AJP - Lung Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 285: L405-L414, 2003. First published April 18, 2003; doi:10.1152/ajplung.00249.2002
1040-0605/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/2/L405    most recent
00249.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Foster, J. E.
Right arrow Articles by Tesfaigzi, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Foster, J. E.
Right arrow Articles by Tesfaigzi, Y.

LPS-induced neutrophilic inflammation and Bcl-2 expression in metaplastic mucous cells

Jennifer E. Foster,1 Katherine Gott,2 Mark R. Schuyler,2 Wieslaw Kozak,3 and Yohannes Tesfaigzi1

1Lovelace Respiratory Research Institute; 2University of New Mexico School of Medicine, and Veterans Administration Medical Center, Albuquerque, New Mexico 87108; 3Medical College of Georgia, Augusta, Georgia 30912; and Nicolaus Copernicus University, 87-100 Torun, Poland

Submitted 26 September 2002 ; accepted in final form 7 April 2003


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Our previous studies show that Bcl-2, a regulator of apoptosis, may be involved in the reduction of mucous cell metaplasia (MCM) during recovery from inflammatory responses. The present study was to determine whether neutrophilic inflammation mediates Bcl-2 expression in mucous cells. Rats were intratracheally instilled with 50–1,000 µg of LPS. The number of neutrophils recovered by bronchoalveolar lavage (BAL) increased with the dose of LPS, and the percentage of Bcl-2-expressing cells increased with the numbers of neutrophils in the BAL. Depletion of neutrophils did not reduce MCM, but the percentage of Bcl-2-positive cells increased 1.8-fold in neutrophil-depleted compared with controls. Injection of rats with bezafibrate, an inducer of cytochrome P-450, doubled the number of neutrophils in the BAL, decreased MCM twofold compared with vehicle-injected controls, and reduced Bcl-2 expression. Bcl-2 mRNA levels decreased in a tracheal epithelial cell line treated with bezafibrate. These data demonstrate that Bcl-2 expression is independent of the number of neutrophils in the BAL and that bezafibrate may directly reduce Bcl-2 expression in epithelial cells.

airway epithelium; bezafibrate; apoptosis; lavaged cells; cytokines


MUCOUS CELLS PROTECT the airway epithelium by secreting mucins and forming a mucous layer that traps foreign particles and allows their removal by ciliary action. Exposure of the lung to harmful substances, such as bacteria, induces acute lung inflammation characterized by infiltration of the lung with neutrophils and macrophages (25, 28, 36). This inflammatory response is followed by epithelial cell proliferation (8), mucin biosynthesis (12, 20), and increases in the numbers of mucus secretory cells (9, 21, 33). The increase of mucous cell numbers in areas that are normally devoid of these cells is termed mucous cell metaplasia (MCM).

Exposure to lipopolysaccharides (LPS), a component of the gram-negative bacterial cell wall, causes inflammatory cells to secrete a number of proteins, including TNF-{alpha}, IL-1{beta}, IL-6, and proteases that promote the differentiation of proliferating and preexisting epithelial cells into mucous cells by inducing mucin biosynthesis (23, 32, 40). In the absence of further insult, inflammation is cleared, and mucous cell numbers are reduced by programmed cell death (29, 38). Disruption of these recovery processes may cause persistently elevated mucous cell numbers and contribute to mucous hypersecretion and airway obstruction as in chronic lung disease, such as cystic fibrosis or chronic bronchitis (13, 18, 21).

Bcl-2 and related proteins affect the process of apoptosis by regulating the release of cytochrome c from mitochondria (7). Members of this family of proteins have either pro- or antiapoptotic functions, and the ratio between these two subsets determines the susceptibility of cells to a death signal (7, 27). Bcl-2 enhances cell survival by inhibiting apoptosis induced in different cell types and in response to different stimuli; this suggests that Bcl-2 acts at a central control point in the pathway to apoptotic cell death (1, 34).

Our previous studies demonstrate that metaplastic mucous cells induced in rat lung airways by ozone, allergen, or LPS exposure express Bcl-2 regardless of airway location (35). The disappearance of Bcl-2 precedes the disappearance of mucous cells, suggesting that Bcl-2 plays a role in the maintenance of MCM (38). The present study was designed to investigate whether LPS-induced neutrophilic inflammation and the appearance of MCM are always associated with Bcl-2 expression. Initially, we examined the role of the intensity of inflammation on Bcl-2 expression by instillation of various doses of LPS. Subsequently, the LPS-induced neutrophilic response associated with the highest percentage of Bcl-2 positivity was modulated by injecting either bezafibrate, an inducer of cytochrome P-450, or antibodies to neutrophils. In an attempt to study the anti-inflammatory nature of bezafibrate (17), we had observed that it increased the number of neutrophils in the bronchoalveolar lavage (BAL) of LPS-instilled rats. On the basis of this observation, we used this agent to study the role of increased neutrophils in the BAL on Bcl-2 expression in metaplastic mucous cells. Results show that MCM can persist after Bcl-2 expression is downregulated, that high doses of LPS are required to induce Bcl-2 in metaplastic mucous cells at 3 days postinstillation, and that the percentage of Bcl-2-positive mucous cells is independent from the number of neutrophils in the BAL. Together, these studies show that Bcl-2 expression in mucous cells may be mediated by inflammatory factors independent of the mediators causing MCM. Bezafibrate, but not LPS, reduced Bcl-2 mRNA levels in the rat airway epithelial cell line SPOC-1 by approximately one-half compared with vehicle-treated controls, suggesting that bezafibrate may also directly affect Bcl-2 expression.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Animals. Male pathogen-free F344/N rats (Frederick Cancer Research, Frederick, MD) and male Brown Norway rats (Charles River Laboratories, Wilmington, MA), 8–10 wk of age, were used in this study. The rats were housed in pairs and were provided food and water ad libitum, a 12:12-h light/dark cycle at 22.2°C, and 30–40% humidity. Rats were weighed and randomly assigned to each experimental group. All experiments were approved by the Lovelace Respiratory Research Institute Institutional Animal Care and Use Committee and were carried out at the Institute, a facility approved by the Association for the Assessment and Accreditation for Laboratory Animal Care International.

