|
|
||||||||
B-inducing kinases
1Pulmonary and Critical Care and Renal Units, Department of Medicine, Massachusetts General Hospital, and Harvard Medical School, Boston 02114; 4Molecular Cardiology Research Institute, Tufts New England Medical Center and Department of Medicine, Tufts University School of Medicine, Boston, Massachusetts 02111; 2Chang Gung University, Tao-Yuan 333, Taiwan; and 3Internal Medicine and Nephrology Department, Amiens Hospital, 80054 Amiens, France
Submitted 31 January 2003 ; accepted in final form 21 April 2003
| ABSTRACT |
|---|
|
|
|---|
B and
activator protein (AP)-1 was blocked by NF-
B inhibitor and JNK
inhibitor, respectively. An NF-IL-6 site was not essential for cyclic
stretch-induced IL-8 promoter activity. Stretch also induced
NF-
B-inducing kinase (NIK) activation, and inhibition of NF-
B
attenuated IL-8 mRNA expression and IL-8 production. We conclude that
stretch-induced transcriptional regulation of IL-8 mRNA and IL-8 production
was via activation of AP-1 and NF-
B and was dependent on JNK and NIK
activation, respectively. A549 cells; mitogen-activated protein kinase; ventilation
The ARDS Network clinical trial (861 patients) of large-volume ventilation
vs. small-volume ventilation was stopped early because 22% fewer deaths were
found in the patients ventilated with smaller tidal volumes
(1a). The use of smaller tidal
volumes in humans leads to reduced concentrations of polymorphonuclear cells,
tumor necrosis factor-
(TNF-
), IL-1
, and IL-8 in the
bronchoalveolar lavage fluid
(33). The exact mechanism of
large volume ventilation-induced cytokine release is unclear. Understanding
these mechanisms may lead to new treatment strategies. In vitro stretch of
lung cells has been used to explore the possible mechanisms.
Intracellular messengers that are activated by mechanical cell stretch
include the mitogen-activated protein kinases (MAPKs)
(14,
18,
22,
36). MAPKs include the growth
factor responsive MAPKs, extracellular signal-regulated kinases (ERK) 1/2,
stress-responsive MAPKs, c-Jun NH2-terminal kinase (JNKs, also
known as stress-activated protein kinases), and the p38s
(9). On the basis of studies
employing pharmacological inhibitors, osmotic stress-induced IL-8 production
by neutrophils and TNF-
and IL-1
regulation of IL-8 in vascular
endothelial cells have been reported to be dependent on p38 activation
(11,
37). However, these studies
used inhibitors that have also been found to inhibit several JNK isoforms
(7). More recently, in
bronchial epithelial cells, stretch was found to activate JNK, ERK1/2, and
p38. Furthermore, ERK1/2 and p38 were found to play a role in stretch-induced
IL-8 production, but whether the JNKs mediate IL-8 production could not be
evaluated due to the lack of specific inhibitors of the JNK pathway
(30). Importantly, in vivo
studies of lung stretch found activation of JNK and ERK1/2 but not p38
(43).
The transcription of IL-8 is regulated by several transcription factors.
The 5' regulatory region of the IL-8 gene includes binding sites for
nuclear factor (NF)-
B, NF-IL-6, and activator protein (AP)-1
(13,
28). In bronchial epithelial
cells, cyclic stretch was found to activate AP-1
(30). NF-
B-inducing
kinase (NIK), an ERK-related kinase, also has been shown to regulate
NF-
B activation (20,
23). The transcription factors
involved in stretch-induced IL-8 production and the role of NIK in regulating
these factors have not been fully explored.
To begin to understand the role of JNK and NIK and transcription factors
NF-
B, AP-1, and NF-IL-6 in stretch-induced IL-8 production, we explored
how lung cell stretch induces IL-8 production. We hypothesized that
stretch-induced IL-8 production would be dependent on the JNK/AP-1 and
NIK/NF-
B pathways. We compared nonstretched static cells, cells exposed
to a low level of stretch to mimic low tidal volume breathing and those
exposed to a high level of stretch to mimic high tidal volumes seen in VILI.
