AJP - Lung Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 285: L354-L362, 2003. First published April 4, 2003; doi:10.1152/ajplung.00026.2003
1040-0605/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/2/L354    most recent
00026.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rich, C. B.
Right arrow Articles by Foster, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rich, C. B.
Right arrow Articles by Foster, J. A.

Transcriptional regulation of pulmonary elastin gene expression in elastase-induced injury

Celeste B. Rich, Isabel Carreras, Edgar C. Lucey, Julie A. Jaworski, Jo Ann Buczek-Thomas, Matthew A. Nugent, Phillip Stone, and Judith Ann Foster

Department of Biochemistry, Boston University School of Medicine, Boston, Massachusetts 02118

Submitted 24 January 2003 ; accepted in final form 31 March 2003


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Previously we have shown that treatment of confluent, pulmonary fibroblast cultures with elastase results in upregulation of elastin mRNA and protein levels. In the present study we focused on determining the level at which elastin expression is upregulated after elastase exposure. We examined as models for this investigation elastin gene expression in primary pulmonary fibroblast cells during the transition from subconfluent to confluent cultures and in confluent, matrix-laden cultures treated briefly with elastase. In addition, we extended our studies to mice that were given an intratracheal dose of elastase; the effects on lung elastin mRNA and elastin promoter activity levels were measured and compared with results from in vitro cell models. The results demonstrate that upregulation of elastin gene expression during the transition of subconfluent to confluent cultures and after elastase injury is associated with an increase in the level of transcription both in vitro and in vivo. Furthermore, intratracheal administration of elastase to transgenic mice illustrates that the increased levels of elastin mRNA are accompanied by increased activity of the elastin gene promoter in cells spatially positioned near major sites of tissue injury.

pulmonary fibroblasts; chronic obstructive pulmonary disease; elastic fibers; promoter; transgenic mice


ELASTIN IS AN EXTRACELLULAR PROTEIN whose intrinsic ability to passively expand and contract under gas and liquid pressure gradients renders it an important element in maintaining proper pulmonary function. In chronic obstructive pulmonary diseases (COPD) such as emphysema, the loss of elastin from the alveolar walls appears to be a major event in precipitating the clinical pathology (38). Initially this loss of elastin was thought to result from elastolytic enzymes secreted by macrophages and/or neutrophils that have migrated into the lungs after prolonged physical or chemical insult (1, 36, 38). More recently, Kasahara et al. (22) have shown that chronic administration of a VEGF receptor blocker to rats resulted in a lung pathology similar to emphysema. These authors further show that administration of the receptor blocker results in alveolar septal cell apoptosis, specifically endothelial cells, and suggest that resultant release of caspases may inactivate protease inhibitors and/or activate matrix protease activity. In either case, elastin is lost from the alveolar septa, resulting in air space enlargement.

A number of experimental models have been developed for the study of biochemical events accompanying elastolytic injury to lung tissue and elastogenic cells. Intratracheal administration of elastolytic enzymes to rodents shows that increased elastin synthesis followed the proteolytic injury (39). Furthermore, in situ hybridization of lung sections obtained from elastase-treated animals demonstrates an increase in elastin mRNA levels, especially in areas adjacent to the sites of tissue damage (26). Our research group has developed an in vitro model for elastase injury where matrix-laden pulmonary fibroblast cell cultures were briefly exposed to elastase, and the response to elastase-released products was examined (14). The results of these studies showed that elastase-treated cell cultures exhibit an increase in elastin mRNA levels with a concomitant increase in soluble elastin synthesis. Interestingly, we found that products released by elastase treatment are inhibitory to elastin gene expression in mock-treated fibroblast cultures. Overall the behavior of the cell model is consistent with data from the in vivo models and further provides a rationale for the spatially confined upregulation of elastin expression in cells adjacent to elastase injury.

Studies of various cytokines and growth factors associated with elastase treatment have provided insight into signal pathways and molecular mechanisms leading to the downregulation of elastin expression in pulmonary fibroblast cultures (2, 9, 11, 23, 34). However, very little information is available on the mechanisms underlying the reinitiation of elastin gene expression after elastase exposure. As in any efficient repair response, the ability to confine the process to a defined area of damaged tissue/matrix involves stimulation of a specific set of cells spatially positioned or recruited to synthesize matrix components. We hypothesize that this repair process involves the transcriptional control of elastin gene expression similar to the regulation operative in the orchestrated patterning of elastin synthesis during lung development (3, 19, 42). Consequently, the goal of the present study was to gain insight into the mechanisms underlying the increase of elastin gene expression after elastase treatment.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Isolation and treatment of cell cultures. Neonatal rat pulmonary fibroblast cells were isolated from lungs of 3-day-old Sprague-Dawley rats and seeded in second passage as previously described (33). Confluent cell cultures were plated at 2 x 104/cm2 in 75-cm2 flasks and maintained for 2–3 wk in 5% fetal bovine serum/Dulbecco's modified Eagle's medium (FBS/DMEM), and medium was changed twice weekly. Neonatal mouse lung fibroblasts were isolated from 6-day-old FVB mice carrying an elastin gene promoter reporter transgene (see Generation, characterization, and elastase treatment of transgenic mice carrying the elastin promoter transgene for description). Cells were isolated as described above for rat lung fibroblasts except that the mouse fibroblasts were allowed to adhere to the flask for 3 h rather than 2 h used for rat fibroblasts (34).

Confluent, matrix-laden fibroblast cultures were washed twice with Puck's saline and once with 44 mM sodium bicarbonate solution (pH 7.4). Five milliliters of 5 µg/ml of porcine pancreatic elastase (Elastin Products, Owensville, MO) were added, and the flask was incubated at 37°C for 5 min. Two conditions were used to study the effect of elastase. In one, the elastase solution was removed, and 20 ml of 5% FBS/DMEM were added, and in the other, elastase-released products were retained, and 15 ml of complete medium were added such that 5% FBS/DMEM was attained in a 20-ml volume. The cells were incubated at 37°C for 1–4 days. Control cells were treated with 44 mM sodium bicarbonate solution without elastase. To make certain that the added elastase was inhibited after removal, 48 h before the experiment we examined two flasks from each treatment condition every 24 h by phase microscopy to ensure that no cell lifting or further matrix damage occurred (14).

