AJP - Lung Information on EB 2010
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 285: L334-L343, 2003. First published March 28, 2003; doi:10.1152/ajplung.00417.2002
1040-0605/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/2/L334    most recent
00417.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (21)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bogatkevich, G. S.
Right arrow Articles by Ludwicka-Bradley, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bogatkevich, G. S.
Right arrow Articles by Ludwicka-Bradley, A.

Contractile activity and smooth muscle {alpha}-actin organization in thrombin-induced human lung myofibroblasts

Galina S. Bogatkevich,1 Elena Tourkina,1 Charles S. Abrams,2 Russell A. Harley,3 Richard M. Silver,1 and Anna Ludwicka-Bradley1

1Division of Rheumatology and Immunology, Department of Medicine, and 3Department of Pathology, Medical University of South Carolina, Charleston, South Carolina 29425; and 2Department of Medicine, University of Pennsylvania Medical School, Philadelphia, Pennsylvania 19104

Submitted 6 December 2002 ; accepted in final form 24 March 2003


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Activated fibroblasts, or myofibroblasts, are crucial players in tissue remodeling, wound healing, and various fibrotic disorders, including interstitial lung fibrosis associated with scleroderma. Here we characterize the signaling pathways in normal lung fibroblasts exposed to thrombin as they acquire two of the main features of myofibroblasts: smooth muscle (SM) {alpha}-actin organization and collagen gel contraction. Our results show that the small G protein Rho is involved in lung myofibroblast differentiation. Thrombin induces Rho-35S-labeled guanosine 5'-O-(3-thiotriphosphate) binding in a dose-dependent manner. It potently stimulates Rho activity in vivo and initiates protein kinase C (PKC)-{epsilon}-Rho complex formation. Toxin B, which inactivates Rho by ADP ribosylation, inhibits thrombin-induced SM {alpha}-actin organization, collagen gel contraction, and PKC-{epsilon}-SM {alpha}-actin and PKC-{epsilon}-RhoA coimmunoprecipitation. However, it has no effect on PKC-{epsilon} activation or translocation of PKC-{epsilon} to the membrane. Overexpression of constitutively active PKC-{epsilon} and constitutively active RhoA induces collagen gel contraction or SM {alpha}-actin organization, whereas, individually, they do not perform these functions. We therefore conclude that the contractile activity of myofibroblasts induced by thrombin is mediated via PKC-{epsilon}- and RhoA-dependent pathways and that activation of both of these molecules is required. We postulate that PKC-{epsilon}-RhoA complex formation is an early event in thrombin activation of lung fibroblasts, followed by PKC-{epsilon}-SM {alpha}-actin coimmunoprecipitation, which leads to the PKC-{epsilon}-RhoA-SM {alpha}-actin ternary complex formation.

fibroblast differentiation; protein kinase C-{epsilon}; RhoA


DURING PULMONARY FIBROSIS, in general, and in systemic sclerosis (SSc, scleroderma), in particular, lung fibroblasts undergo specific phenotypic modulation and develop cytoskeletal features similar to those of smooth muscle (SM) cells (17, 19, 46). These phenotypically altered fibroblasts, or myofibroblasts, express a contractile isoform of actin (SM {alpha}-actin) and promote contractility of lung parenchyma associated with restrictive lung disease (28, 29, 43, 45).

Resting, nonactivated fibroblasts contain only {beta}- and {gamma}-actin isoforms (4, 10, 13). Once fibroblasts become active, they express SM {alpha}-actin (28, 29, 43, 45). All actin isoforms are present in cells in a monomeric state (G-actin) or a polymeric state (filamentous or F-actin). Filamentous actin is generally organized into three discrete structures: actin stress fibers, lamellipodia, and filopodia. In activated fibroblasts, SM {alpha}-actin is incorporated mainly into stress fibers (8, 10).

Cellular functions that depend on the actin cytoskeleton require actin organization (4, 13, 38). The dynamics of actin organization are regulated by the complex of intracellular signaling, which involves activation of various signal transduction molecules, including numerous actin-binding proteins and Rho proteins (4, 11, 16, 24). In resting cells, Rho is present in a GTP-bound (inactive) state. Activation of Rho requires the exchange of GDP for GTP through the action of guanine nucleotide exchange factors. GTP-bound Rho is then targeted to the cell membrane and interacts with its specific targets. Because of intrinsic GTPase activity, the GTP-bound form is converted back to the GDP-bound state so that it can receive a new activating signal (reviewed in Ref. 42). The mammalian Rho family consists of >=14 distinct members divided into subfamilies of Rho, Rac, and Cdc42 proteins (40, 42). Rho proteins regulate stress fiber formation (34), whereas Rac and Cdc42 mediate signals to form lamellipodia and filopodia, respectively (15, 35).

Previously, we reported that thrombin induces SM {alpha}-actin expression and organization in human lung fibroblasts via a protein kinase C (PKC)-{epsilon}-dependent pathway (2). In this study, we showed that RhoA inactivation prevents thrombin-induced SM {alpha}-actin organization and collagen gel contraction. Coexpression of constitutively active RhoA and PKC-{epsilon} promoted SM {alpha}-actin expression/organization and collagen gel contraction. Separate overexpression of the constitutively active PKC-{epsilon} or constitutively active RhoA was not sufficient to induce SM {alpha}-actin organization or contractile activity in lung fibroblasts. Furthermore, we found that thrombin induces PKC-{epsilon}-RhoA-SM {alpha}-actin complex formation. This signaling mechanism is necessary for differentiation of lung fibroblasts to a myofibroblast phenotype by thrombin.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Materials. Thrombin from human plasma (high activity), calphostin C, PKC-{epsilon} translocation inhibitor peptide (TIP), and scrambled peptide for TIP [TIP negative (TIPN)] were obtained from Calbiochem (La Jolla, CA), type I collagen from BD Bioscience (Bedford, MA), and pertussis toxin and Clostridium difficille toxin B from Sigma (St. Louis, MO). Antisense (5'-ATTGAACACTACCAT-3') and sense (5'-ATGGTAGTGTTCCAAT-3') oligonucleotides for PKC-{epsilon} were synthesized in the Oligonucleotide Synthesis Facility at the Medical University of South Carolina.

Plasmid constructions. Constitutively active PKC-{epsilon} A159E in SRD vector (a kind gift of Dr. Shigeo Ohno, Yokohama City University School of Medicine, Yokohama, Japan) was amplified by polymerase chain reaction [5'CTAAGGATCCGCTATGGTAGTG (forward primer) and 5'GTATATCTCGAGTGGGCATCAG (reverse primer)], digested with BamHI/XhoI, and ligated into pcDNA3.1/V5-His (Invitrogen) using a standard procedure (44). The structure of construct was verified by nucleotide sequence analysis (Medical University of South Carolina DNA Sequencing Core). HA-RhoA L63 was subcloned into EcoRI- and BamHI-digested pcDNA3.1 as previously described (6). pGEX expression vector encoding the glutathione S-transferase (GST) fusion protein that contains the isolated GTP-dependent RhoA-binding domain (RBD) of rhotekin was kindly provided by Dr. Shuh Narumiya (Kyoto University Faculty of Medicine, Kyoto, Japan) (32).

