AJP - Lung Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 285: L149-L160, 2003. First published February 14, 2003; doi:10.1152/ajplung.00359.2002
1040-0605/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/1/L149    most recent
00359.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (18)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Abdullah, L. H.
Right arrow Articles by Davis, C. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Abdullah, L. H.
Right arrow Articles by Davis, C. W.

Mucin secretion and PKC isoforms in SPOC1 goblet cells: differential activation by purinergic agonist and PMA

Lubna H. Abdullah,1 Jason T. Bundy,1 Camille Ehre,1 and C. William Davis1,2

1Cystic Fibrosis/Pulmonary Treatment and Research Center; and 2Department of Cell and Molecular Physiology, University of North Carolina at Chapel Hill School of Medicine, Chapel Hill, North Carolina 27599-7248

Submitted 28 October 2002 ; accepted in final form 10 February 2003


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 NOTE ADDED IN PROOF
 REFERENCES
 
SPOC1 cells, which are a mucin-secreting model of rat airway goblet cells, possess a luminal P2Y2 purinoceptor through which UTP, ATP, and ATP{gamma}S stimulate secretion with EC50 values of ~3 µM. PMA elicits mucin secretion with high EC50 (75 nM) and saturation (300 nM) values. For the first time in airway mucin-secreting cells, the PKC isoforms expressed and activated by a secretagogue were determined using RT-PCR/restriction-enzyme mapping and Western blotting. Five isoforms were expressed: cPKC{alpha}, nPKC{delta} and -{eta}, and aPKC{zeta} and -{iota}/{lambda}. PMA caused cPKC{alpha} and nPKC{delta} to translocate to the membrane fraction of SPOC1 cells; only nPKC{delta} so responded to ATP{gamma}S. Membrane-associated nPKC{delta} and mucin secretion increased in parallel with ATP{gamma}S concentration and yielded EC50 values of 2–3 µM and maximum values of 100 µM. Effects of PMA to increase membrane-associated cPKC{alpha} and nPKC{delta} saturated at 30 nM, whereas mucin secretion saturated at 300 nM, which suggests a significant PKC-independent effect of PMA on mucin secretion. A prime alternate phorbol ester-receptor candidate is the C1-domain protein MUNC13. RT-PCR revealed the expression of ubiquitous (ub)MUNC13-2 and its binding partner, DOC2-{gamma}. Hence, P2Y2 agonists activate nPKC{delta} in SPOC1 cells. PMA activates cPKC{alpha} and nPKC{delta} at high affinity and stimulates a lower affinity PKC-independent pathway that leads to mucin secretion.

exocytosis; mucus; airways; P2Y receptor


THE INVOLVEMENT OF PKC in signal transduction has long been accepted (59), and recent work on the identification of specific PKC isoforms and the determination of their structure and regulation (32, 54, 58) has illuminated many details of this participation. Briefly, PKC is a family of 10 serine/threonine kinase isoforms divided into three subfamilies plus one unique isoform, PKCµ or PKD, that is included only by virtue of sharing similar catalytic domains. All isoforms except PKCµ possess a C1 domain, which is a cysteine-rich region of ~50 amino acids that in most isoforms is present as a tandem repeat and functions to bind the kinase to phospholipid membranes via diacylglycerol (DAG). C1 domains also bind phorbol esters such as PMA at very high affinity. Conventional PKC isoforms (cPKC{alpha}, -{beta}I, -{beta}II, and -{gamma}) possess a double C1 domain that is followed on the COOH-terminal side by a C2, Ca2+-dependent phospholipid-binding domain. Novel PKC isoforms (nPKC{delta}, -{epsilon}, -{eta}, and -{theta}) possess a double C1 domain and a Ca2+-independent C2 domain on the NH2-terminal side of the C1 domain. For novel PKC isoforms, being bound to membranes by DAG or PMA is sufficient for activation. Atypical PKC isoforms [aPKC{zeta} and -{iota}/{lambda} (human and rodent, respectively)] possess a single atypical C1 domain and are insensitive to DAG and Ca2+. These isoforms are activated by phosphoinositide-dependent kinase-1 (PDK-1; Ref. 58). Despite decades of work on the molecular mechanisms of PKC activation and action, there remain significant deficits in our knowledge of PKC function regarding the specific roles in cell regulation played by the various PKC isoforms. The number of agonist-mediated events for which the participating PKC isoforms has been identified rigorously is too small to formulate generalizations. For agonist-regulated exocytotic secretion, for instance, only in GH4 (4) and rat basophilic leukemia (RBL) cells (11) have specific PKC isoforms been identified as having a direct role in the secretory response to agonist, namely, nPKC{epsilon} and cPKC{beta}I, respectively.

Goblet cells in the superficial epithelium of the airways (15) and mucous cells in the submucosal glands (23) are secretory epithelial cells that exocytotically release mucin, which is a polymeric high-molecular-weight glycoconjugate that forms the mucus gel responsible for mucociliary clearance. In airway obstructive diseases, arachidonic acid metabolites, inflammatory mediators, bacterial byproducts, reactive oxygen-nitrogen species, and other agents cause mucin hypersecretion by stimulation of goblet cell and submucosal gland meta- and/or hyperplasia. The stimulation from these sources to secrete mucin in both health and disease appears to be controlled by other agents that emanate from the peripheral nervous system or from cells that effect control through local mediators. For mucous cells in submucosal glands, a vast array of agonists and mediators stimulate mucin secretion; in contrast, goblet cells respond to few signaling agents (18). Indeed, the only agents shown rigorously to stimulate goblet cells to secrete mucin consistently and across species and experimental models are ATP and UTP, which appear to act via luminal P2Y2 purinoceptors (P2Y2-R; Refs. 2, 16, 40).

In accord with the general notion that P2Y2-R couples through Gq to phospholipase C (26), inositol phosphate production is elevated in goblet cells by purinergic agonists (40, 41), and mucin secretion is stimulated by both the DAG mimic PMA and the Ca2+ ionophore ionomycin (16, 17). Additionally, membrane-associated PKC activity is enhanced by P2Y2 agonists in SPOC1 cells, and the actions of ionomycin and PMA are fully additive at maximal concentrations, which suggests that Ca2+ and PKC are potentially independent in their actions to effect mucin secretion (1). In agreement with this notion of independence, we recently reported for permeabilized SPOC1 cells that mucin secretion was activated by PMA when Ca2+ activity was buffered to 10 nM, which is a level well below normal resting levels of intracellular Ca2+ (70). Hence, the cumulative data support the participation of one or more Ca2+-independent novel PKC isoforms in the mucin secretory response to purinergic agonist. In this article, RT-PCR/restriction-enzyme mapping and Western blotting techniques were used to identify the PKC isoforms expressed in SPOC1 cells and those that respond uniquely to secretagogue activation of mucin secretion. Additionally, we identified proteins in SPOC1 cells other than PKC that potentially participate in PMA-stimulated mucin secretion by virtue of their DAG-interacting C1 domains (36).


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 NOTE ADDED IN PROOF
 REFERENCES
 
Materials

Culture medium was purchased from GIBCO-BRL (Gaithersburg, MD), and its supplements were from Collaborative Research (Bedford, MA); nucleotides were purchased from Boehringer-Mannheim (Indianapolis, IN). PKC isoform-specific polyclonal antibodies generated against synthetic peptides corresponding to unique COOH-terminal sequences and the corresponding synthetic peptides were purchased from Santa Cruz Biotechnology (Santa Cruz, CA), Promega (Madison, WI), Life Technologies (Gaithersburg, MD), Pan-Vera (Madison, WI), and Oxford Biomedical Research (Oxford, MI). All other chemicals were purchased from Sigma Chemical (St. Louis, MO).

SPOC1 Cell Culture and Mucin Assay

SPOC1 cells (65), passages 7–14, were seeded at 9 x 103 cells/cm2 in 100- or 60-mm tissue-culture plates, or in six-well cluster plates (Costar, Cambridge, MA) and were grown in a DMEM/F-12-based fully defined culture medium (34, 65). Except for cells that were grown solely for passaging, the medium contained 10 nM retinoic acid. Culture media were changed daily, and the cultures were used for experiments after differentiation of a mucin-secreting phenotype at 14–21 days postconfluence.

Media samples were assessed for mucin content by enzyme-linked lectin assay as described previously (2). Briefly, 100-µl samples were added to the wells of 96-well high-binding microtiter plates (Costar no. 3590) with incubation either overnight at 4°C or for 2 h at 37°C. The unbound materials were removed by washing the plates with PBS that contained 0.05% Tween 20 and 0.02% Thimerosol, and the plates were then incubated with 1–5 µg/ml horseradish peroxidase-conjugated soybean agglutinin (SBA) for 1 h at 37°C. After the plates were washed and developed by incubation in 0.04% wt/vol of the substrate (O-phenylene diamine in 0.0175 M citrate-phosphate buffer, pH 5.0, that contained 0.01% hydrogen peroxide), the reaction was stopped by the addition of 4 M sulfuric acid and the optical density was determined at 490 nm (model MR5000 microtiter plate reader, Dynatech, Chantilly, VA). Optical density was converted to nanograms of mucin from standard curves using purified SPOC1 mucin applied to each microtiter plate (2).

