|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 gene in adult rat lung epithelial cells
Department of Medicine, Pulmonary and Critical Care Division, University of Minnesota, Minneapolis, Minnesota 55455
Submitted 6 February 2003 ; accepted in final form 25 April 2003
| ABSTRACT |
|---|
|
|
|---|
1-subunit Na+-K+-ATPase mRNA expression
two- to threefold within 3 h after exposure to the GC. The increased gene
expression was due to increased transcription as demonstrated by nuclear
run-on assays, whereas mRNA stability remained unchanged. Transient
transfection of 5' deletion mutants of a
1
promoter-reporter construct demonstrated a 1.5- to 2.2-fold increase in
promoter activity by Dex. All of the 5' deletion constructs contained
partial or palindromic GC regulatory elements (GRE) and responded to GC. The
increased expression of promoter reporter was inhibited by RU-486, a GC
receptor (GR) antagonist, suggesting the involvement of GR. The palindromic
GRE at -631 demonstrated Dex induction in a heterologous promoter construct.
Gel mobility shift assays using RLE nuclear extracts demonstrated specific
binding to this site and the presence of GR. We conclude that GC directly
stimulate transcription of Na+-K+-ATPase
1 gene expression in adult rat lung epithelial cells through
a GR-dependent mechanism that can act at multiple sites. sodium pump; glucocorticoid receptor; glucocorticoid response element; promoter; alveolar fluid; ion transport; type II cells
-subunit (113 kDa) and a smaller glycosylated
-subunit (35
kDa). The two subunits consist of at least four isoforms
1-
4 and
1-
4 that are expressed in a tissue- and
cell-specific manner (11,
24,
25,
31,
52). The
-subunit
mediates the catalytic activity of the enzyme, and the
-subunit plays a
role in trafficking and anchoring the enzyme to the plasma membrane
(29,
34). In the lung, the
-subunit appears to be rate limiting for the assembly of the

-complex and regulates the level of enzyme transported to the
plasma membrane (22,
32,
35).
Glucocorticoids (GC) regulate the expression of
-and
-subunits
of the Na+-K+-ATPase gene in a variety of tissues
including lung, kidney, liver, heart, cardiac muscle, and smooth muscle
(4,
26,
36,
38,
46,
48). For example, GC increased
renal Na+-K+-ATPase
1-and
1-subunit mRNA three- to sixfold and its corresponding
activity two- to threefold in neonatal rats but not in adult rats
(6,
7). In cultured rat aorta
smooth muscle cells, Na+-K+-ATPase
1
and
1 mRNAs were augmented 2.5- and 10-fold by dexamethasone
(Dex) and aldosterone (Aldo), respectively. Although Dex-mediated induction of
the
1 mRNA occurred only through the glucocorticoid receptor
(GR), Aldo-mediated induction of the
1 mRNA utilized both
gluco- and mineralocorticoid receptors
(33).
GC can regulate Na+-K+-ATPase gene expression through
multiple complex mechanisms, including transcriptional, posttranscriptional,
translational, and protein activity regulation. In some cells, one or more of
these processes may coexist in the regulation of the sodium pump genes.
Although transcriptional effects of GC are a standard paradigm, the effects of
GC on mRNA stability and translation have been less appreciated until recently
(10). In nontransformed rat
liver cells, Dex differentially induced Na+-K+-ATPase
1 and
1 mRNA abundance 2- and 40-fold,
respectively, but the increased mRNA content was not due to increased
transcription of mRNA. The increased mRNA abundance was associated with only a
small increase in Na+-K+-ATPase activity (by 9%),
suggesting post-transcriptional and/or translational regulation also were
involved (4). Devarajan and
Benz (14) recently
demonstrated that in vitro GC can directly enhance
1-and
3-subunit translation via a GC-modulatory element in the
5' untranslated region of their mRNA.
GC induction of transcription commonly involves the binding of the GR to a
glucocorticoid response element (GRE) site within the promoter. The classic
GRE consists of inverted hexanucleotide repeats separated by three nucleotides
(GGTACA nnn TGTTCT) (3,
21). In the human
Na+-K+-ATPase
1 gene, a GRE site at
-650 conferred Dex responsiveness, whereas two other GREs at -1,048 and -276
were necessary only for optimal activation of
1 promoter by
the hormone (13).