Cell culture. Lung fibroblasts were derived from normal lung tissues obtained at autopsy. Lung tissue was diced (0.5 x 0.5-mm pieces) and cultured in Dulbecco's modified Eagle's medium (DMEM; GIBCO, Grand Island, NY) supplemented with 10% fetal calf serum, 2 mM L-glutamine, gentamicin sulfate (50 µg/ml), and amphotericin B (5 µg/ml) at 37°C in 10% CO2. Medium was changed every 3 days to remove dead and nonattached cells until fibroblasts reached confluence. Monolayer cultures were maintained in the same medium. Lung fibroblasts were used between passages 2 and 4 in all experiments. Purity of isolated lung fibroblasts was determined by crystal violet staining (41) and by immunofluorescent staining: monoclonal antibody against human fibroblasts, as described previously (20), followed by FITC-conjugated goat anti-mouse IgG staining (Santa Cruz Biotechnology, Santa Cruz, CA).

Rho-35S-labeled guanosine 5'-O-(3-thiotriphosphate) binding. Rho-35S-labeled guanosine 5'-O-(3-thiotriphosphate) (GTP{gamma}S) binding assay was performed as described by Seasholtz et al. (36) with some modifications. Lung fibroblasts were grown to confluence on 100-mm dishes. In some experiments, antisense oligonucleotide for PKC-{epsilon} and appropriate sense oligonucleotide (control) were introduced into the cells as described previously (2, 21). Cells were harvested in phosphate-buffered saline (PBS) containing (in mM) 137 NaCl, 2.6 KCl, 1.8 KH2PO4, and 10 Na2HPO4 (pH 7.4). Cells were further pelleted at 220 g and lysed in lysis buffer (400 µl/plate) composed of 50 mM Tris (pH 7.4), 10 mM MgCl2, 2 mM EDTA, 100 mM NaCl, 1 µM GDP, 20 µg/ml aprotinin, 10 µg/ml leupeptin, and 100 µM phenylmethylsulfonyl fluoride. The lysates were homogenized with a 1-ml syringe five to six times and spun at 220 g to remove unbroken cells. Protein concentration of the supernatant was determined by using Bio-Rad reagent. Rho-[35S]GTP{gamma}S binding was performed with 20 µg of protein in the presence or absence of thrombin (0.5 U/ml) in a total volume of 50 µl of 300 nM [35S]GTP{gamma}S in lysis buffer at 30°C for 5 min. The reaction was terminated by the addition of 600 µl of ice-cold immunoprecipitation buffer (50 mM Tris, pH 7.5, 20 mM MgCl2, 150 mM NaCl, 0.5% NP-40, 20 µg/ml aprotinin, 100 µM GDP, and 100 µM GTP) and immunoprecipitated with 2 µg of monoclonal anti-Rho antibody (Santa Cruz Biotechnology). Immune complexes were isolated on protein G-Sepharose beads (Amersham, Piscataway, NJ), washed, and boiled in 500 µl of 0.5% SDS for 1 min. Samples were transferred to vials containing 5 ml of Ecoscint A (National Diagnostics, Atlanta, GA) and analyzed by scintillation spectrometry. In one set of experiments, antisense oligonucleotide for PKC-{epsilon} (5'-ATTGAACACTACCAT-3') and sense oligonucleotide as a control (5'-ATGGTAGTGTTCCAAT-3') were introduced into lung fibroblasts, as described elsewhere (2, 21), 24 h before the cells were harvested.

GST-rhotekin pull-down assay. Lung fibroblasts were grown to 70% confluence on 100-mm dishes, deprived of serum overnight, and stimulated with thrombin (0.5 U/ml) for up to 24 h. Cells were then harvested with PBS and lysed with ice-cold buffer containing 50 mM Tris (pH 7.2), 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS, 100 mM NaCl, 20 mM MgCl2, 40 mM {beta}-glycerophosphate, 10 µg/ml aprotinin, 10 µg/ml leupeptin, and 100 mM phenylmethylsulfonyl fluoride. Cell lysates were incubated with GST fusion RBD of the RhoA effector rhotekin previously bound to GST beads for 1 h. The GST beads were washed four times with lysis buffer and subjected to 12% SDS-PAGE. Bound RhoA was detected with anti-RhoA monoclonal antibody (Santa Cruz Biotechnology).

Preparation of collagen lattices and measurement of collagen gel contraction by lung fibroblasts. Collagen lattices were prepared by using type I collagen as described previously (2). To initiate collagen gel contraction, polymerized gels were gently released from the underlying culture dish, and cells were immediately stimulated with 0.5 U/ml of thrombin in serum-free DMEM or pretreated with pertussis toxin or toxin B for 24 h and then stimulated with thrombin. The degree of collagen gel contraction was determined after 2 h. Pictures were taken with a digital camera (model EDAS-120, Eastman Kodak, Rochester, NY). The diameter of the gels was measured in millimeters and recorded as the average value of the major and minor axes. In some experiments, cells were transfected with constitutively active V5/His-PKC-{epsilon} A159E or HA-RhoA L63 by Effectene reagent (Qiagen, Valencia, CA) according to the manufacturer's instructions. Briefly, lung fibroblasts on 100-mm dishes were transfected with V5/His-PKC-{epsilon} in pcDNA3.1 and pcDNA3.1 (2.5 µg each), with HARhoA L63 in pcDNA3.1 and pcDNA3.1 (2.5 µg each), or with V5/His-PKC-{epsilon} in pcDNA3.1 and HA-RhoA L63 in pcDNA3.1 (2.5 µg each). Control cells were transfected with pcDNA3.1 (5 µg). Cells were washed with PBS and incubated overnight with 10 ml of growth medium containing the indicated amount of DNA and Effectene reagent (60 µl). Cells were then collected, suspended in collagen gel (2.5 x 105 cells/ml final concentration), and aliquoted into 24-well plates. The degree of collagen gel contraction was determined 48 h after transfection. To determine expression of SM {alpha}-actin, as well as V5/His-PKC-{epsilon} A159E and HA-RhoA L63, collagen gels were collected, digested with collagenase, and analyzed by Western blot by using anti-SM {alpha}-actin antibody, anti-V5 antibody, and anti-HA antibody, respectively.

Coimmunoprecipitation experiments. Immunoprecipitation was performed as described previously (2). Briefly, lung fibroblasts were grown to confluence, kept in serum-free DMEM overnight, and then treated with thrombin (0.5 U/ml) for 5 min, 15 min, 2 h, and 24 h. In one set of experiments, cells were pretreated with or without toxin B (50 pg/ml) for 18 h and then stimulated with or without thrombin (0.5 U/ml) for 2 h. In another set of experiments, cells were pretreated with PKC-{epsilon} TIP or TIPN as previously described (2). Briefly, TIP or TIPN (each 150 µg/ml) was introduced into the permeabilized cells with saponin (50 µg/ml), and then the cells were treated with thrombin (0.5 U/ml for 2 h). The cells were washed with ice-cold PBS and collected with 1 ml of ice-cold solubilization buffer (10 mM Tris, 10 mM EDTA, 500 mM NaCl, 1% NP-40, 0.5% deoxycholate, and 0.1% SDS, pH 7.4). Samples were rotated for 3 h and then cleared by microcentrifugation at 4°C. Twenty microliters of the lysates were saved for Western analysis. Anti-SM {alpha}-actin monoclonal antibody (Oncogene Research Products, Boston, MA) or anti-Rho polyclonal antibody (Upstate Biotechnology, Lake Placid, NY) was added, and the samples were rotated for an additional 90 min at 4°C. Immune complexes were isolated on protein G-Sepharose beads (Amersham) and washed once with solubilization buffer and three times with buffer containing 10 mM Tris and 10 mM EDTA (pH 7.4). Isolated immune complexes were then resolved on 6% and 12% SDS-PAGE and immunoblotted with anti-PKC-{epsilon} and anti-RhoA antibodies.