RT-PCR and Restriction-Enzyme Mapping

Total RNA was isolated from SPOC1 cells using TRI reagent (Sigma) in accordance with manufacturer's procedures. In each such preparation used, rRNA bands that resulted from electrophoresis on agarose gels were intact, clearly identifiable, and correctly sized. First-strand cDNA was synthesized from 8 µg of total RNA using the SuperScript pre-amplification system (GIBCO) with oligo-dT as a primer. The subsequent PCR reactions used Taq polymerase (GIBCO) and PKC, the mammalian homolog of the uncoordinated (UNC) Caenorhabditis elegans mutants, MUNC13, or double-C2 (DOC2)-specific primers that were synthesized by the University of North Carolina Department of Pathology Nucleotide Synthesis Facility. Sequence data were analyzed with Genetics Computer Group (GCG, Madison, WI) or Vector-NTI (InforMax, Bethesda, MD) software.

For the PKC isoforms, the forward and reverse primers targeted conserved sequences at the 5' end of the C3 domain and in the middle of the C4 domain, respectively. The forward and reverse primers used for conventional and novel isoforms were AARGGSAGYTTTGGSAAG and GGRGCAAKASTCWGG; for atypical PKC isoforms, they were GGAAGTTATGCCAARGTMCT and GCCATCATCTCAAACATRAG. For each PKC isoform, the predicted sizes of the PCR products to result from the use of these primers are indicated in Table 1.


View this table:
[in this window]
[in a new window]
 
Table 1. Analysis of SPOC1 cell PKC isoform RT-PCR products

 

After separation by electrophoresis in 2% agarose gels, PCR products were stained with ethidium bromide for analysis. Restriction maps of PKC isoform sequences retrieved from GenBank were used to select combinations of restriction enzymes that would cleave the PKC isoform cDNA fragments uniquely within each subfamily (Table 1). Because the SPOC1 cells were derived from rat trachea, rat PKC isoform sequences were used when available; where necessary, we used sequences from the homologous mouse or human genes. Each analysis, i.e., a PCR plus its associated restriction-enzyme digestion series for a specific PKC subfamily, was conducted at least twice. In two instances, ambiguities in the results warranted additional steps. For an isoform that proved to be nPKC{epsilon}, RT-PCR was used with the common forward primer specified for the conventional and novel PKC isoforms along with the isoform-specific reverse primer CATGAGGGCCGATGTGACCT. The resulting PCR product was cloned using a TA Cloning Kit (Invitrogen) and sequenced (Univ. of North Carolina Automated DNA Sequencing Facility). And for an isoform that proved to be aPKC{iota}/{lambda}, the original PCR products were cloned and the nucleotide base sequences were determined. As controls, we used rat brain RNA and PTB vectors that contained rat cPKC{alpha}, nPKC{delta}, and aPKC{zeta}, which were kindly provided by Dr. Yoshitaka Ono of the University of Kobe.

The isoforms of MUNC13 expressed in SPOC1 cells were identified in two steps. First, using primers to conserved sequences in the C1 and C2 domains (see Fig. 5), we tested for mRNA expression of MUNC13-1, -2, and -3 using the forward and reverse primers CCCACCTACTGCTAYGAGTGYGA and TGTATWGGGTCACTGGAYCCTGT, respectively. As for PKC isoforms, the PCR fragments were incubated with restriction enzymes selected for their predicted ability to cleave the possible cDNA fragments uniquely: DraIII for MUNC13-1, MscI for MUNC13-2, and RsaI for MUNC13-3. Second, specific primers were used to distinguish between the alternatively spliced mRNAs of MUNC13-2 and to test for MUNC13-4 expression. The MUNC13-2 common forward primer was TGCACGAGATGGGGTAGATTAA, and the specific reverse primers for the brain and ubiquitous spliceoforms were AACTCACCTCTTACAAACTCA and CTCCGTCAGACCTGATGCTGCA, respectively. For MUNC13-4, the forward and reverse primers were ACCATCCTCTTTCTCCACGCCA and TGAGGAGGGACTGCAGCCTGGA, respectively.



View larger version (37K):
[in this window]
[in a new window]
 
Fig. 5. Mammalian homolog of the uncoordinated (UNC) Caenorhabditis elegans mutants (MUNC)13 isoform mRNA expression in SPOC1 cells. Domain maps for MUNC13 isoforms show locations of sequences selected for PCR (after Ref. 43). Restriction enzyme cleavage sites within the conserved sequences of MUNC13-1 (DraIII), MUNC2 (Msc1), and MUNC3 (Rsa1) are indicated (v). Isoform-specific restriction enzyme digestions of RT-PCR products (A) were derived from the use of primers to conserved sequences designed to amplify MUNC13-1, -2, and -3. Digestion by MscI indicated MUNC13-2 expression. RT-PCR products resulted from amplification with spliceoform-specific primers (B) for ubiquitous (ub)- and brain (b)MUNC13-2 and isoform-specific primers to MUNC13-4 are shown.

 

DOC2 mRNA expression in SPOC1 cells was determined using the following isoform-specific forward and reverse primers, respectively: for {alpha}, TATGATCAGGCTTCCTGCAT and AGCGCCGCAGACATTGAAGA; for {beta}, ACTGCACCATCAGCAAAGCC and ATAGTCCCAGACAGTGACCTCC; and for {gamma}, CTGTCCCTGTGCTACAGTTC and CTGCACCCCACCAATGAAATC.

To verify the identity of MUNC13 and DOC2 isoforms indicated by positive RT/PCR-restriction-enzyme digestion results, the products were cloned and sequenced as described for PKC isoforms.

Western Blotting

The expression of PKC proteins was determined by Western blotting in SPOC1 cells. Whole cell lysates were prepared and protein concentrations were estimated as previously described (1). Briefly, after cultures were washed and equilibrated, they were incubated for 40 min or for other time periods as stated (see RESULTS, control conditions or with addition of ATP{gamma}S or PMA at the concentrations indicated). At the end of the incubation period, a sample of the medium was removed for mucin analysis when appropriate to the experiment, and the cells were quickly washed with ice-cold PBS after which they were lysed on ice using a hypotonic buffer (in mM: 20 Tris · HCl, 2 EGTA, 2 EDTA, 6 {beta}-mercaptoethanol, and 0.1 PMSF). At 4°C, the lysed cells were homogenized (15 strokes, Potter-Elvehjem tissue grinder), the extract was centrifuged for 1 h at 100,000 g, and the supernatant was taken as the cytosol fraction. The pellet was solubilized in buffer supplemented with 0.1% Triton X-100, incubated 30–60 min, and centrifuged (14,000 rpm, Eppendorf 5415C microcentrifuge), and the supernatant was taken as the membrane fraction. Samples of the two fractions were taken for protein analysis (BCA Protein Assay Kit, Pierce Biotechnology, Rockford, IL), and the remainder were frozen and stored at -70°C.

Within 48 h of the experiment, the cell fractions were thawed, and equivalent amounts of protein (10–20 µg/lane) were resolved by 10% SDS-PAGE and electrophoretically transferred to polyvinylidene difluoride membranes. In many experiments, the lysates were first fractionated into cytosol and membrane pools of protein by centrifugation (100,000 g) as described. The blots were probed with PKC isoform-specific antibodies from commercial sources (Table 2) using dilutions appropriate to the respective analysis. Where possible, antibody specificity was tested by preabsorbing the antibody with the synthetic peptide antigen (50-fold excess). Immunoreactive proteins were detected using enhanced chemiluminescence (Amersham, Arlington Heights, IL). Films of the Western blots were imaged with a platform scanner at a resolution of 600 x 600 dpi and quantitated using MetaMorph image-processing software (Universal Imaging, Downingtown, PA).


View this table:
[in this window]
[in a new window]
 
Table 2. Summary of Western blot testing for PKC isoform expression in SPOC1 cells

 


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 NOTE ADDED IN PROOF
 REFERENCES
 
SPOC1 cell PKC isoform expression was studied with a dual approach. From total RNA, we used a combination of RT-PCR and restriction-enzyme mapping to first identify the PKC isoform mRNAs that were expressed. Second, using Western blotting with PKC isoform-specific antibodies, we verified the expression at the protein level of those isoforms identified at the mRNA level. Western blotting was also used subsequently to determine which PKC isoforms responded to purinergic stimulation by translocation to the membrane fraction.