Quantitation of basic fibroblast growth factor. We measured basic fibroblast growth factor (bFGF) concentrations in the elastase supernatants using the human FGF basic Quantikine immunoassay kit from R & D Systems (Minneapolis, MN).

Isolation and analysis of RNA. Total RNA was isolated and analyzed by Northern blotting as described previously by Wolfe et al. (44). The rat actin cDNA was a gift of Dr. B. Nadal-Ginard at the University of North Carolina. The rat tropoelastin cDNA is described in Rich and Foster (33). Mouse histone H3.2 plasmid was provided by Dr. W. F. Marzluff at the University of North Carolina in Chapel Hill, NC.

Isolation and quantitation of insoluble elastin. After extraction of cell layers with guanidine thiocyanate (see Isolation and analysis of RNA), the resultant insoluble residue was washed with deionized water and incubated in 0.1 N NaOH at 95°C for 45 min (25). The hot alkali residue was hydrolyzed in 6 N HCl for 24 h at 110°C. Amino acid analysis (Beckman model 6300 with System Gold software; Palo Alto, CA) was used to confirm the characteristic amino acid composition of the elastin, typically consisting of >80% nonpolar amino acids and the characteristic amino acids, desmosine and isodesmosine (40). Elastin present (in micrograms) was calculated by multiplying the sum (in nanomoles) of all amino acid residues present by 85, the average residue mass.

Transcription run-on analysis. Intact nuclei were isolated according to the method of Dean et al. (9). The transcription assay was performed in the presence of [{alpha}-32P]UTP for 20 min at 30°C essentially as previously described (44). We applied 10 µg of pBluescript DNA and chimeric pBluescript DNA containing cDNAs for elastin, actin, and histone in duplicate onto nitrocellulose (Schleicher and Schuell, Keene, NH) using a slot-blot apparatus. Prehybridized filters were hybridized with the resultant transcription run-on solutions at 65°C for 72 h and then membranes were washed and exposed to an X-ray film for visualization and quantitation of the signal on a laser densitometer (Molecular Dynamics, Sunnyvale, CA).

Administration of elastase to mice. Female FVB mice from Taconic Farms were anesthetized by methoxyflurane inhalation and given an intratracheal instillation of 0.1 ml of physiological saline or porcine pancreatic elastase (10 µg in 0.1 ml of saline solution). Treatment of the mice with elastase was approved by Boston University School of Medicine Institutional Animal Care and Use Committee (Protocol number: 02-166). The mice were anesthetized with pentobarbital sodium 4 days after treatment and exsanguinated by cutting the abdominal aorta. The sternum was cut, and the diaphragm was removed to expose the lungs. We inflated the lungs until they were visibly taut (maximum volume) with freshly prepared paraformaldehyde through a tracheal cannula, using previously published methods (26, 27). The maximum volume was maintained for at least 2 min before the trachea was tied off to maintain inflation. The lungs, which harden rapidly with paraformaldehyde, were excised and placed in cold fixative. Two transverse slabs of tissue were cut from the left lung and one from the right caudal lobe. The same locations were sampled in all mice. The tissue was embedded in paraffin and 4-µm serial sections were cut, individually handled and numbered, and transferred to slides.

Generation, characterization, and elastase treatment of transgenic mice carrying the elastin promoter transgene. A 4.13-kb DNA fragment containing the human elastin promoter sequence from -2,260 to +2 driving expression of the chloramphenicol acetyl transferase (CAT) was used as a transgene (Fig. 1). The 4.13-kb DNA fragment was excised from a human elastin gene promoter/CAT reporter plasmid previously described (44). We generated transgenic mice at the Boston University Transgenic Core Facility by microinjecting the 4.13-kb DNA fragment into fertilized pronuclei eggs from FVB mice (Charles River Laboratories, Wilmington, MA). Microinjected eggs were implanted into foster recipient female mice of CD1 strain (Charles River Laboratories). Genomic DNA extracted from the tip of the mice tail was used for detection and analysis of the transgene. Screening for the transgene was performed by PCR using primers within the CAT coding region (5'TTTGAGGCATTTCAGTCAGTTGCTCAAT3' and 5'ATGTGTAGAAACTGCCGGAAATCGTCGT3'). To evaluate the transgene copy number, we digested genomic DNA with the restriction enzyme HaeII, and serial dilutions of the HaeII DNA fragment of the transgene were analyzed by Southern blot hybridization as described in Sambrook et al. (35). The HaeII DNA fragment of the transgene radiolabeled by random priming (Hoffmann-La Roche) with [{alpha}-32P]dCTP, and [{alpha}-32P]dGTP (New England Nuclear Products, Boston, MA) was used as a probe in the hybridization. Hybridized blots were exposed to X-ray film and analyzed by laser densitometry. To evaluate CAT expression in transgenic mice, we obtained protein extracts from tissues and cells homogenized in 0.25 M Tris · HCl, pH 7.5, using a Brinkman polytron and centrifuged at 10,000 g for 15 min at 4°C. We analyzed 100 µg of protein for CAT activity using [14C]chloramphenicol as a substrate as described by Donoghue et al. (12). The acetylated and nonacetylated forms of radioactive chloramphenicol were separated by thin-layer chromatography, and CAT activity was determined by the radioactivity in the acetylated forms as measured by laser densitometry (Molecular Dynamics, Sunnyvale, CA).



View larger version (8K):
[in this window]
[in a new window]
 
Fig. 1. Schematic representation of the elastin promoter-chloramphenicol acetyl transferase (CAT) reporter gene construct used for development of transgenic mice. The 4.13-kb transgene construct contains the 5'-flanking DNA of the human elastin promoter extending from positions -2,260 to +2 followed by the entire coding region of CAT and the SV40 small T antigen region, including the polyadenylation signal (poly A+). The numbers above the promoter region indicate nucleotide position relative to the transcriptional start site (+1). The indicated 2.6-kb HaeII fragment was used as a probe in Southern blot analysis of mouse genomic DNA digested with HaeII restriction endonuclease.