Distribution and translocation of PKC-{epsilon} in lung fibroblasts. PKC-{epsilon} translocation assay was performed as described previously (2, 41). Briefly, lung fibroblasts were grown to confluence, pretreated with or without toxin B (50 pg/ml) overnight, and then treated with thrombin (0.5 U/ml) for 15 min. Cells were collected in ice-cold PBS and divided into membrane and cytosolic fractions as described elsewhere (2). Forty micrograms of protein from each fraction were then analyzed for PKC-{epsilon} expression by Western blotting.

Confocal microscopy. Lung fibroblasts were cultured to subconfluence on glass slides in DMEM containing 10% fetal calf serum. Cells were stimulated with or without thrombin (0.5 U/ml) for 24 h, washed with cold PBS, fixed in methanol, and immunostained with SM {alpha}-actin monoclonal antibody. Cyanine (Cy2) anti-mouse IgG (Jackson Immuno-Research) was used as secondary antibody at 1 µg/ml for 1 h at room temperature. For one series of experiments, cells were transfected with constitutively active V5/His-PKC-{epsilon} A159E in pcDNA3.1 or HA-RhoA L63 in pcDNA3.1 by Effectene reagent according to the manufacturer's instructions. An equal amount of DNA (1 µg) was introduced into the cells on each slide. Lung fibroblasts were transfected with V5/His-PKC-{epsilon} in pcDNA3.1 and pcDNA3.1 (0.5 µg each), with HA-RhoA L63 in pcDNA3.1 and pcDNA3.1 (0.5 µg each), or with V5/His-PKC-{epsilon} in pcDNA3.1 and HA-RhoA L63 in pcDNA3.1 (0.5 µg each). Control cells were transfected with pcDNA3.1 (1 µg). Cells were washed with PBS and incubated overnight with 1.5 ml of growth medium containing the indicated amount of DNA and Effectene reagent (10 µl). Then cells were washed and allowed to grow in fresh medium for another 24 h. In addition to SM {alpha}-actin, cells were stained with rabbit polyclonal His probe (catalog no. sc-803, Santa Cruz Biotechnology) and with goat polyclonal HA probe (catalog no. sc-805-G, Santa Cruz Biotechnology) and then with indodicarbocyanine (Cy5) anti-rabbit IgG and indocarbocyanine (Cy3) anti-goat IgG. Confocal microscopy was performed by using an Olympus Merlin Imaging System (Life Science Resource, Melville, NY).


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Thrombin activates small GTP-binding protein Rho in human lung fibroblasts. The ability of thrombin to induce Rho GTPase was measured in cell lysates by using binding of [35S]GTP{gamma}S to RhoA isolated subsequently by immunoprecipitation (36). We found that thrombin rapidly activates Rho in a concentration-dependent manner (Fig. 1A). Thrombin, at a concentration as low as 0.01 U/ml, produced a significant increase in Rho-[35S]GTP{gamma}S binding. The maximum activation of Rho occurred in the presence of 0.5 U/ml of thrombin when [35S]GTP{gamma}S binding reached 1,600 cpm, or ~5.2-fold over basal levels. Further increases in thrombin concentrations up to 5 U/ml did not significantly change Rho-GTP{gamma}S binding.



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 1. Activation of Rho by thrombin. A: thrombin-induced Rho-35S-labeled guanosine 5'-O-(3-thiotriphosphate) (GTP{gamma}S) binding. Lung fibroblast lysates were stimulated with different concentrations of thrombin for 5 min at 30°C in the presence of 10 mM MgCl2 and 300 nM [35S]GTP{gamma}S. The amount of [35S]GTP{gamma}S bound to Rho was measured by immunoprecipitation using monoclonal anti-RhoA antibody followed by scintillation counting. Values are means ± SD of 3 independent experiments, each performed in duplicate. *Significantly different from nonstimulated cells (P < 0.001). B: in vivo induced Rho guanine nucleotide exchange. Lung fibroblasts were deprived of serum overnight and stimulated with thrombin (0.5 U/ml) for 0–24 h. Cell lysates were then affinity precipitated (AP) with glutathione S-transferase (GST)-Rho-binding domain (RBD) beads. Rho bound to the beads and the total amount of Rho in each cell lysate were analyzed by immunoblotting (IB) with anti-RhoA monoclonal antibody. The experiment was performed 3 times, and representative results are presented.

 

These results suggest that, in thrombin-treated lung fibroblasts, inactive GDP-bound Rho is converted to the GTP-bound form, which is able to interact directly with RBD of the RhoA effector rhotekin. To demonstrate that thrombin indeed stimulates Rho activity in intact lung fibroblasts, we performed a Rho guanine nucleotide exchange assay in vivo (33). Lung fibroblasts were incubated with thrombin (0.5 U/ml), and the levels of the GTP-bound form of Rho associated with GST-RBD of rhotekin were detected by Western blot with an anti-Rho antibody. Time-course analysis of Rho stimulations by thrombin showed the rapid and potent activation of Rho, which was maximal in 2–5 min after thrombin addition and remained above basal levels for up to 24 h (Fig. 1B).

Rho inactivation prevents SM {alpha}-actin organization and collagen gel contraction in lung fibroblasts. Rho protein has been implicated in cytoskeletal reorganization and stress fiber formation (34). Because SM {alpha}-actin in activated fibroblasts has been shown to be incorporated mainly into stress fibers (8, 10), Rho may be one of the proteins responsible for SM {alpha}-actin expression and organization. To test whether Rho is indeed involved in thrombin-mediated lung fibroblast differentiation, we employed C. difficille toxin B, which monoglucosylates and inactivates Rho proteins. As we previously reported, lung fibroblasts express small amounts of SM {alpha}-actin that is not fully organized (2). After 24 h of thrombin treatment, such cells express large amounts of highly organized SM {alpha}-actin, similar to our observation in scleroderma lung fibroblasts, which, without any treatment, express highly organized SM {alpha}-actin. Pretreatment of cells with toxin B for 18 h completely prevented organization of thrombin-induced SM {alpha}-actin in lung fibroblasts without interfering with SM {alpha}-actin expression (Fig. 2).



View larger version (59K):
[in this window]
[in a new window]
 
Fig. 2. Rho inactivation prevents smooth muscle (SM) {alpha}-actin organization. Lung fibroblasts were cultured to subconfluence on glass slides, preincubated for 18 h with or without 50 pg/ml toxin B in serum-free medium, and then stimulated with or without thrombin (0.5 U/ml) for 24 h. SM {alpha}-actin expression and organization in lung fibroblasts were analyzed by confocal microscopy. The experiment was performed 3 times, and representative images are presented.

 

Another typical feature of myofibroblasts, their contractile activity, depends on SM {alpha}-actin expression and organization (29, 45). Recently, we demonstrated that thrombin rapidly induced collagen gel contraction by normal lung fibroblasts, whereas SSc myofibroblasts contracted collagen gels without any treatment (2). Inactivation of Rho proteins by pretreatment of the cells with toxin B for 18 h abolished thrombin-induced collagen gel contraction by normal lung fibroblasts (Fig. 3A). The levels of SM {alpha}-actin in collagen gels were increased after thrombin stimulation but were not dependent on toxin B treatment (Fig. 3B). We conclude that GTP-binding Rho protein is essential for SM {alpha}-actin organization, but not for its expression.



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 3. Rho inactivation prevents thrombin-induced collagen gel contraction by normal lung fibroblasts. A: lung fibroblasts were cultured in collagen gels (1.5 mg/ml of collagen) in 24-well plates in DMEM with 2% fetal calf serum overnight and then preincubated for 18 h with or without toxin B (TxB, 50 pg/ml) in serum-free medium (SFM). Thrombin (Thr, 0.5 U/ml) was added, and collagen gel contraction was measured after 2 h of incubation at 37°C. B: to confirm overexpression of thrombin-induced SM {alpha}-actin, collagen gels were collected, digested with collagenase, and analyzed by Western blot using anti-SM {alpha}-actin antibody. The experiment was performed 3 times, and representative results are presented.