Identification of SPOC1 Cell PKC Isoform mRNAs

From oligo-dT primed SPOC1 cell cDNA, the genes that represent PKC isoforms within each subfamily (conventional, novel, and atypical; see Ref. 54) were amplified by PCR using degenerate primers that were >=94% identical to the nucleotide sequences of the known subfamily members. The products of each PCR were digested by restriction enzymes that were selected to cleave specific PKC isoforms based on published nucleotide sequences (see Table 1).

Conventional and novel PKC isoforms. The PCR reaction that resulted from primers designed for conventional and novel PKC isoforms from SPOC1 cDNA yielded a single prominent band on an agarose gel with a size ~480 bp. The presence of cPKC{alpha} and cPKC{gamma} in this band was indicated by the production of fragments of appropriate size produced by following digestion with ApoI, MseI, and NcoI (see Table 1) and a diminution in signal strength of the original PCR band at ~480 bp (data not shown). By comparison with the band intensity of products judged to represent cPKC{alpha}, those representing cPKC{gamma} were very weak; hence, the abundance of cPKC{gamma} in the SPOC1 cell total RNA may be low, or this isoform may have been amplified with low efficiency. SPOC1 cell cDNA did not contain either of the cPKC{beta} isoforms as is indicated by the failure of NcoI and PstI to generate digestion products of any size.

The presence of nPKC{delta} and nPKC{eta} in SPOC1 cell cDNA was indicated by the generation of appropriately sized fragments (see Table 1) after digestion of the PCR products by NcoI and PstI (nPKC{delta}) and by BamHI and PstI (nPKC{eta}); NPKC{theta} was not expressed. The data relevant to nPKC{epsilon}, however, were equivocal: a very faint band of appropriate size was apparent from a digestion with Xba (data not shown), but appropriately sized bands in the Mse digestion were not apparent (see Table 1). To resolve this issue, primers specific to nPKC{epsilon} were generated. The resulting RT-PCR resulted in a faint band of the proper size on the agarose gel, and the product, after it was cloned, proved to possess the proper sequence for the isoform.

Atypical PKC isoforms. PCR primers for isoforms in the atypical PKC subfamily generated a single, prominent band that is consistent with the predicted size of 557 bp. We identified aPKC{zeta} by the digestion of a portion of this PCR product by MseI with the generation of appropriately sized fragments (see Table 1). Digestion with MseI also generated a product pair of ~460 and 100 bp that was inconsistent with any of the known PKC isoforms. Hence, we suspected the existence of an undescribed isoform or, because the rat sequence for aPKC{lambda} isoform is unknown, that rat aPKC{lambda} might lack the MseI restriction site that is present in the mouse sequence. To resolve this issue, the aPKC PCR product was cloned, and the nucleotide sequence of four clones was determined. Three of the SPOC1 cell (rat) clones possessed sequences 94% identical with mouse aPKC{iota}/{lambda}, which lacked one of the MseI restriction sites that is found in the mouse sequence. Because of the high degree of identity, we conclude that the gene that yields this clone is the rat homolog of aPKC{iota}/{lambda}. The fourth clone yielded a sequence consistent with aPKC{zeta}.

In summary, analysis of SPOC1 mRNA using a combination of PCR and restriction-enzyme digestion indicated the expression of cPKC{alpha} and -{gamma} (trace), nPKC{delta},-{epsilon} (trace), and -{eta}, and aPKC{zeta} and -{iota}/{lambda}.

Western Blot Analysis of SPOC1 Cell PKC Isoform Expression

PKC isoforms were judged to be expressed at the protein level in SPOC1 cells when the appropriate positive signals were present on Western blots (generally when antibodies from two or more independent vendors were used). Rat brain extract was used as a positive control for most isoforms, and specificity was tested with most antibodies by preabsorption with a 50-fold excess by weight of the synthetic peptide antigen. The experiments are summarized in Table 2.

Conventional PKC isoforms. We found that cPKC{alpha} appeared to be the only member of the conventional PKC subfamily that was expressed significantly at the protein level in SPOC1 cells (see Table 2). Similar probes of SPOC1 cell extracts with antibodies to cPKC{beta} (Fig. 1) and to cPKC{gamma} were negative, whereas positive signals in both cases were obtained from rat brain. Hence, SPOC1 cells do not appear to express significant amounts of cPKC{beta} or -{gamma}, even though for the latter isoform, we detected trace amounts of cPKC{gamma} mRNA by PCR (see Atypical PKC isoforms in Identification of SPOC1 Cell PKC Isoform mRNAs and Table 1).



View larger version (39K):
[in this window]
[in a new window]
 
Fig. 1. Western blots show the lack of significant cPKC{beta} and nPKC{epsilon} expression in SPOC1 cells. Whole SPOC1 cell or brain extracts (10 µg of protein/lane) were resolved by PAGE, and blots were probed with isoform-specific antibodies. Where indicated, the antibody was preabsorbed with blocking peptide.

 

Novel PKC isoforms. We found that nPKC{delta} and -{eta} were positively identified in extracts of SPOC1 cell and rat brain (see Table 2). Like cPKC{gamma}, antibodies against nPKC{epsilon} tested against SPOC1 cell extracts yielded negative results, whereas faint signals were observed via RT-PCR, and a positive nPKC{epsilon} signal was obtained by Western blotting from rat brain extracts when the same antibody was used (see Fig. 1).

Atypical PKC isoforms. As shown (see Table 2), aPKC{zeta} and -{iota}/{lambda} were positively identified in extracts of SPOC1 cells.

In summary, Western blotting analysis confirmed the strong signals observed by RT-PCR/restriction-enzyme mapping, which suggests that SPOC1 cells expressed cPKC{alpha}, nPKC{delta} and -{eta}, and aPKC{zeta} and -{iota}/{lambda} at the protein level. However, cPKC{gamma} and nPKC{epsilon}, for which potentially weak expression was indicated by RT-PCR, were not detected by Western blotting. We also found that cPKC{beta}, which was not detected by RT-PCR, was similarly undetectable by Western blotting.

Response of SPOC1 Cell PKC Isoforms to Secretagogues.

Conventional and novel PKC isoforms typically translocate from the cytosol to a membrane surface upon activation by DAG or PMA (32, 58). Hence, as an initial test of the involvement of PKC isoforms in the mucin secretory response of SPOC1 cells, we probed cytosol and membrane fractions of SPOC1 cell extracts by Western blotting using isoform-specific PKC antibodies before and after 40 min of stimulation with PMA (300 nM) and the purinergic agonist ATP{gamma}S (100 µM), secretagogue concentrations of which elicit maximal mucin secretory responses from SPOC1 cells (1, 2). [ATP{gamma}S was used as a P2Y2-R agonist to minimize potential extracellular metabolism of the nucleotide; it is equipotent with ATP and UTP in stimulating SPOC1 cell mucin secretion (2).] The immunoblots for nPKC{eta}, aPKC{zeta}, and aPKC{iota}/{lambda} indicated that neither PMA nor ATP{gamma}S had effects on their respective distributions between cytosol and membrane fractions (data not shown). In contrast, immunoblots for cPKC{alpha} indicated a translocation to the membrane fraction induced by PMA; for nPKC{delta}, both PMA and ATP{gamma}S induced a cytosol-to-membrane translocation. Hence, we evaluated the time courses of the secretagogue-induced translocation of these two isoforms.

The time courses of the individual responses of cPKC{alpha} and nPKC{delta} to PMA are depicted in Fig. 2. For both isoforms, a significant translocation of PKC from the cytosol to the membrane fraction occurred within the first 15 min of the PMA challenge. The peak translocation of cPKC{alpha} (approximately a threefold increase) occurred at 30 min, after which the amount of protein in the membrane declined. At 4 h, the amount of cPKC{alpha} in the membrane exceeded control levels, but the signal at 16 h approximated the control. The relative amounts of nPKC{delta} in the membrane fraction, in contrast, were relatively constant at ~1.75-fold above the control from 15 to 60 min after PMA addition. Subsequently, the amounts declined sharply: at 4 h after PMA addition, <25% of the control levels of nPKC{delta} remained in the membrane fractions, and undetectable amounts were present at 16 h.



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 2. Time course of cPKC{alpha} (A) and nPKC{delta} (B) translocation from cytosol to membrane fractions in SPOC1 cells induced by 300 nM PMA. Western blots of extracts from SPOC1 cells harvested at the times indicated were quantified from digitized images. Data are expressed as means ± SE (n = 3) of integrated intensity of the PKC-specific band relative to the t = 0 control. Images of representative immunoblots are shown (insets); lanes correspond to the time points indicated in the bar graphs.