In previous studies from our laboratory, maternal GC treatment influenced
Na+-K+-ATPase mRNA and protein expression in fetal rat
lung in vivo (26).
Furthermore, we demonstrated that GC increased
Na+-K+-ATPase transcription in a fetal rat lung
epithelial cell line (FD18)
(8). For the present report, we
studied the regulation of Na+-K+-ATPase
1 gene expression by Dex in an adult rat lung epithelial cell
line. The results indicate that Dex increased
1 mRNA via an
increase in transcription, without a change in mRNA stability, similar to the
FD18 cell line. Serial deletion studies of the
1 promoter
reveal at least one GRE at position -631 that functions as a binding site for
the GR. Transcriptional activation by Dex was inhibited by the GR inhibitor
RU-486, supporting the role of the GR in Dex upregulation.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmids. Plasmids containing the rat
Na+-K+-ATPase
1 gene promoter (a gift
of G. Gick) (30) and various
lengths of 5' flanking region were fused to a promoterless luciferase
gene in pGL3 reporter vector (Promega). We identified seven putative GRE sites
in the 817-bp upstream transcription start site using the MatInspector V2.2
program on the website at
http://transfac.gbf.de/TRANSFAC
(40). PCR primers around each
GRE site were designed to delete one or two GRE binding sites. Amplified PCR
fragments were ligated into Bgl II/HindIII sites in the
polylinker region of pGL3 vector. These constructs were named
1-794,
1-714,
1-602,
1-390,
1-274, and
1-34. The
same cloning strategy was used to clone further upstream 5' flanking
region (from -817 bp to -4.4 kb), and these resulting constructs were named
1-4.4,
1-3.2,
1-2.1, and
1-1.2 (Fig.
1). The plasmid containing 4.4 kb of 5' flanking region of
1 Na+-K+-ATPase gene was previously
generated in our laboratory (unpublished data, Z. Zhao, C. Wendt, and D.
Ingbar, GenBank no. AF020685
[GenBank]
). An amplified PCR fragment from -714 to -602 was
ligated into phRLTK vector (Promega) to make the
phRLTK-
1(714-602) construct.
|
Cell culture. The RLE-6TN rat lung epithelial cell line derived from primary rat alveolar epithelial cells that were transformed with the SV40-T antigen gene was purchased from ATCC (16). The original cell line exhibited characteristics of alveolar type II cells such as lipid-containing inclusion bodies and expression of cytokeratin. RLE cells were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal calf serum (Invitrogen, Carlsbad, CA), 100 units/ml penicillin, and 100 µg/ml streptomycin. Dex-treated cells were grown in DMEM supplemented with endogenous GC-removed serum (stripped serum) plus indicated concentrations of Dex. Serum was mixed with Bio-Rad AG1-X8 resin (5 g resin/100 ml serum) three times and filtered to remove resin each time to remove endogenous GC (8, 43). This procedure previously was confirmed to remove >99% exogenously labeled trace GC.
RNA isolation and Northern analysis. RLE cells were grown in
DMEM/10% FBS to 50% confluence and were then placed in serum-free medium for
24 h to ensure GC-free conditions. The RLE cells were then treated with or
without Dex (10-5 and 10-7 M) for
various time intervals. Total RNA was isolated by the Tri reagent method
(Sigma) at time points of 0, 3, 6, 12, 24, and 48 h. Northern analysis was
performed with 10 µg of total RNA in an agarose-formaldehyde gel and
transferred to Hybond-XL membrane (Amersham Pharmacia, Piscataway, NJ)
(1). The membrane was
prehybridized in PerfectHyb Plus (Sigma) at 68°C for 2 h. The blots were
hybridized with a Na+-K+-ATPase
1 cDNA
probe labeled with Rediprime II Kit (Amersham Pharmacia) at 68°C for 18 h.
The membranes were washed two times in each condition for 5 min at room
temperature with 2x SSC, 30 min at 50°C with 2x SSC-1% SDS,
and 1 h at 68°C with 0.1x SSC-0.1% SDS. The blots were exposed to
Kodak X-film or phosphorimaging to quantitate the radioactive signal.
mRNA stability. Stability of Na+-K+-ATPase
1 mRNA was measured as done previously
(8,
9). In brief, RLE cells were
grown in the medium with or without Dex 10-5 M for 24 h
before the addition of Act D (10 µg/ml) to inhibit mRNA synthesis. Cells
were treated with Act D for 0, 3, 6, 9, 12, 15, 24, and 27 h. Total RNA was
isolated at each time point, and Northern blots were analyzed as described in
RNA isolation and Northern analysis. To calculate the mRNA half-life,
we represented the intensity of densitometry at each time point as the
percentage of the signal at time 0 (which was considered as 100%) and
plotted on a log scale as described
(9,
50). The data shown were from
six or seven independent experiments.
