|
|
||||||||
1Lovelace Respiratory Research Institute; 2University of New Mexico School of Medicine, and Veterans Administration Medical Center, Albuquerque, New Mexico 87108; 3Medical College of Georgia, Augusta, Georgia 30912; and Nicolaus Copernicus University, 87-100 Torun, Poland
Submitted 26 September 2002 ; accepted in final form 7 April 2003
| ABSTRACT |
|---|
|
|
|---|
airway epithelium; bezafibrate; apoptosis; lavaged cells; cytokines
Exposure to lipopolysaccharides (LPS), a component of the gram-negative
bacterial cell wall, causes inflammatory cells to secrete a number of
proteins, including TNF-
, IL-1
, IL-6, and proteases that promote
the differentiation of proliferating and preexisting epithelial cells into
mucous cells by inducing mucin biosynthesis
(23,
32,
40). In the absence of further
insult, inflammation is cleared, and mucous cell numbers are reduced by
programmed cell death (29,
38). Disruption of these
recovery processes may cause persistently elevated mucous cell numbers and
contribute to mucous hypersecretion and airway obstruction as in chronic lung
disease, such as cystic fibrosis or chronic bronchitis
(13,
18,
21).
Bcl-2 and related proteins affect the process of apoptosis by regulating the release of cytochrome c from mitochondria (7). Members of this family of proteins have either pro- or antiapoptotic functions, and the ratio between these two subsets determines the susceptibility of cells to a death signal (7, 27). Bcl-2 enhances cell survival by inhibiting apoptosis induced in different cell types and in response to different stimuli; this suggests that Bcl-2 acts at a central control point in the pathway to apoptotic cell death (1, 34).
Our previous studies demonstrate that metaplastic mucous cells induced in rat lung airways by ozone, allergen, or LPS exposure express Bcl-2 regardless of airway location (35). The disappearance of Bcl-2 precedes the disappearance of mucous cells, suggesting that Bcl-2 plays a role in the maintenance of MCM (38). The present study was designed to investigate whether LPS-induced neutrophilic inflammation and the appearance of MCM are always associated with Bcl-2 expression. Initially, we examined the role of the intensity of inflammation on Bcl-2 expression by instillation of various doses of LPS. Subsequently, the LPS-induced neutrophilic response associated with the highest percentage of Bcl-2 positivity was modulated by injecting either bezafibrate, an inducer of cytochrome P-450, or antibodies to neutrophils. In an attempt to study the anti-inflammatory nature of bezafibrate (17), we had observed that it increased the number of neutrophils in the bronchoalveolar lavage (BAL) of LPS-instilled rats. On the basis of this observation, we used this agent to study the role of increased neutrophils in the BAL on Bcl-2 expression in metaplastic mucous cells. Results show that MCM can persist after Bcl-2 expression is downregulated, that high doses of LPS are required to induce Bcl-2 in metaplastic mucous cells at 3 days postinstillation, and that the percentage of Bcl-2-positive mucous cells is independent from the number of neutrophils in the BAL. Together, these studies show that Bcl-2 expression in mucous cells may be mediated by inflammatory factors independent of the mediators causing MCM. Bezafibrate, but not LPS, reduced Bcl-2 mRNA levels in the rat airway epithelial cell line SPOC-1 by approximately one-half compared with vehicle-treated controls, suggesting that bezafibrate may also directly affect Bcl-2 expression.
| MATERIALS AND METHODS |
|---|
|
|
|---|
LPS instillation and BAL. Rats were briefly anesthetized with 5% halothane in oxygen and nitrous oxide and instilled intratracheally once with 50, 100, 250, 500, or 1,000 µg of LPS [Pseudomonas aeruginosa serotype 10, lot 99H4059, 900,000 endotoxin units (EU)/mg; Sigma, St. Louis, MO] in 0.5 ml of 0.9% pyrogen-free saline solution. Control rats were not instilled or were instilled with 0.5 ml of 0.9% pyrogen-free saline. Rats were killed 2, 3, or 4 days postinstillation with an injection of pentobarbital sodium and exsanguinated through the renal artery. The trachea was cannulated with an 18-gauge blunt needle tipped with surgical tubing. The lungs were removed from the rats and lavaged three times with 5 ml of Ham's F-12 media (Hyclone, Logan, UT) before perfusion with 10% zinc formalin under a constant pressure of 25 cmH2O for 2 h. BAL samples were centrifuged to remove inflammatory cells and stored in 0.2-ml aliquots at -80°C until further use.