 

ATP{gamma}S caused a different pattern of translocation responses (Fig. 3) from PMA. There was no elevation of cPKC{alpha} in the membrane fraction in response to ATP{gamma}S: the relative amounts of cPKC{alpha} in the cytosol and membrane fractions were essentially unchanged from control over the entire 16-h period of the experiment. The relative amounts of nPKC{delta} in the membrane fraction, however, were elevated in response to ATP{gamma}S with a peak of ~1.75-fold over the control occurring at 30 min. Correspondingly, the amounts of nPKC{delta} in the cytosol fraction were diminished by ATP{gamma}S over time; the minimum, ~0.4-fold of the control, also occurred 30 min after the agonist challenge. Finally, and in contrast to the longer-term effects of PMA to downregulate nPKC{delta} to negligible levels (see Fig. 2), the amount of nPKC{delta} in the membrane and cytosol fractions returned approximately to control levels following the peak response to ATP{gamma}S (Fig. 3).



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 3. Time course of effects of P2Y2 agonist (100 µM ATP{gamma}S) on the distribution of cPKC{alpha} (A) and nPKC{delta} (B) between SPOC1 cell cytosol and membrane fractions. Western blots were prepared and quantified as in Fig. 1 (n = 4). Images of representative immunoblots are shown (insets); lanes correspond to the time points indicated in the bar graphs.

 

Relationships between Secretagogue-Induced PKC Translocation and Mucin Secretion

The observation that nPKC{delta} but not cPKC{alpha} translocated to the membrane fraction after purinergic stimulation suggests that this isoform may be involved selectively in regulation of the SPOC1 cell mucin secretory responses to agonist. As a more direct test of the causal relationships between nPKC{delta} and mucin secretion, we determined the concentration-effect relationships for both PMA and ATP{gamma}S on the translocations of cPKC{alpha} and nPKC{delta} to the membrane fraction and compared these results with the respective concentration-effect relations on mucin release in the same set of SPOC1 cell cultures. The concentration-effect relationships for ATP{gamma}S on cPKC{alpha} and nPKC{delta} translocation and mucin secretion are depicted in Fig. 4A. Consistent with the time-course experiments, ATP{gamma}S had no effect on the distribution of cPKC{alpha} in the membrane. The relative amount of nPKC{delta} in the membrane fraction, however, increased with increasing ATP{gamma}S with a maximal translocation, 1.7 ± 0.1-fold over the control, occurring with 100 µM ATP{gamma}S. Interestingly, the effects of ATP{gamma}S on mucin release (Fig. 4A, dashed line) closely paralleled the effects of agonist on membrane-associated nPKC{delta}: both maxima occurred at 100 µM, and the EC50 value for each event was ~2–3 µM.



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 4. Concentration-effect relationships for ATP{gamma}S (A) and PMA (B) on membrane translocation of cPKC{alpha} and nPKC{delta} and on mucin secretion. For each secretagogue, cells were exposed to the concentrations indicated for 30 min. Samples of the medium were then collected for mucin analysis, the reactions were quenched, and the cells were fractionated as described (see MATERIALS AND METHODS). Amount of PKC isoform in the membrane fraction of SPOC1 cells is expressed relative to control; the Western blots were quantified as described in Fig. 1 (n = 7). Similarly, mucin secretion is expressed relative to control (SE bars, omitted for clarity, were generally <= 10% of the mean for each point).

 

Figure 4B shows that PMA induced the translocation of both cPKC{alpha} and nPKC{delta} to the membrane fraction but only at low concentrations. There was a significant elevation in the amount of each membrane-associated isoform at 10 nM PMA, and they saturated at concentrations >30 nM, at levels of 3.6 ± 0.8- and 3.2 ± 0.8-fold above control, respectively. The pattern of mucin release in this experiment (Fig. 4B, dashed line) paralleled the translocation of cPKC{alpha} and nPKC{delta} to the membrane fraction at low PMA concentrations but continued to increase at higher concentrations with an apparent saturation in the range of 300–1,000 nM PMA. This responsiveness of mucin release to PMA is consistent with our previous studies, which showed that the peak response occurred at 300 nM PMA (1). However, because mucin secretion increased substantially with PMA concentrations >30 nM, whereas PKC translocation into the membrane fraction saturated at 30 nM, a substantial PKC-independent effect of PMA on mucin secretion in SPOC1 cells is indicated.

MUNC13 and DOC2 Expression in SPOC1 Cells

Proteins with DAG-binding C1 domains other than PKC have been described recently (see Ref. 36); consequently, one of these "phorbol ester receptors" is likely to be responsible for the PKC-independent effects of PMA on mucin secretion from SPOC1 cells. Of the C1 domain-containing proteins known, few localize to the secretory pathway (36); of those that do, MUNC13 is an especially attractive candidate because of its plasma membrane localization and obligate participation in regulated exocytosis (6, 10). Using RT-PCR, we probed for the mRNA expression in SPOC1 cells of MUNC13 and its secretory granule membrane-binding partner DOC2 (20). From SPOC1 cell total RNA, MUNC13-2 was identified initially on the basis of a positive band of the correct size that resulted from the use of common primers for MUNC13-1, -2, and -3, which was followed by the successful digestion of the PCR product by MscI (Fig. 5A). From the lack of PCR product digestion by DraIII and RsaI, MUNC13-1 and -3 are apparently not expressed. Isoform-specific primers were used subsequently to test whether the brain or ubiquitous splice variant of MUNC13-2 was expressed (8) as well as for the expression of MUNC13-4 (43). Positive bands were obtained with RT-PCR primers specific to ubMUNC13-2 and MUNC4 (Fig. 5B), an identification that was verified by cloning and sequencing the PCR products. Analysis of DOC2 mRNA expression in SPOC1 cells by RT-PCR using specific primers reveals that of the three known isoforms, only DOC2{gamma} is expressed in SPOC1 cells (Fig. 6); this result was again verified by cloning and sequencing the PCR product.



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 6. Double-C2 protein (DOC2) isoform mRNA expression in SPOC1 cells. RT-PCR products are shown from reactions that employed isoform-specific primers to DOC2{alpha}, -{beta}, and -{gamma}.

 


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 NOTE ADDED IN PROOF
 REFERENCES
 
Recent intense efforts to define the molecular basis of the regulated exocytotic pathway in nerve terminals and secretory cells have resulted in the identification of many primary and accessory proteins that participate in the process in both types of cells (31). The core exocytotic complex is composed of one member of each of the three soluble N-ethylmaleimide-sensitive fusion (NSF)-protein-receptor subfamilies: syntaxin and the 25-kDa soluble NSF attachment protein (SNAP-25) in the plasma membrane and in the granule membrane, the vesicle-associated membrane protein, VAMP, or synaptobrevin. As the membranes approach one another during exocytosis, the twisted helices of these proteins are brought into contact and they subsequently interact to leverage the two membranes together to promote membrane fusion (31). Obligate accessory proteins to the core complex such as MUNC18 and N-ethyl maleimide-sensitive factor are necessary for membrane fusion and core-complex disassembly, whereas others such as synaptotagmin and MUNC13 play regulatory roles, in this case imparting sensitivities to Ca2+ and DAG, respectively (31, 52). Agonist regulation of exocytotic secretion is initiated by the activation of intracellular signaling cascades that result ultimately in transient increases in Ca2+ and DAG, which trigger exocytosis; note that these transients may be localized to the vicinity of the exocytotic core complex, and in secretory cell exocytosis, the transients may be unrelated to those occurring in the upstream signaling cascades. For most secretory cells including airway goblet cells, agonist activation of exocytosis is largely ill defined beyond receptor activation of intracellular messenger production. Available evidence from model systems suggest, however, that cortical actin microfilaments play a key negative regulatory role in exocytosis by controlling access to docking sites on the plasma membrane and acting as a barrier to the approach of secretory granules (75, 76). Two proteins appear to effect this necessary disruption of the microfilamentous barrier (see Refs. 56, 74): myristolated alanine-rich C kinase substrate (MARCKS) protein, which anchors microfilaments into the plasma membrane, releases from the membrane when phosphorylated by PKC (27), and scinderin (or adseverin), a microfilament-severing enzyme that is closely related to gelsolin, which severs microfilaments when activated by Ca2+ (67, 77). After cortical microfilament disruption, secretory granules dock at the plasma membrane, prime, and exocytose (52), which are processes that occur in a highly regulated fashion and are possibly independent of agonist-related second messengers.

In SPOC1 cells, the available data from RT-PCR and pharmacological experiments indicate that the effects of ATP and UTP to elicit mucin secretion are mediated by P2Y2-R localized to the apical membrane (2), which in turn activate PLC thereby causing inositol 1,4,5-trisphosphate production/Ca2+ mobilization and DAG production and initiating the intracellular signaling cascade (17) that leads to mucin secretion. The goal of this work was to identify the PKC isoform(s) in SPOC1 cells that underlie P2Y2-mediated mucin secretion to begin the process of identifying these pathways at the molecular level in an airway goblet cell model.