 

Elastase was instilled into the lungs of 3- to 5-mo-old transgenic mice carrying the 2.2-kb human elastin gene promoter/CAT reporter transgene as described above. Lungs were isolated at specified times after administration of elastase or saline. Total RNA and protein were extracted as previously described (19) and processed for Northern blots and CAT assays as described above.

In situ hybridization and immunohistochemistry. Sections of tissue were cut from the lung and dehydrated and embedded in Paraplast Plus embedding medium. Serial paraffin sections (4 µm) were cut, individually mounted, and numbered on Superfrost Plus slides for in situ hybridization or staining. We transcribed single-stranded sense and anti-sense RNA probes from a transcription vector containing a cDNA fragment coding elastin using the Riboprobe Gemini System (Promega, Madison, WI). The elastin probe used was a rat tropoelastin cDNA described in Rich and Foster (33). The probe was radiolabeled with [32S]UTP (New England Nuclear). After incubation at 37°C for 2 h, the DNA templates were digested with 1 µg of RQ1 RNase-free DNase (Promega) at 37°C for 15 min. The sense and antisense probes were subjected to alkaline hydrolysis to decrease their average fragment length to 150 bases. The probes were then extracted with phenol-chloroform and precipitated in ethanol. In situ hybridization was performed as previously described (26). Hybridized tissue slides were observed with dark field and phase optics with Leitz NIP Fluotar phase objectives. Paraffin sections, neighboring those used for in situ hybridization, were deparaffinized and stained with Verhoeff's elastin stain with and without the van Gieson counterstain (Fisher Scientific, Suwanee, GA). On stained tissue slides, the mean linear intercept (an indicator of air space size) was measured by projection microscopy in 20 randomly selected fields from each lung (13).

For immunohistochemical analysis, deparaffinized tissue sections were pretreated for antigen retrieval following the citrate buffer protocol described in Shi et al. (37). Immunohistochemical analyses were conducted according to Grushkin-Lerner and Trinkaus-Randall (15). The polyclonal sheep anti-CAT-digoxigenin (Hoffmann-La Roche) was diluted 1:10 in 3% bovine serum albumin-phosphate-buffered saline (BSA/PBS), and the secondary antibody anti-digoxigenin-fluorescein (FITC) (Hoffmann-La Roche) was diluted 1:100 in 3% BSA/PBS. Microscopy was performed on a Zeiss Axiovert 35 microscope with a Hamamatsu digital camera and Open-Lab Improvision software.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Elastin mRNA levels increase during the transition from subconfluence to confluence transition, and the increase is largely due to increased transcriptional levels. In a recent publication, we compared responses of subconfluent and confluent pulmonary fibroblast cultures to the addition of bFGF and subsequent effects on mitogen-activated protein kinase (MAPK) signaling and elastin gene expression (7). Our rationale for the comparative analysis of the two different states of fibroblast cultures was that it would provide insight into events expected after elastase treatment where cell/matrix contacts are disrupted and contact inhibition is lost (14). In the present study we pursued the characterization of the subconfluent to confluent transition and compared these results directly to confluent, matrix-laden fibroblast cultures that were treated with elastase. Figure 2A presents a representative Northern blot analysis where elastin and histone mRNAs were examined from fibroblast cells 2–8 days after seeding. A composite analysis of four separate experiments is given in Fig. 2B, where the levels of elastin mRNA are quantitated to verify the consistency of cell behavior. The results demonstrate that elastin mRNA levels began to increase between days 3 and 4, concomitant with a rapid decline in histone mRNA levels. At this stage, the cells are physically in contact with one another. However, the major burst of elastin mRNA occurred between days 5 and 6, followed by a sustained high level of expression. These results suggest that withdrawal from the cell cycle, as measured by histone mRNA levels, is not a de facto trigger for the increase in elastin mRNA levels but that cell-cell and/or cell-matrix contacts may be important for attaining and sustaining high levels of elastin gene expression.



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 2. Northern blot and nuclear run-on of rat pulmonary fibroblasts in culture. A: total RNA was extracted from pulmonary fibroblasts from 2 to 8 days after seeding in culture and Northern blot analysis was performed on 20 µg of total RNA and probed with 32P-labeled cDNA for elastin and histone. rRNA was stained with methylene blue to show gel loading. B: the results from 4 separate experiments were quantitated by laser densitometer and plotted against days after seeding. Values are means ± SD. C: nuclei were isolated from 2- and 8-day cell cultures of pulmonary fibroblasts and nuclear run-on assay performed in the presence of [32P]UTP for 20 min. The 32P-labeled transcripts were hybridized to histone, elastin, and pBluescript DNA.

 

To determine the level at which the major increase in elastin mRNA is controlled, we performed nuclear run-on assays. Results shown in Fig. 2C demonstrate that the level of elastin gene transcription was significant after 8 days of culturing. It should be noted that in three separate experiments the transcriptional level of the elastin gene was very low between days 2 and 4, suggesting that the initial increase in elastin mRNA is controlled at a posttranscriptional level. Alternatively, a low level of elastin gene transcription between days 2 and 4 may be below detection by nuclear run-on analysis. Although the level of histone 3.2 transcription decreased between the samples examined, this decrease was not comparable with that found for the mRNA levels (see Fig. 2A). This finding is consistent with the report that histone 3.2 mRNA is regulated primarily at the posttranscriptional level (16).

Overall these results show that elastin mRNA levels in primary cultures of pulmonary fibroblasts are increased after cells withdraw from the cell cycle and that this increase is controlled largely at the transcriptional level. Because the major burst of elastin mRNA occurs several days after cell proliferation ceases, factors other than cell cycle proteins appear to contribute to the activation of elastin gene transcription (19).