 

Interaction of Rho protein with PKC-{epsilon} and SM {alpha}-actin. On the basis of our results showing that the presence of active Rho is essential for SM {alpha}-actin organization, we investigated whether Rho protein could associate with PKC-{epsilon} in lung fibroblasts. Lung fibroblasts were stimulated with thrombin for 5 min, 15 min, 2 h, and 24 h, immunoprecipitated with anti-RhoA antibody, and then immunoblotted with anti-PKC-{epsilon} antibody. We found that Rho protein coimmunoprecipitates with PKC-{epsilon} rapidly, within 5 min of thrombin treatment (Fig. 4A). Furthermore, we demonstrated that association of RhoA with PKC-{epsilon} was transient and disappeared after incubation of lung fibroblasts with thrombin for >=2 h. We also immunoprecipitated lung fibroblasts with anti-SM {alpha}-actin antibody and then immunoblotted them with anti-PKC-{epsilon} and anti-RhoA antibodies. We found that, after 5 min of thrombin treatment, neither PKC-{epsilon} nor RhoA associated with SM {alpha}-actin (Fig. 4, B and C, left). Incubation with thrombin for 15 min resulted in coimmunoprecipitation of PKC-{epsilon} with SM {alpha}-actin. A longer stimulation (>=2 h) with thrombin was required for protein coimmunoprecipitation of SM {alpha}-actin and RhoA (Fig. 4C, left).



View larger version (42K):
[in this window]
[in a new window]
 
Fig. 4. Coimmunoprecipitation of protein kinase C (PKC)-{epsilon}, RhoA, and SM {alpha}-actin in thrombin-induced lung fibroblasts. A: coimmunoprecipitation of PKC-{epsilon} and Rho. Lung fibroblasts grown to 90% confluence were stimulated with thrombin (0.5 U/ml) and immunoprecipitated with anti-RhoA polyclonal antibody. Top: immunoblots were performed with anti-PKC-{epsilon} monoclonal antibody. Bottom: lysates were analyzed by Western blotting with anti-PKC-{epsilon} antibody to reveal overall levels of PKC-{epsilon}. B: coimmunoprecipitation of PKC-{epsilon} with SM {alpha}-actin. Left: lung fibroblasts were stimulated with thrombin (0.5 U/ml) and immunoprecipitated with anti-SM {alpha}-actin antibody. Right: cells were pretreated with toxin B or PKC-{epsilon} translocation inhibitor peptide (TIP) or TIPN as a negative control, incubated with thrombin for 2 h, and then immunoprecipitated with anti-SM {alpha}-actin antibody. Top: immunoblots were performed with anti-PKC-{epsilon} antibody. Bottom: parallel lysates were analyzed by Western blotting with anti-PKC-{epsilon} antibody to reveal overall levels of PKC-{epsilon}. C: coimmunoprecipitation of Rho with SM {alpha}-actin. Left: lung fibroblasts were stimulated with thrombin (0.5 U/ml) and immunoprecipitated with anti-SM {alpha}-actin antibody. Right: cells were pretreated with toxin B or PKC-{epsilon} TIP or TIPN as a negative control, incubated with thrombin for 2 h, and then immunoprecipitated with anti-SM {alpha}-actin antibody. Top: immunoblots were performed with anti-RhoA antibody. Bottom: parallel lysates were analyzed by Western blotting with anti-RhoA antibody to reveal overall levels of RhoA. The experiments were performed 3 times, and representative results are presented.

 

PKC isoforms have been shown to have specific subcellular localizations before their activation. Inactive PKC isoforms are localized in cytosol, and after activation they translocate to the plasma membrane and/or cytoskeleton (30). To establish whether inhibition of PKC-{epsilon} activation affects thrombin-induced complex formation between SM {alpha}-actin and PKC or RhoA, we employed specific TIP for PKC-{epsilon} to inhibit its activation. We found that inhibition of PKC-{epsilon} translocation completely abolished interaction among all three molecules (Fig. 4, B and C, right). The Rho inhibitor toxin B had the same effect. We hypothesize that, in thrombin-activated lung fibroblasts, PKC-{epsilon} and RhoA rapidly associate, SM {alpha}-actin is recruited, and a ternary complex is formed. PKC-{epsilon}-RhoA-SM {alpha}-actin leads to differentiation of normal lung fibroblasts to a myofibroblast phenotype (Fig. 5).



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 5. Schema proposed for PKC-{epsilon}-RhoA-SM {alpha}-actin complex formation in thrombin-activated lung fibroblasts. Within 5 min, thrombin activates PKC-{epsilon} and RhoA and induces PKC-{epsilon}-RhoA immunocomplex. PKC-{epsilon} remains coimmunoprecipitated with RhoA after 15 min of thrombin treatment and forms a complex with SM {alpha}-actin (SMA). The ternary complex PKC-{epsilon}-RhoA-SM {alpha}-actin is formed within 2 h of lung fibroblast exposure to thrombin and results in significantly increased SM {alpha}-actin expression and organization. Differentiation of normal lung fibroblasts into myofibroblast phenotype starts after formation of the ternary complex and reaches the maximum in 24 h of thrombin exposure. Specific inhibitors to PKC-{epsilon} (TIP) and RhoA [toxin B (TB)] block interaction between all 3 molecules, preventing complex formation.

 

Several recent studies have demonstrated that some PKC isoforms are required for activation of Rho family members (9, 26). Previously, we showed that thrombin treatment activates and translocates PKC-{epsilon} to the plasma membrane in lung fibroblasts (2). To establish whether inhibition of Rho proteins affects PKC-{epsilon} activation and translocation to the membrane, we treated lung fibroblasts with toxin B for 18 h and then performed a PKC translocation assay. Interestingly, toxin B did not interfere with thrombin-induced PKC translocation to the membrane (Fig. 6A). To determine whether PKC-{epsilon} might regulate Rho activity, we performed a Rho-GTP{gamma}S binding assay after depletion of PKC-{epsilon} in lung fibroblasts by using antisense oligonucleotides. The protein level of PKC-{epsilon} in cells treated with antisense oligonucleotides was decreased by 70–80% compared with untreated cells or cells treated with sense oligonucleotides for PKC-{epsilon} (Fig. 6B, top). Depletion of PKC-{epsilon} did not change thrombin-induced Rho-GTP{gamma}S binding in lung fibroblast lysates (Fig. 6B, bottom).



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 6. Thrombin activates PKC-{epsilon} and RhoA in an independent manner. A: lung fibroblasts were incubated with or without toxin B (50 pg/ml) overnight and then treated with thrombin (0.5 U/ml) for 15 min. Cells were collected in ice-cold PBS, divided into membrane and cytosolic fractions, and analyzed for PKC-{epsilon} expression by immunoblotting. The experiment was performed 3 times, and a representative immunoblot is presented. B: antisense oligonucleotide for PKC-{epsilon} and sense oligonucleotide as a control were introduced into lung fibroblasts 24 h before cells were collected. Cells were harvested in PBS, and thrombin-induced Rho-[35S]GTP{gamma}S binding was performed. The experiment was performed 3 times, and means ± SD are presented. *Significantly different from control (P < 0.001). Top: parallel experiments in which PKC-{epsilon} expression in cells treated with antisense oligonucleotides (AS), sense oligonucleotide (S) for PKC-{epsilon}, or serum-free medium was analyzed by Western blot of cell extracts followed by densitometric analysis. Difference between cells treated with antisense oligonucleotides and control cells treated with sense oligonucleotides is statistically significant (P < 0.001).