Analysis of BAL. LPS levels in the BAL fluid (BALF) were
determined with the QCL-1000 Limulus Amoebocyte Lysate assay (BioWhittaker,
Walkersville, MD) according to the manufacturer's directions and were
expressed as a function of EU/ml. Cells from each BAL were counted on a
hemacytometer; cytological preparations were stained with Wright-Giemsa
(American Scientific Products, McGaw Park, IL) to quantify the percentages of
inflammatory cell types present. Levels of rat TNF-
and IL-6 were
determined with the DuoSet ELISA development system, and IL-1
levels
were determined with the Quantikine M Immunoassay kit according to the
manufacturer's directions (both from R&D Systems, Minneapolis, MN).
Histopathology. The intrapulmonary airways of the left lung lobe from each animal were microdissected according to a modified version of a previously described procedure (9). Microdissection was performed under a high-resolution dissecting microscope (dual-viewing Wild M-8 stereomicroscope; Wild-Heerbrugg, Heerbrugg, Switzerland). Beginning at the lobar bronchus, the airways were split down the long axis of the axial pathway through the 11th airway generation. Three-millimeter-thick lung slices at the level of the 5th (proximal) and 11th (distal) generation airways were embedded in paraffin, and 5-µm-thick sections were prepared for analysis of the axial airways.
Histochemical staining and analysis. Tissue sections were stained with Alcian blue, hematoxylin, and eosin (AB/H & E) essentially as described (4). The extent of inflammation in the lung tissues was scored in a blinded fashion to the identity of the slides. Intensity of inflammation was graded from 0 (no inflammation) to 3 (maximum inflammation).
Histochemical staining for AB and periodic acid Schiff (AB/PAS) was carried out as described by Spicer et al. (31). We determined total mucous cell numeric densities using the NIH Image analysis system (Bethesda, MD) by counting the number of mucous cells and dividing by the length of the basal lamina (BL). The volume of stored mucosubstances in airway epithelia was analyzed by procedures as described (10). In brief, the volume (µm3) of mucus per unit area (µm2) of basement membrane (Vs) was determined from the area of AB/PAS-stained material in the epithelium using the equation Vs = (area of mucus in mm2 x 1,000)/(length of BL in mm x 1.27). Regions of epithelium lining the bronchus-associated lymphoid tissue are not representative of the epithelium in the remainder of an airway and were, therefore, excluded from all morphometric analyses. Morphometry in all sections was done by a person unaware of the exposure history of rats from which the airway tissues were taken.
Immunohistochemical analysis. Endogenous peroxidase activity was blocked by incubating the sections in 2% hydrogen peroxide in methanol for 1 min. Slides were hydrated in graded ethanol and deionized water and then washed in 0.05% (vol) Brij-35 in Dulbecco's PBS (pH 7.4). We unmasked the Bcl-2 protein by treating the slides with the Digest-All kit (Zymed Laboratories, San Francisco, CA) at a 1:3 dilution of trypsin to diluent at 32°C for 10 min. After preincubation in 100 mM Tris, pH 7.7, containing 550 mM NaCl, 10 mM KCl, 1% normal goat serum, and 2% BSA, slides were incubated overnight at room temperature with a Bcl-2 antibody (BDPharmingen, San Diego, CA) at a dilution of 1:1,000. Bcl-2 immunoreaction was detected with the Vectastain rabbit ABC kit and the peroxidase substrate diaminobenzidine (Vector Laboratories, Burlingame, CA) according to the manufacturer's directions; mucous cells were identified by staining with AB (0.05%) for 10 min.