P2Y2-R Signaling and PKC Isoform Expression in SPOC1 Cells

In this first study of PKC isoform expression in an airway goblet cell model, RT-PCR/restriction-enzyme mapping and Western blotting analyses showed that SPOC1 cells express cPKC{alpha}, nPKC{delta} and -{eta}, and aPKC{iota}/{lambda} and -{zeta} (see Tables 1 and 2). The cPKC{gamma} and nPKC{epsilon} mRNAs were identified as very faint bands on agarose gels, but the corresponding proteins were not detected by Western blotting; consequently, these isoforms do not appear to be expressed at physiologically significant levels in these cells. Because aPKC{iota}/{lambda} was shown to participate in the formation of tight junctions, it is very likely to be expressed ubiquitously in epithelial cells (30). The cPKC{alpha}, nPKC{delta} and -{eta}, and aPKC{zeta} isoforms are widely expressed in epithelial tissues including lung and its airways, gastrointestinal tract, and kidney (13, 33, 46, 55, 6163). Significantly, cPKC{beta} and nPKC{epsilon}, which have been implicated widely in both epithelial function (e.g., 7, 12, 66, 73) and regulation of exocytosis (see next section and Refs. 4, 11), are not detectable in SPOC1 cells by Western blotting (see Fig. 1). Although the pattern of PKC isoform expression in SPOC1 cells is consistent with the epithelial nature of the cell type (65), departures from the isoforms active in exocytosis in nonepithelial secretory cell types are apparent that may indicate interesting differences in regulation of the secretory event.

Responses of PKC Isoforms to PMA and Purinergic Agonists

In response to stimulation by 300 nM PMA, a concentration that elicits maximal mucin release from SPOC1 cells (1), cPKC{alpha} and nPKC{delta} were observed to translocate from the cytosol to membrane fractions (see Fig. 2), which is as expected for isoforms in the conventional and novel PKC subfamilies. In contrast, nPKC{eta} and aPKC{zeta} and -{iota}/{lambda} did not undergo PMA-induced translocation. Also, nPKC{eta} is insensitive to PMA in keratinocytes (57) but is activated by cholesterol sulfate (19, 29). This compound in SPOC1 cells, however, had no effect on the localization of nPKC{eta} (data not shown). Because cholesterol sulfate has been shown to activate not only nPKC{eta} in keratinocytes but also nPKC{epsilon} and aPKC{zeta} (19), and because nPKC{eta} is activated by PMA in other cell types (e.g., see Ref. 38), the regulation of nPKC{eta} may prove to be cell specific.

In contrast to PMA, stimulation of SPOC1 cells by a maximal concentration of purinergic agonist (ATP{gamma}S, 100 µM) elicited a translocation of nPKC{delta} but not CPKC{alpha} to the membrane fraction (see Fig. 3). Notably, the development of nPKC{delta} translocation after agonist challenge followed a time course that is typical for the SPOC1 cell mucin secretory response (2), which suggests a temporally linked correlation. A more quantitative relationship between nPKC{delta} translocation and mucin secretion was suggested by the concentration-effect study shown in Fig. 4A. Here we found a clear correlation between agonist and relative quantity of nPKC{delta} localized to the membrane fraction; importantly, there was also a parallel rise in mucin secretion. Thus these two purinergically driven cellular events are characterized by similar time courses and EC50 values of 2–3 µM and identical concentration maxima of 100 µM, all of which strongly support a cause-effect relationship between the translocation of nPKC{delta} and mucin secretion.

Although nPKC{delta} has been implicated widely in the regulation of cell growth, differentiation, and apoptosis and tumor development (25), its potential role in the agonist regulation of differentiated cell function is less well understood. The one role suggested for nPKC{delta} in airway columnar epithelial cell function is the activation of the Na-K-2Cl cotransporter (NKCCl), which is a function in the superficial epithelium ascribed to the basolateral membrane of ciliated cells (48, 49). Interestingly, the most logical site for regulatory actions of nPKC{delta} in mucin granule exocytosis from goblet cells is the apical membrane; hence, we speculate that nPKC{delta} may localize differentially during activation of the two major columnar cell types of the airway epithelium.

The role of PKC in the regulation of exocytosis has been studied extensively in many secretory cells including mucin-secreting cells of the intestine (21, 28), lachrymal gland (78), and airway submucosal gland (45, 71) and surface epithelia (1, 15, 35, 42). Most of these studies, however, have relied exclusively upon the use of phorbol ester (PMA) to activate PKC, and/or they used putative PKC-specific inhibitors for the identification. As with many other kinase inhibitors, most PKC inhibitors have proven to be nonspecific (e.g., Refs. 14, 72). Also, the use of PMA suffers a dual limitation: not only does it attract conventional and novel isoforms to the membrane indiscriminately (51, 60), it also similarly activates other proteins that have DAG/phorbol ester-binding C1 domains (see next section and Ref. 36). Hence, although PMA and inhibitors may be used to generate useful information about PKC and its role in cellular regulation, their utility in identifying specific isoforms that regulate exocytosis or other functions is highly questionable.

In many secretory cells, specific PKC isoforms have been observed to translocate upon agonist activation (e.g., see Refs. 24, 44, 53, 78), but the putative cause-effect relationships between PKC isoform translocation and exocytosis have not been tested more directly. In only a couple of secretory cell types have specific PKC isoforms been associated with the regulation of exocytosis, by agonist, using relatively rigorous criteria. The nPKC{epsilon} isoform has been implicated in the TRH-stimulated prolactin secretory response of GH4 cells, which is an anterior pituitary lactotroph cell model: nPKC{epsilon} translocated to the membrane fraction and was selectively downregulated by TRH stimulation (39), and prolactin secretion was selectively enhanced by its overexpression (4). Additionally, MARCKS has been recently identified as the major downstream target of nPKC{epsilon} phosphorylation in these cells (3), which is consistent with its postulated role in microfilament disruption (74). A recent paper proposed a different role for MARCKS in regulated mucin secretion from human airway goblet cells: once liberated to the cytoplasm, MARCKS was suggested to bind to mucin granules to allow microfilaments to attach and guide them to the plasma membrane (47). Although this hypothesis is intriguing, it is contrary to observations on other secretory cell models (see beginning of DISCUSSION), and therefore requires independent verification as well as testing in other systems. In intact RBL cells, which are a mast cell model, CPKC{alpha} and -{beta} and nPKC{delta} and -{epsilon} were observed to translocate to the membrane fraction upon stimulation by antigen. In permeabilized RBL cells following rundown, however, only the exogenous addition of cPKC{beta} or nPKC{delta} restored exocytotic secretion (64), and in intact cells, only the overexpression of cPKC{beta}I correlated with an enhanced antigen-induced secretory response (11). It is notable, nonetheless, that three different PKC isoforms, cPKC{beta}I, nPKC{epsilon}, and now, nPKC{delta}, have been implicated as having a direct role in regulated exocytosis in the three different secretory cells that are best characterized for PKC involvement. Hence, the PKC isoforms that participate in regulated exocytosis, a function that is highly conserved in eukaryotic cells, appear to be surprisingly diverse.

PKC-Independent Effects of PMA

Evidence that favors PKC-independent effects of PMA in eliciting mucin secretion from SPOC1 cells can be observed, retrospectively, in our previous work. For instance, the PMA concentration-effect relationship for mucin secretion exhibited a high EC50 value of 75 nM that saturated at ~300 nM, whereas PKC activity generally saturates at 10–30 nM PMA or phorbol dibutyrate (37, 44, 50). Furthermore, typical PKC inhibitors had negligible to insubstantial (~50% inhibition) effects on ATP-induced mucin secretion, and we observed a full additivity between PMA and ionomycin on mucin secretion at maximum effective concentrations (1, 70). Although some of these results such as the lack of responsiveness to "PKC" inhibitors can be at least partially attributed to the activation of a novel isoform by PMA (nPKC{delta}; see Fig. 2), those such as a high PMA EC50 value are more likely due to non-PKC effects of PMA. As shown in Fig. 4B, cPKC{alpha} and nPKC{delta} both translocate maximally to the membrane fraction of SPOC1 cells at 30 nM PMA. That mucin secretion increases significantly as PMA concentrations increase >30 nM therefore indicates strongly that PMA has effects on the exocytotic mechanism that are independent of PKC.