 

Overexpression of constitutively active PKC-{epsilon} A159E and RhoA L63 mimics thrombin's effects on SM {alpha}-actin expression/organization and collagen gel contraction in normal lung fibroblasts. Our results suggest that thrombin activates Rho protein and PKC-{epsilon} in lung fibroblasts in an independent manner. We postulated that activated RhoA and PKC-{epsilon} associate with one another and then are capable of mimicking the effects of thrombin on SM {alpha}-actin rearrangements in human lung fibroblasts. To test this hypothesis, we employed constitutively active PKC-{epsilon} and RhoA to transiently transfect cultured lung fibroblasts. The substitution of leucine at position 63 for glycine abolished GTPase activity of RhoA and resulted in a constitutively active form (6). The substitution of glutamic acid at position 159 for alanine in PKC-{epsilon}'s pseudosubstrate motif of the regulatory domain prevented inhibition of the catalytic domain and resulted in constitutive activity of PKC-{epsilon} (9). SM {alpha}-actin expression and organization, as well as overexpression of constitutively active V5/His-PKC-{epsilon} A159E and HA-RhoA L63, were analyzed by confocal microscopy 48 h after transfection. To provide compelling evidence that lung fibroblasts examined by confocal microscopy indeed expressed introduced DNA, we immunostained the cells simultaneously with anti-SM {alpha}-actin, anti-His, and anti-HA antibodies (Fig. 7). Cells transfected with constitutively active V5/His-PKC-{epsilon} A159E alone (top row, 2nd column) and cells transfected with both constitutively active PKC-{epsilon} and constitutively active RhoA (top row, 4th column) expressed PKC-{epsilon} (blue staining with anti-His antibody). PKC-{epsilon} was not expressed when cells were transfected with vector or constitutively active RhoA alone (top row, 1st and 3rd columns). Cells transfected with constitutively active HA-RhoA L63 alone and cells transfected with both constitutively active PKC-{epsilon} and constitutively active RhoA expressed RhoA (red staining with anti-HA antibody, middle row, 3rd and 4th columns). Cells transfected with vector or PKC-{epsilon} alone did not express RhoA (middle row, 1st and 2nd columns). SM {alpha}-actin was expressed only in cells transfected with constitutively active forms of PKC-{epsilon} and RhoA (bottom row, 4th column), suggesting that expression and organization of SM {alpha}-actin occurs only in the presence of activated PKC-{epsilon} and RhoA. Cells transfected with either vector or constitutively active PKC-{epsilon} alone or constitutively active RhoA alone contained only traces of unorganized SM {alpha}-actin (bottom row, 1st–3rd columns). Lung fibroblasts transfected with V5/His-PKC-{epsilon} A159E or HA-RhoA L63 alone did not contract collagen gels in serum-free DMEM, whereas gels containing cells transfected with constitutively active forms of PKC-{epsilon} and RhoA contracted from ~15 to 7–6 mm diameter (Fig. 8A). Contraction was apparent within 2–5 h after release of polymerized gels from the underlying culture dish and reached a maximum within 24 h. On the basis of the fact that thrombin-induced SM {alpha}-actin expression/organization and contractile phenotype of fibroblasts require PKC-{epsilon} and RhoA, we expected that lung fibroblasts transfected with constitutively active forms of PKC-{epsilon} and RhoA and cultured in three-dimensional collagen gels will contain significant amounts of SM {alpha}-actin. To determine expression of SM {alpha}-actin, as well as V5/His-PKC-{epsilon} A159E and HA-RhoA L63, collagen gels were collected, digested with collagenase, and analyzed by Western blot using anti-SM {alpha}-actin antibody, anti-V5 antibody, and anti-HA antibody, respectively (Fig. 8B). Immunoblotting confirmed that SM {alpha}-actin expression was significantly increased in cells transfected with constitutively active forms of PKC-{epsilon} and RhoA compared with the cells transfected with vector, PKC-{epsilon} alone, or RhoA alone (Fig. 8B). We conclude that coexpression of constitutively active PKC-{epsilon} and RhoA mimics the effect of thrombin in normal lung fibroblasts, namely, promoting SM {alpha}-actin expression/organization and collagen gel contraction, two fundamental elements of myofibroblast differentiation.



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 7. Overexpression of constitutively active PKC-{epsilon} A159E and RhoA L63 in lung fibroblasts promotes SM {alpha}-actin expression and organization. Lung fibroblasts cultured on glass slides were transiently transfected with V5/His-PKC-{epsilon} in pcDNA3.1 and pcDNA3.1 (0.5 µg each), HA-RhoA L63 in pcDNA3.1 and pcDNA3.1 (0.5 µg each), or V5/His-PKC-{epsilon} in pcDNA3.1 and HA-RhoA L63 in pcDNA3.1 (0.5 µg each). Control cells were transfected with pcDNA3.1 (1 µg). Cells were washed with PBS and incubated overnight with 1.5 ml of growth medium containing DNA and Effectene reagent (10 µl). Then cells were washed and allowed to grow in fresh medium for another 24 h. At 48 h after transfection, cells were fixed in methanol and immunostained with a mouse monoclonal anti-SM {alpha}-actin antibody, a rabbit polyclonal His probe, and a goat polyclonal HA probe. Secondary antibodies were anti-mouse IgG conjugated to Cy2, anti-rabbit IgG conjugated to Cy5, and anti-goat IgG conjugated to Cy3. SM {alpha}-actin expression and organization (bottom row), as well as overexpression of constitutively active PKC-{epsilon} A159E (top row) and RhoA L63 (middle row), were analyzed by confocal microscopy using the Olympus Merlin Imaging System. The experiment was performed 3 times in duplicate, and representative images are presented.

 


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 8. Overexpression of constitutively active PKC-{epsilon} A159E and RhoA L63 in lung fibroblasts induces collagen gel contraction. A: lung fibroblasts were transiently transfected with constitutively active PKC-{epsilon} A159E and RhoA L63 DNA and cultured in collagen gel on 24-well plates. Polymerized gels were released from the underlying culture dish 24 h after transfection and incubated in serum-free DMEM for another 24 h. *Significantly different from vehicle (P < 0.005). B: to determine expression of SM {alpha}-actin, as well as V5/His-PKC-{epsilon} A159E and HA-RhoA L63, collagen gels were collected, digested with collagenase, and analyzed by Western blot using anti-SM {alpha}-actin antibody, anti-V5 antibody, and anti-HA antibody, respectively. The experiment was performed twice in duplicate, and representative results are presented.

 


    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Recently, we reported that PKC-{epsilon} mediates thrombin-induced SM {alpha}-actin expression and organization and differentiates lung fibroblasts to a myofibroblast phenotype (2). Similar cells can be cultured from bronchoalveolar lavage (BAL) fluid or obtained at autopsy from scleroderma patients with interstitial pulmonary fibrosis (20). The factors regulating SM {alpha}-actin expression and organization in lung fibroblasts, which are involved in the process of pulmonary fibrosis, are not yet understood. In a previous study, we demonstrated that depletion of PKC-{epsilon} or inhibition of its activation abolished thrombin-induced SM {alpha}-expression/organization and collagen gel contraction by lung fibroblasts (2). In this study, we found that overexpression of constitutively active PKC-{epsilon} alone does not affect SM {alpha}-actin expression and organization or collagen gel contraction. Therefore, we speculate that some other protein(s) is activated in lung fibroblasts by thrombin, which is involved in myofibroblast differentiation. A potential candidate is the small GTP-binding protein Rho, which is activated by thrombin in different cell lines (7, 25, 36). We observed that thrombin rapidly activates Rho and increases Rho-[35S]GTP{gamma}S binding up to 5.2 times basal levels in lung fibroblasts. Time-course analysis of Rho stimulation in vivo revealed that Rho remained activated for 24 h after exposure of lung fibroblasts to thrombin.