LPS instillation and BAL. Rats were briefly anesthetized with 5% halothane in oxygen and nitrous oxide and instilled intratracheally once with 50, 100, 250, 500, or 1,000 µg of LPS [Pseudomonas aeruginosa serotype 10, lot 99H4059, 900,000 endotoxin units (EU)/mg; Sigma, St. Louis, MO] in 0.5 ml of 0.9% pyrogen-free saline solution. Control rats were not instilled or were instilled with 0.5 ml of 0.9% pyrogen-free saline. Rats were killed 2, 3, or 4 days postinstillation with an injection of pentobarbital sodium and exsanguinated through the renal artery. The trachea was cannulated with an 18-gauge blunt needle tipped with surgical tubing. The lungs were removed from the rats and lavaged three times with 5 ml of Ham's F-12 media (Hyclone, Logan, UT) before perfusion with 10% zinc formalin under a constant pressure of 25 cmH2O for 2 h. BAL samples were centrifuged to remove inflammatory cells and stored in 0.2-ml aliquots at -80°C until further use.

Analysis of BAL. LPS levels in the BAL fluid (BALF) were determined with the QCL-1000 Limulus Amoebocyte Lysate assay (BioWhittaker, Walkersville, MD) according to the manufacturer's directions and were expressed as a function of EU/ml. Cells from each BAL were counted on a hemacytometer; cytological preparations were stained with Wright-Giemsa (American Scientific Products, McGaw Park, IL) to quantify the percentages of inflammatory cell types present. Levels of rat TNF-{alpha} and IL-6 were determined with the DuoSet ELISA development system, and IL-1{beta} levels were determined with the Quantikine M Immunoassay kit according to the manufacturer's directions (both from R&D Systems, Minneapolis, MN).

Histopathology. The intrapulmonary airways of the left lung lobe from each animal were microdissected according to a modified version of a previously described procedure (9). Microdissection was performed under a high-resolution dissecting microscope (dual-viewing Wild M-8 stereomicroscope; Wild-Heerbrugg, Heerbrugg, Switzerland). Beginning at the lobar bronchus, the airways were split down the long axis of the axial pathway through the 11th airway generation. Three-millimeter-thick lung slices at the level of the 5th (proximal) and 11th (distal) generation airways were embedded in paraffin, and 5-µm-thick sections were prepared for analysis of the axial airways.

Histochemical staining and analysis. Tissue sections were stained with Alcian blue, hematoxylin, and eosin (AB/H & E) essentially as described (4). The extent of inflammation in the lung tissues was scored in a blinded fashion to the identity of the slides. Intensity of inflammation was graded from 0 (no inflammation) to 3 (maximum inflammation).

Histochemical staining for AB and periodic acid Schiff (AB/PAS) was carried out as described by Spicer et al. (31). We determined total mucous cell numeric densities using the NIH Image analysis system (Bethesda, MD) by counting the number of mucous cells and dividing by the length of the basal lamina (BL). The volume of stored mucosubstances in airway epithelia was analyzed by procedures as described (10). In brief, the volume (µm3) of mucus per unit area (µm2) of basement membrane (Vs) was determined from the area of AB/PAS-stained material in the epithelium using the equation Vs = (area of mucus in mm2 x 1,000)/(length of BL in mm x 1.27). Regions of epithelium lining the bronchus-associated lymphoid tissue are not representative of the epithelium in the remainder of an airway and were, therefore, excluded from all morphometric analyses. Morphometry in all sections was done by a person unaware of the exposure history of rats from which the airway tissues were taken.

Immunohistochemical analysis. Endogenous peroxidase activity was blocked by incubating the sections in 2% hydrogen peroxide in methanol for 1 min. Slides were hydrated in graded ethanol and deionized water and then washed in 0.05% (vol) Brij-35 in Dulbecco's PBS (pH 7.4). We unmasked the Bcl-2 protein by treating the slides with the Digest-All kit (Zymed Laboratories, San Francisco, CA) at a 1:3 dilution of trypsin to diluent at 32°C for 10 min. After preincubation in 100 mM Tris, pH 7.7, containing 550 mM NaCl, 10 mM KCl, 1% normal goat serum, and 2% BSA, slides were incubated overnight at room temperature with a Bcl-2 antibody (BDPharmingen, San Diego, CA) at a dilution of 1:1,000. Bcl-2 immunoreaction was detected with the Vectastain rabbit ABC kit and the peroxidase substrate diaminobenzidine (Vector Laboratories, Burlingame, CA) according to the manufacturer's directions; mucous cells were identified by staining with AB (0.05%) for 10 min.

Western blot analysis. For Bcl-2 analysis, protein was extracted from the right lung by homogenization in a buffer (10 mM Tris, pH 7.4, 150 mM NaCl, 1% Triton X-100, 1% deoxycholate, 0.1% SDS, and 5 mM EDTA). The protein concentration was determined with the BCA assay kit (Pierce, Rockford, IL), and 100 µg of protein extract were analyzed by Western blotting as described (37). The filters were stained with Ponceau S to confirm that equivalent amounts of protein were loaded on each lane. Bcl-2 and {beta}-actin were detected using a polyclonal rabbit anti-mouse Bcl-2 antibody (Pharmingen) or a polyclonal goat anti-{beta}-actin IgG (Santa Cruz Biotechnology, Santa Cruz, CA) at a 1:1,000 dilution. Immunoreaction was visualized using peroxidase-conjugated goat anti-rabbit (for anti-Bcl-2) or rabbit anti-goat (for anti-{beta}-actin) (Jackson ImmunoResearch, West Grove, PA) and the ECL kit (Amersham Pharmacia Biotech UK, Buckinghamshire, UK) according to the manufacturer's directions. The blot was imaged with the Fluor-S MAX Imager and Quantity One software (Bio-Rad, Hercules, CA).

Neutrophil depletion. Treatment with rabbit anti-rat polymorphonuclear neutrophil (PMN) antiserum (Accurate Scientific, Westbury, NJ) depletes circulating neutrophils <1% of normal levels by 12 h, and depletion persists for up to 5 days (30). Therefore, 24 h before intratracheal LPS instillation, rats were intraperitoneally injected with 1 ml of rabbit anti-rat PMN antiserum to reduce the LPS-induced inflammation; control rats were injected with normal rabbit serum.

Bezafibrate injection. Bezafibrate (Sigma), an inducer of cytochrome P-450, modulates LPS-induced inflammation when dissolved in sterile corn oil at 40°C before injection in mice and rats (17, 39). To affect the inflammatory response in F344/N and Brown Norway rats following LPS instillation, we injected them intraperitoneally with 50 mg/kg bezafibrate in 0.5 ml of corn oil (Sigma) or with vehicle as control three times at 24-h intervals. Rats were injected 48 and 24 h before the intratracheal instillation and at the time of instillation with 1,000 µg of LPS.