In recent years, new C1-domain proteins have been discovered that function as alternative phorbol ester receptors to the conventional and novel isoforms of PKC (e.g., see Refs. 36, 68, 69). The most likely of these proteins to be responsible for the PKC-independent effects of PMA to promote mucin secretion in SPOC1 cells is MUNC13, the mammalian homolog of UNC-13, which associates with the plasma membrane as an essential accessory protein in the exocytotic apparatus of synaptic terminal and model secretory cell systems (9, 10). MUNC13-1, the brain-specific isoform about which we presently know the most, causes early post-natal death in null mice (6) apparently through a loss of the priming reactions that are necessary for synaptic vesicle exocytosis from glutamatergic and other neurons (5, 52). In SPOC1 cells, we found two MUNC13 isoforms expressed at the mRNA level (see Fig. 5), the ubiquitous splice variant of MUNC13-2, ubMUNC13-2 (8), and MUNC13-4 (43). Although MUNC13-4 localizes primarily to goblet cells in the lung (43), two reasons suggest that ubMUNC13-2 is the isoform most likely to respond to activation of SPOC1 cells by high concentrations of PMA. First, MUNC13-4 lacks the C1 domain characteristic of the other isoforms, which makes it unlikely to respond to PMA. Second, the NH2-terminal region of ubMUNC13-2 is homologous with that of MUNC13-1, a region through which both isoforms bind RIM1 (8). It is by its interaction with RIM1 that MUNC13-1 is thought to be localized to the exocytotic active zone (52); by analogy, ubMUNC13-2 most likely localizes by the same mechanism.

The DOC2 protein associates with secretory granule membranes and functions as the binding partner for MUNC13 in exocytotic priming reactions (20). Hence, if MUNC13 is important in regulated mucin secretion from SPOC1 cells, we would expect to also find DOC2 expression. As shown in Fig. 6, in fact, DOC2{gamma} (22) is also expressed in SPOC1 cells.

In conclusion, the novel PKC isoform nPKC{delta} translocates uniquely to the membrane fraction during P2Y2-R-activated mucin secretion from SPOC1 cells. This event correlates well temporally with the onset of mucin secretion and exhibits a saturating concentration-effect relationship with agonist. PMA causes both cPKC{alpha} and nPKC{delta} to translocate in a concentration-dependent fashion that saturates at 30 nM. Mucin secretion continues to increase with increasing PMA concentrations >30 nM, however, which indicates that a substantial part of the PMA effect is PKC independent. This PKC-independent effect of PMA is likely mediated by ubMUNC13-2 and DOC2{gamma}, both of which are expressed in SPOC1 cells.


    NOTE ADDED IN PROOF
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 NOTE ADDED IN PROOF
 REFERENCES
 
In experiments performed since manuscript submission to check the persistent finding of nPKC{epsilon} mRNA expression in SPOC1 cells, we have now an antibody different from the one used herein (SBC instead of LT; see Table 1). This probe yielded a positive band of the correct size for nPKC{epsilon} in Western blots; hence, the protein, in fact, appears to be expressed in SPOC1 cells. In three experiments, however, nPKC{epsilon} did not translocate to the membrane from the cytosolic fraction following stimulation of the cells with purinergic agonist, as we report here for nPKC{delta}. Consequently, nPKC{delta} may play a singular role in regulated mucin granule exocytosis.


    ACKNOWLEDGMENTS
 
The authors gratefully acknowledge support for these studies from the National Heart, Lung, and Blood Institute (Grant HL-63756) and the Cystic Fibrosis Foundation.


    FOOTNOTES
 

Address for reprint requests and other correspondence: C. W. Davis, 6009 Thurston-Bowles, CB 7248, Univ. of North Carolina, Chapel Hill, NC 27599 (E-mail: cwdavis{at}med.unc.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 NOTE ADDED IN PROOF
 REFERENCES
 