Western blot analysis. For Bcl-2 analysis, protein was extracted
from the right lung by homogenization in a buffer (10 mM Tris, pH 7.4, 150 mM
NaCl, 1% Triton X-100, 1% deoxycholate, 0.1% SDS, and 5 mM EDTA). The protein
concentration was determined with the BCA assay kit (Pierce, Rockford, IL),
and 100 µg of protein extract were analyzed by Western blotting as
described (37). The filters
were stained with Ponceau S to confirm that equivalent amounts of protein were
loaded on each lane. Bcl-2 and
-actin were detected using a polyclonal
rabbit anti-mouse Bcl-2 antibody (Pharmingen) or a polyclonal goat
anti-
-actin IgG (Santa Cruz Biotechnology, Santa Cruz, CA) at a 1:1,000
dilution. Immunoreaction was visualized using peroxidase-conjugated goat
anti-rabbit (for anti-Bcl-2) or rabbit anti-goat (for anti-
-actin)
(Jackson ImmunoResearch, West Grove, PA) and the ECL kit (Amersham Pharmacia
Biotech UK, Buckinghamshire, UK) according to the manufacturer's directions.
The blot was imaged with the Fluor-S MAX Imager and Quantity One software
(Bio-Rad, Hercules, CA).
Neutrophil depletion. Treatment with rabbit anti-rat polymorphonuclear neutrophil (PMN) antiserum (Accurate Scientific, Westbury, NJ) depletes circulating neutrophils <1% of normal levels by 12 h, and depletion persists for up to 5 days (30). Therefore, 24 h before intratracheal LPS instillation, rats were intraperitoneally injected with 1 ml of rabbit anti-rat PMN antiserum to reduce the LPS-induced inflammation; control rats were injected with normal rabbit serum.
Bezafibrate injection. Bezafibrate (Sigma), an inducer of cytochrome P-450, modulates LPS-induced inflammation when dissolved in sterile corn oil at 40°C before injection in mice and rats (17, 39). To affect the inflammatory response in F344/N and Brown Norway rats following LPS instillation, we injected them intraperitoneally with 50 mg/kg bezafibrate in 0.5 ml of corn oil (Sigma) or with vehicle as control three times at 24-h intervals. Rats were injected 48 and 24 h before the intratracheal instillation and at the time of instillation with 1,000 µg of LPS.
Treatment of SPOC-1 cells with LPS and bezafibrate and quantification of Bcl-2 mRNA. The rat tracheal epithelial cell line SPOC-1 was maintained in culture as described (3, 26). SPOC-1 cells were seeded in 30-mm dishes and after 24 h were treated with 50 µg/ml of LPS in medium, and untreated cells served as controls. In another set of experiments, SPOC-1 cells were treated with bezafibrate dissolved in DMSO before dilution in medium to a final concentration of 1 µl/ml of DMSO and 25 µg/ml of bezafibrate, and cells treated with 1 µl/ml of DMSO served as controls. The dose for LPS was chosen on the basis of the amount present in rat BALF 3 h postinstillation of 1,000 µg of LPS (data not shown). The dose for bezafibrate was chosen on the basis of the amount given to rats in this study. Cells were harvested 24 h after treatment, and RNA was isolated with TRI-Reagent (Molecular Research Center, Cincinnati, OH) as described by the manufacturer. Two micrograms of RNA were subjected to DNase I treatment and reverse transcription using the Qiagen Omniscript RT kit (Qiagen, Hilden, Germany), and 5 µl of the undiluted, 1:10-, or 1:50-diluted RT reaction were subjected to a polymerase chain reaction (PCR) for cyclophilin and Bcl-2. PCR reaction for cyclophilin included a 5-min denaturation at 95°C and 33 cycles of 95°C for 1 min, 55°C for 1 min, and 72°C for 1 min with a final extension for 10 min at 72°C using the primers 5' CTTGTCCATGGCAAATGCTG and 5' GTGATCTTCTTGCTGGTCTTGC to obtain a 190-bp product. PCR reaction for Bcl-2 was the same as for cyclophilin, except it included 40 cycles and used 60°C for annealing and the primers 5'GACCTCTGTTTGATTTCTCC and 5'TGGTCCATCCTTGATAATGC to obtain a 200-bp product. Linearity of amplified PCR products from the reactions was determined to be in the 1:101:50 dilution range of the RT product. Controls for the PCR reactions included no addition of RT product (negative control) or RT product from rat spleen RNA (positive control). Each RT-PCR assay was repeated with RNA isolated from three different treatments of SPOC-1 cells. The bands of the PCR products were visualized with ethidium bromide in a 2% agarose gel and quantified via densitometry using a GelDoc and Quantity One software (Bio-Rad, Hercules, CA). The band intensities of Bcl-2 were normalized with the corresponding band intensities for cyclophilin.
