the peak
response occurred at 300 nM PMA
(1). However, because mucin
secretion increased substantially with PMA concentrations >30 nM, whereas
PKC translocation into the membrane fraction saturated at 30 nM, a substantial
PKC-independent effect of PMA on mucin secretion in SPOC1 cells is
indicated.
MUNC13 and DOC2 Expression in SPOC1 Cells
Proteins with DAG-binding C1 domains other than PKC have been described
recently (see Ref. 36);
consequently, one of these "phorbol ester receptors" is likely to
be responsible for the PKC-independent effects of PMA on mucin secretion from
SPOC1 cells. Of the C1 domain-containing proteins known, few localize to the
secretory pathway (36); of
those that do, MUNC13 is an especially attractive candidate because of its
plasma membrane localization and obligate participation in regulated
exocytosis (6,
10). Using RT-PCR, we probed
for the mRNA expression in SPOC1 cells of MUNC13 and its secretory granule
membrane-binding partner DOC2
(20). From SPOC1 cell total
RNA, MUNC13-2 was identified initially on the basis of a positive band of the
correct size that resulted from the use of common primers for MUNC13-1, -2,
and -3, which was followed by the successful digestion of the PCR product by
MscI (Fig.
5A). From the lack of PCR product digestion by
DraIII and RsaI, MUNC13-1 and -3 are apparently not
expressed. Isoform-specific primers were used subsequently to test whether the
brain or ubiquitous splice variant of MUNC13-2 was expressed
(8) as well as for the
expression of MUNC13-4 (43).
Positive bands were obtained with RT-PCR primers specific to ubMUNC13-2 and
MUNC4 (Fig. 5B), an
identification that was verified by cloning and sequencing the PCR products.
Analysis of DOC2 mRNA expression in SPOC1 cells by RT-PCR using specific
primers reveals that of the three known isoforms, only DOC2
is
expressed in SPOC1 cells (Fig.
6); this result was again verified by cloning and sequencing the
PCR product.
|
| DISCUSSION |
|---|
|
|
|---|
In SPOC1 cells, the available data from RT-PCR and pharmacological experiments indicate that the effects of ATP and UTP to elicit mucin secretion are mediated by P2Y2-R localized to the apical membrane (2), which in turn activate PLC thereby causing inositol 1,4,5-trisphosphate production/Ca2+ mobilization and DAG production and initiating the intracellular signaling cascade (17) that leads to mucin secretion. The goal of this work was to identify the PKC isoform(s) in SPOC1 cells that underlie P2Y2-mediated mucin secretion to begin the process of identifying these pathways at the molecular level in an airway goblet cell model.
P2Y2-R Signaling and PKC Isoform Expression in SPOC1 Cells
In this first study of PKC isoform expression in an airway goblet cell
model, RT-PCR/restriction-enzyme mapping and Western blotting analyses showed
that SPOC1 cells express cPKC
, nPKC
and -
, and
aPKC
/
and -
(see Tables
1 and
2). The cPKC
and
nPKC
mRNAs were identified as very faint bands on agarose gels, but the
corresponding proteins were not detected by Western blotting; consequently,
these isoforms do not appear to be expressed at physiologically significant
levels in these cells. Because aPKC
/
was shown to participate in
the formation of tight junctions, it is very likely to be expressed
ubiquitously in epithelial cells
(30). The cPKC
,
nPKC
and -
, and aPKC
isoforms are widely expressed in
epithelial tissues including lung and its airways, gastrointestinal tract, and
kidney (13,
33,
46,
55,
6163).
Significantly, cPKC
and nPKC
, which have been implicated widely in
both epithelial function (e.g.,
7,
12,
66,
73) and regulation of
exocytosis (see next section and Refs.
4,
11), are not detectable in
SPOC1 cells by Western blotting (see Fig.
1). Although the pattern of PKC isoform expression in SPOC1 cells
is consistent with the epithelial nature of the cell type
(65), departures from the
isoforms active in exocytosis in nonepithelial secretory cell types are
apparent that may indicate interesting differences in regulation of the
secretory event.
Responses of PKC Isoforms to PMA and Purinergic Agonists
In response to stimulation by 300 nM PMA, a concentration that elicits
maximal mucin release from SPOC1 cells
(1), cPKC
and
nPKC
were observed to translocate from the cytosol to membrane
fractions (see Fig. 2), which
is as expected for isoforms in the conventional and novel PKC subfamilies. In
contrast, nPKC
and aPKC
and -
/
did not undergo
PMA-induced translocation. Also, nPKC
is insensitive to PMA in
keratinocytes (57) but is
activated by cholesterol sulfate
(19,
29). This compound in SPOC1
cells, however, had no effect on the localization of nPKC
(data not
shown). Because cholesterol sulfate has been shown to activate not only
nPKC
in keratinocytes but also nPKC
and aPKC
(19), and because nPKC
is
activated by PMA in other cell types (e.g., see Ref.