  1. Abdullah LH, Conway JD, Cohn JA, and Davis CW. Protein kinase C and Ca2+ activation of mucin secretion in airway goblet cells. Am J Physiol Lung Cell Mol Physiol 273: L201-L210, 1997.[Abstract/Free Full Text]
  2. Abdullah LH, Davis SW, Burch L, Yamauchi M, Randell SH, Nettesheim P, and Davis CW. P2u purinoceptor regulation of mucin secretion in SPOC1 cells, a goblet cell line from the airways. Biochem J 316: 943-951, 1996.[Web of Science][Medline]
  3. Akita Y, Kawasaki H, Ohno S, Suzuki K, and Kawashima S. Involvement of protein kinase C epsilon in thyrotropin-releasing hormone-stimulated phosphorylation of the myristoylated alanine-rich C kinase substrate in rat pituitary clonal cells. Electrophoresis 21: 452-459, 2000.[Web of Science][Medline]
  4. Akita Y, Ohno S, Yajima Y, Konno Y, Saido TC, Mizuno K, Chida K, Osada S, Kuroki T, and Kawashima S. Overproduction of a Ca2+-independent protein kinase C isozyme, nPKC epsilon, increases the secretion of prolactin from thyrotropin-releasing hormone-stimulated rat pituitary GH4C1 cells. J Biol Chem 269: 4653-4660, 1994.[Abstract/Free Full Text]
  5. Ashery U, Varoqueaux F, Voets T, Betz A, Thakur P, Koch H, Neher E, Brose N, and Rettig J. Munc13-1 acts as a priming factor for large dense-core vesicles in bovine chromaffin cells. EMBO J 19: 3586-3596, 2000.[Web of Science][Medline]
  6. Augustin I, Rosenmund C, Sudhof TC, and Brose N. Munc13-1 is essential for fusion competence of glutamatergic synaptic vesicles. Nature 400: 457-461, 1999.[Medline]
  7. Banan A, Fields JZ, Talmage DA, Zhang Y, and Keshavarzian A. PKCbeta1 mediates EGF protection of microtubules and barrier of intestinal monolayers against oxidants. Am J Physiol Gastrointest Liver Physiol 281: G833-G847, 2001.[Abstract/Free Full Text]
  8. Betz A, Thakur P, Junge HJ, Ashery U, Rhee JS, Scheuss V, Rosenmund C, Rettig J, and Brose N. Functional interaction of the active zone proteins Munc13-1 and RIM1 in synaptic vesicle priming. Neuron 30: 183-196, 2001.[Web of Science][Medline]
  9. Brose N, Hofmann K, Hata Y, and Sudhof TC. Mammalian homologues of Caenorhabditis elegans unc-13 gene define novel family of C2-domain proteins. J Biol Chem 270: 25273-25280, 1995.[Abstract/Free Full Text]
  10. Brose N, Rosenmund C, and Rettig J. Regulation of transmitter release by Unc-13 and its homologues. Curr Opin Neurobiol 10: 303-311, 2000.[Web of Science][Medline]
  11. Chang EY, Szallasi Z, Acs P, Raizada V, Wolfe PC, Fewtrell C, Blumberg PM, and Rivera J. Functional effects of overexpression of protein kinase C-alpha, -beta, -delta, -epsilon, and -eta in the mast cell line RBL-2H3. J Immunol 159: 2624-2632, 1997.[Abstract]
  12. Chow JY, Uribe JM, and Barrett KE. A role for protein kinase C epsilon in the inhibitory effect of epidermal growth factor on calcium-stimulated chloride secretion in human colonic epithelial cells. J Biol Chem 275: 21169-21176, 2000.[Abstract/Free Full Text]
  13. Davidson LA, Jiang YH, Derr JN, Aukema HM, Lupton JR, and Chapkin RS. Protein kinase C isoforms in human and rat colonic mucosa. Arch Biochem Biophys 312: 547-553, 1994.[Web of Science][Medline]
  14. Davies SP, Reddy H, Caivano M, and Cohen P. Specificity and mechanism of action of some commonly used protein kinase inhibitors. Biochem J 351: 95-105, 2000.[Web of Science][Medline]
  15. Davis CW. Goblet cells: physiology and pharmacology. In: Airway Mucus: Basic Mechanisms and Clinical Perspectives, edited by Rogers DF and Lethem MI. Basel: Berkhauser, 1997, p. 150-177.
  16. Davis CW and Abdullah LH. In vitro models for airways mucin secretion. Pulm Pharmacol 10: 145-155, 1997.
  17. Davis CW, Abdullah LH, and Boucher RC. Cellular basis for the purinergic regulation of mucin secretion in the airways. In: Cilia, Mucus, and Mucociliary Interactions, edited by Baum GL. New York: Marcel Dekker, 1998, p. 153-166.
  18. Davis CW and Randell SH. Airway goblet and mucous cells: identical, similar, or different? In: Cilia and Mucus: From Development to Respiratory Defense, edited by Salathe M. New York: Marcel Dekker, 2001, p. 195-210.
  19. Denning MF, Kazanietz MG, Blumberg PM, and Yuspa SH. Cholesterol sulfate activates multiple protein kinase C isoenzymes and induces granular cell differentiation in cultured murine keratinocytes. Cell Growth Differ 6: 1619-1626, 1995.[Abstract]
  20. Duncan RR, Shipston MJ, and Chow RH. Double C2 protein. A review. Biochimie 82: 421-426, 2000.[Medline]
  21. Forstner G. Signal transduction, packaging and secretion of mucins. Annu Rev Physiol 57: 585-605, 1995.[Web of Science][Medline]
  22. Fukuda M and Mikoshiba K. Doc2gamma, a third isoform of double C2 protein, lacking calcium-dependent phospholipid binding activity. Biochem Biophys Res Commun 276: 626-632, 2000.[Web of Science][Medline]
  23. Fung DC and Rogers DF. Airway submucosal glands: physiology and pharmacology. In: Airway Mucus: Basic Mechanisms and Clinical Perspectives, edited by Rogers D and Lethem MI. Basel: Birkhauser, 1997, p. 179-210.
  24. Gobran LI, Xu ZX, and Rooney SA. PKC isoforms and other signaling proteins involved in surfactant secretion in developing rat type II cells. Am J Physiol Lung Cell Mol Physiol 274: L901-L907, 1998.[Abstract/Free Full Text]
  25. Gschwendt M. Protein kinase C delta. Eur J Biochem 259: 555-564, 1999.[Web of Science][Medline]
  26. Harden TK, Boyer JL, and Nicholas RA. P2-purinergic receptors: subtype-associated signaling responses and structure. Annu Rev Pharmacol Toxicol 35: 541-579, 1995.[Web of Science][Medline]
  27. Hartwig JH, Thelen M, Rosen A, Janmey PA, Nairn AC, and Aderem A. MARCKS is an actin filament crosslinking protein regulated by protein kinase C and calcium-calmodulin. Nature 356: 618-622, 1992.[Medline]
  28. Hong DH, Forstner JF, and Forstner G. Protein kinase C-epsilon is the likely mediator of mucin exocytosis in human colonic cell lines. Am J Physiol Gastrointest Liver Physiol 272: G31-G37, 1997.[Abstract/Free Full Text]
  29. Ikuta T, Chida K, Tajima O, Matsuura Y, Iwamori M, Ueda Y, Mizuno K, Ohno S, and Kuroki T. Cholesterol sulfate, a novel activator for the eta isoform of protein kinase C. Cell Growth Differ 5: 943-947, 1994.[Abstract]
  30. Izumi Y, Hirose T, Tamai Y, Hirai S, Nagashima Y, Fujimoto T, Tabuse Y, Kemphues KJ, and Ohno S. An atypical PKC directly associates and colocalizes at the epithelial tight junction with ASIP, a mammalian homologue of Caenorhabditis elegans polarity protein PAR-3. J Cell Biol 143: 95-106, 1998.[Abstract/Free Full Text]
  31. Jahn R and Sudhof TC. Membrane fusion and exocytosis. Annu Rev Biochem 68: 863-911, 1999.[Web of Science][Medline]
  32. Jaken S and Parker PJ. Protein kinase C binding partners. Bioessays 22: 245-254, 2000.[Web of Science][Medline]
  33. Jiang YH, Aukema HM, Davidson LA, Lupton JR, and Chapkin RS. Localization of protein kinase C isozymes in rat colon. Cell Growth Differ 6: 1381-1386, 1995.[Abstract]
  34. Kaartinen L, Nettesheim P, Adler KB, and Randell SH. Rat tracheal epithelial cell differentiation in vitro. In Vitro Cell Dev Biol Animal 29A: 481-492, 1993.[Web of Science][Medline]
  35. Kai H, Yoshitake K, Isohama Y, Hamamura I, Takahama K, and Miyata T. Involvement of protein kinase C in mucus secretion by hamster tracheal epithelial cells in culture. Am J Physiol Lung Cell Mol Physiol 267: L526-L530, 1994.[Abstract/Free Full Text]
  36. Kazanietz MG. Novel "nonkinase" phorbol ester receptors: the C1 domain connection. Mol Pharmacol 61: 759-767, 2002.[Abstract/Free Full Text]
  37. Kazanietz MG, Areces LB, Bahador A, Mischak H, Goodnight J, Mushinski JF, and Blumberg PM. Characterization of ligand and substrate specificity for the calcium-dependent and calcium-independent protein kinase C isozymes. Mol Pharmacol 44: 298-307, 1993.[Abstract]
  38. Keenan C, Long A, Volkov Y, and Kelleher D. Protein kinase C isotypes theta, delta and eta in human lymphocytes: differential responses to signaling through the T-cell receptor and phorbol esters. Immunology 90: 557-563, 1997.[Web of Science][Medline]
  39. Kiley S, Schaap D, Parker P, Hsieh LL, and Jaken S. Protein kinase C heterogeneity in GH4C1 rat pituitary cells. Characterization of a Ca2+-independent phorbol ester receptor. J Biol Chem 265: 15704-15712, 1990.[Abstract/Free Full Text]
  40. Kim KC, Park HR, Shin CY, Akiyama T, and Ko KH. Nucleotide-induced mucin release from primary hamster tracheal surface epithelial cells involves the P2u purinoceptor. Eur Respir J 9: 542-548, 1996.[Abstract]
  41. Kim KC, Zheng QX, and Van-Seuningen I. Involvement of a signal transduction mechanism in ATP-induced mucin release from cultured airway goblet cells. Am J Respir Cell Mol Biol 8: 121-125, 1993.[Medline]
  42. Ko KH, Jo M, McCracken K, and Kim KC. ATP-induced mucin release from cultured airway goblet cells involves, in part, activation of protein kinase C. Am J Respir Cell Mol Biol 16: 194-198, 1997.[Abstract]
  43. Koch H, Hofmann K, and Brose N. Definition of Munc13-homology domains and characterization of a novel ubiquitously expressed Munc13 isoform. Biochem J 349: 247-253, 2000.[Web of Science][Medline]
  44. Kratzmeier M, Poch A, Mukhopadhyay AK, and McArdle CA. Selective translocation of non-conventional protein kinase C isoenzymes by gonadotropin-releasing hormone (GnRH) in the gonadotrope-derived alpha T3–1 cell line. Mol Cell Endocrinol 118: 103-111, 1996.[Web of Science][Medline]
  45. Larivee P, Levine SJ, Martinez A, Wu T, Logun C, and Shelhamer JH. Platelet-activating factor induces airway mucin release via activation of protein kinase C: evidence for translocation of protein kinase C to membranes. Am J Respir Cell Mol Biol 11: 199-205, 1994.[Abstract]
  46. Leibersperger H, Gschwendt M, Gernold M, and Marks F. Immunological demonstration of a calcium-unresponsive protein kinase C of the delta-type in different species and murine tissues. Predominance in epidermis. J Biol Chem 266: 14778-14784, 1991.[Abstract/Free Full Text]
  47. Li Y, Martin LD, Spizz G, and Adler KB. MARCKS protein is a key molecule regulating mucin secretion by human airway epithelial cells in vitro. J Biol Chem 276: 40982-40990, 2001.[Abstract/Free Full Text]
  48. Liedtke CM and Cole TS. Activation of NKCC1 by hyperosmotic stress in human tracheal epithelial cells involves PKC-delta and ERK. Biochim Biophys Acta 1589: 77-88, 2002.[Medline]
  49. Liedtke CM, Papay R, and Cole TS. Modulation of Na-K-2Cl cotransport by intracellular Cl- and protein kinase C-{delta} in Calu-3 cells. Am J Physiol Lung Cell Mol Physiol 282: L1151-L1159, 2002.[Abstract/Free Full Text]
  50. Liles WC, Meier KE, and Henderson WR. Phorbol myristate acetate and the calcium ionophore A23187 [GenBank] synergistically induce release of LTB4 by human neutrophils: involvement of protein kinase C activation in regulation of the 5-lipoxygenase pathway. J Immunol 138: 3396-3402, 1987.[Abstract]
  51. Liu WS and Heckman CA. The sevenfold way of PKC regulation. Cell Signal 10: 529-542, 1998.[Web of Science][Medline]
  52. Martin TF. Prime movers of synaptic vesicle exocytosis. Neuron 34: 9-12, 2002.[Web of Science][Medline]
  53. Mau SE and Vilhardt H. Translocation of protein kinase C isozymes in rat pituitary lactotroph-enriched cell cultures by substance P: effects of sex and age. J Recept Signal Transduct Res 15: 801-809, 1995.[Web of Science][Medline]
  54. Mellor H and Parker PJ. The extended protein kinase C superfamily. Biochem J 332: 281-292, 1998.[Web of Science][Medline]
  55. Mizuno K, Kubo K, Saido TC, Akita Y, Osada S, Kuroki T, Ohno S, and Suzuki K. Structure and properties of a ubiquitously expressed protein kinase C, nPKC delta. Eur J Biochem 202: 931-940, 1991.[Web of Science][Medline]
  56. Muallem S, Kwiatkowska K, Xu X, and Yin HL. Actin filament disassembly is a sufficient final trigger for exocytosis in nonexcitable cells. J Cell Biol 128: 589-598, 1995.[Abstract/Free Full Text]
  57. Murakami A, Chida K, Suzuki Y, Kikuchi H, Imajoh-Ohmi S, and Kuroki T. Absence of down-regulation and translocation of the eta isoform of protein kinase C in normal human keratinocytes. J Invest Dermatol 106: 790-794, 1996.[Web of Science][Medline]
  58. Newton AC. Protein kinase C: structural and spatial regulation by phosphorylation, cofactors, and macromolecular interactions. Chem Rev 101: 2353-2364, 2001.[Web of Science][Medline]
  59. Nishizuka Y. Studies and perspectives of protein kinase C. Science 233: 305-312, 1986.[Abstract/Free Full Text]
  60. Nishizuka Y. Intracellular signaling by hydrolysis of phospholipids and activation of protein kinase C. Science 258: 607-614, 1992.[Abstract/Free Full Text]
  61. Osada S, Hashimoto Y, Nomura S, Kohno Y, Chida K, Tajima O, Kubo K, Akimoto K, Koizumi H, and Kitamura Y. Predominant expression of nPKC eta, a Ca2+-independent isoform of protein kinase C in epithelial tissues, in association with epithelial differentiation. Cell Growth Differ 4: 167-175, 1993.[Abstract]
  62. Osada S, Mizuno K, Saido TC, Akita Y, Suzuki K, Kuroki T, and Ohno S. A phorbol ester receptor/protein kinase, nPKC eta, a new member of the protein kinase C family predominantly expressed in lung and skin. J Biol Chem 265: 22434-22440, 1990.[Abstract/Free Full Text]
  63. Ostlund E, Mendez CF, Jacobsson G, Fryckstedt J, Meister B, and Aperia A. Expression of protein kinase C isoforms in renal tissue. Kidney Int 47: 766-773, 1995.[Web of Science][Medline]
  64. Ozawa K, Szallasi Z, Kazanietz MG, Blumberg PM, Mischak H, Mushinski JF, and Beaven MA. Ca2+-dependent and Ca2+-independent isozymes of protein kinase C mediate exocytosis in antigen-stimulated rat basophilic RBL-2H3 cells. Reconstitution of secretory responses with Ca2+ and purified isozymes in washed permeabilized cells. J Biol Chem 268: 1749-1756, 1993.[Abstract/Free Full Text]
  65. Randell SH, Liu JY, Ferriola PC, Kaartinen L, Doherty MM, Davis CW, and Nettesheim P. Mucin production by SPOC1 cells—an immortalized rat tracheal epithelial cell line. Am J Respir Cell Mol Biol 14: 146-154, 1996.[Abstract]
  66. Ridge KM, Dada L, Lecuona E, Bertorello AM, Katz AI, Mochly-Rosen D, and Sznajder JI. Dopamine-induced exocytosis of Na,K-ATPase is dependent on activation of protein kinase C-epsilon and -delta. Mol Biol Cell 13: 1381–1389, 2002.
  67. Rodriguez DC, Lemaire S, Tchakarov L, Jeyapragasan M, Doucet JP, Vitale ML, and Trifaro JM. Chromaffin cell scinderin, a novel calcium-dependent actin filament-severing protein. EMBO J 9: 43-52, 1990.[Web of Science][Medline]
  68. Ron D and Kazanietz MG. New insights into the regulation of protein kinase C and novel phorbol ester receptors. FASEB J 13: 1658-1676, 1999.[Abstract/Free Full Text]
  69. Rozengurt E, Sinnett-Smith J, and Zugaza JL. Protein kinase D: a novel target for diacylglycerol and phorbol esters. Biochem Soc Trans 25: 565-571, 1997.[Web of Science][Medline]
  70. Scott CE, Abdullah LH, and Davis CW. Ca2+ and protein kinase C activation of mucin granule exocytosis in permeabilized SPOC1 cells. Am J Physiol Cell Physiol 275: C285-C292, 1998.[Abstract/Free Full Text]
  71. Shimura S, Ishihara H, Nagaki M, Sasaki H, and Takishima T. A stimulatory role of protein kinase C in feline tracheal submucosal gland secretion. Respir Physiol 93: 239-247, 1993.[Web of Science][Medline]
  72. Soltoff SP. Rottlerin is a mitochondrial uncoupler that decreases cellular ATP levels and indirectly blocks protein kinase Cdelta tyrosine phosphorylation. J Biol Chem 276: 37986-37992, 2001.[Abstract/Free Full Text]
  73. Song JC, Hanson CM, Tsai V, Farokhzad OC, Lotz M, and Matthews JB. Regulation of epithelial transport and barrier function by distinct protein kinase C isoforms. Am J Physiol Cell Physiol 281: C649-C661, 2001.[Abstract/Free Full Text]
  74. Trifaro J, Rose SD, Lejen T, and Elzagallaai A. Two pathways control chromaffin cell cortical F-actin dynamics during exocytosis. Biochimie 82: 339-352, 2000.[Medline]
  75. Trifaro JM. Scinderin and cortical F-actin are components of the secretory machinery. Can J Physiol Pharmacol 77: 660-671, 1999.[Web of Science][Medline]
  76. Trifaro JM, Bader MF, and Doucet JP. Chromaffin cell cytoskeleton: its possible role in secretion. Can J Biochem Cell Biol 63: 661-679, 1985.[Web of Science][Medline]
  77. Vitale ML, Rodriguez Del Castillo A, Tchakarov L, and Trifaro JM. Cortical filamentous actin disassembly and scinderin redistribution during chromaffin cell stimulation precede exocytosis, a phenomenon not exhibited by gelsolin. J Cell Biol 113: 1057-1067, 1991.[Abstract/Free Full Text]
  78. Zoukhri D, Hodges RR, Dicker DM, and Dartt DA. Role of protein kinase C in cholinergic stimulation of lacrimal gland protein secretion. FEBS Lett 351: 67-72, 1994.[Web of Science][Medline]