Recent publications support an important role for Rho GTPase in cytoskeletal reorganization (16, 27). Microinjection studies performed in fibroblasts showed that Rho mediates stress fiber formation, and inhibition of Rho prevents stress fiber formation in response to lysophosphatidic acid and bombesin (3, 31). We found that Rho inactivation inhibits SM {alpha}-actin organization and collagen gel contraction by lung fibroblasts. This is consistent with the fact that SM {alpha}-actin in activated lung fibroblasts is chiefly incorporated in stress fibers. Furthermore, we showed that inhibition of Rho proteins by toxin B abolished interaction between SM {alpha}-actin and PKC-{epsilon}. This effect is not due to SM {alpha}-actin disorganization but, rather, direct involvement of RhoA, because, as we showed previously, the actin microfilament-disrupting agent cytochalasin D does not affect complex formation between PKC-{epsilon} and SM {alpha}-actin (2).

With the use of a yeast two-hybrid system, direct interaction has been shown between the yeast homolog of Rho protein, Rho1p, and the homolog of mammalian PKC, Pkc1p (12). Recent studies also provide evidence that mammalian PKC isozymes and Rho GTPases coimmunoprecipitate and participate in direct protein-protein interactions (5, 37, 39). On the basis of our results showing that the presence of active Rho is essential for SM {alpha}-actin organization, we investigated whether Rho protein could associate with PKC-{epsilon} in lung fibroblasts. Using an immunoprecipitation assay, we found that, after thrombin treatment, Rho protein rapidly, but transiently, coimmunoprecipitates with PKC-{epsilon}. A longer (>=2 h) stimulation with thrombin was required for protein coimmunoprecipitation of Rho and SM {alpha}-actin. PKC-{epsilon} and RhoA remain associated with SM {alpha}-actin after 2 and 24 h of exposure to thrombin. We hypothesize that, in thrombin-activated lung fibroblasts, PKC-{epsilon} and RhoA rapidly associate, recruit SM {alpha}-actin, and form the ternary complex. However, we were not able to coimmunoprecipitate PKC with anti-Rho antibody after 2 and 24 h of thrombin stimulation, whereas PKC and Rho were easily detected after 2 and 24 h of thrombin treatment, when coimmunoprecipitation was performed with anti-SM {alpha}-actin antibody. We believe that PKC-{epsilon} could not be detected in association with RhoA, because, after 2 h of thrombin stimulation, there is no longer direct interaction between Rho and PKC; however, Rho and PKC interact with SM {alpha}-actin. It is also possible that during protein-protein interaction between PKC and SM {alpha}-actin, some changes in PKC conformation occur that make it unavailable for anti-PKC antibody, when immunoprecipitation is performed with anti-RhoA antibody.

We assumed that association of Rho GTPase and PKC-{epsilon} in lung fibroblasts might be necessary for activation of one another or for regulation of a common signaling pathway(s) downstream from the Rho-PKC signal transduction complex. Recently, the association of PKC-{alpha} with Rho was demonstrated in endothelial cells, suggesting its critical role in Rho activation (25). However, we observed that Rho protein was not necessary for thrombin-induced PKC-{epsilon} activation and translocation to the membrane, nor did depletion of PKC-{epsilon} affect Rho activation and thrombin-induced GTP{gamma}S binding. On the other hand, Rho inhibition prevented coimmunoprecipitation of PKC-{epsilon} with SM {alpha}-actin. This suggests that the association of thrombin-activated Rho and PKC is essential for the regulation of SM {alpha}-actin organization in normal lung fibroblasts. We postulated that constitutively active RhoA and PKC-{epsilon} associate with one another and mimic the effects of thrombin on SM {alpha}-actin functions in lung fibroblasts. To test this hypothesis, we overexpressed constitutively active PKC-{epsilon} and constitutively active RhoA in lung fibroblasts and compared their effects on SM {alpha}-actin with nontransfected cells. We found that cells transfected with constitutively active PKC-{epsilon} alone appeared and behaved similar to control lung fibroblasts. Cells transfected with constitutively active RhoA alone had only slightly increased SM {alpha}-actin organization. Interestingly, lung fibroblasts transfected with the combination of constitutively active PKC-{epsilon} and constitutively active RhoA contained highly organized SM {alpha}-actin. Transfected lung fibroblasts acquired the ability to contract collagen gel in serum-free medium without any stimulation, similar to our observation with SSc lung myofibroblasts (2). We conclude that PKC-{epsilon} and RhoA in their active forms are required for SM {alpha}-actin expression/organization and collagen gel contraction. It has been demonstrated that Rho alone can increase the activity of SM {alpha}-actin promoter and modulate SM {alpha}-actin expression in other cell types such as vascular smooth muscle cells (22). Our data suggest that Rho promotes SM {alpha}-actin expression only in the presence of activated PKC-{epsilon} in lung fibroblasts. The molecular link between Rho and actin stress fiber formation has been recently identified (1, 34). The downstream target of Rho, Rho kinase, has been shown to directly phosphorylate myosin light chain, which promotes interaction of myosin filaments with actin filaments and is followed by stress fiber formation and increased contractility (1, 14, 18). Thrombin has been shown to promote actin reorganization in endothelial and astrocytoma cells via Rho-dependent activation of myosin light chain but without PKC involvement (23, 47). In the present study, we confirm that PKC-{epsilon} activation is required for thrombin-induced SM {alpha}-actin organization. Recently, we found that inhibition of PKC-{epsilon} activation in lung fibroblasts prevents thrombin-induced SM {alpha}-actin organization and contractility of lung fibroblasts (2). However, overexpression of constitutively active PKC-{epsilon} alone was not sufficient to induce SM {alpha}-actin expression and organization; it was observed when only constitutively active RhoA was overexpressed in lung fibroblasts. Overexpression of constitutively active RhoA and constitutively active PKC-{epsilon} promoted SM {alpha}-actin expression, organization, and collagen gel contraction mimicking thrombin's effects in these cells. These data suggest that PKC-{epsilon} in association with RhoA recruits SM {alpha}-actin and possibly some other protein(s) to promote intracellular events responsible for SM {alpha}-actin expression and organization. Our study demonstrates for the first time an apparent link between PKC-{epsilon}- and Rho-mediated signaling pathways, which is an essential intracellular connection in differentiation of normal lung fibroblasts to a myofibroblast phenotype by thrombin.


    ACKNOWLEDGMENTS
 
DISCLOSURES

This work was supported by National Institutes of Health Grant RR-1070-1 (to R. M. Silver) and National Research Service Award 1 F32 HL-69689-01 (to G. S. Bogatkevich), a grant from the Scleroderma Foundation (to A. Ludwicka-Bradley and E. Tourkina), and a grant from the R. G. Kozmetsky Foundation (to R. M. Silver). An Olympus Merlin confocal imaging system from a Department of Veterans Affairs shared equipment grant and the Research Enhancement Award Program from the Department of Veterans Affairs was used for this study.