Treatment of SPOC-1 cells with LPS and bezafibrate and quantification of Bcl-2 mRNA. The rat tracheal epithelial cell line SPOC-1 was maintained in culture as described (3, 26). SPOC-1 cells were seeded in 30-mm dishes and after 24 h were treated with 50 µg/ml of LPS in medium, and untreated cells served as controls. In another set of experiments, SPOC-1 cells were treated with bezafibrate dissolved in DMSO before dilution in medium to a final concentration of 1 µl/ml of DMSO and 25 µg/ml of bezafibrate, and cells treated with 1 µl/ml of DMSO served as controls. The dose for LPS was chosen on the basis of the amount present in rat BALF 3 h postinstillation of 1,000 µg of LPS (data not shown). The dose for bezafibrate was chosen on the basis of the amount given to rats in this study. Cells were harvested 24 h after treatment, and RNA was isolated with TRI-Reagent (Molecular Research Center, Cincinnati, OH) as described by the manufacturer. Two micrograms of RNA were subjected to DNase I treatment and reverse transcription using the Qiagen Omniscript RT kit (Qiagen, Hilden, Germany), and 5 µl of the undiluted, 1:10-, or 1:50-diluted RT reaction were subjected to a polymerase chain reaction (PCR) for cyclophilin and Bcl-2. PCR reaction for cyclophilin included a 5-min denaturation at 95°C and 33 cycles of 95°C for 1 min, 55°C for 1 min, and 72°C for 1 min with a final extension for 10 min at 72°C using the primers 5' CTTGTCCATGGCAAATGCTG and 5' GTGATCTTCTTGCTGGTCTTGC to obtain a 190-bp product. PCR reaction for Bcl-2 was the same as for cyclophilin, except it included 40 cycles and used 60°C for annealing and the primers 5'GACCTCTGTTTGATTTCTCC and 5'TGGTCCATCCTTGATAATGC to obtain a 200-bp product. Linearity of amplified PCR products from the reactions was determined to be in the 1:10–1:50 dilution range of the RT product. Controls for the PCR reactions included no addition of RT product (negative control) or RT product from rat spleen RNA (positive control). Each RT-PCR assay was repeated with RNA isolated from three different treatments of SPOC-1 cells. The bands of the PCR products were visualized with ethidium bromide in a 2% agarose gel and quantified via densitometry using a GelDoc and Quantity One software (Bio-Rad, Hercules, CA). The band intensities of Bcl-2 were normalized with the corresponding band intensities for cyclophilin.

Statistical analysis. Numerical data were expressed as mean group values ± SE. Data from experiments with various doses of LPS were analyzed by ANOVA, and Fisher's least significant difference test was used to determine differences between treatment groups. Data from the anti-PMN and bezafibrate experiments were analyzed by paired t-test using the freeware Webstat (University of South Carolina, Columbia, SC). The criterion for significant differences was P < 0.05 in all studies.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
MCM and Bcl-2 expression at 2, 3, and 4 days post-LPS instillation. The number of neutrophils in the BALF of rats instilled with 100 and 1,000 µg of LPS was similar at 2 days postinstillation of LPS, but their numbers decreased in rats instilled with 100 µgofLPS at 3 days and remained elevated in rats instilled with 1,000 µg (Fig. 1A). Macrophage numbers were elevated at both the 100- and 1,000-µg doses at all three time points postinstillation (Fig. 1B). Vs was increased at 3 days postinstillation in both groups of rats but was decreased to background levels in the 100-µg group at 4 days, and it was further increased in rats given the 1,000-µg dose (Fig. 1C). The percentage of Bcl-2-positive mucous cells was significantly different from control in both the 100- and 1,000-µg doses at 2 days postinstillation. Significantly increased Bcl-2 positivity persisted through 3 and 4 days only in mucous cells of rats instilled with 1,000 µg of LPS (Fig. 1D).



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 1. LPS-induced inflammation, mucous cell metaplasia (MCM), and Bcl-2 expression in rats given saline, 100 µg of LPS, or 1,000 µg of LPS. Rats were instilled intratracheally and then killed 2, 3, or 4 days (d) postinstillation. LPS instillation causes an increase of airway neutrophils (A) and macrophages (B) that persists for up to 4 d postinstillation. The lungs were removed and lavaged three times with 5 ml of Ham's F-12 media. Bronchoalveolar lavage (BAL) cells were analyzed by staining cytospins with Wright-Giemsa. C: MCM is significantly elevated at 3 d postinstillation and is reduced to control levels or persists through 4 d in the rats instilled with 100 or 1,000 µg of LPS, respectively. Lung tissues were analyzed by morphometry following staining with Alcian blue/periodic acid Schiff (AB/PAS), and the amount of intraepithelial mucosubstances is expressed as volume of intraepithelial mucous (Vs) per mm basal lamina (BL). D: Bcl-2 expression is present 2 d postinstillation and is decreased to background levels in rats instilled with 100 µg of LPS at 3 d but persists in the 1,000-µg group for 4 d. Bcl-2 was detected by immunohistochemical staining of tissue sections from the left lung. MC, mucous cells. All values are group means ± SE; n = 5 rats per group. *Significantly different from saline-instilled controls, P < 0.05.

 

BALF from rats with various LPS doses at 3 days. Because significant increases in MCM occurred at 3 days postinstillation, we investigated the effect of various LPS doses on BALF cytokines, MCM, and Bcl-2 expression at 3 days postinstillation. The levels of LPS recovered by BAL 3 days after instillation were almost undetectable in untreated and saline-treated controls, as well as in rats instilled with 50 and 100 µg of LPS. However, in BALF recovered from rats instilled with 250, 500, and 1,000 µg of LPS, 27 ± 4, 299 ± 162, and 472 ± 84 EU/ml were detected, respectively. Cytokines associated with LPS-induced inflammation and MCM (14, 16, 19) were measured by ELISA. IL-6 and TNF-{alpha} levels were essentially unchanged (100–500 pg/ml) at all doses compared with saline-instilled controls, but IL-1{beta} levels increased significantly from 0.01 ± 0.007 in saline controls to 0.45 ± 0.1, 1.1 ± 0.35, 2.6 ± 0.9, 15.4 ± 6.4, and 30.1 ± 2.8 ng/ml at 50-, 100-, 250-, 500-, and 1,000-µg LPS doses, respectively (P < 0.05 for all LPS doses).

Inflammatory cells in BALF from rats with various LPS doses at 3 days. The number of lymphocytes was not affected by LPS instillation, and the number of eosinophils was increased significantly by 1,000 µg of LPS but remained <3.6 x 105 per rat. Approximately 2–4 x 106 macrophages and 0.1–1 x 105 neutrophils were retrieved by BAL from noninstilled and saline-instilled controls. In LPS-instilled rats, the number of macrophages was increased in a dose-dependent manner from 7.2 x 106 at 50 µg to a maximum of 1.9 x 107 at the 500-µg LPS dose and decreased twofold when 1,000 µg of LPS were instilled (Fig. 2). In contrast, the number of neutrophils increased in a dose-dependent manner from 50 µg of LPS (9 x 105) up to 1,000 µg of LPS (1.7 x 107) (Fig. 2).



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 2. LPS instillation causes a dose-dependent increase of neutrophils and macrophages in the lungs. Rats were instilled intratracheally with different doses of LPS; controls were instilled with vehicle or were not instilled. At 72 h postinstillation, we analyzed BAL cells by staining cytospins with Wright-Giemsa. Values are group means ± SE; n = 5 rats per group. The numbers of all cell types were significantly different from saline-instilled controls at all doses (P < 0.05).

 

MCM in rats with various LPS doses at 3 days. The inflammation observed in the lung tissues correlated with that observed in the BALF (data not shown). To determine whether LPS at different doses increases stored mucosubstances by increasing mucous cell numbers, we quantified both the Vs and the number of mucous cells per mm BL. The volume of stored mucus was 0.1 and 0.3 nl/mm BL in noninstilled and saline-instilled control rats, respectively, and was increased approximately twofold at 100 µg, threefold at 500 µg, and 4.5-fold at 1,000 µg of LPS compared with saline controls (Fig. 3A). However, the numbers of mucous cells per mm BL increased only 1.7-fold at 50 µg, twofold at 100 µg, and 2.5-fold at 1,000 µg of LPS (Fig. 3B).



View larger version (12K):
[in this window]
[in a new window]
 
Fig. 3. LPS instillation induces a dose-dependent increase in MCM. Rats were instilled intratracheally with different doses of LPS; controls were instilled with vehicle or were not instilled. Lungs were removed 72 h postinstillation and analyzed by morphometry following staining with AB/PAS. The amount of intraepithelial mucosubstances is expressed as Vs per mm BL (A). The numbers of MCs per mm BL were quantified from the same digital images (B). Values are group means ± SE; n = 5 rats per group. *Significantly different from saline-instilled controls, P < 0.05.

 

Bcl-2 expression in mucous cells at various LPS doses at 3 days. The specificity of the Bcl-2 antibody was demonstrated by Western blot analysis of protein extracts prepared from lung homogenates of uninstilled and LPS-instilled rats. The 28-kDa Bcl-2 protein was increased in LPS-instilled rats (Fig. 4A). The airway mucous cells in the noninstilled control rats showed no immunoreaction with the Bcl-2 antibody, and only 4–6% of mucous cells were Bcl-2 positive in the saline-instilled control rats and in rats instilled with 50, 100, and 250 µg of LPS (Fig. 4, B and C). The percentage of Bcl-2-positive mucous cells increased significantly to 22 and 23% at 500 and 1,000 µg of LPS, respectively (Fig. 4, B and C).



View larger version (63K):
[in this window]
[in a new window]
 
Fig. 4. Expression of Bcl-2 in metaplastic mucous cells induced by various doses of LPS. A: detection of Bcl-2 by Western blot analysis. Protein extracts were prepared from the right lung of rats instilled with saline only (lane 1) or with 1,000 µg of LPS (lane 2); 100 µg of protein were analyzed with antibodies to Bcl-2 and {beta}-actin as described in MATERIALS AND METHODS. Levels of the 28-kDa Bcl-2 protein were increased in extracts from LPS-compared with saline-instilled rats. B: representative photomicrographs of axial airways at generation 5 in the left lung lobes of rats intratracheally instilled with saline (S) or 100 (L100) or 1,000 (L1,000) µg of LPS. Bcl-2 was detected by immunohistochemistry and diaminobenzidine and appears dark brown; mucous cells were identified by staining with AB. Bar = 20 µm. C: high doses of LPS are required to sustain Bcl-2 expression. Bcl-2 was detected by immunohistochemical staining of tissue sections from the left lung lobe of rats that were not instilled or were instilled with saline only or with various doses of LPS. The percentages of Bcl-2-positive MCs were quantified in axial airways at generation 5. Values are group means ± SE; n = 5 rats per group. *Significantly different from saline-instilled controls, P < 0.05.

 

Neutrophil depletion. Because the number of neutrophils in the BALF increased significantly in rats that showed Bcl-2-positive mucous cells, we hypothesized that neutrophilic inflammation was responsible for Bcl-2 expression. Therefore, we depleted neutrophils by injecting F344/N rats with anti-PMN antibodies before instillation with 1,000 µg of LPS. The rabbit anti-rat neutrophil antibody decreased neutrophils in the BALF by 50% compared with control rats that were injected with normal rabbit serum (Fig. 5A). Neutrophil accumulation observed in the lung tissues was also reduced by anti-PMN antibody treatment compared with controls (data not shown). Although the numbers of lymphocytes and eosinophils were not affected significantly, the numbers of macrophages increased threefold compared with controls (Fig. 5A). LPS, TNF-{alpha}, and IL-6 levels were not affected by the treatment, but IL-1{beta} levels were decreased significantly compared with controls (data not shown). Both volume of stored mucosubstances (Fig. 5B) and mucous cell numbers per mm BL (data not shown) were not significantly decreased by neutrophil depletion, but the percentage of mucous cells immunopositive for Bcl-2 increased 1.8-fold compared with rats injected with normal rabbit serum (Fig. 5C).



View larger version (11K):
[in this window]
[in a new window]
 
Fig. 5. LPS-induced inflammation, MCM, and Bcl-2 expression in rats injected with antineutrophil antibodies or control serum. Rats were injected intraperitoneally with normal rabbit serum (NRS) or with rabbit anti-rat polymorphonuclear neutrophil (PMN) antibodies 24 h before intratracheal instillation with 1,000 µg of LPS and killed 72 h post-LPS instillation. A: anti-PMN antibodies reduce LPS-induced neutrophilia but increase the number of macrophages compared with controls. The numbers of neutrophils, lymphocytes (Lymph), macrophages (Macs), and eosinophils (Eos) were determined from cytospins prepared from lavaged cells. Cytospins were stained with Wright-Giemsa. B: the Vs was not affected by the antineutrophil antibody. Lung sections from rats were stained for mucosubstances; the volume of Vs cells per mm BL was quantified for each rat. C: increased percentage of Bcl-2-positive cells in rats injected with anti-PMN antibodies. Lung sections were immunostained with Bcl-2 antibodies; the percentage of MCs staining positive for Bcl-2 was quantified. Values are group means ± SE; n = 5 rats per group. *Significantly different from saline-instilled controls, P < 0.05.

 

Cytochrome P-450 modulator. To further investigate the role of neutrophils on Bcl-2 expression, we injected F344/N and Brown Norway rats intraperitoneally with bezafibrate, a cytochrome P-450 inducer (17). Injection of bezafibrate did not alter LPS, TNF-{alpha}, and IL-6 levels, but IL-1{beta} levels (data not shown) and the number of neutrophils recovered in the BALF were increased compared with controls injected with corn oil (Fig. 6A). The numbers of lymphocytes, eosinophils, and macrophages were not affected by this treatment (Fig. 6A). Interestingly, despite increased neutrophil numbers in the BAL, the lung tissues displayed reduced inflammation (Fig. 6B). In addition, the LPS-induced volume of stored mucosubstances (Fig. 6C) and mucous cell numbers (data not shown) per mm BL MCM were decreased twofold in bezafibrate-injected compared with corn oil-injected control rats. Sixteen percent of the mucous cells from the Brown Norway rats injected with corn oil were positive for Bcl-2, and injection with bezafibrate reduced Bcl-2 positivity to 2% (Fig. 6D). A similar reduction in Bcl-2-positive mucous cells was observed in F344/N rats, although the overall percentage of Bcl-2-positive mucous cells was lower compared with that in Brown Norway rats (data not shown).



View larger version (10K):
[in this window]
[in a new window]
 
Fig. 6. LPS-induced inflammation, MCM, and Bcl-2 expression in rats injected with bezafibrate or corn oil. Rats were intraperitoneally injected with bezafibrate or corn oil 24 h before intratracheal instillation, on the day of instillation, and 24 h postinstillation with 1,000 µg of LPS, then killed 72 h postinstillation. A: bezafibrate increases the number of neutrophils in the BAL fluid. The numbers of neutrophils, lymphocytes, macrophages, and eosinophils were determined from cytospins prepared from BAL cells. Cytospins were stained with Wright-Giemsa. B: injection with bezafibrate reduced inflammation in the lung tissues compared with control rats. Index of inflammation was determined from AB/hematoxylin and eosin-stained lung sections. C: Vs was reduced twofold by bezafibrate. Lung sections from rats injected intraperitoneally with bezafibrate or corn oil were instilled with LPS and stained for mucosubstances. The Vs cells per mm BL was quantified. D: Bcl-2 positivity was reduced to background levels by bezafibrate. Lung sections of rats injected intraperitoneally with bezafibrate or corn oil and instilled with LPS were immunostained for Bcl-2; the percentage of MCs staining positive for Bcl-2 was quantified. Values are group means ± SE; n = 5 rats per group. *Significantly different from saline-instilled controls, P < 0.05.

 

Changes in Bcl-2 mRNA levels in SPOC-1 cells treated with LPS or bezafibrate. We examined the direct effects of bezafibrate and LPS on Bcl-2 expression in rat tracheal epithelial cells by treating SPOC-1 cells. Although treatment with LPS had minimal effect on Bcl-2 mRNA levels (Fig. 7A), treatment with bezafibrate decreased the amount of Bcl-2 mRNA by approximately one-half compared with vehicle-treated controls (Fig. 7B).



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 7. Semiquantitative PCR for Bcl-2 mRNA in rat airway epithelial cells treated with LPS or bezafibrate. RNA was isolated from SPOC-1 cells treated for 24 h with LPS, bezafibrate, or vehicle as control and subjected to DNase I treatment and reverse transcription (RT). Bcl-2 and cyclophilin mRNAs were amplified by PCR from the RT product at various dilutions. Densitometry was performed using Bio-Rad Quantity One software. Results represent averages of 3 independent experiments. A: LPS has minimal effect on Bcl-2 mRNA levels. Densitometric values were normalized to cyclophilin and compared with cells treated with medium (M) only. B: bezafibrate (Beza) treatment reduces Bcl-2 mRNA levels. Densitometric values were normalized to cyclophilin and compared with control cells treated with 1 µl of DMSO/ml medium.

 


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The present study shows that LPS instillation causes Bcl-2 expression in metaplastic mucous cells, that MCM can persist after Bcl-2 expression is downregulated, that neutrophils are not required for Bcl-2 expression in metaplastic mucous cells, and that bezafibrate may reduce Bcl-2 expression by directly affecting airway epithelial cells.

We chose to focus our studies on the effects of various LPS doses at 72 h postinstillation because our studies in F344/N rats show that MCM reached maximum levels at this time point. In Brown Norway rats, MCM had reached maximum levels 2 days postinstillation and persisted at least until 4 days (38), suggesting that the development of MCM is strain dependent. Both mucous cell numbers and the volume of intraluminal mucosubstances (Vs) per mm BL were increased in a dose-dependent manner. However, major differences were noted in the extent of these measures for MCM. Although 50 µg of LPS were sufficient to increase the numbers of mucous cells twofold compared with saline controls, 100 µg of LPS were required to increase Vs twofold compared with saline-instilled rats. Furthermore, 500 and 1,000 µg of LPS instillation did not significantly increase the number of mucous cells once they were increased twofold compared with saline controls by instillation of 100 µg of LPS. However, Vs was increased from twofold at 100 µg to 4.5-fold when 1,000 µg of LPS were instilled. These results show that mucous cell numbers reached maximum levels at 30–40 per mm BL, and additional increases in inflammation only caused the accumulation of mucosubstances within each of those mucous cells. Increases in mucous cell numbers by low levels of inflammation also suggest that cell numbers in airway epithelia may increase frequently. These changes would emphasize the importance of mechanisms involved in reducing cell numbers and in adjusting the cell types to proportions found in normal airway epithelia.

The percentage of Bcl-2-expressing mucous cells was significantly increased only at the 3- and 4-day time points at doses that increased Vs by 3- to 4.5-fold, indicating that high levels of inflammation are required for prolonged Bcl-2 expression. A low dose of LPS caused a transient expression of Bcl-2 in metaplastic mucous cells that was reduced to background levels 3 days postinstillation. Our studies in F344/N rats show that Bcl-2 positivity was maximum at 2 and 3 days postinstillation; our previous studies in Brown Norway rats show that the percentage of Bcl-2-positive mucous cells reached maximum levels 2 days postinstillation (38).

Because maximum Bcl-2 expression combined with increased storage of intraepithelial mucosubstances was associated with the doses of LPS that showed the highest levels of neutrophils, we suspected that mediators associated with neutrophils cause Bcl-2 expression in metaplastic mucous cells. Depletion of circulating neutrophils has been used to alter LPS-induced inflammatory response in various studies (41). Injection of anti-PMN antibodies caused a twofold decrease in the number of neutrophils and a twofold increase in macrophage numbers compared with control rats. Wagner et al. (41) report that circulating neutrophils were decreased from 700–900/100 to <10 cells/100 µl of blood in F344/N rats injected with PMN antibodies. Therefore, decreased neutrophil numbers in the BAL may be a direct result of reduced availability of neutrophils in circulation. Neutrophil elastase is a known inducer of mucin expression and MCM (22, 40). However, the decrease in neutrophils in BAL was not accompanied with significant reduction of MCM. It may have been sufficient to cause maximum MCM by the presence of reduced numbers of neutrophils, particularly in combination with increases in macrophage numbers in the BAL.

Injection of rats with bezafibrate led to increased neutrophils in the BAL, whereas inflammation in the lung tissues was decreased compared with rats injected with vehicle. These observations suggest that bezafibrate augments the migration of neutrophils to the air spaces, thereby depleting the remaining cells in the lung tissues. However, the number of macrophages and other inflammatory cells in the BAL was not changed compared with controls. Bezafibrate likely causes the metabolism of arachidonic acid to shift from the cyclooxygenase pathway to an epoxygenase pathway, which produces anti-inflammatory epoxyeicosatrienoic acids (17, 39), and this pathway in turn may cause the reduction of general inflammation in the lung and MCM in the airways. The mechanism underlying the rapid migration of neutrophils due to bezafibrate injection is not understood but may be due to production of epoxyeicosatrienoic acids, which increase transmigration by decreasing adherence of neutrophils to endothelial cells (2, 24). Contrary to our expectation, increased numbers of neutrophils in the BAL under this circumstance were associated with a twofold reduction of MCM and suppression of Bcl-2 expression to background levels. Furthermore, although CYP26 expression is closely associated with mucous cell differentiation in normal human bronchial epithelial cells (15), injection of bezafibrate, a nonspecific P-450 inducer (5), caused a decrease in MCM. Our results from treating SPOC-1 cells with bezafibrate suggest that bezafibrate may directly affect airway epithelial cells to reduce Bcl-2 expression independently of its effect on the inflammatory response in vivo. Together with our previous report that Bcl-2, an antiapoptotic protein, is downregulated before the reduction of MCM (38), the present study suggests that bezafibrate may have reduced MCM by affecting expression of this protein.

The main inflammatory cell types recovered after LPS instillation were neutrophils and macrophages, whereas lymphocytes and eosinophils were present in low numbers. Our previous studies show that neutrophil numbers reach maximum levels 48 h after 1,000 µg of LPS are instilled and decrease to background levels 7 days postinstillation (36). Therefore, we assume that the number of neutrophils must have been on the decline at 72 h postinstillation, when rats were killed in the present study. Although the number of neutrophils increased in a dose-dependent manner, the number of macrophages was reduced at 1,000 µg of LPS from the maximum numbers reached at the 500-µg dose. This decrease may be associated with increased adherence of macrophages to epithelial cells in the presence of LPS (11) as was also observed in the present study (data not shown). LPS persists in the lungs longer, as shown by higher levels at the 1,000-µg dose, thereby prolonging adherence and delaying their migration into the lung air spaces. Other cell types, such as neutrophils, may have to clear the LPS before macrophages can migrate into the air spaces in higher numbers. Our previous study shows that the number of macrophages continues to increase over 7 days post-LPS instillation to reach numbers observed at 500 µg of LPS in the present study (36).

Analysis of the BALF from rats instilled with various doses of LPS indicated a correlation of Bcl-2 expression with the presence of high levels of LPS and IL-1{beta} in the BALF. The observation that IL-6 and TNF-{alpha} levels were not detected at 3 days post-LPS instillation is consistent with previous reports that show that these cytokines are elevated early after LPS exposure and are reduced rapidly (6). As expected, BALF from rats instilled with 1,000 µg of LPS also had the most LPS remaining. Because IL-1{beta} is associated with mucin expression (16), we expected that rats with the highest MCM would have the highest IL-1{beta}. However, levels of IL-1{beta} in the BALF from bezafibrate-treated rats were increased, whereas MCM and Bcl-2 levels were suppressed compared with controls. In addition, levels of IL-1{beta} in the BALF from neutrophil-depleted rats were decreased, whereas MCM remained unchanged and Bcl-2 positivity was increased 1.8-fold compared with controls. This lack of correlation of these mediators with the observed changes suggests that IL-1{beta} is not likely responsible for inducing MCM and Bcl-2 expression in this model. However, the role of this inflammatory mediator and others, such as IL-6 and TNF-{alpha}, at early time points post-LPS instillation and the possible involvement of macrophages require further investigation.

Collectively, these findings suggest that the percentage of Bcl-2-positive mucous cells is independent of the numbers of neutrophils in the BAL. Whether neutrophils have an inhibitory role for Bcl-2 expression or whether their depletion results in decreased inhibition of an inducer of Bcl-2 expression is currently being investigated.


    ACKNOWLEDGMENTS
 
We thank Mark Fischer and Leigh Schutzberger for assistance with the animal studies and Yoneko Knighton for preparation of tissue samples and James Aden for help with statistical analyses.

DISCLOSURES

These studies were sponsored by the National Institutes of Health Grant ES-09237.


    FOOTNOTES
 

Address for reprint requests and other correspondence: Y. Tesfaigzi, Lovelace Respiratory Research Inst., 2425 Ridgecrest Dr., SE, Albuquerque, NM 87108 (E-mail: ytesfaig{at}lrri.org).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Adams JM and Cory S. The Bcl-2 protein family: arbiters of cell survival. Science 281: 1322–1326, 1998.[Abstract/Free Full Text]
  2. Bednar MM, Gross CE, Russell SR, Fuller SP, Ahern TP, Howard DB, Falck JR, Reddy KM, and Balazy M. 16(R)-hydroxyeicosatetraenoic acid, a novel cytochrome P-450 product of arachidonic acid, suppresses activation of human polymorphonuclear leukocyte and reduces intracranial pressure in a rabbit model of thromboembolic stroke. Neurosurgery 47: 1410–1418, 2000.[ISI][Medline]
  3. Doherty MM, Liu J, Randell SH, Carter CA, Davis CW, Nettesheim P, and Ferriola PC. Phenotype and differentiation potential of a novel rat tracheal epithelial cell line. Am J Respir Cell Mol Biol 12: 385–395, 1995.[Abstract]
  4. El-Zimaity HM, Ota H, Scott S, Killen DE, and Graham DY. A new triple stain for Helicobacter pylori suitable for the autostainer: carbol fuchsin/Alcian blue/hematoxylin-eosin. Arch Pathol Lab Med 122: 732–736, 1998.[ISI][Medline]
  5. Gibson GG and Lake BG. Induction protocols for the cytochrome P-450IVA subfamily in animals and primary hepatocyte cultures. Methods Enzymol 206: 353–364, 1991.[ISI][Medline]
  6. Gourine AV, Gourine VN, Tesfaigzi Y, Caluwaerts N, Van Leuven F, and Kluger MJ. Role of {alpha}2-macroglobulin in fever and cytokine responses induced by lipopolysaccharide in mice. Am J Physiol Regul Integr Comp Physiol 283: R218–R226, 2002.[Abstract/Free Full Text]
  7. Gross A, McDonnell JM, and Korsmeyer SJ. BCL-2 family members and the mitochondria in apoptosis. Genes Dev 13: 1899–1911, 1999.[Free Full Text]
  8. Harkema JR and Hotchkiss JA. In vivo effects of endotoxin on DNA synthesis in rat nasal epithelium. Microsc Res Tech 26: 457–465, 1993.[ISI][Medline]
  9. Harkema JR and Hotchkiss JA. In vivo effects of endotoxin on intraepithelial mucosubstances in rat pulmonary airways. Quantitative histochemistry. Am J Pathol 141: 307–317, 1992.[Abstract]
  10. Harkema JR and Hotchkiss JA. In vivo effects of endotoxin on nasal epithelial mucosubstances: quantitative histochemistry. Exp Lung Res 17: 743–761, 1991.[ISI][Medline]
  11. Hirano S. Interaction of rat alveolar macrophages with pulmonary epithelial cells following exposure to lipopolysaccharide. Arch Toxicol 70: 230–236, 1996.[ISI][Medline]
  12. Jany B, Gallup M, Tsuda T, and Basbaum C. Mucin gene expression in rat airways following infection and irritation. Biochem Biophys Res Commun 181: 1–8, 1991.[ISI][Medline]
  13. Jeffery PK. Comparison of the structural and inflammatory features of COPD and asthma. Giles F. Filley lecture. Chest 117: 251S–260S, 2000.[Medline]
  14. Kampf C, Relova AJ, Sandler S, and Roomans GM. Effects of TNF-alpha, IFN-gamma and IL-beta on normal human bronchial epithelial cells. Eur Respir J 14: 84–91, 1999.[Abstract]
  15. Kim SY, Adachi H, Koo JS, and Jetten AM. Induction of the cytochrome P-450 gene CYP26 during mucous cell differentiation of normal human tracheobronchial epithelial cells. Mol Pharmacol 58: 483–490, 2000.[Abstract/Free Full Text]
  16. Koo JS, Kim YD, Jetten AM, Belloni P, and Nettesheim P. Overexpression of mucin genes induced by interleukin-1 beta, tumor necrosis factor-alpha, lipopolysaccharide, and neutrophil elastase is inhibited by a retinoic acid receptor alpha antagonist. Exp Lung Res 28: 315–332, 2002.[ISI][Medline]
  17. Kozak W, Kluger MJ, Kozak A, Wachulec M, and Dokladny K. Role of cytochrome P-450 in endogenous antipyresis. Am J Physiol Regul Integr Comp Physiol 279: R455–R460, 2000.[Abstract/Free Full Text]
  18. Lemjabbar H and Basbaum C. Platelet-activating factor receptor and ADAM10 mediate responses to Staphylococcus aureus in epithelial cells. Nat Med 8: 41–46, 2002.[ISI][Medline]
  19. Levine S, Larivee P, Logun C, Angus C, Ognibene F, and Shelhamer J. Tumor necrosis factor-alpha induces mucin hypersecretion and MUC-2 gene expression by human airway epithelial cells. Am J Respir Cell Mol Biol 12: 196–204, 1995.[Abstract]
  20. Li J, Dohrman A, Gallup M, Miyata S, Gum J, Kim Y, Nadel J, Prince A, and Basbaum C. Transcriptional activation of mucin by Pseudomonas aeruginosa lipopolysaccharide in the pathogenesis of cystic fibrosis lung disease. Proc Natl Acad Sci USA 94: 967–972, 1997.[Abstract/Free Full Text]
  21. Maestrelli P, Saetta M, Mapp CE, and Fabbri LM. Remodeling in response to infection and injury. Airway inflammation and hypersecretion of mucus in smoking subjects with chronic obstructive pulmonary disease. Am J Respir Crit Care Med 164: S76–S80, 2001.[Abstract/Free Full Text]
  22. Nadel JA, Takeyama K, and Agusti C. Role of neutrophil elastase in hypersecretion in asthma. Eur Respir J 13: 190–196, 1999.[Abstract]
  23. O'Grady NP, Preas HL, Pugin J, Fiuza C, Tropea M, Reda D, Banks SM, and Suffredini AF. Local inflammatory responses following bronchial endotoxin instillation in humans. Am J Respir Crit Care Med 163: 1591–1598, 2001.[Abstract/Free Full Text]
  24. Pratt PF, Rosolowsky M, and Campbell WB. Effects of epoxyeicosatrienoic acids on polymorphonuclear leukocyte function. Life Sci 70: 2521–2533, 2002.[ISI][Medline]
  25. Raetz CR, Ulevitch RJ, Wright SD, Sibley CH, Ding A, and Nathan CF. Gram-negative endotoxin: an extraordinary lipid with profound effects on eukaryotic signal transduction. FASEB J 5: 2652–2660, 1991.[Abstract]
  26. Randell SH, Liu JY, Ferriola PC, Kaartinen L, Doherty MM, Davis CW, and Nettesheim P. Mucin production by SPOC1 cells–an immortalized rat tracheal epithelial cell line. Am J Respir Cell Mol Biol 14: 146–154, 1996.[Abstract]
  27. Reed JC. Bcl-2 family proteins. Oncogene 17: 3225–3236, 1998.[ISI][Medline]
  28. Sandstrom T, Bjermer L, and Rylander R. Lipopolysaccharide (LPS) inhalation in healthy subjects increases neutrophils, lymphocytes and fibronectin levels in bronchoalveolar lavage fluid. Eur Respir J 5: 992–996, 1992.[Abstract]
  29. Shi ZQ, Fischer MJ, De Sanctis GT, Schuyler M, and Tesfaigzi Y. IFN{gamma} but not Fas mediates reduction of allergen-induced mucous cell metaplasia by inducing apoptosis. J Immunol 168: 4764–4771, 2002.[Abstract/Free Full Text]
  30. Snipes MB, Barnett AL, Harkema JR, Hotchkiss JA, Rebar AH, and Reddick LJ. Specific biological effects of an anti-rat PMN antiserum intraperitoneally injected into F344/N rats. Vet Clin Pathol 24: 11–17, 1995.[Medline]
  31. Spicer SS, Chakrin LW, Wardell JR Jr, and Kendrick W. Histochemistry of mucosubstances in the canine and human respiratory tract. Lab Invest 25: 483–490, 1971.[ISI][Medline]
  32. Stassen M, Muller C, Arnold M, Hultner L, Klein-Hessling S, Neudorfl C, Reineke T, Serfling E, and Schmitt E. IL-9 and IL-13 production by activated mast cells is strongly enhanced in the presence of lipopolysaccharide: NF-kappa B is decisively involved in the expression of IL-9. J Immunol 166: 4391–4398, 2001.[Abstract/Free Full Text]
  33. Steiger D, Hotchkiss J, Bajaj L, Harkema J, and Basbaum C. Concurrent increases in the storage and release of mucin-like molecules by rat airway epithelial cells in response to bacterial endotoxin. Am J Respir Cell Mol Biol 12: 307–314, 1995.[Abstract]
  34. Strasser A, O'Connor L, and Dixit VM. Apoptosis signaling. Annu Rev Biochem 69: 217–245, 2000.[ISI][Medline]
  35. Tesfaigzi J, Hotchkiss JA, and Harkema JR. Expression of Bcl-2 during mucous cell metaplasia and remodeling in F344/N rats. Am J Respir Cell Mol Biol 18: 794–799, 1998.[Abstract/Free Full Text]
  36. Tesfaigzi J, Johnson NF, and Lechner JF. Induction of EGF receptor and erbB-2 during endotoxin-induced alveolar type II cell proliferation in the rat lung. Int J Exp Pathol 77: 143–154, 1996.[ISI][Medline]
  37. Tesfaigzi J, Smith-Harrison W, and Carlson DM. A simple method for reusing Western blots on PVDF membranes. Biotechniques 17: 268–269, 1994.[ISI][Medline]
  38. Tesfaigzi Y, Fischer MJ, Martin AJ, and Seagrave J. Bcl-2 in LPS- and allergen-induced hyperplastic mucous cells in airway epithelia of Brown Norway rats. Am J Physiol Lung Cell Mol Physiol 279: L1210–L1217, 2000.[Abstract/Free Full Text]
  39. Tesfaigzi Y, Kluger MJ, and Kozak W. Clinical and cellular effects of cytochrome P-450 modulators. Respir Physiol 128: 79–87, 2001.[ISI][Medline]
  40. Voynow JA, Young LR, Wang Y, Horger T, Rose MC, and Fischer BM. Neutrophil elastase increases MUC5AC mRNA and protein expression in respiratory epithelial cells. Am J Physiol Lung Cell Mol Physiol 276: L835–L843, 1999.[Abstract/Free Full Text]
  41. Wagner JG, Van Dyken SJ, Hotchkiss JA, and Harkema JR. Endotoxin enhancement of ozone-induced mucous cell metaplasia is neutrophil-dependent in rat nasal epithelium. Toxicol Sci 60: 338–347, 2001.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
J. Xu, F. Xu, and E. Barrett
Metalloelastase in lungs and alveolar macrophages is modulated by extracellular substance P in mice
Am J Physiol Lung Cell Mol Physiol, July 1, 2008; 295(1): L162 - L170.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
K. Schwalm, J. F. Stevens, Z. Jiang, M. R. Schuyler, R. Schrader, S. H. Randell, F. H. Y. Green, and Y. Tesfaigzi
Expression of the proapoptotic protein Bax is reduced in bronchial mucous cells of asthmatic subjects
Am J Physiol Lung Cell Mol Physiol, June 1, 2008; 294(6): L1102 - L1109.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
L. R. Bartner, N. E. Robinson, M. Kiupel, and Y. Tesfaigzi
Persistent mucus accumulation: a consequence of delayed bronchial mucous cell apoptosis in RAO-affected horses?
Am J Physiol Lung Cell Mol Physiol, October 1, 2006; 291(4): L602 - L609.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
Y. Tesfaigzi, J. D. McDonald, M. D. Reed, S. P. Singh, G. T. De Sanctis, P. R. Eynott, F. F. Hahn, M. J. Campen, and J. L. Mauderly
Low-Level Subchronic Exposure to Wood Smoke Exacerbates Inflammatory Responses in Allergic Rats
Toxicol. Sci., December 1, 2005; 88(2): 505 - 513.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
J. F. Harris, M. J. Fischer, J. R. Hotchkiss, B. P. Monia, S. H. Randell, J. R. Harkema, and Y. Tesfaigzi
Bcl-2 Sustains Increased Mucous and Epithelial Cell Numbers in Metaplastic Airway Epithelium
Am. J. Respir. Crit. Care Med., April 1, 2005; 171(7): 764 - 772.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/2/L405    most recent
00249.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Foster, J. E.
Right arrow Articles by Tesfaigzi, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Foster, J. E.
Right arrow Articles by Tesfaigzi, Y.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2003 by the American Physiological Society.