This article has been cited by other articles:


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
O. R. Farah, D. Li, B. A. S. McIntyre, J. Pan, and J. Belik
Airway epithelial-derived factor relaxes pulmonary vascular smooth muscle
Am J Physiol Lung Cell Mol Physiol, January 1, 2009; 296(1): L115 - L120.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
F. Chappe, M. E. Loewen, J. W. Hanrahan, and V. Chappe
Vasoactive Intestinal Peptide Increases Cystic Fibrosis Transmembrane Conductance Regulator Levels in the Apical Membrane of Calu-3 Cells through a Protein Kinase C-Dependent Mechanism
J. Pharmacol. Exp. Ther., October 1, 2008; 327(1): 226 - 238.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
Y. Zhu, C. Ehre, L. H. Abdullah, J. K. Sheehan, M. Roy, C. M. Evans, B. F. Dickey, and C. W. Davis
Munc13-2-/- baseline secretion defect reveals source of oligomeric mucins in mouse airways
J. Physiol., April 1, 2008; 586(7): 1977 - 1992.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
J.-A. Park, A. L. Crews, W. R. Lampe, S. Fang, J. Park, and K. B. Adler
Protein Kinase C{delta} Regulates Airway Mucin Secretion via Phosphorylation of MARCKS Protein
Am. J. Pathol., December 1, 2007; 171(6): 1822 - 1830.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
C. Ehre, Y. Zhu, L. H. Abdullah, J. Olsen, K. I. Nakayama, K. Nakayama, R. O. Messing, and C. W. Davis
nPKC{varepsilon}, a P2Y2-R downstream effector in regulated mucin secretion from airway goblet cells
Am J Physiol Cell Physiol, November 1, 2007; 293(5): C1445 - C1454.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
L. H. Abdullah and C. W. Davis
Regulation of airway goblet cell mucin secretion by tyrosine phosphorylation signaling pathways
Am J Physiol Lung Cell Mol Physiol, September 1, 2007; 293(3): L591 - L599.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
G. Burnstock
Physiology and Pathophysiology of Purinergic Neurotransmission
Physiol Rev, April 1, 2007; 87(2): 659 - 797.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
A. H. Rossi, W. C. Salmon, M. Chua, and C. W. Davis
Calcium signaling in human airway goblet cells following purinergic activation
Am J Physiol Lung Cell Mol Physiol, January 1, 2007; 292(1): L92 - L98.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
C. Ehre, A. H. Rossi, L. H. Abdullah, K. De Pestel, S. Hill, J. C. Olsen, and C. W. Davis
Barrier role of actin filaments in regulated mucin secretion from airway goblet cells
Am J Physiol Cell Physiol, January 1, 2005; 288(1): C46 - C56.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
P. A. Kemp, R. A. Sugar, and A. D. Jackson
Nucleotide-Mediated Mucin Secretion from Differentiated Human Bronchial Epithelial Cells
Am. J. Respir. Cell Mol. Biol., October 1, 2004; 31(4): 446 - 455.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/1/L149    most recent
00359.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (18)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Abdullah, L. H.
Right arrow Articles by Davis, C. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Abdullah, L. H.
Right arrow Articles by Davis, C. W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2003 by the American Physiological Society.