    FOOTNOTES
 

Address for reprint requests and other correspondence: G. S. Bogatkevich, Div. of Rheumatology and Immunology, Dept. of Medicine, Medical University of South Carolina, 96 Jonathan Lucas St., Suite 912, PO Box 250623, Charleston, SC 29425 (E-mail: bogatkev{at}musc.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Amano M, Chihara K, Kimura K, Fukata Y, Nakamura N, Matsuura Y, and Kaibuchi K. Formation of actin stress fibers and focal adhesions enhanced by Rho-kinase. Science 275: 1308–1311, 1997.[Abstract/Free Full Text]
  2. Bogatkevich GS, Tourkina E, Silver RM, and Ludwicka-Bradley A. Thrombin differentiates normal lung fibroblasts to a myofibroblast phenotype via proteolytically activated receptor-1 and a protein kinase C-dependent pathway. J Biol Chem 276: 45184–45192, 2001.[Abstract/Free Full Text]
  3. Buhl AM, Johnson NL, Dhanasekaran N, and Johnson GL. G{alpha}12 and G{alpha}13 stimulate Rho-dependent stress fiber formation and focal adhesion assembly. J Biol Chem 270: 24631–24634, 1995.[Abstract/Free Full Text]
  4. Carpenter CL. Actin cytoskeleton and cell signaling. Crit Care Med 28 Suppl: N94–N99, 2000.[Web of Science][Medline]
  5. Chang JH, Pratt JC, Sawasdikosol S, Kapeller R, and Burakoff SJ. The small GTP-binding protein Rho potentiates AP-1 transcription in T cells. Mol Cell Biol 18: 4986–4993, 1998.[Abstract/Free Full Text]
  6. Chatah NE and Abrams CS. G-protein-coupled receptor activation induces the membrane translocation and activation of phosphatidylinositol-4-phosphate 5-kinase I{alpha} by a Rac- and Rho-dependent pathway. J Biol Chem 276: 34059–34065, 2001.[Abstract/Free Full Text]
  7. Chikumi H, Fukuhara S, and Gutkind JS. Regulation of G protein-linked guanine nucleotide exchange factors for Rho, PDZ-RhoGEF, and LARG by tyrosine phosphorylation. J Biol Chem 277: 12463–12473, 2002.[Abstract/Free Full Text]
  8. DeNofrio D, Hoock TC, and Herman IM. Functional sorting of actin isoforms in microvascular pericytes. J Cell Biol 109: 191–202, 1989.[Abstract/Free Full Text]
  9. Genot EM, Parker PJ, and Cantrell DA. Analysis of the role of protein kinase C in T cell activation. J Biol Chem 270: 9833–9839, 1995.[Abstract/Free Full Text]
  10. Herman IM. Actin isoforms. Curr Opin Cell Biol 5: 48–55, 1993.[Medline]
  11. Hu MH, Bauman EM, Roll RL, Yeilding N, and Abrams CS. Pleckstrin 2, a widely expressed paralog of pleckstrin involved in actin rearrangement. J Biol Chem 274: 21515–21518, 1999.[Abstract/Free Full Text]
  12. Kamada Y, Qadota H, Python CP, Anraku Y, Ohya Y, and Levin DE. Activation of yeast protein kinase C by Rho1 GTPase. J Biol Chem 271: 9193–9196, 1996.[Abstract/Free Full Text]
  13. Khaitlina SY. Functional specificity of actin isoforms. Int Rev Cytol 202: 35–98, 2001.[Web of Science][Medline]
  14. Kimura K, Ito M, Amano M, Chihara K, Fukata Y, Nakafuku M, Yamamori B, Feng J, Nakano T, Okawa K, Iwamatsu A, and Kaibuchi K. Regulation of myosin phosphatase by Rho and Rho-associated kinase (Rho-kinase). Science 273: 245–248, 1996.[Abstract]
  15. Kozma R, Ahmed S, Best A, and Lim L. The Ras-related protein Cdc42Hs and bradykinin promote formation of peripheral actin microspikes and filopodia in Swiss 3T3 fibroblasts. Mol Cell Biol 15: 1942–1952, 1995.[Abstract]
  16. Kreisberg JI, Ghosh-Choudhury N, Radnik RA, and Schwartz MA. Role of Rho and myosin phosphorylation in actin stress fiber assembly in mesangial cells. Am J Physiol Renal Physiol 273: F283–F288, 1997.[Abstract/Free Full Text]
  17. Kuhn C and McDonald JA. The roles of the myofibroblast in idiopathic pulmonary fibrosis. Am J Pathol 138: 1257–1265, 1991.[Abstract]
  18. Kureishi Y, Kobayashi S, Amano M, Kimura K, Kanaide H, Nakano T, Kaibuchi K, and Ito M. Rho-associated kinase directly induces smooth muscle contraction through myosin light chain phosphorylation. J Biol Chem 272: 12257–12260, 1997.[Abstract/Free Full Text]
  19. Low RB. Modulation of myofibroblasts and smooth-muscle phenotypes in the lung. Curr Top Pathol 93: 19–26, 1999.[Medline]
  20. Ludwicka A, Trojanowska M, Smith EA, Baumann M, Strange C, Korn J, Smith T, LeRoy EC, and Silver RM. Growth and characterization of fibroblasts obtained from bronchoalveolar lavage of scleroderma patients. J Rheumatol 19: 1716–1723, 1992.[Web of Science][Medline]
  21. Ludwicka-Bradley A, Tourkina E, Suzuki S, Tyson E, Bonner M, Fentin JW II, Hoffman S, and Silver RM. Thrombin upregulates interleukin-8 in lung fibroblasts via cleavage of proteolytically activated receptor-I and protein kinase C-{gamma} activation. Am J Respir Cell Mol Biol 22: 235–243, 2000.[Abstract/Free Full Text]
  22. Mack CP, Somlyo AV, Hautmann M, Somlyo AP, and Owens GK. Smooth muscle differentiation marker gene expression is regulated by RhoA-mediated actin polymerization. J Biol Chem 276: 341–347, 2001.[Abstract/Free Full Text]
  23. Majumdar M, Seasholtz TM, Goldstein D, de Lanerolle P, and Brown JH. Requirement for Rho-mediated myosin light chain phosphorylation in thrombin-stimulated cell rounding and its dissociation from mitogenesis. J Biol Chem 273: 10099–10106, 1998.[Abstract/Free Full Text]
  24. McGough A. F-actin-binding proteins. Curr Opin Cell Biol 8: 166–176, 1996.
  25. Mehta D, Rahman A, and Malik AB. Protein kinase C-{alpha} signals Rho-guanine nucleotide dissociation inhibitor phosphorylation and Rho activation and regulates the endothelial cell barrier function. J Biol Chem 276: 22614–22620, 2001.[Abstract/Free Full Text]
  26. Nozu F, Tsunoda Y, Ibitayo AI, Bitar KN, and Owyang C. Involvement of RhoA and its interaction with protein kinase C and Src in CCK-stimulated pancreatic acini. Am J Physiol Gastrointest Liver Physiol 276: G915–G923, 1999.[Abstract/Free Full Text]
  27. Parizi M, Howard E, and Tomasek JJ. Regulation of LPA-promoted myofibroblast contraction: role of Rho, myosin light chain kinase, and myosin light chain phosphatase. Exp Cell Res 254: 210–220, 2000.[Web of Science][Medline]
  28. Phan SH. Role of the myofibroblast in pulmonary fibrosis. Kidney Int 49: S46–S48, 1996.
  29. Phan SH, Zhang K, Zhang HY, and Gharaee-Kermani M. The myofibroblast as an inflammatory cell in pulmonary fibrosis. Curr Top Pathol 93: 173–182, 1999.[Medline]
  30. Prekeris R, Hernandez RM, Mayhew MW, White MK, and Terrian DM. Molecular analysis of the interactions between protein kinase C-{epsilon} and filamentous actin. J Biol Chem 273: 26790–26798, 1998.[Abstract/Free Full Text]
  31. Rankin S, Morii N, Narumiya S, and Rozengurt E. Botulinum C3 exoenzyme blocks the tyrosine phosphorylation of p125FAK and paxillin induced by bombesin and endothelin. FEBS Lett 354: 315–319, 1994.[Web of Science][Medline]
  32. Reid T, Furuyashiki T, Ishizaki T, Watanabe N, Fujisawa K, Morii N, Madaule P, and Narumiya S. Rhotekin, a new putative target for Rho bearing homology to a serine/threonine kinase, PKN, and rhophilin in the Rho-binding domain. J Biol Chem 271: 13556–13560, 1996.[Abstract/Free Full Text]
  33. Ren XD, Kiosses WB, and Schwartz MA. Regulation of the small GTP-binding protein Rho by cell adhesion and the cytoskeleton. EMBO J 18: 578–585, 1999.[Web of Science][Medline]
  34. Ridley AJ and Hall A. Signal transduction pathways regulating Rho-mediated stress fiber formation: requirement for a tyrosine kinase. EMBO J 13: 2600–2610, 1994.[Web of Science][Medline]
  35. Ridley AJ, Paterson HF, Johnston CL, Diekmann D, and Hall A. The small GTP-binding protein Rac regulates growth factor-induced membrane ruffling. Cell 70: 401–410, 1992.[Web of Science][Medline]
  36. Seasholtz TM, Majumdar M, Kaplan DD, and Brown JH. Rho and Rho kinase mediate thrombin-stimulated vascular smooth muscle cell DNA synthesis and migration. Circ Res 84: 1186–1193, 1999.[Abstract/Free Full Text]
  37. Slater SJ, Seiz JL, Stagliano BA, and Stubbs CD. Interaction of protein kinase C isozymes with Rho GTPases. Biochemistry 40: 4437–4445, 2001.[Medline]
  38. Small V, Rottner K, and Kaverina I. Functional design in the actin cytoskeleton. Curr Opin Cell Biol 11: 54–60, 1999.[Web of Science][Medline]
  39. Taggart MJ, Leavis P, Feron O, and Morgan KG. Inhibition of PKC-{alpha} and RhoA translocation in differentiated smooth muscle by a caveolin scaffolding domain peptide. Exp Cell Res 258: 72–81, 2000.[Web of Science][Medline]
  40. Takai Y, Sasaki T, and Matozaki T. Small GTP-binding proteins. Physiol Rev 81: 153–208, 2001.[Abstract/Free Full Text]
  41. Tourkina E, Hoffman S, Fenton JW II, Lipsitz S, Silver RM, and Ludwicka-Bradley A. Depletion of PKC in normal and scleroderma lung fibroblasts has opposite effects on tenascin expression. Arthritis Rheum 44: 1370–1381, 2001.[Web of Science][Medline]
  42. Van Aelst L and D'Souza-Schorey C. Rho GTPases and signaling networks. Genes Dev 11: 2295–2322, 1997.[Free Full Text]
  43. Vyalov SL, Gabbiani G, and Kapanci Y. Rat alveolar myofibroblasts acquire {alpha}-smooth muscle actin expression during bleomycin-induced pulmonary fibrosis. Am J Pathol 143: 1754–1765, 1993.[Abstract]
  44. Wu G, Bogatkevich GS, Mukhin YV, Benovic JL, Hilde-brandt JD, and Lanier SM. Identification of G{beta}{gamma} binding sites in the third intracellular loop of the M3-muscarinic receptor and their role in receptor regulation. J Biol Chem 275: 9026–9034, 2000.[Abstract/Free Full Text]
  45. Zhang H, Gharaee-Kermani M, Zhang K, Karmiol S, and Phan SH. Lung fibroblast {alpha}-smooth muscle actin expression and contractile phenotype in bleomycin-induced pulmonary fibrosis. Am J Pathol 148: 527–537, 1996.[Abstract]
  46. Zhang K, Rekhter MD, Gordon D, and Phan SH. Myofibroblasts and their role in lung collagen gene expression during pulmonary fibrosis: a combined immunohistochemical and in situ hybridization. Am J Pathol 145: 114–125, 1994.[Abstract]
  47. Zhao Y and Davis HW. Signaling pathways in thrombin-induced actin reorganization in pulmonary artery endothelial cells. Exp Cell Res 25: 23–39, 1999.[Medline]