Brief elastase treatment of confluent, matrix-laden pulmonary fibroblast culture results in the upregulation of elastin mRNA that is accompanied by increased elastin gene transcription. The data presented above show that maximal elastin gene expression in pulmonary fibroblasts is achieved after 5–6 days in culture. The work of our group and others have shown that pulmonary fibroblasts require an additional 7–14 days for significant accumulation of insoluble elastin in the extracellular matrix (14, 30, 41) as well as proteoglycans and growth factors (4, 5, 34). Within these experiments, the amount of insoluble elastin ranged from 15 to 32 µg/75-cm2 flask.

The next series of experiments were designed to study the effect of elastase treatment on 14- to 17-day fibroblast cultures containing detectable amounts of alkali-resistant, insoluble elastin (14, 30, 41). Two experimental conditions were used for these studies that involved either removal or retention of the elastase-released products within each culture flask. Figure 3A presents Northern blot analyses of elastin and histone mRNA levels after elastase treatment where elastase released products were either removed (fresh medium) or retained (retained medium), and the results were compared with mock-treated cell cultures (control). The results are interesting from several aspects. First, elastase treatment results in an initial decrease in elastin mRNA levels (30 ± 10%) followed by a gradual increase that eventually exceeds the initial level. This increase in elastin mRNA occurred regardless of retention or removal of elastase-released products. Retention of elastase products consistently showed a greater decrease in elastin mRNA and may reflect the inhibitory effect of released bFGF on cells that were not affected by the brief elastase treatment since the proteolytic damage is not uniform (34). The amount of bFGF released by elastase treatment was calculated to be in the range of 35–40 pg/ml. Mock-treated cell cultures exhibited no change in elastin or histone mRNA levels, which obviates any concern due to culture conditions. Morphological examination of the cell cultures after elastase treatment revealed a definite disruption of cell and matrix interactions as shown by rounding of some cells adjacent to elastase exposure and a clearing of matrix near the proteolytic damage (14). The decrease in elastin mRNA levels at 24 h coincides with a recovery period where some cells re-attach to the matrix and a low level of cell proliferation occurs as shown by small induction of histone mRNA. These events are followed by an increase in elastin mRNA levels. The results suggest that one of the major effects of elastase treatment is to release cells from contact inhibition, therefore reinitiating elastin gene expression.



View larger version (65K):
[in this window]
[in a new window]
 
Fig. 3. Northern blot and nuclear run-on analysis of 14-day rat pulmonary fibroblasts cultures treated with elastase. A: total RNA was extracted from 14-day pulmonary fibroblast cultures treated with elastase at designated times after elastase treatment. Three conditions are given: 1) fresh medium, where elastase products were removed and cultures were given fresh medium; retained medium, where elastase products were added along with fresh medium (see MATERIALS AND METHODS); and 3) control, where cells were treated with buffer, and fresh medium was added. The Northern blot analysis was performed on 20 µg of total RNA and probed with elastin and histone cDNAs. rRNA was stained with methylene blue. B: nuclei were isolated from 14-day rat pulmonary fibroblasts cultures after treatment with elastase at the indicated times. Elastase-released products were retained in the medium after treatment. A nuclear run-on assay was performed, and the 32P-labeled transcripts were hybridized to actin, histone, elastin, and pBluescript cDNAs.

 

Nuclear run-on analysis was performed to determine whether the increase in elastin mRNA seen after elastase treatment is controlled at the transcriptional level. Elastase-released products were retained in the medium after treatment. Results presented in Fig. 3B show that elastin gene transcription levels dropped to barely detectable levels within the first 2 days after elastase treatment and then returned to the initial levels. This finding is consistent with the changes observed in the elastin mRNA levels after elastase treatment.

Overall these results show that elastin gene expression increased 48–72 h after elastase treatment and that this increase is due, in part, to transcription. The fact that elastase treatment induces cell proliferation is consistent with other models of repair responses where cell migration and proliferation precede the initiation of new matrix synthesis (24, 43).

Elastin mRNA and elastin gene promoter activity levels are increased after intratracheal administration of elastase to mice. Animal experiments were designed to examine the effect of intratracheal administration of elastase on elastin mRNA in lungs of female FVB mice. Figure 4, A and B, shows photomicrographs of the light and dark field, respectively, of a representative section of lung tissue obtained 4 days after mice were given 10 µg of pancreatic elastase. Calculations of mean linear intercept values for each individual microscopic field show that 15% of the fields in the elastase-treated mice had mean linear intercept values that were 2 SD higher than that for control animals, indicating enlargement of air spaces in elastase-treated animals. In situ hybridization with elastin riboprobe demonstrates that elastin mRNA levels are increased in cells directly adjacent to the elastase injury and establishes that elastogenesis is an initial response to elastase injury in vivo.



View larger version (103K):
[in this window]
[in a new window]
 
Fig. 4. Photomicrographs of the lung parenchyma of a mouse treated 4 days earlier with 10 µg of porcine pancreatic elastase. A: Verhoeff's-van Gieson-stained lung field with enlarged emphysematous spaces surrounded by normal-looking parenchyma. B: dark-field image of a neighboring serial section showing masses of silver grains (bright white) over tissue that expresses elastin mRNA. The cells/tissue that show the high elastin mRNA content are found in the area of the porcine pancreatic elastase injury.

 

The next set of experiments were designed to examine the response of the elastin gene promoter to elastase administration using FVB mice carrying the elastin promoter/reporter transgene. Three separate transgenic mouse lines originating from independent founders were generated with transgene copy numbers in the range of 3–5, 5–10, and 30–40 copies, as measured by Southern blot analysis. Organ-specific expression of elastin gene promoter activity was measured by CAT activity in 3- and 7-day-old mice. A representative assay of tissues isolated from skin, lung, kidney, and brain is presented in Fig. 5. These results show that the 2.2-kb elastin promoter fragment CAT activity was similar to that reported by Hsu-Wong et al. (18) for 5.2-kb elastin promoter transgene. The data further point out that elastin promoter activity in the lung is very high during the period corresponding to lung alveolarization where elastin gene expression is prominent as defined by mRNA levels (3). Three different transgenic mouse lines presented essentially the same pattern of CAT activity, which was linear with the copy number of the transgene (data not shown). To show that the CAT activity measured in tissue was reflective of endogenous elastin gene expression, we isolated pulmonary lung fibroblasts from neonatal transgenic mice and compared the level of elastin mRNA levels and CAT activity. Figure 5B provides both a Northern blot and CAT assay performed on 6-day-old mouse pulmonary fibroblasts maintained in either 10 or 0.5% serum. The results show the CAT activity mirrors the levels of elastin mRNA.