We used adenovirus-mediated gene transfer of a dominant inhibitory mutant of
SEK-1, the immediate upstream activator of the JNKs, and various
pharmacological inhibitors to inhibit the JNK, NIK, and NF-
B. We found
that stretch induced IL-8 mRNA expression and IL-8 protein production, which
were dependent on JNK and NIK activation of transcription factors AP-1 and
NF-
B, respectively.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Two to three days before use, A549 cells were seeded at 3 x 106 cells/plate on membrane dishes for use in the mechanical strain device. These dishes consist of a plastic cylinder (100-mm diameter) with a circular silicone elastomeric membrane that serves as the culture surface. Fibronectin coating was used in A549 cells since expression of JNK and ERK1/2 has been found with fibronectin (22). On the day of stretching, medium was removed and replaced with serum-free medium to minimize the effect of residual growth factors. The plates were placed on the mechanical deformation device. The stretching device (U. S. patent no. 5,348,879, 1994) was provided by Dr. Martha Gray (Massachusetts Institute of Technology, Cambridge, MA) and has been described in detail (35). It provides a sinusoidal, spatially homogeneous, and isotropic biaxial strain to cultured cells. Strain is a measure of the degree of stretch and is expressed as the percentage of the change in cell length to resting cell length. By mathematical modeling, a change in lung volumes from 42% of the total lung capacity (TLC) to 64% of the TLC was associated with 32% of the alveolar surface area, which corresponded to 15% linear strain of alveolar cells. A change from 42 to 45% of TLC was associated with 4% of the alveolar surface area, corresponding to 2% linear strain. Cells were subjected to 20 cycles/min of either 2 or 15% strain for 5 min to 2 h. Parallel dishes of control cells were seeded identically and maintained without mechanical deformation. All experiments were performed in 5% CO2 at 37°C.
At the end of the experimental period, medium was removed and centrifuged
at 3,000 rpm for 10 min, then the supernatant was aliquotted, flash-frozen,
and stored at -70°C for further analysis of IL-8 production. For
measurements of kinase activation, plates were washed with Hanks' balanced
salt solution and 1 ml of lysis buffer [20 mM HEPES, pH 7.4, 1% Triton X, 10%
glycerol, 2 mM EGTA, 50 µM
-glycerophosphate, 1 mM sodium
orthovanadate, 1 mM dithiothreitol (DTT), 400 µM aprotinin, and 400 µM
phenylmethylsulfonyl fluoride (PMSF)] was added. Cells were removed by
scraping, transferred to Eppendorf tubes, and placed on ice for 15 min. Tubes
were centrifuged at 14,000 rpm for 10 min at 4°C and flash-frozen. For
isolation of mRNA and Northern blot analysis, plates were rinsed with Hanks'
balanced salt solution, treated with 3 ml of guanidine isothiocyanate with
2-mercaptoethanol, scraped, and frozen, or cells were lifted with
trypsin-EDTA, pelleted, and lysed.
IL-8 production. IL-8 production was measured in cell supernatants by a commercially available kit (R&D Systems, Minneapolis, MN).
JNK activation. Cell lysates were matched for protein concentration (Bio-Rad, Richmond, CA) before assay. For measurement of JNK activation, cell lysates were immunoprecipitated with JNK1 antibody (Santa Cruz Biotechnology, Santa Cruz, CA), which recognizes all the JNK isoforms, for 2 h while rotating at 4°C. Immune complexes were collected with protein G-Sepharose beads for 1 h while rotating at 4°C. Kinase assays were performed with glutathione S-transferase (GST)-c-Jun as substrate (6). Samples were resolved by SDS-polyacrylamide gel electrophoresis, stained with Coomassie blue, exhaustively destained, dried, and analyzed with phosphoimaging (Cyclone; Packard Bioscience, Meriden, CT) or autoradiography. We utilized osmolar stress as a positive control for JNK activation (800 mosM NaCl).