38), the regulation of
nPKC
may prove to be cell specific.
In contrast to PMA, stimulation of SPOC1 cells by a maximal concentration
of purinergic agonist (ATP
S, 100 µM) elicited a translocation of
nPKC
but not CPKC
to the membrane fraction (see
Fig. 3). Notably, the
development of nPKC
translocation after agonist challenge followed a
time course that is typical for the SPOC1 cell mucin secretory response
(2), which suggests a
temporally linked correlation. A more quantitative relationship between
nPKC
translocation and mucin secretion was suggested by the
concentration-effect study shown in Fig.
4A. Here we found a clear correlation between agonist and
relative quantity of nPKC
localized to the membrane fraction;
importantly, there was also a parallel rise in mucin secretion. Thus these two
purinergically driven cellular events are characterized by similar time
courses and EC50 values of 23 µM and identical
concentration maxima of 100 µM, all of which strongly support a
cause-effect relationship between the translocation of nPKC
and mucin
secretion.
Although nPKC
has been implicated widely in the regulation of cell
growth, differentiation, and apoptosis and tumor development
(25), its potential role in
the agonist regulation of differentiated cell function is less well
understood. The one role suggested for nPKC
in airway columnar
epithelial cell function is the activation of the Na-K-2Cl cotransporter
(NKCCl), which is a function in the superficial epithelium ascribed to the
basolateral membrane of ciliated cells
(48,
49). Interestingly, the most
logical site for regulatory actions of nPKC
in mucin granule exocytosis
from goblet cells is the apical membrane; hence, we speculate that nPKC
may localize differentially during activation of the two major columnar cell
types of the airway epithelium.
The role of PKC in the regulation of exocytosis has been studied extensively in many secretory cells including mucin-secreting cells of the intestine (21, 28), lachrymal gland (78), and airway submucosal gland (45, 71) and surface epithelia (1, 15, 35, 42). Most of these studies, however, have relied exclusively upon the use of phorbol ester (PMA) to activate PKC, and/or they used putative PKC-specific inhibitors for the identification. As with many other kinase inhibitors, most PKC inhibitors have proven to be nonspecific (e.g., Refs. 14, 72). Also, the use of PMA suffers a dual limitation: not only does it attract conventional and novel isoforms to the membrane indiscriminately (51, 60), it also similarly activates other proteins that have DAG/phorbol ester-binding C1 domains (see next section and Ref. 36). Hence, although PMA and inhibitors may be used to generate useful information about PKC and its role in cellular regulation, their utility in identifying specific isoforms that regulate exocytosis or other functions is highly questionable.
In many secretory cells, specific PKC isoforms have been observed to
translocate upon agonist activation (e.g., see Refs.
24,
44,
53,
78), but the putative
cause-effect relationships between PKC isoform translocation and exocytosis
have not been tested more directly. In only a couple of secretory cell types
have specific PKC isoforms been associated with the regulation of exocytosis,
by agonist, using relatively rigorous criteria. The nPKC
isoform has
been implicated in the TRH-stimulated prolactin secretory response of GH4
cells, which is an anterior pituitary lactotroph cell model: nPKC
translocated to the membrane fraction and was selectively downregulated by TRH
stimulation (39), and
prolactin secretion was selectively enhanced by its overexpression
(4). Additionally, MARCKS has
been recently identified as the major downstream target of nPKC
phosphorylation in these cells
(3), which is consistent with
its postulated role in microfilament disruption
(74). A recent paper proposed
a different role for MARCKS in regulated mucin secretion from human airway
goblet cells: once liberated to the cytoplasm, MARCKS was suggested to bind to
mucin granules to allow microfilaments to attach and guide them to the plasma
membrane (47). Although this
hypothesis is intriguing, it is contrary to observations on other secretory
cell models (see beginning of DISCUSSION), and therefore requires
independent verification as well as testing in other systems. In intact RBL
cells, which are a mast cell model, CPKC
and -
and
nPKC
and -
were observed to translocate to the membrane fraction
upon stimulation by antigen. In permeabilized RBL cells following rundown,
however, only the exogenous addition of cPKC
or nPKC
restored
exocytotic secretion (64), and
in intact cells, only the overexpression of cPKC
I correlated with an
enhanced antigen-induced secretory response
(11). It is notable,
nonetheless, that three different PKC isoforms, cPKC
I, nPKC
, and
now, nPKC
, have been implicated as having a direct role in regulated
exocytosis in the three different secretory cells that are best characterized
for PKC involvement. Hence, the PKC isoforms that participate in regulated
exocytosis, a function that is highly conserved in eukaryotic cells, appear to
be surprisingly diverse.