Nuclear run-on assay. The nuclear run-on assay was performed as
described by Schubeler et al.
(44) and Tao et al.
(45). In brief, nuclei were
isolated from RLE cells (1 x 107) treated with or without
10-7 M Dex overnight and incubated with 100 µCi (10
µl)
-[32P]UTP (3,000 Ci/mmol) for 30 min in a 30°C
water bath. The plasmid DNA containing either full-length
1
cDNA or
-actin (ATCC) was denatured and transferred to Hybond XL
membrane at 10 µg/slot as described by Sambrook and Russell
(42). The slot blots were
prehybridized in PerfectHyb Plus overnight; 13 million counts of RNA were
added and then hybridized at 60°C for 72 h. The blots were washed as
previously described (45), and
the RNA-integrated optical density was determined by Molecular Analysis
Software (Bio-Rad).
Transfection and luciferase assays. RLE cells were grown to 40-50%
confluence in DMEM supplemented with 10% stripped FBS. We transfected cells
with Lipofectamine Plus following the standard method of Invitrogen. Each
transfection contained 0.25 µg of plasmid DNA with various deletion mutants
of Na+-K+-ATPase
1 gene, 0.1 µg
pSV-
-Gal (Promega), 6 µl Plus reagent, and 4 µl Lipofectamine
reagent (Invitrogen) in a total volume of 1 ml. After a 3-h incubation, the
transfection solution was replaced with fresh DMEM with or without Dex
(10-5-10-8 M). Forty-eight hours
later, cells were lysed by luciferase assay lysis buffer, and the cell lysate
was centrifuged and assayed for luciferase activity with the
Luciferase/Renilla Luciferase Assay System (Promega). All luciferase
activities were normalized to
-galactosidase activity that was measured
using the Galacto-Star method (Tropix, Bedford, MA). For the RU-486 inhibition
experiments, after transfection, cells were incubated with 5x
10-6 M RU-486 for 2 h before incubation with
10-8 M Dex. Incubations were continued for 48 h until
luciferase assay was performed.
Preparation of cellular extracts. RLE cells were treated with 10-7 M Dex for 3 h before the preparation of nuclear extracts. Nuclear extracts were prepared according to a modified procedure described by Dignam et al. (15), with the omission of dialysis. Protein concentrations were determined by the bicinchoninic acid method (Pierce, Rockford, IL). Whole cell extracts were prepared from Dex-treated RLE cells according to the method of Derfoul et al. (13).
EMSA. A double-stranded synthetic oligonucleotide
(ATTGTCCGGATTGAGGTGGTTCAAGC) corresponding to the rat
Na+-K+-ATPase
1 gene from position -631
to -606 was used as a probe. Human tyrosine amino transferase gene GRE
CTAGGCTGTACAGGATGTTCTGCCTAG was used as a GRE consensus
DNA site for competition experiments (Affinity BioReagents, Golden, CO)
(41). An oligonucleotide
containing an AP2 consensus sequence (Promega) was used as a nonspecific
competitor. Oligonucleotides were either end radiolabeled as probes or
unlabeled for use as competitors.
Nuclear extracts (5 µg) and 32P-labeled
1-631 (0.3-0.4 ng) were incubated in 30 µl of buffer
containing 10 mM Tris (pH 7.5), 4% glycerol, 1 mM MgCl2, 0.5 mM
EDTA, 0.5 mM DTT, 50 mM NaCl, and 0.05 mg/ml poly(dI-dC)·poly(dI-dC)
for 20 min at room temperature. In some reactions, a 50- to 115-fold excess of
cold competitors was incubated for 10 min at room temperature before the
addition of radiolabeled probe. The reaction mixture was applied to a 4%
nondenaturing polyacrylamide gel and electrophoresed in 0.5x
Tris-borate-EDTA buffer at 200 V for 2 h at room temperature. The gel was
dried under vacuum and autoradiographed at -80°C.