This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
T. Kita, Y. Hata, R. Arita, S. Kawahara, M. Miura, S. Nakao, Y. Mochizuki, H. Enaida, Y. Goto, H. Shimokawa, et al.
Role of TGF-{beta} in proliferative vitreoretinal diseases and ROCK as a therapeutic target
PNAS, November 11, 2008; 105(45): 17504 - 17509.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
A. Leask, X. Shi-wen, K. Khan, Y. Chen, A. Holmes, M. Eastwood, C. P. Denton, C. M. Black, and D. J. Abraham
Loss of protein kinase C{epsilon} results in impaired cutaneous wound closure and myofibroblast function
J. Cell Sci., October 15, 2008; 121(20): 3459 - 3467.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
T. Smani, T. Patel, and V. M. Bolotina
Complex regulation of store-operated Ca2+ entry pathway by PKC-{varepsilon} in vascular SMCs
Am J Physiol Cell Physiol, June 1, 2008; 294(6): C1499 - C1508.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
E. Tourkina, M. Richard, P. Gooz, M. Bonner, J. Pannu, R. Harley, P. N. Bernatchez, W. C. Sessa, R. M. Silver, and S. Hoffman
Antifibrotic properties of caveolin-1 scaffolding domain in vitro and in vivo
Am J Physiol Lung Cell Mol Physiol, May 1, 2008; 294(5): L843 - L861.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
P.-J. Wipff, D. B. Rifkin, J.-J. Meister, and B. Hinz
Myofibroblast contraction activates latent TGF- 1 from the extracellular matrix
J. Cell Biol., December 17, 2007; 179(6): 1311 - 1323.
[Abstract] [Full Text] [PDF]


Home page
PhysiologyHome page
K. R. Stenmark, N. Davie, M. Frid, E. Gerasimovskaya, and M. Das
Role of the Adventitia in Pulmonary Vascular Remodeling
Physiology, April 1, 2006; 21(2): 134 - 145.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
H. Hao, G. Gabbiani, E. Camenzind, M. Bacchetta, R. Virmani, and M.-L. Bochaton-Piallat
Phenotypic Modulation of Intima and Media Smooth Muscle Cells in Fatal Cases of Coronary Artery Lesion
Arterioscler Thromb Vasc Biol, February 1, 2006; 26(2): 326 - 332.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
K. L. Watts, E. M. Sampson, G. S. Schultz, and M. A. Spiteri
Simvastatin Inhibits Growth Factor Expression and Modulates Profibrogenic Markers in Lung Fibroblasts
Am. J. Respir. Cell Mol. Biol., April 1, 2005; 32(4): 290 - 300.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
S. Clement, B. Hinz, V. Dugina, G. Gabbiani, and C. Chaponnier
The N-terminal Ac-EEED sequence plays a role in {alpha}-smooth-muscle actin incorporation into stress fibers
J. Cell Sci., April 1, 2005; 118(7): 1395 - 1404.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
G. S. Bogatkevich, E. Gustilo, J. C. Oates, C. Feghali-Bostwick, R. A. Harley, R. M. Silver, and A. Ludwicka-Bradley
Distinct PKC isoforms mediate cell survival and DNA synthesis in thrombin-induced myofibroblasts
Am J Physiol Lung Cell Mol Physiol, January 1, 2005; 288(1): L190 - L201.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/2/L334    most recent
00417.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (21)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bogatkevich, G. S.
Right arrow Articles by Ludwicka-Bradley, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bogatkevich, G. S.
Right arrow Articles by Ludwicka-Bradley, A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2003 by the American Physiological Society.