PKC-Independent Effects of PMA
Evidence that favors PKC-independent effects of PMA in eliciting mucin
secretion from SPOC1 cells can be observed, retrospectively, in our previous
work. For instance, the PMA concentration-effect relationship for mucin
secretion exhibited a high EC50 value of 75 nM that saturated at
300 nM, whereas PKC activity generally saturates at 1030 nM PMA or
phorbol dibutyrate (37,
44,
50). Furthermore, typical PKC
inhibitors had negligible to insubstantial (
50% inhibition) effects on
ATP-induced mucin secretion, and we observed a full additivity between PMA and
ionomycin on mucin secretion at maximum effective concentrations
(1,
70). Although some of these
results such as the lack of responsiveness to "PKC" inhibitors can
be at least partially attributed to the activation of a novel isoform by PMA
(nPKC
; see Fig. 2),
those such as a high PMA EC50 value are more likely due to non-PKC
effects of PMA. As shown in Fig.
4B, cPKC
and nPKC
both translocate
maximally to the membrane fraction of SPOC1 cells at 30 nM PMA. That mucin
secretion increases significantly as PMA concentrations increase >30 nM
therefore indicates strongly that PMA has effects on the exocytotic mechanism
that are independent of PKC.
In recent years, new C1-domain proteins have been discovered that function as alternative phorbol ester receptors to the conventional and novel isoforms of PKC (e.g., see Refs. 36, 68, 69). The most likely of these proteins to be responsible for the PKC-independent effects of PMA to promote mucin secretion in SPOC1 cells is MUNC13, the mammalian homolog of UNC-13, which associates with the plasma membrane as an essential accessory protein in the exocytotic apparatus of synaptic terminal and model secretory cell systems (9, 10). MUNC13-1, the brain-specific isoform about which we presently know the most, causes early post-natal death in null mice (6) apparently through a loss of the priming reactions that are necessary for synaptic vesicle exocytosis from glutamatergic and other neurons (5, 52). In SPOC1 cells, we found two MUNC13 isoforms expressed at the mRNA level (see Fig. 5), the ubiquitous splice variant of MUNC13-2, ubMUNC13-2 (8), and MUNC13-4 (43). Although MUNC13-4 localizes primarily to goblet cells in the lung (43), two reasons suggest that ubMUNC13-2 is the isoform most likely to respond to activation of SPOC1 cells by high concentrations of PMA. First, MUNC13-4 lacks the C1 domain characteristic of the other isoforms, which makes it unlikely to respond to PMA. Second, the NH2-terminal region of ubMUNC13-2 is homologous with that of MUNC13-1, a region through which both isoforms bind RIM1 (8). It is by its interaction with RIM1 that MUNC13-1 is thought to be localized to the exocytotic active zone (52); by analogy, ubMUNC13-2 most likely localizes by the same mechanism.
The DOC2 protein associates with secretory granule membranes and functions
as the binding partner for MUNC13 in exocytotic priming reactions
(20). Hence, if MUNC13 is
important in regulated mucin secretion from SPOC1 cells, we would expect to
also find DOC2 expression. As shown in Fig.
6, in fact, DOC2
(22) is also expressed in
SPOC1 cells.
In conclusion, the novel PKC isoform nPKC
translocates uniquely to
the membrane fraction during P2Y2-R-activated mucin secretion from
SPOC1 cells. This event correlates well temporally with the onset of mucin
secretion and exhibits a saturating concentration-effect relationship with
agonist. PMA causes both cPKC
and nPKC
to translocate in a
concentration-dependent fashion that saturates at 30 nM. Mucin secretion
continues to increase with increasing PMA concentrations >30 nM, however,
which indicates that a substantial part of the PMA effect is PKC independent.
This PKC-independent effect of PMA is likely mediated by ubMUNC13-2 and
DOC2
, both of which are expressed in SPOC1 cells.
| NOTE ADDED IN PROOF |
|---|
|
|
|---|
mRNA expression in SPOC1 cells, we have now
an antibody different from the one used herein (SBC instead of LT; see
Table 1). This probe yielded a
positive band of the correct size for nPKC
in Western blots; hence, the
protein, in fact, appears to be expressed in SPOC1 cells. In three
experiments, however, nPKC
did not translocate to the membrane from the
cytosolic fraction following stimulation of the cells with purinergic agonist,
as we report here for nPKC
. Consequently, nPKC
may play a
singular role in regulated mucin granule exocytosis. | ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|