Immunoblot analysis. Crude cell lysates were matched for protein concentration, resolved on a 10% bis-acrylamide gel, and electrotransferred to Immobilon-P membranes (Millipore, Bedford, MA). Blots were blocked overnight at 4°C with 5% dried milk in TBST (20 mM Tris, pH 7.6, 137 mM NaCl, and 0.1% Tween 20), incubated with appropriate antibody (1:1,000) for 2 h at room temperature, washed with TBST, blocked with 5% dried milk in TBST, and incubated with horseradish peroxidase-conjugated anti-rabbit IgG (1:5,000) for 1 h at room temperature. Blots were developed by enhanced chemiluminescence (NEN Life Science Products, Boston, MA). For assay of ERK1/2 and p38 phosphorylation, Western blot analysis was performed with antibodies to phospho-ERK1/2 and phospho-p38 (New England BioLabs, Beverly, MA). For determination of JNK, ERK1/2, and p38 protein expression, Western blot analysis was performed with the respective antibodies (Santa Cruz Biotechnology). Positive controls for ERK1/2 and p38 activation were performed with 25 ng/ml of PMA and 800 mosM NaCl, respectively. mRNA isolation and Northern blot analysis. Total cellular RNA was isolated from the cells in 4 M guanidine hydrochloride followed by purification over a 5.7 M CsCl2 gradient (5) or was isolated with RNAqueous, a small-scale phenol-free total RNA isolation kit (Ambion, Austin, TX) according to the manufacturer's directions. Total RNA was fractionated on a 1.2% agarose gel containing 7% formaldehyde, transferred to Hybond-N (Amersham Life Science, Buckinghamshire, UK), and hybridized with [32P]dCTP Klenow-labeled random-primed mouse IL-8 cDNA probes. GAPDH mRNA was used to ensure equal loading.
Construction of adenoviral vectors. SEK-1 (KR) was produced by an
overlapping PCR method using a mutant PCR primer to produce an A-to-G
transposition at nucleotide 414, resulting in a Lys-to-Arg substitution at
lysine 129 (34). The
recombinant adenovirus encoding SEK-1 (KR) with a respiratory syncytial virus
(RSV) promoter (AdSEK) was prepared as previously described
(6). SEK-1 (KR) has been shown
to be specific for JNK and did not affect p38 or ERK1/2 activation
(34). The recombinant
adenovirus carrying the Escherichia coli LacZ gene encoding
-galactosidase (AdLacZ) with an RSV promoter was kindly provided by
David Dichek (University of Washington, Seattle, WA)
(6). Multiplicity of infection
(MOI) of 30300 was employed, and expression of SEK-1 (KR) was measured
by Western blot analysis with antibody to SEK-1 (MEK-4 K-18; Santa Cruz
Biotechnology).
Transfections and chloramphenicol acetyl transferase assays. A549
cells were transiently transfected with a wild-type IL-8 promoter construct
with a chloramphenicol acetyl transferase (CAT) reporter using Lipofectamine
(Invitrogen, Carlsbad, CA). Dr. Charles Kunsch provided wild-type and mutated
IL-8 promoter construct of NF-
B, NF-IL-6 (Atherogenics, Norcross, GA)
(16), and Dr. Naofumi Mukaida
(Kanazawa Univ., Tokyo, Japan) provided wild type and AP-1 mutant
(28). After stretch, CAT
expression was measured by ELISA (Roche Molecular Biochemicals, Mannheim,
Germany) on 100 µg of protein lysate as previously described
(4). To correct for variations
in transfection efficiency, we tested each construct at least three times with
separate plasmid preparations in three independent experiments and normalized
CAT activity by pCMV-
-galactosidase activity.
The combination of adenoviral infection and plasmid transfection with Lipofectamine was toxic to the cells. Therefore, to examine the role of JNK pathway in IL-8 promoter activity experiments, we used JNK inhibitor II (SP-600125; Calbiochem, La Jolla, CA). Unlike older nonspecific inhibitors, this pharmacological inhibitor has been shown to be relatively specific for JNK activity at the concentrations used herein (2, 10).
Other pharmacological inhibitors. Bisindolylmaleimide I
hydrochloride (GF-109203X, 5 µM; Sigma Chemical, St. Louis, MO), a protein
kinase C (PKC) inhibitor, was used to inhibit NIK expression
(25,
42). p38 inhibitor (SB-203580,
1 µM; Calbiochem), ERK1/2 inhibitor (PD-98059, 25 µM; Calbiochem), and
NF-
B inhibitor (SN-50, 50 µg/ml; Calbiochem) were used to explore
the roles of p38, ERK1/2, and NF-
B
(21). Cells were treated with
SP-600125, GF-109203X, SB-203580, and PD-98059 in DMSO, and SN-50 in water, or
equivalent amount of DMSO without inhibitors for 30 min to 3 h before
stretch.
Extraction of nuclear proteins and EMSA analysis. The cellular
pellet was resuspended in 1020 times its volume in buffer A
(lysis buffer) containing 50 mM KCl, 0.5% Igepal CA-630, 25 mM HEPES (pH 7.8),
1 mM PMSF, 2 µM leupeptin, 20 µg/ml aprotinin, 100 µM DTT and was
subsequently incubated 5 min on ice. Cells were collected by centrifugation at
2,000 rpm, and the supernatant was decanted. The nuclei were washed in
buffer A without Igepal CA-630, collected at 2,000 rpm, and
resuspended in buffer B (extraction buffer) containing 500 mM KCl, 25
mM HEPES (pH 7.8), 10% glycerol, 1 mM PMSF, 2 µM leupeptin, 20 µg/ml
aprotinin, and 100 µM DTT for 5 min on ice. The samples were subsequently
frozen and thawed twice using dry ice and a 37°C water bath, rotating 20
min at 4°C, and centrifuged at 14,000 rpm for 20 min. The clear
supernatant was collected, and nuclear protein concentration was measured by
the Bradford method. EMSA was done with the Gel Shift Assay System (Promega,
Madison, WI). In brief, nucleoproteins (10 µg) were incubated with
[
-32P]ATP (3,000 Ci/mmol; Amersham Pharmacia Biotech) in a
15-µl reaction mixture containing 50 mM Tris (pH 7.5), 250 mM NaCl, 5 mM
MgCl2, 2.5 mM EDTA, 2.5 mM DTT, 0.25 mg/ml poly(dI-dC), and 20%
glycerol. The oligonucleotide sequences were as follows: NF-
B
oligonucleotide (5'-AGTTGAGGGGACTTTCCCAGG-3'), AP-1
oligonucleotide [5'-d(C GCTTGATGAGTCAGCCGGAA)-3'], and NF-IL-6
oligonucleotide (5'-TGCAGATTGCGCAATCTGCA-3', from Santa Cruz
Biotechnology). To complete the specific binding reactions, we added each of
the 100-fold molar excesses of unlabeled oligonucleotides (cold
oligonucleotide probe) to the binding mixture before addition of the labeled
probe. Nucleoprotein complexes were resolved by electrophoresis on 4%
nondenaturing polyacrylamide gels in 0.5x Tris borate-EDTA buffer at 100
V for 3 h at room temperature. Dried gels were exposed to Kodak XAP-5 film at
-70°C with intensifying screens
(38).
Statistical evaluation. The EMSA, Northern blots, and Western blots were quantitated using a National Institutes of Health (NIH) image analyzer ImageJ 1.27z (NIH, Bethesda, MD) and were presented as arbitrary units only, ratio of IL-8 mRNA to GAPDH, GST-c-Jun to JNKs, or phospho-MAPK to MAPK (relative phosphorylation). All results were normalized to static cells with medium or vehicle alone. Values were expressed as the means ± SE of at least three experiments. Data were analyzed with Statview 4.5 (Abacus Concepts; SAS Institute, Cary, NC). ANOVA was used to assess the statistical significance of the differences followed by multiple comparisons with a Scheffé's test, and a P value < 0.05 was considered statistically significant.
| RESULTS |
|---|
|
|
|---|
|
Cell stretch-induced JNK and NIK activation. We measured activity of JNKs and NIK after 2 and 15% cyclic strain for 30 min. There was a dose-dependent increase in phosphorylation of JNKs but no change in the expression of JNK protein (Fig. 2A). There was also a dose-dependent increase in NIK protein expressions (Fig. 2B).
|
Cell stretch-induced MAPK activation. We measured activity of three families of MAPKs, JNKs, p38, and ERK1/2 in A549 cells exposed to 15% strain for 5 min to 2 h. Cyclic stretch of A549 cells resulted in a rapid activation of all three MAPKs but with markedly different time course of phosphorylation of MAPKs tested (Figs. 3A and 7, A and B). JNK activity was increased after 15 min of 15% strain stretch and further increased after 1 and 2 h of stretch. (Fig. 3A). There was no change in the expression of JNK protein, indicating an increase in JNK-specific activity (Fig. 3A). In contrast to JNK activity, activation of phospho-p38 and ERK1/2 lasted for 15 min and then decreased (Fig. 7, A and B).
|
|
JNK inhibition with a dominant-negative mutant of its upstream activator. Due to lack of specific pharmacological JNK inhibitors, it was difficult to explore the role of JNK activation in stretch-induced IL-8 production. To inhibit JNK activation, we infected A549 cells with adenovirus encoding the dominant-negative mutant of SEK-1, AdSEK, at 30300 MOI (6). After 48 h, there was an increase of SEK-1 (KR) expression (Fig. 3B). Cells were infected with AdSEK or AdLacZ at 300 MOI for 48 h and subjected to 15% strain at 20 cycles/min for 12 h. Although gene transfer of adenoviral vector alone caused an increase in baseline expression of IL-8 protein, stretch caused a significant rise in IL-8 expression over and above the baseline in AdLacZ-transfected cells. Gene transfer with AdSEK significantly attenuated stretch-induced JNK activation by both kinase activity assay (Fig. 3B) and immunoblotting with phospo-specific JNK antibodies (Fig. 3C), IL-8 mRNA expression (Fig. 3D), and IL-8 protein production (Fig. 4). These data suggest that stretch-induced IL-8 expression is, at least in part, dependent on JNK activation.
|
JNK inhibition with JNK inhibitor II blocked stretch-induced IL-8 mRNA expression and IL-8 protein production. We also pretreated A549 cells with the now available specific pharmacological JNK inhibitor II (SP-600125) to support our findings with gene transfer of SEK-1 (KR) (2, 10). Northern blot analysis and IL-8 protein measurement showed that stretch markedly increased the levels of IL-8 mRNA and IL-8 protein, and these were significantly reduced by SP-600125 (Fig. 5). Thus inhibition of JNKs by two different techniques, viral gene transfer of dominant inhibitors and pharmacological inhibition, blocked stretch-induced IL-8 production. We concluded that stretch-induced IL-8 expression is dependent, at least in part, on the JNK pathway.
|
Effects of JNK inhibitor II on the phosphorylation of p38, ERK1/2, and protein expression of NIK. We pretreated A549 cells with JNK inhibitor II and performed Western blot analyses to measure the effect of this inhibitor on the activation of p38, ERK, and NIK. No statistically significant inhibition of p38, ERK phosphorylation, and NIK protein expression was found (Fig. 6).
|
Inhibition of ERK1/2 and p38. To test the potential role of the more transient activation of phospho-p38 and ERK1/2 in stretch-induced IL-8 production, we treated A549 cells with specific MAPK inhibitors: SB-203580 (p38 inhibitor) and PD-98059 (ERK1/2 inhibitor). Neither of them significantly prevented the stretch-induced IL-8 production (Fig. 7C).
NF-
B and AP-1 binding sites are required for
stretch-induced increase in IL-8 promoter activity. To determine the
relative contribution of specific elements within the IL-8 promoter,
NF-
B, NF-IL-6, and AP-1, we transiently transfected A549 cells with
wild-type IL-8 promoter-CAT constructs and wild-type IL-8 promoter plasmids
with mutation of NF-
B, NF-IL-6, or AP-1 binding sites. NF-
B and
AP-1 mutants, but not the NF-IL-6 mutant, significantly blocked cyclic
stretch-induced increase in IL-8 promoter activity
(Fig. 8). The result
demonstrated that both NF-
B and AP-1 promoter elements are involved in
stretch-induced IL-8 gene activation.
|
Cyclic stretch increased DNA binding by NF-
B and AP-1
but not NF-IL-6. We performed EMSA to further identify the amplitudes and
kinetics of stretch-induced nuclear protein-DNA complex formation. Stretch
increased NF-
B and AP-1 binding to oligonucleotides with their
respective promoter elements in a dose-dependent manner
(Fig. 9). AP-1 was activated at
5 min of stretch and remained activated for up to 30 min. NF-
B was
activated in a time-dependent manner from 10 to 30 min of stretch
(Fig. 10). Competition with
binding was done with a 100-fold molar excess of unlabeled NF-
B or AP-1
consensus oligonucleotide (cold oligonucleotide probe). There was no
significant effect of stretch on the NF-IL-6 binding that appeared to be
constitutive (Fig. 10). These
data suggest that stretch activated NF-
B and AP-1 binding but not
NF-IL-6 binding to the IL-8 promoter.
|
|
JNK inhibitor II blocked stretch-induced IL-8 DNA binding by AP-1 but
not NF-
B. To determine which transcription factor is
activated in the stretch-induced JNK pathway, we pretreated A549 cells with
JNK inhibitor II (SP-600125) and performed EMSA. SP-600125 effectively
inhibited AP-1 binding activity but had no effect on NF-
B binding
activity (Fig. 11). These data
suggest that AP-1 binding activity was regulated by the JNK pathway but that
stretch-induced increase of NF-
B binding activity was via another
mechanism.
|
GF-109203X reduced stretch-induced NIK expression. To explore the
mechanism responsible for stretch-induced NF-
B binding to IL-8 DNA, we
determined NIK protein expression. NIK has been found to be an
autophosphorylated MAPK, and the protein expression of NIK correlates with
increased NIK activity as measured by activity assay
(20,
23). Expression of NIK was
increased after 5 min of stretch and persisted for 30 min of stretch. The
increased expression of NIK was reduced by GF-109203X
(Fig. 12, A and
B), a PKC inhibitor, which has previously been shown to
inhibit NIK expression in a dose-dependent manner
(25,
42). Inhibition of increased
NIK expression reduced stretch-induced IL-8 mRNA expression and NF-
B
activation but not AP-1 activation (Fig.
12, C and D). These data suggest that
stretch-induced IL-8 mRNA is also regulated by NIK and NF-
B.
|
Effects of PKC inhibitor on MAPK activation. We pretreated A549 cells with PKC inhibitor to test the effect of this inhibitor on the activation of JNKs, p38, and ERK1/2. Western blot analyses show that JNKs, p38, and ERK phosphorylation were not statistically significantly inhibited by PKC inhibitor (Fig. 13).
|
NF-
B inhibitor SN-50 attenuated stretch-induced IL-8
production, IL-8 mRNA expression, and IL-8 DNA binding by AP-1 but not
NF-
B. To explore the role of NF-
B in
stretch-induced IL-8 regulation further, we treated A549 cells with a specific
NF-
B inhibitor: SN-50
(21). Whereas the NF-
B
inhibitor effectively inhibited NF-
B, but not AP-1, binding activity
and IL-8 mRNA expression (Fig. 14,
A and B), there was less inhibition (40%) of
stretch-induced IL-8 protein secretion
(Fig. 14C) compared
with that of JNK inhibitor II (77%).
|
| DISCUSSION |
|---|
|
|
|---|
This is due to several factors. First, the reported pattern of stretch-induced MAPK activation differs depending on the cell type (14, 18, 22, 30, 36). In some cells, stretch induces activation of all three MAPKs, whereas in others, only a subset is activated. In addition, the regulation of IL-8 by MAPKs has differed depending on the stimulus (37) and the cell type (11, 19, 30). With stretch as the stimulus, Oudin and Pugin (30) found in BEAS-2B cells, an SV40-transformed bronchial epithelial cell line, that JNK, p38, and ERK1/2 were activated by stretch, and p38 and ERK1/2 were important in stretch-induced IL-8 production. However, studies in vivo with high tidal volume ventilation in rats found that JNK and ERK1/2 are activated, but p38 is not (43). Furthermore, in isolated rat lungs, inhibition of ERK1/2 with PD-98059 did not affect lung stretch-induced cytokine production (43). Consistent with these observations in vivo, we found that stretch-induced IL-8 production is not dependent on p38 and ERK1/2, rather we found that IL-8 is dependent on JNKs.
The biological roles of JNKs have been extremely difficult to characterize due to lack of specific pharmacological inhibitors. Although several investigators (30, 43) have found stretch-induced activation of JNK, the role of JNKs has not been defined. We employed two different strategies to determine whether stretch-induced IL-8 production was dependent on JNK, adenoviral gene transfer of SEK-1 (KR), the dominant-negative mutant of SEK1, an MEK immediately upstream of the JNKs that specifically inhibits the JNK pathway (6), and the recently available specific anthrapyrazolone inhibitor of JNK inhibitor II. Adenoviral transfection alone has been reported to induce IL-8 production (3). To control for the effects of adenoviral infection, we used AdLacZ. Infection was performed 48 h before stretch, and immediately before stretch, medium was changed to remove any adenovirus-induced IL-8 in cell supernatants. IL-8 production was higher in static cells with adenoviral transfection compared with noninfected cells, but we were able to induce further increases in IL-8 production with stretch. SEK-1 (KR) blocked this increase. We confirmed our findings with JNK inhibitor II, a small-molecule, ATP-competitive inhibitor with a >20-fold selectivity for JNKs (IC50 - 0.110.15 µM) over ERK2 and p38 (IC50 > 30 µM) when tested in cell culture (2, 10). These data are the first of which we are aware to directly implicate JNKs in the stretch-induced regulation of IL-8 gene expression.
Although JNK inhibition statistically blocked IL-8 production by SP-600125,
we also explored other possible mechanisms. We found stretch induced
expression of NIK, an ERK-related kinase, which has been shown to regulate
NF-
B activation in a time-dependent and dose-dependent manner
(20,
23). In our study, we also
have shown stretch induced NIK expression in a dose- and time-dependent manner
(Figs. 2B and
12A). Although
specific pharmacological inhibitors for NIK were not available, we used
GF-109203X, a PKC inhibitor, which has been shown to inhibit NIK
(25) with minimal effects on
MEKK1, JNK, p38, and ERK (Ref.
7 and
Fig. 13). GF-109203X inhibited
stretch-induced NIK expression but only partially blocked IL-8 mRNA expression
and IL-8 protein production. Yamamoto and associates
(45) also found that PKC
inhibitors blocked stretch-induced IL-8 production in A549 cells, but they did
not measure NIK expression. Thus stretch-induced IL-8 production also appears
to involve NIK activation that may be PKC dependent.
Transcriptional regulation of the IL-8 promoter involved the interaction of
NF-
B, AP-1, and/or NF-IL-6, depending on the cell type
(30,
43) and stimuli employed
(1,
1517,
24,
27,
29,
44). Cyclic stretch-induced
activation of NF-
B has been found in isolated perfused mouse lungs
(12) and rat lungs
(43) and macrophages
(31). Oudin and Pugin
(30), employing
SV40-transformed bronchial epithelial cells, found stretch induced activation
of AP-1 but not NF-
B after 4 h of stretch. In contrast, our data
suggest that both AP-1 and NF-
B were activated, and both were involved
in stretch-induced IL-8 production. The NF-IL-6 binding site was not essential
to stretch-induced IL-8 gene regulation, in that mutation of the NF-IL-6
binding site had no significant effect on stretch-induced IL-8 reporter
activity (Fig. 8).
Others have found that stretch activated NF-
B and that this was
blocked by a nonspecific inhibitor, dexamethasone
(12,
31). To confirm the role of
NF-
Binthe stretch-induced IL-8 production, we used a relatively
specific NF-
B inhibitor (SN-50)
(21) and found inhibition of
NF-
B activity, IL-8 production, and IL-8 mRNA expression.
To identify the cell types involved in lung stretch-induced activation of MAPKs, Uhlig et al. (43) used immunohistochemical staining of rat lung tissue and found activation of JNK and ERK1/2 in type II pneumocytes. Insufficient numbers of type II pneumocytes could be freshly isolated to form confluent cell layers in our stretcher. Therefore, we selected human alveolar epithelial A549 cells for study, because they maintain features of type II pneumocytes through their morphological appearance and ability to secrete a variety of cytokines and growth factors, including monocyte chemotactic protein-1, IL-8, and intercellular adhesion molecule-1 (39).
In both humans and animals, lung stretch has been shown to be associated
with release of chemokines. We have found that in an in vitro model of lung
cell stretch, transcription regulation of IL-8 gene involved the action of at
least two different signal transduction pathways, JNK/AP-1 and
NIK/NF-
B, but only the JNK pathway appeared necessary for
stretch-induced IL-8 production.
| ACKNOWLEDGMENTS |
|---|
DISCLOSURES
This work was supported by National Heart, Lung, and Blood Institute Grants HL-039020, HL-61688, and HL-67371.
We thank Susannah Wood for generous financial support.
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
B and
is blocked by steroids. Am J Respir Crit Care Med
163: 711716,
2001.
B-inducing kinase action. Mol Cell
Biol 18:
58995907, 1998.
B by a synthetic peptide containing a cell
membrane-permeable motif and nuclear localization sequence. J Biol
Chem 270:
1425514258, 1995.
B induction by TNF, CD95 and IL-1. Nature
385: 540544,
1997.[Medline]
B in respiratory syncytial virus-induced
interleukin-8 gene expression in airway epithelium. J Infect
Dis 177:
12751281, 1998.[ISI][Medline]
B-inducing kinase in T cell activation through the
TCR/CD3 pathway. J Immunol 169:
11511158, 2002.
B-
and cis-regulatory enhancer binding protein-like factor binding elements in
activating the interleukin-8 gene by pro-inflammatory cytokines. J
Biol Chem 265:
2112821133, 1990.
B-binding
sites of the IL-8 gene. J Virol
71: 56925695,
1997.[Abstract]
B and NFAT with the interferon-
promoter. J Biol
Chem 272:
3041230420, 1997.This article has been cited by other articles:
![]() |
C. D. Ochoa, H. Baker, S. Hasak, R. Matyal, A. Salam, C. A. Hales, W. Hancock, and D. A. Quinn Cyclic Stretch Affects Pulmonary Endothelial Cell Control of Pulmonary Smooth Muscle Cell Growth Am. J. Respir. Cell Mol. Biol., July 1, 2008; 39(1): 105 - 112. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. R. Amura, K. S. Brodsky, B. Gitomer, K. McFann, G. Lazennec, M. T. Nichols, A. Jani, R. W. Schrier, and R. Brian Doctor CXCR2 agonists in ADPKD liver cyst fluids promote cell proliferation Am J Physiol Cell Physiol, March 1, 2008; 294(3): C786 - C796. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Haegens, J. H. J. Vernooy, P. Heeringa, B. T. Mossman, and E. F. M. Wouters Myeloperoxidase modulates lung epithelial responses to pro-inflammatory agents Eur. Respir. J., February 1, 2008; 31(2): 252 - 260. [Abstract] [Full Text] [PDF] |