View larger version (50K):
[in this window]
[in a new window]
 
Fig. 5. Expression of human elastin promoter in transgenic mice as determined by CAT activity. A: different tissues were dissected from 3- and 7-day-old transgenic mice, and CAT activity was determined by the incubation of tissue extracts containing the same amount (100 µg) of protein with [14C]chloramphenicol. The samples were spotted on a thin-layer chromatography plate and visualized by autoradiography. The control sample is with CAT enzyme. B: Northern blot and CAT assay were performed on 6-day-old mouse pulmonary fibroblasts maintained in either 10 or 0.5% serum.

 

To examine the response of elastin gene promoter activity to lung injury, we instilled 10 µg of pancreatic elastase intratracheally to adult transgenic mice and analyzed lungs 3 and 14 days after treatment. Mean linear intercept values showed 21 and 60% increase at days 3 and 14, respectively. Figure 6 provides a summary of two separate experiments where elastin mRNA levels and CAT activity were determined from whole lung samples. It should be pointed out that the CAT activity measured in the control (saline-treated) lung tissue was 2.5% of that found in the tissue isolated from 3-day-old mice. A major increase in the level of elastin mRNA was seen 3 days after elastase treatment, and significantly, this increase was accompanied by increased elastin gene promoter activity. After 14 days, elastin mRNA remained elevated but at lower levels, whereas elastin promoter activity continued at the same elevated level. This latter finding is very interesting, since it shows that, although both elastin promoter activity and elastin mRNA are increased and remain elevated after elastase exposure, the two measurements of elastin gene expression do not parallel one another. These data suggest that posttranscriptional, as well as transcriptional, mechanisms may play a role in the elastogenic response to elastase injury. This observation is consistent with proposed developmental mechanisms regulating lung elastin gene expression (29).



View larger version (42K):
[in this window]
[in a new window]
 
Fig. 6. Comparison of elastin mRNA and CAT activity in transgenic mice treated with elastase or saline. Lungs from 4-mo-old transgenic mice were isolated at 3 days and 2 wk after instillation of elastase (3 and 14 elastase) or saline (3 and 14 control) into the lungs. The control for these experiments was the lung tissue isolated from transgenic mice that were instilled with saline. Total RNA for Northern blot analysis and protein for CAT activity were extracted. The results from 2 separate experiments were quantitated by laser densitometer. Values are the means from the 2 experiments with 3 mice per condition.

 

To localize the cells exhibiting increased elastin promoter activity after elastase treatment, we treated an additional group of transgenic mice with an intratracheal dose of elastase (10 µg/mouse) or saline solution (as control) as described above. Five days later the mice were killed, the lungs were fixed, and sections were prepared for immunohistochemistry. Figure 7 provides a panel of sections where the localization of antibody to CAT protein in elastase-treated lung (Fig. 7A) and saline-treated lung (Fig. 7B) is compared with the light fields of the same sections (Fig. 7, C and D, respectively). Results show that CAT protein localization in the tissue sections from elastase-treated lungs (Fig. 7D) appeared in areas associated with obvious tissue damage similar to the spatial location of elastase-induced levels of elastin transcript (see Fig. 4).



View larger version (76K):
[in this window]
[in a new window]
 
Fig. 7. Immunofluorescent localization of CAT protein on elastase-treated and control transgenic mice. Transgenic mice carrying the 2.2-kb human elastin gene promoter/CAT reporter transgene were treated with an intratracheal dose of pancreatic elastase (10 µg) or saline solution (control). Five days after treatment, mice were killed and tissue was fixed as described. Sections were incubated with CAT antibody. B (control) and D (elastase treated) show immunofluorescence associated with CAT protein. A (control) and C (elastase treated) show the light fields of the same sections.

 


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Investigations into the response of lung elastin gene expression to elastolytic activity are important to our understanding of the development and progression of pulmonary emphysema. Available animal models for elastase injury rely on a single, exogenous dose of active elastolytic enzymes (39) or acute exposure to cigarette smoke (17) to produce enlargement of respiratory spaces with destruction of alveolar walls. The results of these models have provided valuable information concerning elastogenic responses to injury (26, 39) and potential cellular sources of elastase activity (17). However, human emphysema is characterized as a COPD and as such develops over a long period of time. The human disease is diagnosed in its terminal stages by clinical manifestations of compromised respiratory function. Tissue samples obtained at autopsy provide little information regarding early events precipitating the pathogenesis. There are no means available to study tissues from individuals exposed to conditions known to cause COPD, yet there are those who do not develop the disease. Experimentally, it is difficult to design whole animal experiments that involve a repetitive exposure to chemical or biological agents leading to elastolytic activity that mimic events accompanying development or protection from the human disease.

We have previously proposed that a "normal" repair of proteolytic damage to interstitial lung elastin exists and is accompanied by an upregulation of elastin gene expression in the localized area of elastin damage (34). A breakdown in this homeostatic condition might occur in chronic exposure to elastolytic enzymes, where a wide spectrum of active proteolytic enzymes released from damaged matrix and apoptotic cells exacerbate the situation. These events can destroy the structural integrity of the airway network, causing depletion and/or dissociation of elastogenic cells from important matrix signals that initiate the repair process. As a model to understand the mechanisms underlying "normal" responses of elastogenic cells to elastase exposure, we have utilized pulmonary fibroblasts cultures that produce a significant matrix containing insoluble, cross-linked elastin (6) as well as matrix-bound growth factors (4, 34). This model allows controlled exposure to elastase and an opportunity to investigate the specific cellular responses to proteolytic damage and ligands released by elastase treatment. In the present study we focused on determining the level at which elastin expression is upregulated after elastase exposure (14). The results are significant from several aspects. First, the results demonstrate that upregulation of elastin gene expression after elastase injury is associated with an increase in the level of transcription both in vitro and in vivo. Others have proposed that elastin gene expression is regulated at the posttranscriptional level after maturity (42). Mauviel et al. (28) demonstrated transcriptional regulation in lung fibroblasts from transgenic mice containing the 5.2-kb elastin transgene with human recombinant IL-1. It now appears that elastin regulation is complex and involves multiple levels of regulation whose individual contribution may be independent of age but rather dependent on specific circumstances surrounding tissue damage or exposure to various ligands. Second, the fact that the cell system mimics events observed within whole lung tissue affords investigators the opportunity to use the cell model for dissection of the molecular mechanism regulating elastin upregulation. For example, we previously showed that bFGF, a major growth factor released by elastase treatment of pulmonary fibroblasts (34), affects proliferating and confluent pulmonary fi-broblast cultures differently in terms of the duration of MAPK activation and the impact on elastin gene expression (7). The differential effects of bFGF on proliferating vs. confluent cells could result from differences in the level of heparan sulfate proteoglycans that can bind bFGF. Indeed, we have recently observed a dramatic increase (approximately twofold) in the level of elastase releasable bFGF that is stored within the extracellular matrix of these cultures from days 4–8 (5). Thus at confluence the cells and their corresponding matrix may be positioned to bind and sequester bFGF, leading to distinctly different kinetics of cell stimulation. Interestingly, elastase treatment causes a dramatic decrease in the heparan sulfate levels and bFGF binding to confluent pulmonary cells without dramatically altering FGF receptor levels (4). Hence, cells after elastase treatment and at subconfluence with limited and/or damaged extracellular matrix might be tuned to respond to the proliferative effects of bFGF. These latter results, in combination with data from the current study, suggest that bFGF may be an important ligand in initiating cell proliferation after elastase treatment similar to a situation described in pulmonary artery smooth muscle cell cultures (43). Future studies will address the role of bFGF in elastase-treated cultures in an attempt to understand the role that this growth factor plays in controlling repair mechanisms in the fibroblast cultures.

The results from this study show that the increase in elastin mRNA levels following elastase treatment is accompanied by an increase in elastin gene transcription. Currently, very little information is available on how elastin gene transcription is increased. The majority of published studies on specific cis-acting elements and cognizant trans-acting factors have focused on the downregulation of transcriptional levels (2, 21, 23, 28, 32, 34). On the other hand, only two cis-acting elements within the elastin gene promoter have been shown to convey increases in transcriptional initiation. These include a Sp1/Sp3 sequence in the proximal promoter region that possesses similarities to a retinoblastoma element sequence (8) and an NF1 sequence located in the distal promoter region (10). The former site controls upregulation by insulin-like growth factor I in aortic smooth muscle cells through a mechanism of derepression (8, 20). The latter site appears to control the level of elastin gene transcription via the binding of different NF1 family members, although specific factors regulating the differential binding of family members in elastogenic cells is unknown (10). It is interesting to point out that a recent report by Rafty and Khachigian (31) demonstrates that there is cross talk between NF1 and Sp1 factors. Future studies will focus on determining the possible involvement of these two sites in regulating elastin gene transcriptional responses to elastase injury.

In conclusion, the data presented in this study demonstrate that transcription plays a major role in the response of elastin gene expression to elastase exposure both in vitro and in vivo. Furthermore, the similarity between cell culture and lung tissue responses to elastase treatment supports the use of cell cultures to dissect molecular events accompanying in vivo conditions.


    ACKNOWLEDGMENTS
 
The authors acknowledge the superb technical assistance of Valerie Verbitzki for isolating and maintaining pulmonary fibroblasts.

DISCLOSURES

This work was supported by National Heart, Lung, and Blood Institute Grant HL-46902.


    FOOTNOTES
 

Address for reprint requests and other correspondence: J. A. Foster, Dept. of Biochemistry, Boston Univ. School of Medicine, 80 E. Concord St., Boston, MA 02118 (E-mail: jfoster{at}biochem.bumc.bu.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Albin RJ, Senior RM, Welgus HG, Connolly NL, and Campbell EJ. Metalloproteinase elastase inhibition by human alveolar macrophages. In: Pulmonary Emphysema and Proteolysis. Part V, edited by Taylor JC and Mittman C. Orlando, FL: Academic, 1986, p. 283–288.
  2. Brettell LM and McGowan SE. Basic fibroblast growth factor decreases elastin production by neonatal rat lung fibroblasts. Am J Respir Cell Mol Biol 10: 306–315, 1994.[Abstract]
  3. Bruce MC. Developmental changes in tropoelastin mRNA levels in rat lung: evaluation by in situ hybridization. Am J Respir Cell Mol Biol 5: 344–350, 1991.[ISI][Medline]
  4. Buczek-Thomas J and Nugent MA. Elastase-mediated release of heparan sulfate proteoglycans from pulmonary fibroblast cultures. A mechanism for basic fibroblast growth factor (bFGF) release and attenuation of bFGF binding following elastase-induced injury. J Biol Chem 274: 25167–25172, 1999.[Abstract/Free Full Text]
  5. Buczek-Thomas JA, Chu CL, Rich CB, Stone PJ, Foster JA, and Nugent MA. Heparan sulfate depletion within pulmonary fibroblasts: implications for elastogenesis and repair. J Cell Physiol 192: 294–303, 2002.[ISI][Medline]
  6. Campagnone R, Regan J, Rich CB, Miller M, Keene DR, Sakai L, and Foster JA. Pulmonary fibroblasts: a model system for studying elastin synthesis. Lab Invest 56: 224–230, 1987.[ISI]
  7. Carreras I, Rich CB, Jaworski JA, Dicamillo SJ, Panchenko MP, Goldstein R, and Foster JA. Functional components of basic fibroblast growth factor signaling that inhibit lung elastin gene expression. Am J Physiol Lung Cell Mol Physiol 281: L766–L775, 2001.[Abstract/Free Full Text]
  8. Conn KJ, Rich CB, Jensen DE, Fontanilla MR, Bashir MM, Rosenbloom J, and Foster JA. Insulin-like growth factor-I regulates transcription of the elastin gene through a putative retinoblastoma control element. A role for Sp3 acting as a repressor of elastin gene transcription. J Biol Chem 271: 28853–28860, 1996.[Abstract/Free Full Text]
  9. Dean M, Levine RA, and Campisi J. c-myc regulation during retinoic acid-induced differentiation of F9 cells is posttranscriptional and associated with growth arrest. Mol Cell Biol 6: 518–524, 1986.[Abstract/Free Full Text]
  10. Degterev A and Foster JA. The role of NF-1 factors in regulation of elastin gene transcription. Matrix Biol 18: 295–307, 1999.[ISI][Medline]
  11. DiCamillo SJ, Carreras I, Panchenko MV, Stone PJ, Nugent MA, Foster JA, and Panchenko MP. Elastase-released epidermal growth factor recruits epidermal growth factor receptor and extracellular signal-regulated kinases to down-regulate tropoelastin mRNA in lung fibroblasts. J Biol Chem 277: 18938–18946, 2002.[Abstract/Free Full Text]
  12. Donoghue M, Heidemarie D, Wentworth B, Nadal-Ginard B, and Rosenthal N. A muscle specific enhancer is located at the 3' end of the myosin light chain 1/3 locus. Genes Dev 2: 1779–1790, 1988.[Abstract/Free Full Text]
  13. Dunnill MS. Quantitative methods in the study of pulmonary pathology. Thorax 17: 320–328, 1962.
  14. Foster JA, Rich CB, and Miller MF. Pulmonary fibroblasts: an in vitro model of emphysema. Regulation of elastin gene expression. J Biol Chem 265: 15544–15551, 1990.[Abstract/Free Full Text]
  15. Grushkin-Lerner LS and Trinkaus-Randall V. Localization of integrin and syndecan in vivo in a corneal epithelial abrasion and keratectomy. Curr Eye Res 10: 75–85, 1991.[Medline]
  16. Harris ME, Bohni R, Schneiderman MH, Ramamurthy L, Schumperli D, and Marzluff WF. Regulation of histone mRNA in the unperturbed cell cycle: evidence suggesting control at two posttranscriptional steps. Mol Cell Biol 11: 2416–2424, 1991.[Abstract/Free Full Text]
  17. Hautamaki RD, Kobayashi DK, Senior RM, and Shapiro SD. Requirement for macrophage elastase for cigarette smoke-induced emphysema in mice. Science 277: 2002–2004, 1997.[Abstract/Free Full Text]
  18. Hsu-Wong S, Katchman SD, Ledo I, Wu M, Khillan J, Bashir MM, Rosenbloom J, and Uitto J. Tissue-specific and developmentally regulated expression of human elastin promoter activity in transgenic mice. J Biol Chem 269: 18072–18075, 1994.[Abstract/Free Full Text]
  19. James MF, Rich CB, Trinkhaus-Randall V, Rosenbloom J, and Foster JA. Elastogenesis in the developing chick lung is transcriptionally regulated. Dev Dyn 213: 170–181, 1998.[ISI][Medline]
  20. Jensen DE, Rich CB, Terpestra A, Farmer SR, and Foster JA. Transcriptional regulation of the elastin gene by insulin-like growth factor-I involves disruption of Sp1 binding. Evidence for the role of Rb in mediating Sp1 binding in aortic smooth muscle cells. J Biol Chem 270: 6555–6563, 1995.[Abstract/Free Full Text]
  21. Kahari VM, Chen YQ, Bashir MM, Rosenbloom J, and Uitto J. Tumor necrosis factor-alpha down-regulates human elastin gene expression. Evidence for the role of AP-1 in the suppression of promoter activity. J Biol Chem 267: 26134–26141, 1992.[Abstract/Free Full Text]
  22. Kasahara Y, Tuder RM, Taraseviciene-Stewart L, Le Cras TD, Abman S, Hirth PK, Waltenberger J, and Voelkel NF. Inhibition of VEGF receptors causes lung cell apoptosis and emphysema. J Clin Invest 106: 1311–1319, 2000.[ISI][Medline]
  23. Kuang PP, Berk JL, Rishikof DC, Foster JA, Humphries DE, Ricupero DA, and Goldstein RH. NF-kappaB induced by IL-1beta inhibits elastin transcription and myofibroblast pheno-type. Am J Physiol Cell Physiol 283: C58–C65, 2002.[Abstract/Free Full Text]
  24. Kypreos KE, Nugent MA, and Sonenshein GE. Basic fibroblast growth factor-induced decrease in type I collagen gene transcription is mediated by B-myb. Cell Growth Differ 9: 723–730, 1998.[Abstract]
  25. Lansing AI, Rosenthal TB, Alex M, and Dempsey EW. The structure and characterization of elastic fibers as revealed by elastase and electron microscopy. Anat Rec 114: 555–570, 1952.[Medline]
  26. Lucey EC, Goldstein RH, Stone PJ, and Snider GL. Remodeling of alveolar walls after elastase treatment of hamsters. Results of elastin and collagen mRNA in situ hybridization. Am J Respir Crit Care Med 158: 555–564, 1998.[Abstract/Free Full Text]
  27. Lucey EC, Keane J, Kuang PP, Snider GL, and Goldstein RH. Severity of elastase-induced emphysema is decreased in tumor necrosis factor-alpha and interleukin-1beta receptor-deficient mice. Lab Invest 82: 79–85, 2002.[ISI]
  28. Mauviel A, Chen YQ, Kahari VM, Ledo I, Wu M, Rudnicka L, and Uitto J. Human recombinant interleukin-1 beta upregulates elastin gene expression in dermal fibroblasts. Evidence for transcriptional regulation in vitro and in vivo. J Biol Chem 268: 6520–6524, 1993.[Abstract/Free Full Text]
  29. McGowan SE, Jackson SK, Olson PJ, Parekh T, and Gold LI. Exogenous and endogenous transforming growth factors-beta influence elastin gene expression in cultured lung fibroblasts. Am J Respir Cell Mol Biol 17: 25–35, 1997.[Abstract/Free Full Text]
  30. Morris SM, Thomas KM, Rich CB, and Stone PJ. Degradation and repair of elastic fibers in rat lung interstitial fibroblast cultures. Anat Rec 250: 397–407, 1998.[Medline]
  31. Rafty LA and Khachigian LM. Von Hippel-Lindau tumor suppressor protein represses platelet-derived growth factor B-chain gene expression via the Sp1 binding element in the proximal PDGF-B promoter. J Cell Biochem 85: 490–495, 2002.[ISI][Medline]
  32. Rich CB, Fontanilla MR, Nugent M, and Foster JA. Basic fibroblast growth factor decreases elastin gene transcription through an AP1/CRE hybrid site in the distal promoter. J Biol Chem 274: 33433–33439, 1999.[Abstract/Free Full Text]
  33. Rich CB and Foster JA. Characterization of rat heart tropoelastin. Arch Biochem Biophys 268: 551–558, 1989.[ISI][Medline]
  34. Rich CB, Nugent MA, Stone P, and Foster JA. Elastase release of basic fibroblast growth factor in pulmonary fibroblast cultures results in down-regulation of elastin gene transcription. A role for basic fibroblast growth factor in regulating lung repair. J Biol Chem 271: 23043–23048, 1996.[Abstract/Free Full Text]
  35. Sambrook J, Fritsche EF, and Maniatis T. Molecular Cloning: A Laboratory Manual (2nd ed.). Cold Spring Harbor, NY: Cold Springs Harbor Laboratory, p. 42–43, 1989.
  36. Sandhaus RA. Elastase may play a central role in neutrophil migration through connective tissue. In: Pulmonary Emphysema and Proteolysis: Part IV, edited by Tayor JC and Mittman C. Orlando, FL: Academic, 1986, p. 227–233.
  37. Shi SR, Chaiwun B, Young L, Cote RJ, and Taylor CR. Antigen retrieval technique utilizing citrate buffer or urea solution for immunohistochemical demonstration of androgen receptor in formalin-fixed paraffin sections. J Histochem Cytochem 41: 1599–1604, 1993.[Abstract]
  38. Snider GL, Ciccolella DE, Morris SM, Stone PJ, and Lucey EC. Putative role of neutrophil elastase in the pathogenesis of emphysema. Ann NY Acad Sci 624: 45–59, 1991.[Abstract]
  39. Snider GL, Lucey EC, and Stone PJ. Animal models of emphysema. Am Rev Respir Dis 133: 149–169, 1986.[ISI][Medline]
  40. Starcher BC and Galione MJ. Purification and comparison of elastins from different animal species. Anal Biochem 74: 441–447, 1976.[ISI][Medline]
  41. Stone PJ, Morris SM, Thomas KM, Schuhwerk K, and Mitchelson A. Repair of elastase-digested elastic fibers in acellular matrices by replating with neonatal rat lung lipid interstitial fibroblasts or other elastogenic cell types. Am J Respir Cell Mol Biol 17: 289–301, 1997.[Abstract/Free Full Text]
  42. Swee MH, Parks WC, and Pierce RA. Developmental regulation of elastin production. Expression of tropoelastin pre-mRNA persists after down-regulation of steady-state mRNA levels. J Biol Chem 270: 14899–14906, 1995.[Abstract/Free Full Text]
  43. Thompson K and Rabinovitch M. Exogenous leukocyte and endogenous elastases can mediate mitogenic activity in pulmonary artery smooth muscle cells by release of extracellular-matrix bound basic fibroblast growth factor. J Cell Physiol 166: 495–505, 1996.[ISI][Medline]
  44. Wolfe LB, Rich CB, Goud HD, Terpstra AJ, Bashir M, Rosenbloom J, Sonenshein GE, and Foster JA. Insulin-like growth factor-I regulates transcription of the elastin gene. J Biol Chem 268: 12418–12426, 1993.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
P.-P. Kuang, X.-H. Zhang, C. B. Rich, J. A. Foster, M. Subramanian, and R. H. Goldstein
Activation of elastin transcription by transforming growth factor-beta in human lung fibroblasts
Am J Physiol Lung Cell Mol Physiol, April 1, 2007; 292(4): L944 - L952.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. J. DiCamillo, S. Yang, M. V. Panchenko, P. A. Toselli, E. F. Naggar, C. B. Rich, P. J. Stone, M. A. Nugent, and M. P. Panchenko
Neutrophil elastase-initiated EGFR/MEK/ERK signaling counteracts stabilizing effect of autocrine TGF-beta on tropoelastin mRNA in lung fibroblasts
Am J Physiol Lung Cell Mol Physiol, August 1, 2006; 291(2): L232 - L243.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
J. A. Buczek-Thomas, E. C. Lucey, P. J. Stone, C. L. Chu, C. B. Rich, I. Carreras, R. H. Goldstein, J. A. Foster, and M. A. Nugent
Elastase Mediates the Release of Growth Factors from Lung In Vivo
Am. J. Respir. Cell Mol. Biol., September 1, 2004; 31(3): 344 - 350.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
J. Liu, C. B. Rich, J. A. Buczek-Thomas, M. A. Nugent, M. P. Panchenko, and J. A. Foster
Heparin-binding EGF-like growth factor regulates elastin and FGF-2 expression in pulmonary fibroblasts
Am J Physiol Lung Cell Mol Physiol, November 1, 2003; 285(5): L1106 - L1115.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/2/L354    most recent
00026.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rich, C. B.
Right arrow Articles by Foster, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rich, C. B.
Right arrow Articles by Foster, J. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2003 by the American Physiological Society.