Western blotting. The -631 oligonucleotide probe used in the EMSA was biotin-labeled for use in purification of DNA binding proteins. The biotinylated probe was mixed with prewashed streptavidin paramagnetic particles (SAPMP) in 1x gel shift binding buffer (see EMSA) at room temperature for 30-60 min. Probe-bound SAPMP were washed three times with 1x gel shift buffer to remove any free probe. The beads were then added to 1,000 µg of whole cell extract in 1x gel shift binding buffer and incubated at room temperature for 20-30 min. The SAPMP mixture was washed four times with 1x gel shift binding buffer, and the particles were magnetically separated from the solution. Proteins bound to SAPMP were loaded onto a 7.5% denaturing gel and separated by electrophoresis. Proteins on the gel were transferred electrophoretically to an Immobilon-P membrane (Millipore, Bedford, MA). The membrane was blocked with 5% dry milk in TBS (20 mM Tris, pH 7.5, 150 mM NaCl) with 0.1% Tween 20 and then incubated with anti-GR antibody 1:500 (Santa Cruz Biotechnology, Santa Cruz, CA) at room temperature for 1 h followed by incubation with an anti-rabbit IgG conjugated to horseradish peroxidase at 1:2,000 (Sigma). Protein detection was via an enhanced chemiluminescence reaction (Amersham Pharmacia).
| RESULTS |
|---|
|
|
|---|
1 mRNA level. RLE cells were treated with
Dex at concentrations of either 10-7 or
10-5 M for various time intervals. Total RNA was
isolated for Northern study with
1 cDNA as a probe. Within 3
h of Dex exposure,
1 mRNA steady-state level increased
dramatically, approaching peak levels. The maximal mRNA upregulation was
achieved within 6 h, demonstrating approximately a threefold increase at both
Dex concentrations (Fig.
2).
|
Dex did not alter
Na+-K+-ATPase
1 mRNA stability. In some systems, GC
regulates gene expression posttranscriptionally. As an example, GC increased
human growth hormone mRNA expression by increasing its RNA stability as well
as RNA synthesis (37). In the
fetal rat lung, GC increases fatty acid synthase mRNA stability
(51). To investigate whether
the increase in Na+-K+-ATPase steady-state
1 mRNA levels in RLE cells was due to an increase in mRNA
stability, we measured half-lives of Na+-K+-ATPase
1 mRNA in the presence or absence of Dex
(10-5 M). The calculated half-life for
1-subunit mRNA from multiple experiments was identical,
comparing the control with Dex-treated cells (15.0 ± 0.9 h vs. 15.4
± 0.7 h, Fig. 3). This
suggests the increased steady-state mRNA level of
1-subunit
with GC is secondary to an increase in transcription.
|
Dex increased
Na+-K+-ATPase
1 gene transcription rate. To directly
measure whether Dex increased Na+-K+-ATPase
transcription, we performed nuclear run-on assays in isolated nuclei comparing
control cells to cells treated with Dex (10 -7 M)
overnight. Full-length actin cDNA was used as an internal control for
normalization. Dex increased the transcription rate of
Na+-K+-ATPase
1 gene an average of
1.8-fold in two independent experiments with similar response in each (1.6-
and 1.9-fold, Fig. 4). This
correlated to an increase in mRNA steady-state levels of between 1.6- and
2.1-fold (Fig. 2).
|
Dex induced Na+-K+-ATPase
1 gene promoter activity. To analyze the
regulation of the Na+-K+-ATPase
1
promoter activity by Dex, we transiently transfected RLE cells with DNA
constructs containing the
1 promoter (from -794 to +123,
Fig. 1A; -4.4 to +151,
Fig. 1B) linked to the
luciferase reporter gene in the pGL3 vector. For the -794-bp construct,
luciferase activity increased 1.8-fold in Dex-treated cells compared with
untreated cells (Fig. 5, A and
C), and the -4.4-kb construct demonstrated a 1.5-fold
increase in luciferase activity (Fig.
5B). The maximal increase in promoter activity by Dex
induction was demonstrated in the
1-714 and
1-3.2 constructs, with a 2.2-fold increase of each. The
results of 5' deletion were confirmed in a second plasmid vector (phRL
vector from Promega) to rule out vector-specific responses to Dex (data not
shown). Serial deletion between -794 and -714 resulted in a fivefold increase
in the basal promoter activity, suggesting the presence of strong negative
cis-regulatory elements within this region.
|
Computer analysis with MatInspector to look for homologous GRE sites
revealed multiple sites in the 5' flanking region between -350 and -4.4
kb. In the proximal promoter we identified six half-site GREs at positions
-788, -758, -700, -594, -589, and -350
(Fig. 1A). The GRE at
position -631 was palindromic, consistent with a full GRE and was homologous
to a functional GRE site at -650 to -630 in the human
Na+-K+-ATPase
1 gene promoter
(13). The search also revealed
five full palindromic GRE sites in the upstream region from -817 bp to -4.4 kb
(Fig. 1B). To
determine whether these GREs were functional, we transfected plasmids
containing various lengths of 5' deletions of the
1
promoter into RLE cells and studied for Dex responses. Serial deletion
constructs demonstrated variability in the basal transcription activity;
however, the fold induction of Na+-K+-ATPase promoter
activity by GC remained relatively unchanged (from 1.5- to 2.2-fold)
(Fig. 5, A-C). The
elimination of all putative GRE sites resulted in minimal promoter activity
identical to that of the empty vector.
Statistical analysis revealed a small but statistically significant
decrease in promoter induction by GC between
1-714 and
1-602 (P < 0.05,
Fig. 5C). To confirm
that the full palindromic GRE at -631 was functional, we transfected RLE cells
with phRLTK-
1(714-602) construct that contained the -631
site. The results of transient transfection experiments demonstrate that the
GRE at -631 activated transcription in response to Dex in a heterologous
promoter vector (Fig.
5D). This induction was orientation specific, since the
reverse sequence did not result in upregulation by Dex.
RU-486 inhibited Dex induced
Na+-K+-ATPase
1 promoter activity. RU-486 exerts its
anti-GC activity at several steps of receptor action such as prevention of
complete GR transformation and inhibition of chromatin remodeling and
transactivation (5). To examine
whether Dex-mediated induction of the
1 gene occurs via the
GR or alternative mechanism, we transfected RLE cells with reporter plasmids
containing various lengths of the 5' deletion constructs of the
1 promoter followed by pretreatment with RU-486 before the
addition of Dex (10-8 M). RU-486 alone, in the absence
of Dex, had no effect on
1 promoter expression
(Fig. 6A); however,
the Dex-induced promoter activity was eliminated by RU-486 for all constructs
studied (Fig. 6). These
findings demonstrating RU-486 inhibition of Dex-mediated induction of the
1 promoter suggest that the Dex induction occurs through a
GR.
|
GR bound to GRE at -631. We studied the full palindromic
GRE at -631 in the rat
1 proximal promoter, since it had
significant sequence homology to the human GRE at -650 to -630, matching 11 of
12 bases and demonstrated increased promoter activity in deletion analyses as
well as the heterologous expression system
(Fig. 5, C and
D). We utilized gel mobility shift assays to identify
protein binding of this site. The synthetic oligonucleotide from -631 to -606
was end labeled as a probe to perform gel mobility shift assays. When this
probe was incubated with the nuclear extract from Dex-treated cells, one
dominant band (shown by arrow) along with three weak bands were identified
(Fig. 7A, lane
2). Competition experiments using a well-defined consensus GRE showed
specific competition with the dominant band only (lanes 3 and
4), whereas a nonspecific oligonucleotide (AP2) was a weak competitor
(lane 5). These results suggest that the GR was part of the
DNA-protein complex that binds in the -631 region. For confirmation, the -631
GRE was incubated with whole cell extracts, and the bound proteins were
subjected to Western analysis using a GR-specific antibody. A distinct single
band on the Western blot demonstrated the presence of GR in the GRE-protein
complexes (Fig. 7B).
Supershift experiments using the same anti-GR antibody resulted in a smear of
DNA-protein complex at higher molecular weight, rather than a distinct shift
(data not shown). This result of the supershift assay suggests more than one
protein may be present in this binding assay, resulting in the incomplete
access of the GR antibody. The multiple protein complex with the GR has been
previously reported (39). The
other palindromic GRE located at -1,045, -2,063, -2,487, -2,620, and -4,267
also demonstrated specific binding in vitro with nuclear extracts at the same
gel shift position as that of GRE at -631 but with relatively lower affinities
than the GRE at -631 (data not shown).
|
| DISCUSSION |
|---|
|
|
|---|
1-subunit gene in a GR-dependent fashion and that the
palindromic GRE at -631 of the promoter was functional and bound to GR.
Understanding the mechanism of Na+-K+-ATPase gene
regulation by Dex should provide insight into manipulation of sodium pump
expression by GC during development and alveolar edema states.
The various Na+-K+-ATPase isoforms are differentially
regulated by GC depending on cell type. In liver cells of adrenalectomized
rats, Dex increased the
1-subunit mRNA markedly more than the
1-subunit mRNA (40- vs. 2-fold)
(4). Another example of the
differential regulation of the
1-subunit mRNA occurred in
cultured adult rat alveolar epithelial type II cells
(2); after 6, 12, and 24 h of
incubation with Dex,
1 mRNA increased by 2-, 3-, and
1.5-fold, whereas the steady-state level of
1 mRNA remained
unchanged. These studies suggest that the
1-subunit gene
contains elements essential for the response to Dex, whereas the
1-subunit gene might lack these elements or may be
indirectly activated. Additional supportive data derives from the
mineralocorticoid receptor/GR induction of human
1 and
1 Na+-K+-ATPase gene expression.
GR-dependent induction of the human Na+-K+-ATPase gene
was greater for the
1-subunit gene than the
1-subunit gene
(13,
27). In the lung, the
1-subunit is felt to be the rate-limiting step for functional
sodium pumps. In rat fetal lung epithelial cells (FD18), Dex induced a more
rapid initial increase in
1 compared with
1-subunit mRNA level (6 vs. 18 h)
(8). Therefore, we focused our
studies on the
1 gene regulation by Dex.
Our results demonstrate that Dex induced a rapid increase in
Na+-K+-ATPase
1 mRNA abundance. A
similar increase occurred in a rat liver cell line, with mRNA level peaking at
6 h after Dex induction (4).
Our previous studies in a fetal rat lung epithelial cell line (FD18)
demonstrated a delay in the maximum mRNA level for
1 gene
occurring at 24 h. This discrepancy in the response to Dex of the
1 gene between fetal and adult lung epithelial cells may
represent differences that reflect developmental stage or the presence of
other transcription factors.
GC can regulate specific mRNA levels at the post-transcriptional level, including altering of RNA stability and stimulating of nuclear-cytoplasmic transport (10, 20). In our study, treatment with Dex did not change mRNA stability. This result from adult cells is consistent with our prior observations in fetal lung epithelial cells where Dex did not alter mRNA stability (8). We did not examine sodium pump protein levels or whether there is also an independent effect of Dex on translation.
Similar to other genes subject to GC regulation, the
Na+-K+-ATPase promoter has multiple putative responsive
elements for the GR. Transient transfection experiments using 5'
flanking sequences linked with the luciferase receptor gene showed a twofold
increase in promoter activity by Dex. However, deletion of serial putative GRE
sites had little effect on the magnitude of the Dex-dependent induction. The
maximal induction by Dex occurred in construct
1-714, which
included the full GRE site at -631. The physiological relevance of these
multiple sites remains unknown. First, only some or possibly one site may be
physiologically relevant. That is, only certain sites may be accessible for
DNA protein binding due to chromatin conformation or the modification of core
histones, such as acetylation. These conformational changes and/or histone
modifications may not play a role in transient transfection experiments where
relatively small pieces of promoter DNA are introduced into the cell. Because
Na+-K+-ATPase is considered an essential housekeeping
gene and the
1-subunit is rate limiting in lung epithelial
cells, there may be sufficient redundancy that weaker GRE assume functional
significance as 5' deletion is augmented. This pattern was seen for the
multiple SP1 sites involved in hyperoxic stimulation of
Na+-K+-ATPase
1-subunit transcription
(49). Similar observations
also were reported in the GC induction of human insulin receptor gene (hIR)
expression. Although each GRE in hIR was functional in vitro by GC, the
contribution of multiple GREs expression was neither additive nor cooperative
(28). There is mounting
evidence that the GR is recycled within the nucleus between sites of
sequestration and active DNA binding during transcriptional activation
(12,
19). The presence of GC
results in activation and a bias toward enhanced DNA binding over
sequestration. This implies that GR interactions with DNA-specific elements
are dynamic and the GR may occupy its target sites only transiently. In
addition, these target sites may vary depending on DNA accessibility, which in
turn may be dependent on chromatin structure and histone modification. This
suggests that multiple sites, although not simultaneously, may participate in
the GC response. It is noteworthy to point out that the level of
transcriptional induction of Na+-K+-ATPase
1 promoter is consistent with the two- to threefold increase
in steady-state
1 mRNA by GC observed in vivo. Although this
degree of induction is not very large compared with stress-responsive mRNAs,
such as heat shock proteins or heme oxygenese, it is quite significant for an
essential housekeeping gene whose protein consumes large amounts of ATP.
GC often mediate their effect through the intracellular GR but can act
through other signaling pathways. In the case of GRs, the hormone-receptor
complexes are transported into the nucleus and bind to a GRE sequence in
target genes. GR are known to be present in lung epithelial cells, thus
enabling them to be targets for GC action
(23). Although multiple GRE
within the Na+-K+-ATPase
1 promoter
conferred activity in our deletion studies, we chose to study the GRE at -631
since it is a full palindromic GRE, confers the highest activity, and is
homologous to the functional mineralocorticoid response element/GRE at
positions -650 to -630 on the human
1-subunit promoter
(13). Our RU-486 inhibition
data indicate that the GR was involved in the transcriptional stimulation by
GC. Our in vitro DNA binding assay also showed specific binding of the -631
GRE with nuclear extracts. This specific DNA-protein complex was inhibited by
cold consensus GRE sequences, and we demonstrated the presence of GR by a GR
antibody in Western blotting. In addition, we confirmed that the GRE at -631
was induced by Dex in the absence of its native gene when this promoter region
(-631 to -606) was placed in a heterologous thymidine kinase promoter. Similar
full-site GRE located upstream (-1,045, -2,063, -2,487, -2,620, and -4,267)
also showed specific binding with nuclear extracts in gel mobility shift
assays. However, they had relatively lower affinities compared with the GRE at
-631 (data not shown). These distal full-site GRE demonstrated similar Dex
induction as the proximal GRE, showing a 1.5- to 2.2-fold increase in promoter
activity (Fig. 5B).
Again, serial deletion of the distal GRE had little effect on the magnitude of
the Dex-dependent induction. The relative contribution of the other GRE sites
to transcription in vivo remains unknown.
In summary, we report that GC stimulate the transcription of the
Na+-K+-ATPase
1 gene as demonstrated by
an increase in the steady-state
1 mRNA levels, no alteration
in mRNA stability, and an increase in
1 promoter activity in
promoter-reporter transfection experiments. Direct measurements of
transcription via nuclear run-on assay confirm this finding. In addition, GR
plays a role in this induction, since transcription is inhibited by the GR
antagonist RU-486, and GR is present in binding assays. Understanding the
molecular mechanism of GC regulation of sodium pump and other transport
proteins may improve our therapeutic approaches to treating lung edema during
development and lung injury.
| DISCLOSURES |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
1 gene. We thank Drs.
Howard Towle and Michele Sanders for critical reading of the manuscript. | FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
* C. H. Wendt and D. H. Ingbar served as joint senior authors with equal
contributions to this paper. ![]()
| REFERENCES |
|---|
|
|
|---|
1- and
1-subunit degradation: evidence for multiple subunit specific
rates. Am J Physiol Cell Physiol
264: C583-C590,
1993.This article has been cited by other articles:
![]() |
S. H. Kim, K. X. Kim, N. N. Raveendran, T. Wu, S. R. Pondugula, and D. C. Marcus Regulation of ENaC-mediated sodium transport by glucocorticoids in Reissner's membrane epithelium Am J Physiol Cell Physiol, March 1, 2009; 296(3): C544 - C557. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Unfried, U. Sydlik, K. Bierhals, A. Weissenberg, and J. Abel Carbon nanoparticle-induced lung epithelial cell proliferation is mediated by receptor-dependent Akt activation Am J Physiol Lung Cell Mol Physiol, February 1, 2008; 294(2): L358 - L367. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Pondugula, N. N. Raveendran, Z. Ergonul, Y. Deng, J. Chen, J. D. Sanneman, L. G. Palmer, and D. C. Marcus Glucocorticoid regulation of genes in the amiloride-sensitive sodium transport pathway by semicircular canal duct epithelium of neonatal rat Physiol Genomics, January 12, 2006; 24(2): 114 - 123. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |