AJP - Lung Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Lung Cell Mol Physiol 285: L719-L729, 2003. First published May 23, 2003; doi:10.1152/ajplung.00406.2002
1040-0605/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/3/L719    most recent
00406.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via ISI Web of Science (12)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Richter, M.
Right arrow Articles by Larivée, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Richter, M.
Right arrow Articles by Larivée, P.

Zinc chelators inhibit eotaxin, RANTES, and MCP-1 production in stimulated human airway epithelium and fibroblasts

Martin Richter, André M. Cantin, Claudia Beaulieu, Alexandre Cloutier, and Pierre Larivée

Unité de recherche pulmonaire, Faculté de médecine, Université de Sherbrooke, Sherbrooke, Québec, Canada J1H 5N4

Submitted 26 November 2002 ; accepted in final form 19 May 2003


   ABSTRACT
TOP
 ABSTRACT
METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
Asthma is characterized by an increased production of eosinophil-active C-C chemokines by the airway epithelium. Recent studies have identified the presence of important quantities of labile zinc in the conducting airways. We hypothesized that modulation of this labile zinc could influence the production of proinflammatory chemokines in respiratory epithelial cells. The zinc chelator N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine (TPEN) and the heavy metal chelator 2,3-dimercapto-1-propanesulfonic acid (DMPS) were used to reduce the labile zinc content of A549, BEAS-2B, and HFL-1 cells. Northern blot analysis and RNase protection assay were used to study the effects of the zinc chelators on mRNA expression. DMPS and TPEN specifically inhibited the production of eotaxin, regulated on activation, normal T-cell expressed, and presumably secreted, and monocyte chemotactic protein-1 in TNF-{alpha}-stimulated respiratory epithelial cells and fibroblasts through labile zinc chelation. The inhibitory effects of DMPS and TPEN were associated with the decreased binding of the zinc-finger transcription factor GATA-1, whereas no change in NF-{kappa}B activation was observed. Together these results demonstrate that modulation of the labile pool of zinc can regulate gene expression and protein synthesis of C-C chemokines in lung epithelial cells and fibroblasts.

CC chemokines; inflammation; asthma; regulated on activation, normal T-cell expressed, and presumably secreted; monocyte chemotactic protein

ASTHMA IS A COMPLEX INFLAMMATORY DISEASE of the airways characterized by airway hyperreactivity, reversible airway obstruction, mucus hypersecretion, inflammatory cell migration into the airways, bronchial epithelial desquamation, and airway remodeling. The bronchial epithelium in asthma is a major source of inflammatory molecules, mitogenic factors, and chemotactic mediators (10, 13, 14, 15, 28). One of these mediators produced by the activated epithelium in asthma is eotaxin. Eotaxin, a 74-amino acid protein, belongs to the CC family of chemokines and has ~50% sequence homology with the monocyte chemotactic proteins (MCPs). Via the CCR3 receptor, eotaxin induces eosinophil activation, chemotaxis, aggregation (9), and eosinophil adhesion to endothelial cells (2).

Recently, zinc has been identified as an important factor in the airway epithelium (38). Zinc exists in two distinct pools, the first being tightly bound and an integral part of >300 enzymes, of transcription factors and of structural proteins. The second pool is more labile and dynamic and is rapidly exchangeable (38). Its intracellular levels are dictated by a dynamic process involving three main mechanisms: buffered by zinc-binding proteins such as metallothionein (6, 25), transported by plasma membrane zinc transporters such as ZnT-1 (27), and sequestered by vesicular membranes through ZnT-2 and ZnT-3 (25, 26). It has been suggested that zinc can be a significant factor in the biology of the respiratory epithelium (5, 38). As is extensively reviewed by Shankar and Prasad (31), zinc is very important for specific cells of the immune system. For example, zinc is required for T lymphocyte proliferation in response to interleukin (IL)-1, phytohemagglutinin, concanavalin A, or IL-2. Moreover, it has been shown that zinc alters the expression and function of lymphocyte surface molecules governing cell-cell interactions (21) and enhances the transcription and expression of ICAM-1 on the surface of lymphoid cells but not on fibroblasts (19).

Because zinc is important for immune function and has been shown to be important in the airway epithelium, we proposed that the pharmacological modulation of zinc can influence epithelial cytokine production. The aim of this study was therefore to investigate the effect of zinc modulation, using zinc chelators, on the expression and secretion of C-C chemokines from several lung cell lines.


   METHODS
TOP
 ABSTRACT
 METHODS
RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
Cell culture. Three different lung cell lines were used in this study. The alveolar epithelial cell line A549 (ATCC, Rockville, MD) was cultured in petri dishes and maintained in RPMI 1640 medium (GIBCO-BRL, Rockville, MD) containing 10% fetal bovine serum (FBS), 1% L-glutamine, penicillin (100 U/ml), streptomycin (100 mg/ml), and fungizone (2.5 µg/ml). This medium is referred to as complete medium. The BEAS-2B cell line (ATCC), derived from human bronchial epithelium transformed by an adenovirus 12-SV40 hybrid virus, was cultured in 150-cm2 tissue culture flasks (Falcon/VWR, Oakville, ON, Canada) coated with type I rat tail collagen (Collaborative Biomedical Products, Bedford, MA) and maintained in LHC-8 (serum-free) medium (Biofluids, Rockville, MD). A portion of the BEAS-2B cells were passaged into collagen-coated petri dishes and used for experiments, and the remaining cells were reseeded into the 150-cm2 culture flasks for longer-term culture. The fibroblastic cell line HFL-1 (ATCC) was cultured in petri dishes and maintained in DMEM (GIBCO-BRL) containing the same additives as for RPMI. A549 and BEAS-2B cells were cultured at 37°C with 5% CO2 in humidified air. HFL-1 cells were cultured in similar conditions but with 10% CO2.

Experimental protocols. The following procedures and times were respected throughout the study. All cell lines were seeded and grown to ~90% confluence (unless otherwise specified) in their respective media as described in Cell culture. Cells were washed three times with phosphate-buffered saline (PBS), and media were replaced with incomplete media (without FBS). A 24-h equilibration period was respected. Media were discarded, fresh incomplete medium was added, and cells were pretreated with either 2,3-dimercapto-1-propanesulfonic acid (DMPS, 18 h) or N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine (TPEN, 1 h; Sigma, St. Louis, MO). Cells were then washed, incomplete medium was added, and cells were stimulated with TNF-{alpha} (10 ng/ml; Peprotech, Rocky Hill, NJ) for 4 h. After this 4-h stimulation period, the cells underwent the procedures described below.

Zinquin fluorescence. A549 cells were seeded and grown to ~70-80% confluence on sterile glass coverslips in six-well plates and washed as described above. Cells were then pretreated with 1.5 mM DMPS (18 h) or 20 µM TPEN (1 h), washed three times with PBS, and 25 µM Zinquin [TRC, Toronto, ON, Canada; excitation/emission (ex/em): 368 nm/490 nm] in PBS was added for 30 min at 37° C. Coverslips were then mounted with Vectashield mounting medium (Vector Laboratories, Burlingame, CA), and cells were analyzed under an Axioskop 2 fluorescence microscope (Carl Zeiss, Thornwood, NY). Photomicrographs were captured with a SPOT-3 color digital camera (Diagnostic Instruments, St. Sterling Heights, MI). The images were processed with SPOT software. Zinquin fluorescence was captured with the 4,6-diamidino-2-phenylindole (DAPI)/Hoechst/AMCA filter (ex 360/40 nm, em 460/50 nm), an exposure time of 4 s, and a signal gain of 2. Nonspecific cellular fluorescence at 535 nm, as an indicator of the presence of cells, was captured with the FITC/BODIPI/FLUO-3/DiO filter (ex 480/30 nm, em 535/40 nm) with an exposure time of 2 s and a signal gain of 1. A single dilution of Zinquin was used in each set of experiments to ensure that all coverslips received the same concentration of dye, and all experimental conditions were rigorously followed between coverslips and sets of experiments. The results shown are representative of the results obtained in each separate set of experiments.

RNA extraction and Northern blot analysis. After having been exposed to experimental conditions, cells were harvested with the TRIzol reagent. Total RNA was extracted with a one-step guanidium-phenol chloroform extraction procedure according to the TRIzol manufacturer's protocol (GIBCO-BRL). We carried out RNA quantification by reading the optical density of the sample at 260 nm with a Beckman spectrophotometer, and RNA quality was monitored by simultaneous optical density reading at 280 nm. Northern blot analysis was performed by the electrophoresis of 20-µg samples of total cell RNA in a 1% agarose-6% formaldehyde MOPS-buffered gel. The RNA was then transferred onto a Hybond-N+ membrane (Amersham Pharmacia Biotech, Buckinghamshire, UK) for analysis. Membranes were prehybridized for 4 h at 68°C in a solution containing 600 mM NaCl, 120 mM Tris, 8 mM EDTA, 10% dextran sulfate, 0.2% SDS, 0.1% Na4P2O7, and 625 µg/ml heparin at pH 7.4. Hybridization was carried out overnight at 68° C in the same solution containing the radioactively labeled probe. Membranes were hybridized sequentially with the eotaxin, IL-8, or glyceraldehyde phosphate dehydrogenase housekeeping gene (GAPDH, as control for RNA quantity and integrity) probes labeled with the Multiprime DNA labeling system using [{alpha}-32P]dCTP (Amersham Life Science, Oakville, ON, Canada). The eotaxin probe was obtained from PCR amplification of a 222-bp fragment of eotaxin cDNA, the IL-8 probe was an EcoRI fragment spanning 500 bp of the coding region of IL-8, and the GAPDH probe was a 1-kb PstI cDNA fragment (ATCC). The membranes were then washed once at room temperature (RT) for 20 min in 2x SSC, three times at 68°C for 20 min in 0.1% SDS/0.1% SSC, and rinsed at RT in 0.1% SSC. The membranes were then exposed to Kodak XAR5 film (Eastman Kodak, Rochester, NY) with an intensifying screen at -80°C. Autoradiographs were quantified with a UMAX PowerLook II scanner and the NIH Image 1.62 software (National Institutes of Health, Bethesda, MD). Results shown are ratios of chemokine-GAPDH (housekeeping gene) densitometric units.

Eotaxin ELISA. Eotaxin protein levels in cell culture supernatants were measured with commercially available ELISA kits (Biosource International, Montreal, PQ, Canada). The limit of detection of this assay was 2 pg/ml for eotaxin. In brief, eotaxin protein levels were measured in cell culture supernatants from cells having been cultured in 24-well plates, treated according to experimental protocols, and following a 4-h stimulation with TNF-{alpha} (10 ng/ml). After the stimulation period, cells were washed three times with PBS, and fresh medium was added; 48 h later, supernatants were collected and stored for analysis.

GATA Western blot. The presence of GATA transcription factor immunoreactivity was assessed by Western blot analysis in whole cell extracts from A549 cells. A549 cells were cultured and stimulated with TNF-{alpha} (10 ng/ml) for 4 h. Whole cell extracts were prepared in a lysis buffer containing 50 mM Tris, 10 mM EDTA, 5 mM EGTA, 10 mM NaF, 10 mM NaPP, 0.5 mM Na2VO4, 1 tablet Mini Complete (protease inhibitor mix)/10 ml, 1 mM PMSF, and 1% Nonidet P-40. Cells were incubated in the lysis buffer for 5 min and sonicated. Homogenates were centrifuged 10 min at 10,000 g (4°C), and the supernatant fractions were collected. Protein content was determined by the Bio-Rad assay (Bio-Rad Laboratories, Hercules, CA). Standard Western blot analyses were used to determine protein expression. Fifty micrograms of proteins were separated by SDS-polyacrylamide gel electrophoresis (10% resolving gel) and transferred to polyvinylidene difluoride membranes. Membranes were blocked for 2 h at room temperature with 5% nonfat milk in Tris-buffered saline with 0.1% Tween 20. GATA immunoreactivity was identified with the M-20 GATA-1 antibody (Santa Cruz Biotechnology, Santa Cruz, CA). Membranes were incubated with the GATA-1 primary antibody (1:1,000) overnight at 4°C, washed, and incubated for 1 h with a horseradish peroxidase-labeled anti-goat IgG. (1:8,000; Sigma). Immunoreactive bands were revealed with the enhanced chemiluminescence detection system (ECL+; Amersham Canada). Cellular extracts obtained form megakaryocytic DAMI cells were used as positive controls in these experiments (22).

NF-{kappa}B and GATA-1 EMSA. The ability of zinc chelators to modulate NF-{kappa}B and GATA-1 binding was assessed by EMSA. Cells were cultured and treated as described above. After stimulation, cells were scraped with a rubber policeman in PBS at 4° C and centrifuged, and nuclear extracts were prepared at 4°C in lysis buffer (60 mM KCl, 10 mM HEPES, 1 mM EDTA, 1 mM DTT, and 0.5% Nonidet P-40, pH 8.0) containing 1 tablet/10 ml Mini Complete (protease inhibitor mix), and 1 mM Pefabloc SC (all reagents from Boehringer Mannheim, Laval, QC, Canada). After centrifugation cell nuclei were resuspended in 250 mM Tris · HCl, 60 mM KCl, 1 mM DTT, 1 mM Pefabloc SC, containing 1 tablet/10 ml Mini Complete, pH 7.8, lysed by freezing-thawing, and centrifuged at 13,000 g for 10 min at 4°C. The supernatant containing nuclear extracts was supplemented with 20% glycerol, and total protein content was determined by the Bio-Rad assay (Bio-Rad Laboratories). Fractionated nuclear extracts (3 µg total protein) were added at RT for 30 min to 10 mM Tris · HCl, 50 mM NaCl, 1 mM DTT, 1 mM EDTA, 5% glycerol containing 0.25 µg poly(dI-dC), and 7.1 fmol 32P-end-labeled double-stranded oligonucleotide with a high-affinity binding matrix as follows (binding site is underlined): NF-{kappa}B: 5'-(AGTTGAGGGGACTTTCCCAGGC)-3', 3'-(TCAACTCCCCTGAAAGGGTCCG)-5'; GATA-1: 5'-(GTGCGACCAGATATGTCACCACCACATCACTTTTAG)-3', 3'-(CACGCTGGTCTATACAGTGGTGGTGTAGTGAAAATC)-5'. DNA-binding reactions were analyzed on 5% nondenaturing polyacrylamide gels (37.5:1 acrylamide/bis-acrylamide) for NF-{kappa}B and on 4% polyacrylamide gels (60:1 acrylamide/bisacrylamide) for GATA-1. Dried gels were exposed to Kodak XAR5 film (Eastman Kodak). Supershift experiments were performed with the N-6 anti-GATA-1 antibody (Santa Cruz Biotechnology). Binding buffer, poly(dI-dC) (0.25 µg), nuclear extract, and antibody were mixed and incubated for 30 min at 4°C. The 32P-labeled GATA-1 probe was then added and incubated of 15 min at RT. Samples were then immediately loaded onto gels for analysis.

RNase protection assay. Total RNA was isolated from A549 cells by the TRIzol method as described in RNA extraction and Northern blot analysis and used in the standard PharMingen (San Diego, CA) RNase protection protocol as follows. The multiprobe template set hCK5, containing DNA templates for lymphotactin; regulated on activation, normal T-cell expressed, and presumably secreted (RANTES); IFN-{gamma}-inducible protein; macrophage inflammatory protein (MIP)-1{beta}; MIP-1{alpha}; MCP-1; IL-8; I-309; L32; and GAPDH (PharMingen) was used to synthesize [{alpha}-32P]UTP (NEN Life Science Products, Boston, MA)-labeled probes in the presence of a GACU pool using a T7 RNA polymerase. Probes were hybridized overnight with 5 µg of target RNA, followed by RNase digestion and proteinase K treatment. Samples were chloroform-extracted, ethanol-precipitated in the presence of ammonium acetate, and loaded on an acrylamideurea sequencing gel in 0.53 M Tris-borate-EDTA buffer. After electrophoresis at 50 W for 1-2 h, the gel was adsorbed to filter paper and dried under vacuum. The dried gel blot was exposed to a phosphor screen for phosphor imagery analysis using ImageQuant software (Molecular Dynamics, Sunnyvale, CA). The intensity of each band was analyzed and normalized to the values of the housekeeping gene GAPDH, and normalized values were used to quantify expression.

Statistical analysis. All data are presented as means ± SE. To assess statistical significance between treatments, we analyzed data using Student's t-test. A P value of <0.05 was considered as statistically significant.


   RESULTS
TOP
 ABSTRACT
 METHODS
 RESULTS
DISCUSSION
 DISCLOSURES
 REFERENCES
 
Fluorescence analysis of intracellular labile zinc. The ability of DMPS and TPEN to modulate the intracellular pool of labile zinc was tested by fluorescence microscopy. Studies from other laboratories have shown that chelation of intracellular labile zinc by TPEN reduces the fluorescence of the zinc indicator probe Zinquin in treated cells (38). We have therefore investigated the effects of DMPS and TPEN on intracellular labile zinc as assessed by Zinquin fluorescence. Figure 1 shows corresponding images of Zinquin fluorescence and nonspecific cellular fluorescence at 535 nm for A549 cells. A549 cells loaded with Zinquin showed appreciable fluorescence (using the DAPI/Hoechst/AMCA filter; ex 360/40, em 460/50) compared with negative control cells. Pretreatment of cells with DMPS or TPEN markedly quenched Zinquin fluorescence, indicating a reduction in the intracellular pool of labile zinc. The presence of cells in each photograph was assessed by nonspecific cellular fluorescence at 535 nm with the use of the FITC/BODIPI/FLUO-3/DiO filter (ex 480/30, em 535/40; no nonspecific fluorescence was detected using the DAPI/Hoechst/AMCA filter).



View larger version (42K):
[in this window]
[in a new window]
  		Fig. 1. Reduction of the labile zinc content by 2,3-dimercapto-1-propanesulfonic acid (DMPS) and N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine (TPEN) treatments in the A549 alveolar type II epithelial cell line. Cells were grown to 70-80% confluence in 6-well cell culture plates on glass coverslips and pretreated with DMPS as described in METHODS. Cells were then loaded with 25 µM Zinquin in PBS for 30 min at 37°C and 5% CO2 and studied under an Axioskop 2 fluorescence microscope equipped with a SPOT color digital camera. Shown are Zinquin fluorescence and cellular fluorescence at 535 nm as control for the presence of cells. This figure shows typical results obtained in this series of experiments.

 

Effects of DMPS and TPEN on eotaxin mRNA expression in A549 and BEAS-2B cell lines. To explore the effect of zinc chelation on eotaxin mRNA induced by TNF-{alpha}, we preincubated A549 cells with either DMPS for 18 h (18-24 h being optimal preincubation times as determined by time-course experiments; data not shown) or TPEN for 1 h and stimulated these cells with TNF-{alpha}. A549 cells stimulated for 4 h with TNF-{alpha} showed marked eotaxin mRNA expression. This increase in eotaxin mRNA induced by TNF-{alpha} was also a dose- and time-dependent phenomenon (data not shown). In a few cases, a basal amount of eotaxin mRNA was detected in these cells. In each experiment the effects of medium alone and of TNF-{alpha} (positive control) were examined. In A549 cells both DMPS and TPEN significantly and dose dependently inhibited TNF-{alpha} induced eotaxin mRNA expression as determined by Northern blot analysis (Fig. 2A). DMPS was most effective at 2.0 mM, inhibiting TNF-{alpha}-induced eotaxin mRNA expression by 84.5% ± 0.8%; however, a statistically significant reduction of eotaxin mRNA was observed at all other concentrations (0.5-1.5 mM). TPEN was most effective at the 25 µM concentration, achieving 57.5 ± 2.1% inhibition. Treatment of cells with the TPEN diluent DMSO, tested at an amount equivalent to that contained in the TPEN preparation, altered neither basal nor TNF-{alpha}-induced eotaxin mRNA expression. Similar results were observed in the bronchial epithelial cell line BEAS-2B stimulated and pretreated in the same manner. In BEAS-2B cells, DMPS dose dependently inhibited TNF-{alpha}-induced eotaxin mRNA expression, achieving maximal inhibition at the 2.0 mM concentration (81.3 ± 1.1% inhibition) (Fig. 2B). However, in this cell line, TPEN was more effective in inhibiting eotaxin mRNA expression than in A549 cells. TPEN achieved maximal inhibition (77.5 ± 7.1%) of TNF-{alpha}-induced eotaxin mRNA expression at the 25 µM concentration. DMPS and TPEN treatments were tested for cytotoxicity with the 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT) assay (10) under the same experimental conditions as described in the Cell culture and Experimental protocols sections. No cytotoxicity was observed for any of the compounds compared with medium alone (data not shown).



View larger version (55K):
[in this window]
[in a new window]
  		Fig. 2. Inhibition of TNF-{alpha}-induced eotaxin mRNA expression by the zinc chelators DMPS and TPEN in the A549 (A) and BEAS-2B (B) cell lines. Concentration-response experiments showing DMPS (I) or TPEN (II) inhibition of TNF-{alpha} (10 ng/ml)-induced eotaxin mRNA expression. Northern blot analysis was performed on cells incubated with control medium or TNF-{alpha} (4 h, positive control)-, and DMPS (18 h)-, or TPEN (1 h)-pretreated cells as indicated in the figure. C: effect of DMPS or TPEN pretreatment on TNF-{alpha}-induced IL-8 mRNA expression. A549 cells were treated as described above. Each panel (A-C) includes a representative autoradiograph of n = 3-8 experiments showing chemokine mRNA expression and GAPDH mRNA expression (indicating equal loading of lanes and for normalization). Results are means ± SE of the densitometric analysis of chemokine mRNA expression normalized to GAPDH expression. *P < 0.05; **P < 0.01.

 

Effects of DMPS and TPEN on IL-8 mRNA expression. To ascertain the specificity of the zinc chelation treatments, we tested the ability of DMPS and TPEN to inhibit the mRNA expression of a structurally and functionally unrelated chemokine, IL-8. In this set of experiments, A549 cells were treated in exactly the same conditions as for the eotaxin experiments. TNF-{alpha}-stimulated A549 cells showed a marked increase in IL-8 mRNA expression. However, in contrast to eotaxin, TNF-{alpha}-induced IL-8 mRNA expression was not inhibited by zinc chelation treatments (Fig. 2C). In this case, a slight but nonsignificant increase in IL-8 mRNA was observed at the 1.5 mM DPMS and 25 µM TPEN concentrations.

Effect of exogenous zinc on the inhibitory effect of DMPS. We investigated whether TNF-{alpha}-induced eotaxin mRNA expression could be reversed by the addition of varying concentrations of zinc. We added exogenous zinc acetate at varying ratios to DMPS (1:1 being one molecule of DMPS to one zinc ion) 20 min before adding it to cell media. At the 1:1 ratio, cell death was observed due to an excess of zinc. At the 3:1 ratio, enough DMPS was free to chelate a small amount of intracellular labile zinc and therefore retained ~10% of its inhibitory effect. In contrast, at the 2:1 ratio (2 mM DMPS/1 mM zinc acetate), exogenous zinc completely abolished the inhibitory effect of DMPS on TNF-{alpha}-induced eotaxin mRNA expression. In this set of experiments, 2.0 mM DMPS alone achieved ~60% inhibition of TNF-{alpha}-induced eotaxin mRNA expression (Fig. 3).



View larger version (42K):
[in this window]
[in a new window]
  		Fig. 3. Exogenous zinc reverses DMPS inhibition of TNF-{alpha}-induced eotaxin mRNA expression in the A549 cell line. Northern blot analysis was performed on cells stimulated with TNF-{alpha} (10 ng/ml) alone or pretreated with DMPS (18 h) and stimulated with TNF-{alpha} for 4 h. Exogenous zinc acetate at indicated concentrations was combined with DMPS 20 min before adding it to the cells (n = 2). *P < 0.05.

 

Effects of DMPS and TPEN on eotaxin protein production. In preliminary experiments we tested eotaxin release from the A549 and BEAS-2B cell lines, but only very small amounts of eotaxin protein (5-10 pg/ml, also the limit of detection of the ELISA kit) could be detected under our experimental conditions. This was also observed by Fujizawa et al. (7) when cells were stimulated with TNF-{alpha} alone. In this set of experiments, both DMPS and TPEN reduced eotaxin production; however, the concentrations obtained were at the limit of detection of the ELISA kits and were therefore deemed inadequate for the proper evaluation of the effects of zinc chelators on eotaxin production. To remain in the same experimental conditions and to avoid the use of supplemental or different stimuli such as LPS, IL-1{beta}, or IL-4, we chose the fibroblastic cell line HFL-1 to investigate the effect of DMPS and TPEN on eotaxin at the protein level, because of the large amount of eotaxin that these cells can produce and for their importance in producing eotaxin under inflammatory conditions (35).

Effects of DMPS and TPEN on eotaxin mRNA in the fibroblastic cell line HFL-1. In a first series of experiments we tested the effects of DMPS and TPEN at the eotaxin mRNA level in HFL-1 cells to verify that the effects were similar to those demonstrated with the epithelial (A549 and BEAS-2B) cell lines. HFL-1 cells were treated similarly to the A549 and BEAS-2B cells as described in Effects of DMPS and TPEN on eotaxin mRNA expression in A549 and BEAS-2B cell lines. The effects of both chelators were similar to those observed with the two previous cell lines. DMPS dose dependently inhibited the TNF-{alpha}-induced eotaxin mRNA expression with maximal inhibition (69.5 ± 5.2%) at the 2.0 mM concentration (Fig. 4A). TPEN also significantly inhibited TNF-{alpha}-induced eotaxin mRNA expression. However, in this case, although dose dependent, up to 41 ± 0.2% inhibition was still observed at the lowest (1 µM) TPEN dose used (Fig. 4A). At the TPEN dose of 25 µM, a 73.9 ± 6.6% inhibition was observed.



View larger version (40K):
[in this window]
[in a new window]
  		Fig. 4. Inhibition of eotaxin mRNA expression and protein release by the zinc chelators DMPS and TPEN in fibroblastic (HFL-1) cell line. A: concentration-response experiments showing DMPS (I) or TPEN (II) inhibition of TNF-{alpha} (10 ng/ml)-induced eotaxin mRNA expression. Northern blot analysis was performed on cells incubated with control medium or TNF-{alpha} (4 h, positive control)-, and DMPS (18 h)-, or TPEN (1 h)-pretreated cells as indicated in the figure. A: representative autoradiograph of n = 4 experiments showing eotaxin mRNA expression and GAPDH mRNA expression (indicating equal loading of lanes and for normalization). Results are means ± SE of the densitometric analysis of chemokine mRNA expression normalized to GAPDH expression. B: inhibitory effects of DMPS (I) and TPEN (II) on TNF-{alpha}-induced eotaxin protein release from the HFL-1 fibroblastic cell line. ELISA was performed on supernatants of cells treated with control medium or TNF-{alpha} (10 ng/ml, 4 h) or pretreated with DMPS (18 h) or TPEN (1 h). Cells were washed, fresh medium was added, and supernatants were collected 48 h after TNF-{alpha} stimulation period. Results are means ± SE. *P < 0.05; **P < 0.01.

 

Effects of DMPS and TPEN on eotaxin at the protein level. The effects of DMPS and TPEN on eotaxin protein secretion, as assessed by ELISA in the supernatants of HFL-1 cells, were similar. The data in Fig. 4B demonstrate that a significant amount of eotaxin was produced by HFL-1 cells (2,750 pg/ml) in a 48-h period following stimulation with TNF-{alpha}. HFL-1 cells also produced a constitutive quantity of eotaxin (480 pg/ml) without stimulation. DMPS dose dependently inhibited TNF-{alpha}-induced eotaxin protein secretion from HFL-1 cells (Fig. 4B). Maximal inhibition (38 ± 4.6%) was observed at the highest DMPS dose used (2.0 mM). The lowest (0.5 mM) DMPS dose used had little or no effect on eotaxin protein secretion. Similarly, TPEN dose dependently inhibited TNF-{alpha}-induced eotaxin protein secretion from HFL-1 cells (Fig. 4B). Maximal inhibition (45 ± 6.1%) was achieved by the 25 µM TPEN concentration. However, at the lowest concentration of TPEN used (1 µM), 29.7 ± 6.3% inhibition was still observed.

GATA immunoreactivity. We assessed GATA immunoreactivity in cellular extracts obtained from A549 cells. In this set of experiments, A549 cells were cultured and stimulated with TNF-{alpha} (10 ng/ml) for 4 h, and cellular extracts were prepared. Figure 5 shows that GATA immunoreactivity using the GATA-1 antibody was observed in cell lysates from A549 cells in the form of a 47-kDa protein (lanes 1 through 3). This was compared with a positive control obtained from the lysates of megakaryocytic DAMI cells (lane 4). With 50 µg of total proteins, A549 cells exhibited GATA-1 immunoreactivity to a lesser degree than the megakaryocytic DAMI cells.



View larger version (17K):
[in this window]
[in a new window]
  		Fig. 5. Detection of GATA immunoreactivity in A549 cells. Western blot analyses were carried out on whole cell extracts obtained from A549 cells. Cellular extracts were obtained in supernatants following incubation of cells in lysis buffer (5 min), sonication, and centrifugation (10,000 g). GATA immunoreactivity was assessed with the M-20 GATA-1 antibody directed toward the carboxy terminus of the protein. Cellular extracts obtained from DAMI cells were used as positive controls. Results shown are representative of 3 separate experiments.

 

GATA-1 and NF-{kappa}B EMSA. In the EMSA experiments, TNF-{alpha} clearly induced NF-{kappa}B activation (Fig. 6A, arrow). However, neither DMPS (2.0 mM) nor TPEN (25 µM) treatments seemed to inhibit the TNF-{alpha}-induced NF-{kappa}B activation. Figure 6B (arrow) shows GATA-1 binding. GATA-1 had constitutive binding in A549 cells as is shown by binding of the probe in the nuclear extracts from cells treated with medium alone. TNF-{alpha} stimulation increased the binding of the GATA-1 probe (lane 2). Neither DMPS nor TPEN alone affected the basal GATA-1 binding (lanes 3 and 5). However, both DMPS and TPEN reduced the TNF-{alpha}-induced GATA-1 activation (lanes 4 and 6). Furthermore, supershift experiments (Fig. 6C) using an anti-GATA-1 antibody confirmed that GATA-1 was indeed involved in DNA binding.



View larger version (27K):
[in this window]
[in a new window]
  		Fig. 6. Effects of DMPS and TPEN on binding of NF-{kappa}B (A) and GATA-1 (B). EMSAs of NF-{kappa}B and GATA-1 were carried out with nuclear extracts from A549 cells treated with either DMPS (2.0 mM, 18 h) or TPEN (25 µM, 1 h), followed by incubation with 10 ng/ml TNF-{alpha} for 4 h. Bands marked with an arrow represent activated NF-{kappa}B (A) or GATA-1 (B) complexes, and bands not marked by arrows represent nonspecific binding. S. Comp., the specific competitors (20x the unlabeled probe); N.-S. Comp., the nonspecific competitors (20x an unrelated and unlabeled probe). C: GATA-1 probe binding (lane 1) and supershift (lane 2) using the N-6 anti-GATA-1 antibody and the same nuclear extract as in lane 2 of A and B. Results shown are representative of 5 separate experiments.

 

Effects of DMPS on RANTES, MCP-1, and IL-8 mRNAs. To further study the specificity of the effects of DMPS on TNF-{alpha}-induced mRNA inhibition, we carried out RNase protection assays on total RNA from A549 cells treated with medium alone, stimulated for 4 h with TNF-{alpha}, or pretreated with DMPS (1.5 mM for 18 h) and stimulated with TNF-{alpha}. mRNAs for RANTES and MCP-1 (CC chemokine family members) and IL-8 (CXC chemokine family member) and GAPDH were examined. Figure 7 shows that cells treated with medium alone express little or no mRNA for the three chemokines studied (lane 2). In contrast, lane 3 shows a significant increase in mRNA for all three chemokines studied following TNF-{alpha} stimulation of the cells compared with the medium control. IL-8 and MCP-1 had the greatest increase in mRNA, whereas RANTES had about half the level of expression of the other two chemokines in our experimental conditions. Lane 4 shows that pretreatment of cells with DMPS signifi-cantly decreased TNF-{alpha}-induced mRNA for the C-C chemokine family members RANTES and MCP-1 (75 and 80%, respectively). Conversely, as previously shown by Northern blot analysis, the CXC chemokine IL-8 induction was unaffected by DMPS pretreatment. In lanes 2-4 GAPDH was affected neither by TNF-{alpha} stimulation nor by DMPS pretreatment and shows equal loading.



View larger version (43K):
[in this window]
[in a new window]
  		Fig. 7. RNase protection assay (RPA) showing the effects of DMPS on regulated on activation, normal T-cell expressed, and presumably secreted (RANTES); monocyte chemotactic protein (MCP)-1; and IL-8 mRNA expression. RPA was performed on cells having been incubated with control medium (lane 2), TNF-{alpha} (10 ng/ml, 4 h) stimulation (lane 3), or DMPS (18 h) pretreatment and TNF-{alpha} (10 ng/ml, 4 h) stimulation (lane 4). Lane 1 shows the free probes.

 


   DISCUSSION
TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
DISCLOSURES
 REFERENCES
 
Airway inflammation plays an important role in the pathogenesis of asthma. The airway epithelium acts as a major player in the production of multiple proinflammatory chemokines and factors leading to the recruitment of inflammatory cells, particularly eosinophils (14, 40). Among these potent and selective inflammatory cell-active chemotactic and activating chemokines are the C-C chemokines, which include eotaxin, eotaxin-2, RANTES, and members of the MCP family. In diseases characterized by tissue eosinophilia such as asthma, allergic rhinitis, and nasal polyposis, many studies have shown an increased expression of mRNA and/or protein for eotaxin, RANTES, MCP-3, and MCP-4 (36). Immunohistochemical studies of airway biopsies from asthmatics have shown that these chemokines are localized to the airway epithelium (33, 36).

In this study, we clearly show that eotaxin mRNA expression is influenced by intracellular zinc concentrations. In fact, our results show that the widely recognized zinc chelator TPEN (3) and the clinically used heavy metal chelator DMPS (37) inhibit the mRNA expression of the proinflammatory chemokine eotaxin in three different human lung cell lines (BEAS-2B, a bronchial epithelial cell line; A549, an alveolar epithelial cell line; and HFL-1, a fibroblastic cell line). As is clearly demonstrated by Northern blot analysis experiments, the cell lines used in this study all respond very well to TNF-{alpha} stimulation, leading to increased eotaxin mRNA expression. These results show that the cell lines used are valid models for the study of TNF-{alpha}-induced chemokine mRNA expression. This is supported by the findings of Lilly et al. (17), where A549 cells were used to determine the time course of TNF-{alpha}-induced eotaxin mRNA expression. Furthermore, in other in vitro studies involving eotaxin, BEAS-2B cells (7, 32) and HFL-1 cells (30) were used as models to study the effects of various proinflammatory cytokines on mRNA expression.

Our results show that in all three cell lines studied DMPS and TPEN acted dose dependently to inhibit eotaxin mRNA expression induced by TNF-{alpha}. Moreover, an inhibition of ~80% was achieved at the highest concentrations of DMPS and TPEN used. In vitro studies have shown that exogenously administered zinc could influence the expression of molecules such as ICAM-1 (19), but none have demonstrated the effects of pharmacological alterations of the intracellular concentrations of zinc on proinflammatory cytokine mRNA expression. The relevance of our results can be seen by the many studies showing an increased production of eosinophil-active chemokines at the sites of allergic inflammatory reactions, such as those found in asthma (36). Our results clearly indicate that the inhibitory effect of the chelators was not a disruptive effect on cellular function, since the mRNA of the housekeeping gene GAPDH was not affected by the treatment. The GAPDH mRNA was used in all Northern blot analysis experiments as a control of equal loading of total RNA on the gels and as a control of maintained cellular function. However, to further determine the specificity of action of DMPS, we compared the effects of the compound on TNF-{alpha}-stimulated eotaxin mRNA expression with those found for the neutrophil-active cytokine IL-8. Even at the highest concentration of DMPS or TPEN used, the TNF-{alpha}-stimulated IL-8 mRNA expression was not altered. These results suggest that at the concentrations used, zinc chelators do not disrupt the housekeeping functions of the cell but specifically alter the expression of certain inducible chemokines (in this case eotaxin), while not affecting the expression of other cytokines such as IL-8. The nontoxic effects of the zinc chelators are supported by the cytotoxicity experiments using the MTT assay in which the chelators were tested at the maximal concentrations in the same experimental conditions as described for Northern blot analysis and compared with medium alone. The MTT assay demonstrated that all the treatments used in this study were nontoxic to the cells.

The proposed mechanism by which DMPS could chelate divalent cations such as zinc is through its two free thiol groups. We therefore tested the reversibility of the inhibitory effect of DMPS on TNF-{alpha}-induced eotaxin mRNA expression by the addition of exogenous zinc. When A549 cells were incubated with a combination of exogenous zinc and DMPS treatment, the inhibitory effect of DMPS was lost. At a molar ratio of 3:1 (DMPS/zinc acetate), the inhibitory action of DMPS was partially repressed, whereas at a molar ratio of 2:1, the inhibitory effect of DMPS was completely abolished. This suggests that a two-molecule complex of the chelator is needed to efficiently bind one zinc ion. This is in accordance with the fact that dimercaprol (2,3-dimercaptopropanol, a molecular cousin of DMPS) also functions at the 2:1 ratio to heavy metal (8). Together these results show that DMPS and TPEN through zinc chelation specifically inhibit TNF-{alpha}-induced eotaxin mRNA expression. It should, however, be noted that DMPS can also bind other physiologically important metals such as copper and to a much lesser extent iron, magnesium, and manganese.

A recent study of zinc in the airway epithelium (38) showed an important role for this cation within the lung. The use of the sulfoamidoquinoline-based UV-excitable zinc fluoroprobe Zinquin enabled the authors to show the presence of labile zinc lining the apical and luminal sides of the entire length of the conducting airways. Using the Zinquin probe, Tang et al. (34) demonstrated that the potent zinc chelator TPEN could compete with the labile pool of zinc, which is further evidence that Zinquin interacts with the physiologically relevant levels of labile zinc. Our results show that DMPS also interacts with this physiologically important pool of labile zinc, since there was a significant difference between the fluorescence of Zinquin-loaded untreated A549 cells and that of DMPS-treated cells. In this series of experiments DMPS clearly diminished Zinquin fluorescence in fluoroprobe-loaded cells compared with untreated fluoroprobe-loaded cells.

At the protein level, our results show that the production of TNF-{alpha}-induced eotaxin protein was dose dependently inhibited by pretreatment of cells with DMPS or TPEN. An inhibition of up to 50% of eotaxin release was observed at the highest chelator doses used. These results are in accordance with those found at the mRNA level, where both chelators significantly reduced the amount of eotaxin mRNA after TNF-{alpha} stimulation.

Given the efficiency by which zinc chelators inhibited TNF-{alpha}-induced eotaxin mRNA expression, we investigated the effects of the clinically used DMPS chelator on the mRNA expression of other C-C chemokines (RANTES and MCP-1) and cytokines (IL-8). Our results show that TNF-{alpha} stimulation induced the expression of RANTES, MCP-1, and IL-8. These results are in accordance with other studies (1, 16, 29). Interestingly, we demonstrate that the zinc chelator DMPS selectively inhibited the TNF-{alpha}-induced mRNA expression of the C-C type chemokines RANTES and MCP-1, while leaving unaffected the TNF-{alpha}-induced CXC-type chemokine IL-8. These results confirm our previous Northern blot analysis results. Together the results demonstrated herein lead to the interesting hypothesis that zinc chelators could selectively inhibit the C-C chemokine family without influencing other chemokine families such as the CXC type. However, this hypothesis warrants further investigation since it is derived from in vitro studies where the CXC chemokine family was represented only by IL-8.

Many cis-regulatory elements have been identified in the promoter regions of eotaxin, RANTES, and MCP-1 (4, 11, 20, 23, 39). The most commonly identified sites relate to the transcription factors NF-{kappa}B, activator protein (AP)-1, and the signal transducer and activator of transcription family. These transcription factors were regarded as having little or no dependence on zinc ions. However, recent studies by Mackenzie et al. (18), Ho and Ames (12), and Oteiza et al. (24) show that the activities of transcription factors NF-{kappa}B and AP-1 could be modulated by reduced zinc concentrations in the culture medium in various cell types. Conversely, the zinc-finger family of transcription factors requires the binding of one or more zinc ions to ensure proper folding and DNA binding. From the analysis of the eotaxin, RANTES, MCP-1, and IL-8 promoter regions using the TRANSFAC database (41), many potential binding sites for the zinc-finger transcription factor GATA-1 were identified in the C-C chemokine promoters, whereas none were found for the IL-8 promoter, suggesting that this factor could be involved in the mechanism of action of the zinc chelators DMPS and TPEN. In fact, we observed that the zinc chelators had no effect on the TNF-{alpha}-mediated activation of NF-{kappa}B, which appeared to be zinc insensitive under our experimental conditions in A549 cells. This indeed supports the results showing that DMPS or TPEN treatments did not affect TNF-{alpha}-induced IL-8 mRNA expression, where NF-{kappa}B is the most important transcription factor for IL-8. In the studies mentioned above involving NF-{kappa}B and AP-1 and their dependency on zinc, NF-{kappa}B activity was reduced by exposure to low zinc concentrations in the culture medium in IMR-32, C6, and 3T3 cells. However, in 3T3 cells, AP-1 activity was increased by low-culture-medium zinc, and, on the other hand, AP-1 activity was decreased by low-culture-medium zinc in rat glioma C6 cells. This suggests that various cell types may have different responses to reduced zinc that may be dependent on exposure time and/or threshold levels. Conversely, DMPS and TPEN both reduced the binding of the zinc-dependent transcription factor GATA-1 in TNF-{alpha}-stimulated cells. These results suggest that GATA-1 could be an important regulatory factor in the transcription complex of these chemokines, possibly participating in the enhancement of mRNA transcription. This, however, does not eliminate the involvement of other zinc-dependent factors, nor does it exclude effects of the chelators on other parts of signal transduction. Site-directed mutagenesis in the promoters of these chemokines would shed some light on the relative importance of GATA transcription factors for the transcription of these chemokines; however, this was outside the scope of this study.

In summary, this study shows that intracellular zinc clearly plays a key role in regulating TNF-{alpha}-induced C-C chemokine mRNA expression and protein release in respiratory epithelial cells and in fibroblasts. Zinc chelators act efficiently in depleting cellular labile zinc, therefore reducing its availability for zinc-dependent transcription factors. The inhibitory effect of zinc chelators on inflammatory cytokine-induced mRNA expression seems specific to the C-C chemokine family, whereas it leaves the CXC family unaffected. Furthermore, zinc chelation influenced the binding of the zinc-finger transcription factor GATA-1. To our knowledge this is the first study to clearly demonstrate the importance of the intracellular labile zinc content for the expression of specific proinflammatory chemokines from human lung cells.


   DISCLOSURES
TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
REFERENCES
 
M. Richter was a recipient of a Ph.D. scholarship from the Fond de Recherche en Santé du Québec. P.Larivée was supported by the Centre de Recherche Clinique du Centre hospitalier universitaire de Sherbrooke.


   ACKNOWLEDGMENTS
 
The authors thank Dr. Claire Dubois for kindly providing the GATA consensus oligonucleotides and Dr. Leonid Volkov for expert assistance with the fluorescence microscopy experiments. Also, the authors thank Micheline Poulin for excellent technical assistance.


   FOOTNOTES
 

Address for reprint requests and other correspondence: P. Larivée, Unité de recherche pulmonaire, Faculté de médecine, Université de Sherbrooke, 3001 12e Ave. Nord, Sherbrooke, QC, Canada J1H 5N4 (E-mail: Pierre.Larivee{at}USherbrooke.ca).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   REFERENCES
TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 

  1. Berkman N, Krishnan VL, Gilbey T, Newton R, O'Connor B, Barnes PJ, and Chung KF. Expression of RANTES mRNA and protein in airways of patients with mild asthma. Am J Respir Crit Care Med 154: 1804-1811, 1996.[Abstract]
  2. Burke-Gaffney A and Hellewell PG. Eotaxin stimulates eosinophil adhesion to human lung microvascular endothelial cells. Biochem Biophys Res Commun 227: 35-40, 1996.[ISI][Medline]
  3. Chai F, Truong-Tran AQ, Ho LH, and Zalewski PD. Regulation of caspase activation and apoptosis by cellular zinc fluxes and zinc deprivation: a review. Immunol Cell Biol 77: 272-278, 1999.[Medline]
  4. Danoff TM, Lalley PA, Chang YS, Heeger PS, and Neilson EG. Cloning, genomic organization, and chromosomal localization of the Scya5 gene encoding the murine chemokine RANTES. J Immunol 152: 1182-1189, 1994.[Abstract]
  5. De Raeve HR, Thunnissen FB, Kaneko FT, Guo FH, Lewis M, Kavuru MS, Secic M, Thomassen MJ, and Erzurum SC. Decreased Cu,Zn-SOD activity in asthmatic airway epithelium: correction by inhaled corticosteroid in vivo. Am J Physiol Lung Cell Mol Physiol 272: L148-L154, 1997.[Abstract/Free Full Text]
  6. Fischer EH and Davie EW. Recent excitement regarding metallothionein. Proc Natl Acad Sci USA 95: 3333-3334, 1998.[Free Full Text]
  7. Fujisawa T, Kato Y, Atsuta J, Terada A, Iguchi K, Kamiya H, Yamada H, Nakajima T, Miyamasu M, and Hirai K. Chemokine production by the BEAS-2B human bronchial epithelial cells: differential regulation of eotaxin, IL-8, and RANTES by TH2- and TH1-derived cytokines. J Allergy Clin Immunol 105: 126-133, 2000.[ISI][Medline]
  8. Goodman LS, Gilman A, Hardman JG, Gilman AG, and Limbird LE. Goodman & Gilman's the Pharmacological Basis of Therapeutics. New York: McGraw-Hill Health Professions Division, 1996.
  9. Hamilton LM, Davies DE, Wilson SJ, Kimber I, Dearman RJ, and Holgate ST. The bronchial epithelium in asthma-much more than a passive barrier. Monaldi Arch Chest Dis 56: 48-54, 2001.[Medline]
  10. Hansen MB, Nielsen SE, and Berg K. Re-examination and further development of a precise and rapid dye method for measuring cell growth/cell kill. J Immunol Methods 119: 203-210, 1989.[ISI][Medline]
  11. Hein H, Schluter C, Kulke R, Christophers E, Schroder JM, and Bartels J. Genomic organization, sequence, and transcriptional regulation of the human eotaxin gene. Biochem Biophys Res Commun 237: 537-542, 1997.[ISI][Medline]
  12. Ho E and Ames BN. Low intracellular zinc induces oxidative DNA damage, disrupts p53, NFkappa B, and AP1 DNA binding, and affects DNA repair in a rat glioma cell line. Proc Natl Acad Sci USA 99: 16770-16775, 2002.[Abstract/Free Full Text]
  13. Holgate ST. Epithelial damage and response. Clin Exp Allergy 30 Suppl 1: 37-41, 2000.[ISI][Medline]
  14. Holgate ST. The role of mast cells and basophils in inflammation. Clin Exp Allergy 30 Suppl 1: 28-32, 2000.[Medline]
  15. Holgate ST, Lackie PM, Davies DE, Roche WR, and Walls AF. The bronchial epithelium as a key regulator of airway inflammation and remodelling in asthma. Clin Exp Allergy 29 Suppl 2: 90-95, 1999.[ISI][Medline]
  16. Kwon OJ, Au BT, Collins PD, Adcock IM, Mak JC, Robbins RR, Chung KF, and Barnes PJ. Tumor necrosis factor-induced interleukin-8 expression in cultured human airway epithelial cells. Am J Physiol Lung Cell Mol Physiol 267: L398-L405, 1994.[Abstract/Free Full Text]
  17. Lilly CM, Nakamura H, Kesselman H, Nagler-Anderson C, Asano K, Garcia-Zepeda EA, Rothenberg ME, Drazen JM, and Luster AD. Expression of eotaxin by human lung epithelial cells: induction by cytokines and inhibition by glucocorticoids. J Clin Invest 99: 1767-1773, 1997.[ISI][Medline]
  18. Mackenzie GG, Zago MP, Keen CL, and Oteiza PI. Low intracellular zinc impairs the translocation of activated NF-kappa B to the nuclei in human neuroblastoma IMR-32 cells. J Biol Chem 277: 34610-34617, 2002.[Abstract/Free Full Text]
  19. Martinotti S, Toniato E, Colagrande A, Alesse E, Alleva C, Screpanti I, Morrone S, Scarpa S, Frati L, Hayday AC, Piovella F, and Gulino A. Heavy-metal modulation of the human intercellular adhesion molecule (ICAM-1) gene expression. Biochim Biophys Acta 1261: 107-114, 1995.[Medline]
  20. Matsukura S, Stellato C, Plitt JR, Bickel C, Miura K, Georas SN, Casolaro V, and Schleimer RP. Activation of eotaxin gene transcription by NF-kappa B and STAT6 in human airway epithelial cells. J Immunol 163: 6876-6883, 1999.[Abstract/Free Full Text]
  21. McMahon LJ, Montgomery DW, Guschewsky A, Woods AH, and Zukoski CF. In vitro effects of zinc chloride on spontaneous sheep red blood cell (e) rosette formation by lymphocytes from cancer patients and normal subjects. Immunol Commun 5: 53-67, 1976.[ISI][Medline]
  22. Mouthon MA, Bernard O, Mitjavila MT, Romeo PH, Vainchenker W, and Mathieu-Mahul D. Expression of tal-1 and GATA-binding proteins during human hematopoiesis. Blood 81: 647-655, 1993.[Abstract/Free Full Text]
  23. Nelson PJ, Kim HT, Manning WC, Goralski TJ, and Krensky AM. Genomic organization and transcriptional regulation of the RANTES chemokine gene. J Immunol 151: 2601-2612, 1993.[Abstract]
  24. Oteiza PI, Clegg MS, Zago MP, and Keen CL. Zinc deficiency induces oxidative stress and AP-1 activation in 3T3 cells. Free Radic Biol Med 28: 1091-1099, 2000.[ISI][Medline]
  25. Palmiter RD, Cole TB, and Findley SD. ZnT-2, a mammalian protein that confers resistance to zinc by facilitating vesicular sequestration. EMBO J 15: 1784-1791, 1996.[ISI][Medline]
  26. Palmiter RD, Cole TB, Quaife CJ, and Findley SD. ZnT-3, a putative transporter of zinc into synaptic vesicles. Proc Natl Acad Sci USA 93: 14934-14939, 1996.[Abstract/Free Full Text]
  27. Palmiter RD and Findley SD. Cloning and functional characterization of a mammalian zinc transporter that confers resistance to zinc. EMBO J 14: 639-649, 1995.[ISI][Medline]
  28. Polito AJ and Proud D. Epithelia cells as regulators of airway inflammation. J Allergy Clin Immunol 102: 714-718, 1998.[ISI][Medline]
  29. Propst SM, Denson R, Rothstein E, Estell K, and Schwiebert LM. Proinflammatory and Th2-derived cytokines modulate CD40-mediated expression of inflammatory mediators in airway epithelia: implications for the role of epithelial CD40 in airway inflammation. J Immunol 165: 2214-2221, 2000.[Abstract/Free Full Text]
  30. Sato E, Nelson DK, Koyama S, Hoyt JC, and Robbins RA. Inflammatory cytokines modulate eotaxin release by human lung fibroblast cell line. Exp Lung Res 27: 173-183, 2001.[ISI][Medline]
  31. Shankar AH and Prasad AS. Zinc and immune function: the biological basis of altered resistance to infection. Am J Clin Nutr 68: 447S-463S, 1998.[Abstract]
  32. Stellato C, Matsukura S, Fal A, White J, Beck LA, Proud D, and Schleimer RP. Differential regulation of epithelial-derived C-C chemokine expression by IL-4 and the glucocorticoid budesonide. J Immunol 163: 5624-5632, 1999.[Abstract/Free Full Text]
  33. Taha RA, Minshall EM, Miotto D, Shimbara A, Luster A, Hogg JC, and Hamid QA. Eotaxin and monocyte chemotactic protein-4 mRNA expression in small airways of asthmatic and nonasthmatic individuals. J Allergy Clin Immunol 103: 476-483, 1999.[ISI][Medline]
  34. Tang ZL, Wasserloos K, St. Croix CM, and Pitt BR. Role of zinc in pulmonary endothelial cell response to oxidative stress. Am J Physiol Lung Cell Mol Physiol 281: L243-L249, 2001.[Abstract/Free Full Text]
  35. Teran LM. CCL chemokines and asthma. Immunol Today 21: 235-242, 2000.[ISI][Medline]
  36. Teran LM, Mochizuki M, Bartels J, Valencia EL, Nakajima T, Hirai K, and Schroder JM. Th1- and Th2-type cytokines regulate the expression and production of eotaxin and RANTES by human lung fibroblasts. Am J Respir Cell Mol Biol 20: 777-786, 1999.[Abstract/Free Full Text]
  37. Torres-Alanis O, Garza-Ocanas L, and Pineyro-Lopez A. Evaluation of urinary mercury excretion after administration of 2,3-dimercapto-1-propane sulfonic acid to occupationally exposed men. J Toxicol Clin Toxicol 33: 717-720, 1995.[ISI][Medline]
  38. Truong-Tran AQ, Ruffin RE, and Zalewski PD. Visualization of labile zinc and its role in apoptosis of primary airway epithelial cells and cell lines. Am J Physiol Lung Cell Mol Physiol 279: L1172-L1183, 2000.[Abstract/Free Full Text]
  39. Ueda A, Okuda K, Ohno S, Shirai A, Igarashi T, Matsunaga K, Fukushima J, Kawamoto S, Ishigatsubo Y, and Okubo T. NF-kappa B and Sp1 regulate transcription of the human monocyte chemoattractant protein-1 gene. J Immunol 153: 2052-2063, 1994.[Abstract]
  40. Velden VH and Versnel HF. Bronchial epithelium: morphology, function and pathophysiology in asthma. Eur Cytokine Netw 9: 585-597, 1998.[ISI][Medline]
  41. Wingender E, Chen X, Hehl R, Karas H, Liebich I, Matys V, Meinhardt T, Pruss M, Reuter I, and Schacherer F. TRANSFAC: an integrated system for gene expression regulation. Nucleic Acids Res 28: 316-319, 2000.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/3/L719    most recent
00406.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via ISI Web of Science (12)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Richter, M.
Right arrow Articles by Larivée, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Richter, M.
Right arrow Articles by Larivée, P.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2003 by the American Physiological Society.