Statistical analysis. Numerical data were expressed as mean group values ± SE. Data from experiments with various doses of LPS were analyzed by ANOVA, and Fisher's least significant difference test was used to determine differences between treatment groups. Data from the anti-PMN and bezafibrate experiments were analyzed by paired t-test using the freeware Webstat (University of South Carolina, Columbia, SC). The criterion for significant differences was P < 0.05 in all studies.
| RESULTS |
|---|
|
|
|---|
|
BALF from rats with various LPS doses at 3 days. Because
significant increases in MCM occurred at 3 days postinstillation, we
investigated the effect of various LPS doses on BALF cytokines, MCM, and Bcl-2
expression at 3 days postinstillation. The levels of LPS recovered by BAL 3
days after instillation were almost undetectable in untreated and
saline-treated controls, as well as in rats instilled with 50 and 100 µg of
LPS. However, in BALF recovered from rats instilled with 250, 500, and 1,000
µg of LPS, 27 ± 4, 299 ± 162, and 472 ± 84 EU/ml were
detected, respectively. Cytokines associated with LPS-induced inflammation and
MCM (14,
16,
19) were measured by ELISA.
IL-6 and TNF-
levels were essentially unchanged (100500 pg/ml)
at all doses compared with saline-instilled controls, but IL-1
levels
increased significantly from 0.01 ± 0.007 in saline controls to 0.45
± 0.1, 1.1 ± 0.35, 2.6 ± 0.9, 15.4 ± 6.4, and 30.1
± 2.8 ng/ml at 50-, 100-, 250-, 500-, and 1,000-µg LPS doses,
respectively (P < 0.05 for all LPS doses).
Inflammatory cells in BALF from rats with various LPS doses at 3 days. The number of lymphocytes was not affected by LPS instillation, and the number of eosinophils was increased significantly by 1,000 µg of LPS but remained <3.6 x 105 per rat. Approximately 24 x 106 macrophages and 0.11 x 105 neutrophils were retrieved by BAL from noninstilled and saline-instilled controls. In LPS-instilled rats, the number of macrophages was increased in a dose-dependent manner from 7.2 x 106 at 50 µg to a maximum of 1.9 x 107 at the 500-µg LPS dose and decreased twofold when 1,000 µg of LPS were instilled (Fig. 2). In contrast, the number of neutrophils increased in a dose-dependent manner from 50 µg of LPS (9 x 105) up to 1,000 µg of LPS (1.7 x 107) (Fig. 2).
|
MCM in rats with various LPS doses at 3 days. The inflammation observed in the lung tissues correlated with that observed in the BALF (data not shown). To determine whether LPS at different doses increases stored mucosubstances by increasing mucous cell numbers, we quantified both the Vs and the number of mucous cells per mm BL. The volume of stored mucus was 0.1 and 0.3 nl/mm BL in noninstilled and saline-instilled control rats, respectively, and was increased approximately twofold at 100 µg, threefold at 500 µg, and 4.5-fold at 1,000 µg of LPS compared with saline controls (Fig. 3A). However, the numbers of mucous cells per mm BL increased only 1.7-fold at 50 µg, twofold at 100 µg, and 2.5-fold at 1,000 µg of LPS (Fig. 3B).
|
Bcl-2 expression in mucous cells at various LPS doses at 3 days. The specificity of the Bcl-2 antibody was demonstrated by Western blot analysis of protein extracts prepared from lung homogenates of uninstilled and LPS-instilled rats. The 28-kDa Bcl-2 protein was increased in LPS-instilled rats (Fig. 4A). The airway mucous cells in the noninstilled control rats showed no immunoreaction with the Bcl-2 antibody, and only 46% of mucous cells were Bcl-2 positive in the saline-instilled control rats and in rats instilled with 50, 100, and 250 µg of LPS (Fig. 4, B and C). The percentage of Bcl-2-positive mucous cells increased significantly to 22 and 23% at 500 and 1,000 µg of LPS, respectively (Fig. 4, B and C).
|
Neutrophil depletion. Because the number of neutrophils in the
BALF increased significantly in rats that showed Bcl-2-positive mucous cells,
we hypothesized that neutrophilic inflammation was responsible for Bcl-2
expression. Therefore, we depleted neutrophils by injecting F344/N rats with
anti-PMN antibodies before instillation with 1,000 µg of LPS. The rabbit
anti-rat neutrophil antibody decreased neutrophils in the BALF by 50% compared
with control rats that were injected with normal rabbit serum
(Fig. 5A). Neutrophil
accumulation observed in the lung tissues was also reduced by anti-PMN
antibody treatment compared with controls (data not shown). Although the
numbers of lymphocytes and eosinophils were not affected significantly, the
numbers of macrophages increased threefold compared with controls
(Fig. 5A). LPS,
TNF-
, and IL-6 levels were not affected by the treatment, but
IL-1
levels were decreased significantly compared with controls (data
not shown). Both volume of stored mucosubstances
(Fig. 5B) and mucous
cell numbers per mm BL (data not shown) were not significantly decreased by
neutrophil depletion, but the percentage of mucous cells immunopositive for
Bcl-2 increased 1.8-fold compared with rats injected with normal rabbit serum
(Fig. 5C).
|
Cytochrome P-450 modulator. To further investigate the role of
neutrophils on Bcl-2 expression, we injected F344/N and Brown Norway rats
intraperitoneally with bezafibrate, a cytochrome P-450 inducer
(17). Injection of bezafibrate
did not alter LPS, TNF-
, and IL-6 levels, but IL-1
levels (data
not shown) and the number of neutrophils recovered in the BALF were increased
compared with controls injected with corn oil
(Fig. 6A). The numbers
of lymphocytes, eosinophils, and macrophages were not affected by this
treatment (Fig. 6A).
Interestingly, despite increased neutrophil numbers in the BAL, the lung
tissues displayed reduced inflammation
(Fig. 6B). In
addition, the LPS-induced volume of stored mucosubstances
(Fig. 6C) and mucous
cell numbers (data not shown) per mm BL MCM were decreased twofold in
bezafibrate-injected compared with corn oil-injected control rats. Sixteen
percent of the mucous cells from the Brown Norway rats injected with corn oil
were positive for Bcl-2, and injection with bezafibrate reduced Bcl-2
positivity to 2% (Fig.
6D). A similar reduction in Bcl-2-positive mucous cells
was observed in F344/N rats, although the overall percentage of Bcl-2-positive
mucous cells was lower compared with that in Brown Norway rats (data not
shown).
|
Changes in Bcl-2 mRNA levels in SPOC-1 cells treated with LPS or bezafibrate. We examined the direct effects of bezafibrate and LPS on Bcl-2 expression in rat tracheal epithelial cells by treating SPOC-1 cells. Although treatment with LPS had minimal effect on Bcl-2 mRNA levels (Fig. 7A), treatment with bezafibrate decreased the amount of Bcl-2 mRNA by approximately one-half compared with vehicle-treated controls (Fig. 7B).
|
| DISCUSSION |
|---|
|
|
|---|
We chose to focus our studies on the effects of various LPS doses at 72 h postinstillation because our studies in F344/N rats show that MCM reached maximum levels at this time point. In Brown Norway rats, MCM had reached maximum levels 2 days postinstillation and persisted at least until 4 days (38), suggesting that the development of MCM is strain dependent. Both mucous cell numbers and the volume of intraluminal mucosubstances (Vs) per mm BL were increased in a dose-dependent manner. However, major differences were noted in the extent of these measures for MCM. Although 50 µg of LPS were sufficient to increase the numbers of mucous cells twofold compared with saline controls, 100 µg of LPS were required to increase Vs twofold compared with saline-instilled rats. Furthermore, 500 and 1,000 µg of LPS instillation did not significantly increase the number of mucous cells once they were increased twofold compared with saline controls by instillation of 100 µg of LPS. However, Vs was increased from twofold at 100 µg to 4.5-fold when 1,000 µg of LPS were instilled. These results show that mucous cell numbers reached maximum levels at 3040 per mm BL, and additional increases in inflammation only caused the accumulation of mucosubstances within each of those mucous cells. Increases in mucous cell numbers by low levels of inflammation also suggest that cell numbers in airway epithelia may increase frequently. These changes would emphasize the importance of mechanisms involved in reducing cell numbers and in adjusting the cell types to proportions found in normal airway epithelia.
The percentage of Bcl-2-expressing mucous cells was significantly increased only at the 3- and 4-day time points at doses that increased Vs by 3- to 4.5-fold, indicating that high levels of inflammation are required for prolonged Bcl-2 expression. A low dose of LPS caused a transient expression of Bcl-2 in metaplastic mucous cells that was reduced to background levels 3 days postinstillation. Our studies in F344/N rats show that Bcl-2 positivity was maximum at 2 and 3 days postinstillation; our previous studies in Brown Norway rats show that the percentage of Bcl-2-positive mucous cells reached maximum levels 2 days postinstillation (38).
Because maximum Bcl-2 expression combined with increased storage of intraepithelial mucosubstances was associated with the doses of LPS that showed the highest levels of neutrophils, we suspected that mediators associated with neutrophils cause Bcl-2 expression in metaplastic mucous cells. Depletion of circulating neutrophils has been used to alter LPS-induced inflammatory response in various studies (41). Injection of anti-PMN antibodies caused a twofold decrease in the number of neutrophils and a twofold increase in macrophage numbers compared with control rats. Wagner et al. (41) report that circulating neutrophils were decreased from 700900/100 to <10 cells/100 µl of blood in F344/N rats injected with PMN antibodies. Therefore, decreased neutrophil numbers in the BAL may be a direct result of reduced availability of neutrophils in circulation. Neutrophil elastase is a known inducer of mucin expression and MCM (22, 40). However, the decrease in neutrophils in BAL was not accompanied with significant reduction of MCM. It may have been sufficient to cause maximum MCM by the presence of reduced numbers of neutrophils, particularly in combination with increases in macrophage numbers in the BAL.
Injection of rats with bezafibrate led to increased neutrophils in the BAL, whereas inflammation in the lung tissues was decreased compared with rats injected with vehicle. These observations suggest that bezafibrate augments the migration of neutrophils to the air spaces, thereby depleting the remaining cells in the lung tissues. However, the number of macrophages and other inflammatory cells in the BAL was not changed compared with controls. Bezafibrate likely causes the metabolism of arachidonic acid to shift from the cyclooxygenase pathway to an epoxygenase pathway, which produces anti-inflammatory epoxyeicosatrienoic acids (17, 39), and this pathway in turn may cause the reduction of general inflammation in the lung and MCM in the airways. The mechanism underlying the rapid migration of neutrophils due to bezafibrate injection is not understood but may be due to production of epoxyeicosatrienoic acids, which increase transmigration by decreasing adherence of neutrophils to endothelial cells (2, 24). Contrary to our expectation, increased numbers of neutrophils in the BAL under this circumstance were associated with a twofold reduction of MCM and suppression of Bcl-2 expression to background levels. Furthermore, although CYP26 expression is closely associated with mucous cell differentiation in normal human bronchial epithelial cells (15), injection of bezafibrate, a nonspecific P-450 inducer (5), caused a decrease in MCM. Our results from treating SPOC-1 cells with bezafibrate suggest that bezafibrate may directly affect airway epithelial cells to reduce Bcl-2 expression independently of its effect on the inflammatory response in vivo. Together with our previous report that Bcl-2, an antiapoptotic protein, is downregulated before the reduction of MCM (38), the present study suggests that bezafibrate may have reduced MCM by affecting expression of this protein.
The main inflammatory cell types recovered after LPS instillation were neutrophils and macrophages, whereas lymphocytes and eosinophils were present in low numbers. Our previous studies show that neutrophil numbers reach maximum levels 48 h after 1,000 µg of LPS are instilled and decrease to background levels 7 days postinstillation (36). Therefore, we assume that the number of neutrophils must have been on the decline at 72 h postinstillation, when rats were killed in the present study. Although the number of neutrophils increased in a dose-dependent manner, the number of macrophages was reduced at 1,000 µg of LPS from the maximum numbers reached at the 500-µg dose. This decrease may be associated with increased adherence of macrophages to epithelial cells in the presence of LPS (11) as was also observed in the present study (data not shown). LPS persists in the lungs longer, as shown by higher levels at the 1,000-µg dose, thereby prolonging adherence and delaying their migration into the lung air spaces. Other cell types, such as neutrophils, may have to clear the LPS before macrophages can migrate into the air spaces in higher numbers. Our previous study shows that the number of macrophages continues to increase over 7 days post-LPS instillation to reach numbers observed at 500 µg of LPS in the present study (36).
Analysis of the BALF from rats instilled with various doses of LPS
indicated a correlation of Bcl-2 expression with the presence of high levels
of LPS and IL-1
in the BALF. The observation that IL-6 and TNF-
levels were not detected at 3 days post-LPS instillation is consistent with
previous reports that show that these cytokines are elevated early after LPS
exposure and are reduced rapidly
(6). As expected, BALF from
rats instilled with 1,000 µg of LPS also had the most LPS remaining.
Because IL-1
is associated with mucin expression
(16), we expected that rats
with the highest MCM would have the highest IL-1
. However, levels of
IL-1
in the BALF from bezafibrate-treated rats were increased, whereas
MCM and Bcl-2 levels were suppressed compared with controls. In addition,
levels of IL-1
in the BALF from neutrophil-depleted rats were decreased,
whereas MCM remained unchanged and Bcl-2 positivity was increased 1.8-fold
compared with controls. This lack of correlation of these mediators with the
observed changes suggests that IL-1
is not likely responsible for
inducing MCM and Bcl-2 expression in this model. However, the role of this
inflammatory mediator and others, such as IL-6 and TNF-
, at early time
points post-LPS instillation and the possible involvement of macrophages
require further investigation.
Collectively, these findings suggest that the percentage of Bcl-2-positive mucous cells is independent of the numbers of neutrophils in the BAL. Whether neutrophils have an inhibitory role for Bcl-2 expression or whether their depletion results in decreased inhibition of an inducer of Bcl-2 expression is currently being investigated.
| ACKNOWLEDGMENTS |
|---|
DISCLOSURES
These studies were sponsored by the National Institutes of Health Grant ES-09237.
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
2-macroglobulin in fever and cytokine responses induced
by lipopolysaccharide in mice. Am J Physiol Regul Integr Comp
Physiol 283:
R218R226, 2002.
but not Fas
mediates reduction of allergen-induced mucous cell metaplasia by inducing
apoptosis. J Immunol 168:
47644771, 2002.This article has been cited by other articles:
![]() |
J. Xu, F. Xu, and E. Barrett Metalloelastase in lungs and alveolar macrophages is modulated by extracellular substance P in mice Am J Physiol Lung Cell Mol Physiol, July 1, 2008; 295(1): L162 - L170. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Schwalm, J. F. Stevens, Z. Jiang, M. R. Schuyler, R. Schrader, S. H. Randell, F. H. Y. Green, and Y. Tesfaigzi Expression of the proapoptotic protein Bax is reduced in bronchial mucous cells of asthmatic subjects Am J Physiol Lung Cell Mol Physiol, June 1, 2008; 294(6): L1102 - L1109. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. R. Bartner, N. E. Robinson, M. Kiupel, and Y. Tesfaigzi Persistent mucus accumulation: a consequence of delayed bronchial mucous cell apoptosis in RAO-affected horses? Am J Physiol Lung Cell Mol Physiol, October 1, 2006; 291(4): L602 - L609. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Tesfaigzi, J. D. McDonald, M. D. Reed, S. P. Singh, G. T. De Sanctis, P. R. Eynott, F. F. Hahn, M. J. Campen, and J. L. Mauderly Low-Level Subchronic Exposure to Wood Smoke Exacerbates Inflammatory Responses in Allergic Rats Toxicol. Sci., December 1, 2005; 88(2): 505 - 513. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Harris, M. J. Fischer, J. R. Hotchkiss, B. P. Monia, S. H. Randell, J. R. Harkema, and Y. Tesfaigzi Bcl-2 Sustains Increased Mucous and Epithelial Cell Numbers in Metaplastic Airway Epithelium Am. J. Respir. Crit. Care Med., April 1, 2005; 171(7): 764 - 772. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |