Am J Physiol Lung Cell Mol Physiol 285: L808-L818, 2003.
First published June 6, 2003; doi:10.1152/ajplung.00377.2002
1040-0605/03 $5.00
Leukotrienes mediate part of Ova-induced lung effects in mice via EGFR
B. Boris Vargaftig and
Monique Singer
Unité de Pharmacologie Cellulaire, Unité Associée Institut Pasteur-Institut National de la Santé et de la Recherche Médicale U485, Institut Pasteur, 75015 Paris, France
Submitted 5 November 2002
; accepted in final form 28 May 2003
 |
ABSTRACT
|
|---|
Antigen induces murine bronchial hyperreactivity (BHR), inflammation, mucus accumulation, and airway remodeling. To investigate whether leukotrienes (LT) mediate the effects of antigen [ovalbumin (Ova)], we studied 5-lipoxygenase (5-LO) expression in immunized BP2 mice and blocked LT synthesis with the 5-LO inhibitor zileuton or antagonized their effects with receptor antagonists [cysteinyl leukotriene (Cys-LT)-ra MK-571, LY-171883; LTB4-ra PH-163]. Cys-LT content increased in the bronchoalveolar lavage fluid (BALF) as early as 15 min after the intratracheal instillation of Ova. Zileuton inhibited LT release in the BALF and eosinophil recruitment in the lungs, and dose dependently reduced BHR, mucus accumulation, and remodeling, as did the LT-ra. Thus LT, released just after antigen challenge, might constitute the first step in accounting for the effects of Ova. Because mucus accumulation is regulated via the EGF receptor (EGFR), which is also implicated in the effects of LT, we studied this pathway with AG-1478, an EGFR tyrosine kinase inhibitor given at 0.5, 4, and 20 mg/kg. AG-1478 inhibited BHR, inflammation, and lung remodeling induced by Ova or by molecules themselves generated by Ova, such as LT, IL-13, and monocyte chemoattractant protein-1, which promote identical effects, suggesting the involvement of the EGFR pathway in the asthma-like syndrome observed.
asthma; hyperreactivity; mucus; inflammation; remodeling; epidermal growth factor receptor
LEUKOTRIENES (LT) are important mediators of inflammation and asthma (18, 19, 26, 33, 46-48). They promote bronchoconstriction (18, 19, 47), recruitment of inflammatory cells (18, 19, 46, 47), plasma extravasation, and edema. They also increase mucus release (18, 23, 28, 47) and reduce ciliary function (37), thus promoting bronchial obstruction. Drugs preventing the synthesis or the effects of LT have been developed as a treatment for asthma (1, 12, 20, 21, 30, 38, 42) and have become useful tools to study the role of LT (18, 19, 37, 39, 44, 46, 47). We recently demonstrated that the effects of antigen and of IL-13 may involve secondary mediators and suggested that LT could account for some of these (39, 46, 47). This led us to study the kinetics of LT production following the intratracheal administration of Ova to immunized mice and the role of LT in these responses using specific inhibitors and antagonists. The present results show that LT mediate numerous effects of Ova, such as bronchial hyperreactivity (BHR), inflammation, remodeling, and mucus accumulation. Takayama et al. (40) previously demonstrated that mucus production is regulated by the EGF receptor (EGFR) pathway, and we have shown that EGFR mRNAs are induced in the murine model (46), which has also been shown in asthmatic patients (2, 4). This led us now to investigate the role of the EGFR pathway in the induction of BHR, inflammation, and lung remodeling, using the EGFR tyrosine kinase (EGFR-TK) inhibitor AG-1478. The latter dose-dependently inhibited BHR, inflammation, mucus accumulation, and remodeling that follow challenge with antigen or with the potential mediators we have previously studied, such as LT, recombinant murine (rm) IL-13, and monocyte chemoattractant protein (MCP)-1 (39, 46, 47). Indeed, these molecules induce and amplify LT and their effects, as well as a large part of the effects of Ova (46), and promote a positive loop of regulation that perpetuates the asthma-like syndrome. Accordingly, the downregulation of these molecules by AG-1478 inhibits the amplification process of the inflammatory reaction, suggesting that EGFR is involved in the effects of LT and in the asthma-like syndrome triggered by antigen in mice.
 |
MATERIALS AND METHODS
|
|---|
Animals, immunization, and materials. The experimental design was approved by the Institut Pasteur Review Board, according to the European directives. Male BP2 mice (Centre d'Elevage R. Janvier, Le Genest St. Isle, France), aged 5-6 wk, were immunized subcutaneously at 1-wk intervals with 1 µg of ovalbumin (Ova; ICN Pharmaceuticals, Orsay, France) and 1.6 mg of aluminum hydroxide (Merck, Darmstadt, Germany) in 0.4 ml of 0.9% saline (39). Two weeks later, groups of five mice were challenged intratracheally with Ova (10 or 20 µg) in 50 µl of endotoxin-free 0.9% saline, animals being lightly anesthetized with 12% xylazine (20 mg/kg) and ketamine 500 (45 mg/kg, both from Sigma, St. Louis, MO). Repeated challenges with Ova were also performed (10 µl/ day for 3 days). We performed challenge with other molecules induced by Ova, i.e., leukotriene (LT) C4 or LTB4 (1 µg, evaporated under N2 and dissolved in NaCl, both from Cayman Chemicals, Ann Arbor, MI), IL-13 receptor antagonist (-ra, 4 µg; Snafu Elf Bioresearches, Liege, France), or MCP-1 (1 µg; Imogene, Los Angeles, CA) (46, 47). Groups of mice were treated separately with different drugs; the 5-lipoxygenase (5-LO) inhibitor zileuton (Zyflo; Abbott, Chicago, IL) (30) was first used, because it inhibits the initial step of the transformation of arachidonic acid via this pathway, providing cysteinyl leukotrienes (Cys-LT, by LTC4 synthase) or LTB4 (by LTA4 hydrolase) (1, 26, 33); zileuton was given by oral gavage at 50 mg/kg 1 h before challenge, then three times a day up to 24 h (for BHR and cytokines) or 72 h (for BHR and mucus accumulation). The chemical component of zileuton ICI-230487 (Astra Zeneca), available only in small amounts, was also injected at 35 mg/kg iv (30). Two receptor antagonists specific for the Cys-LT LY-171883, or Tomelukast (12), and MK-571 (21), both from Cayman Chemicals, were instilled at 1, (3 or) 5, 15, or 50 mg/kg it 1 h before challenge, 6 h later, then once a day for 2 days (47). The LTB4-ra PH-163 (20) was instilled under the same conditions, at 1, 3, 10, or 30 mg/kg it as described previously (47).
Dexamethasone (sodium salt, Sigma) was injected at 1.25 mg/kg iv (at 18 and 1 h before and 6, 24, 48 h after challenge) (39).
The EGFR-TK inhibitor AG-1478 (35) (Calbiochem, Schwalbach, Germany) was instilled at 0.5, then 4, and 20 mg/kg it 1 h before the challenge with Ova, 6 h later, then once a day for 2 days. These doses were in the range for specific EGFR inhibition in mice (5). Seventy-two hours after challenge, mice were anesthetized with urethane (35 mg/kg), then bronchoalveolar lavage fluid (BALF), and lungs were collected.
To evaluate cell proliferation in vivo, we injected bromodeoxyuridine (BrdU, Sigma) at 120 mg/kg ip (21) 1 h before the intratracheal challenge, then 1 h later at 50 mg/kg, and subsequently twice a day until the animal was killed.
Evaluation of BHR. Basal enhanced pause (Penh) of the airways and BHR were assessed in unrestrained conscious animals by barometric plethysmography (Buxco Electronics, Troy, NY). We evaluated bronchial reactivity using noncumulative methacholine challenges as described (17). Mice were placed in a Buxco chamber, and respiratory parameters were measured after methacholine aerosol inhalation for 90 s at 60 mM (39, 46, 47) (Nebulizor Type LS light; System Assistance Medical, Le Ledat, France). Penh was calculated according to the manufacturer's recommendations as Penh = [(expectory time/relaxation time) - 1] x peak expectory flow/peak inspiratory flow (15, 17, 27).
For graphic representation, BHR (expressed in area under the curve) is measured by the difference between the surface under the curve of the peak of Penh and the surface under the curve of the basal level of Penh, evaluated for 10 min after the start of methacholine inhalation (39, 46, 47).
BALF. Mice were anesthetized with urethane (45 mg/30 g body wt ip), and the trachea was cannulated. BALF was collected with 0.5 ml followed by 2x 1 ml of sterile saline containing EDTA (0.005 M), PMSF (0.005 M), and DTT (0.005 M), all from Sigma, then immediately centrifuged to eliminate the cells, and immersed in liquid nitrogen. The total number of nucleated cells was determined as described previously (39).
Determination of Cys-LT, LTB4 proteins by enzyme immunoassay and MUC5AC, IL-4, IL-13 proteins in the BALF by ELISA. Fresh cell-free BALF kept at 4°C for <1 h or nitrogen-frozen cell-free BALF kept for <72 h was used, since the stability of LT in these conditions has been verified (47). The quantification (pg/ml) was achieved by enzyme immunoassay according to the manufacturer's instructions (kit for Cys-LT or for LTB4, Cayman Chemicals) (47).
MUC5AC, IL-4, and IL-13 by ELISA were determined as described previously (39).
Quantitative RT-PCR. After lung washing, isolation, and dispersion, mRNAs were extracted as described (46, 47). We performed intron-differential RT-PCR for lungs, using specific primers for 5-LO, IL-4, IL-13, MCP-1, MCP-5, KC, MUC5AC, and
-actin (39, 46, 47); for eotaxin, oligos 5' TGCACCCTGAAAGCCATAGTCTT and 3' TTATCCTCAGTTACTCCTAACTCG were used. The cDNAs and PCR were obtained as described previously (7, 27, 39). Standards (PCR products or plasmids) were prepared, and the copy number was determined (7, 39, 46). The results are given as a ratio of specific mRNAs/
-actin copies.
Determination of lung myeloperoxidase or eosinoperoxidase activities. After being washed, lungs were homogenized with a Potter for 1 min at 4°C, then centrifuged. Myeloperoxidase (MPO) and eosinoperoxidase (EPO) activities were determined on supernatants as previously described (27, 39).
Histology. The lungs were flushed to remove blood, then inflated with optimum cutting temperature medium (Sakura Finetek, Torrance, CA), diluted 1:1 (vol/vol) in saline, and immersed in 10% formaldehyde in PBS overnight at 4°C, then processed to paraffin wax. Five-micrometer sections were stained with periodic acid-Schiff (PAS)/hematoxylin for mucins. Collagen was visualized by acidic picrofuschine staining of van Gieson (14).
Quantification of mucins and collagen was achieved with the Optilab software, version 2.1 (Grastek, Mirmande, France). In the case of mucins, the labeled area of airway epithelia was measured on longitudinal lung sections, always at the same place of the main bronchiole, by surrounding the epithelium and measuring the total area (labeled plus nonlabeled) minus the nonlabeled area. For each sample, the same total area of epithelium was evaluated [approximately the same length of airways, as previously described (39)]. The sum of the values of five fields/slide for five slides is provided for each animal, and the area in pixels is converted in millimeters squared with a coefficient variable according to the objective, the same one for the whole experiment. Five animals were used for each treatment, and the mean of the five values is given in Table 1, and standard deviation was calculated on the mean of these five values (in three independent experiments). All the data were obtained in a blind fashion at x200 magnification. These results are representative of those obtained by other ways of investigation, such as the measure of the labeled area on the same surface of the airway sections on five random fields for each slide, which was performed for mucus and for collagen.
The effect of the treatment was estimated by the number of labeled airways on the total number of airways for each slide (not shown, since it did not modify the results presented in Table 1 in terms of order of magnitude).
Immunohistochemistry. We determined
-actin from smooth muscle actin (
-SMA) by immunohistochemistry (36), using a mouse anti-
-SMA monoclonal antibody amplified by a biotin-streptavidin-peroxidase antibody system [Dako, as described previously (47)], revealed by 3-amino-9-ethylcarbazole (Sigma). Slides were counterstained by hematoxylin Gill-2 (Shandon, Pittsburgh, PA). Quantification was achieved with the Optilab System.
Cell proliferation in vivo. Immunodetection of cell-incorporated BrdU (32, 47) was performed in the lung sections, with the streptavidin-biotin antibody system for BrdU staining (Oncogene Research Products, Boston, MA) (32). We counted the dark brown positive nuclei in the bronchial epithelium under the microscope using a grid at x400 magnification at different time points (6, 24, and 72 h) after challenge, without counterstain for better sensitivity. Results are given as percentages, as positive nuclei among total nuclei per millimeter of basement membrane.
Secretion assays. Seventy-two hours after challenge with Ova [i.e., on airway epithelial cells full of mucus (39, 47)], LT or Ova was instilled intratracheally to test its ability to trigger secretion. BALF was collected 30 min later to determine MUC5AC by ELISA, and lungs were analyzed by histology.
Statistical analysis. Results are presented as means ± SD (n = 5). Significance levels were calculated by one-way ANOVA followed by Scheffé's test, with the SPSS 6.1 software (SPSS, Chicago, IL) (* significance between data with a threshold of P < 0.05, n = 5).
 |
RESULTS
|
|---|
Induction by Ova challenge of the expression of 5-LO mRNAs in the lungs and of LT release into the BALF: drug modulation. 5-LO mRNAs, which were expressed intensively in the lungs at 15 min after challenge with Ova and persisted up to 72 h (Fig. 1A), were downregulated by zileuton at all time points (Fig. 1B, and not shown).

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 1. A: kinetic of 5-lipoxygenase (LO) expression after the intratracheal instillation of saline (S) or ovalbumin (O, 10 µg), evaluated by quantitative RT-PCR (5-LO copies/ -actin copies, LightCycler system). B: interference of zileuton (Z) or dexamethasone (D) with 5-LO mRNA expression in the lungs of immunized BP2 mice 24 h after saline or ovalbumin (Ova) challenge evaluated by RT-PCR. Doses: dexamethasone, 1.25 mg/kg, 1 h before and 6 h after challenge, then once a day for 3 days; zileuton, orally, 50 mg/kg, 1 h before challenge, then 3 times a day for 3 days. *P < 0.05; n = 5.
|
|
The products of 5-LO, Cys-LT (composed of LTC4, D4, E4), and LTB4 accumulated in the BALF after challenge with Ova (Fig. 2A). Large amounts of Cys-LT were already released at 15 min, followed by LTB4 between 2 and 24 h and again by Cys-LT at 48-72 h (Fig. 2A), showing a bimodal kinetics of expression. Cys-LT production was reduced by zileuton 15 min after challenge with Ova, and at 6 h, all the LT were reduced (Fig. 2B, other time points not shown).

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 2. Kinetics of cysteinyl leukotrienes (Cys-LT, A) or leukotriene (LT) B4 (B) production in the bronchoalveolar lavage fluid (BALF) of BP2 mice after saline or Ova challenge (10 µg). C: interference of zileuton (orally, 50 mg/kg, 1 h before challenge, then 3 times a day for 3 days), with the 5-LO products Cys-LT (high level of expression at 15 min) and LTB4 (at 6 h). mn, Min. *P < 0.05; n = 5.
|
|
Dexamethasone inhibited the expression of 5-LO mRNAs at both 6 (Fig. 1B) and 72 h (not shown) after Ova challenge and, as a consequence, the release of LT into the BALF (Fig. 2B).
LT mediate Ova-induced BHR: drug modulation. To investigate whether LT are involved in Ova-induced BHR, we gave zileuton orally at 15, 35, 50, and 70 mg/kg (not shown). Only doses of 70 mg/kg twice a day for 3 days, or 50 mg/kg three times a day for 3 days, reduced BHR (Fig. 3A). ICI-230487, injected at the dose of 35 mg/kg iv, reduced Ova-induced BHR to 55% (Fig. 3A); higher doses failed to improve efficacy (not shown).

View larger version (41K):
[in this window]
[in a new window]
|
Fig. 3. Bronchopulmonary hyperreactivity (BHR) to methacholine (MCh) 72 h after the intratracheal challenge of immunized mice with saline (Sal or S) or Ova and drug modulation. A: dose-dependent interference of zileuton (Zil) with BHR to MCh. B, C: dose-dependent interference of LTD4 receptor antagonists (-ra) with BHR to MCh using MK-571 (MK; B) or LY-171883 (LY; C). D: interference of the LTB4-ra PH-163 (PH), with BHR to MCh in the same conditions. BHR is expressed as the area under the curve (AUC, in arbitrary units). *P < 0.05, n = 5.
|
|
The mediator role of the individual LT was confirmed by use of receptor antagonists. The LTD4-ra MK-571 or LY-171883, instilled intratracheally 1 h before and 6 h after challenge with Ova, dose dependently inhibited BHR evaluated 24 h later (Fig. 3, B and C, respectively) and was still efficacious 72 h later (not shown) after daily instillation of the drug.
The LTB4-ra PH-163, instilled intratracheally, also dose dependently reduced BHR 24 (or 72) h after Ova (Fig. 3D, and not shown), supporting the involvement of LT in BHR.
LT are involved in Ova-induced cell recruitment, Th2 cytokine, and chemokine expression: drug modulation. Zileuton (50 mg/kg, three times a day for 3 days) inhibited eosinophil recruitment into the lungs and, consequently, their release into the BALF (measured by EPO titers at 72 h, Fig. 4A), as did the LTD4-ra MK-571 and the LTB4-ra PH-163. This reduction was confirmed by hematoxylin-eosin staining of the corresponding lung sections (not shown). Neutrophils were poorly recruited into the lungs after Ova and were reduced by zileuton and by PH-163, but less so by MK-571 (measured by MPO titers at 24 h, Fig. 4B). Moreover, zileuton and the LT-ra reduced the expression of IL-4 and IL-13 mRNAs in the lungs at 6 h (Fig. 5A) and the corresponding proteins in the BALF 6-24 h after antigenic challenge (Fig. 5, C and D). These drugs also reduced the expression of mRNAs for MCP-1, MCP-5, KC, and eotaxin 24 h after challenge with antigen (Fig. 5, C-F).

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 4. Inhibition by zileuton (orally, 50 mg/kg, 1 h before challenge, then 3 times a day for 3 days), by MK-571 (MK, 15 mg/kg), or by PH-163 (PH, 10 mg/kg) of eosinoperoxidase (EPO, A) and myeloperoxidase (MPO, B) in lung tissue, and of the number of eosinophils (A) or of neutrophils (B) in the BALF after Ova (10 µg) compared with saline challenge. OD, optical density. *P < 0.05, n = 5.
|
|

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 5. Inhibition by zileuton (Z, oral gavage, 50 mg/kg, 1 h before challenge, then 3 times a day for 3 days), MK-571 (15 mg/kg), or PH-163 (10 mg/kg) of Th2 cytokines and chemokines mRNAs in the lungs [IL-4, A; IL-13, B; and monocyte chemoattractant protein (MCP)-1, E; MCP-5, F; KC, G; eotaxin, H] and of IL-4 and IL-13 proteins in the BALF (C, D), induced 6 or 24 h after instillation of Ova (10 µg it) in BP2 mice. *P < 0.05, n = 5.
|
|
Involvement of LT in mucus synthesis/accumulation and in mucus secretion after Ova. Zileuton dose dependently inhibited mucus accumulation in the lungs after Ova challenge and completely so at 50 mg/kg three times a day for 3 days (39, 47), as evaluated by RT-PCR for MUC5AC mRNAs (Fig. 6A), by ELISA for MUC5AC proteins (Fig. 6B), and by PAS staining of mucins in the airways (Fig. 7C, and Table 1). The LTD4-ra MK-571 also dose dependently inhibited MUC5AC (Fig. 6, A and B) and mucus accumulation in epithelial cells as verified morphologically (Fig. 7D and Table 1), as did the LTB4-ra PH-163 72 h after challenge with Ova (Figs. 6, A and B, 7E; Table 1).

View larger version (39K):
[in this window]
[in a new window]
|
Fig. 6. Inhibition by zileuton (Zil), MK-571, or PH-163 of MUC5AC mRNAs in the lungs (A) and of MUC5AC proteins by ELISA in the BALF (B) induced after Ova challenge compared with saline. C: MUC5AC secretion evaluated by ELISA 30 min after the instillation of Ova (10 µg it) or of LTC4 (1 µg) on airway epithelial cells full of mucus (i.e., 72 h after a first intratracheal challenge on immunized BP2 mice). Doses: Zil-a 10 mg/kg, Zil-b 50 mg/kg, 1 h before challenge, then 3 times a day for 3 days. MK-a 1 mg/kg, MK-b 15 mg/kg, PH-a 3 mg/kg, PH-b 10 mg/kg, 1 h before challenge and once a day for 3 days (for both MK-571 and PH-163). *P < 0.05, n = 4.
|
|

View larger version (90K):
[in this window]
[in a new window]
|
Fig. 7. Periodic acid-Schiff (PAS) staining of neutral mucins in the airways (bright pink, counterstained with hematoxylin in purple) collected 72 h after the intratracheal instillation of saline (A), Ova (10 µg) (B), zileuton (for dose, see Fig. 1B) + Ova (C), LY-171883 (15 mg/kg) + Ova (D), and PH-163 (10 mg/kg) + Ova (E). Note Ova-induced hypertrophy of epithelial cells, inflammatory infiltrate, and mucus accumulation (B). LT inhibition/antagonism abolished mucous cell metaplasia and reduced the inflammatory infiltrate around the airways (C, D, and arrow a in E) and neighboring vessels (arrow b in E). Immunodetection of bromodeoxyuridine (BrdU)-containing nuclei (of proliferating cells) in the airways (F) 72 h after Ova (10 µg) with hematoxylin counterstain: labeled cells are observed in airway epithelium (arrow a), at the site of collagen deposition (arrow b), and in alveoli (arrow c, alveolar macrophages). G-K: lung tissue remodeling after Ova and role of LT. Collagen deposition around the airways (G, H) was induced by the intratracheal instillation of Ova, identified by specific acidic picrofuschine staining of van Gieson. Collagen (in brown/orange) accounts for hypertrophy of the tissues around the bronchioles and a reduction of the diameter of the lumen of airways (G, H). Effect of zileuton is indicated by arrow a in K; no matrix deposition in the tissue was observed. For quantification after specific staining, see Table 1. I-K: remodeling of airways after Ova identified by -smooth muscle actin immunocytochemistry: smooth muscle cells after saline (I). Note thickening of -actin labeling after Ova (J), which was reduced by zileuton (arrow a in K). Vessels (v) were poorly affected after Ova (not shown), and zileuton had no effect (arrow b in K). L: PAS staining of airway section after 72 h of Ova (i.e., on airway epithelial cells full of mucus as in B) and 30 min after a new intratracheal instillation of Ova; the latter induced mucus secretion since no or little mucus was detected in epithelial cells. The bar represents 100 µm.
|
|
We have previously shown that LT promote MUC5AC synthesis and production as well as the direct release of mucus into the BALF, without mucus accumulation in the airways (47). We demonstrate now that LT, as well as Ova, are potent secretagogues since they induce, when instilled intratracheally, MUC5AC secretion from epithelial cells previously filled with mucus (i.e., 72 h after a single challenge with Ova) (Fig. 6C). This was confirmed by histology (not shown). These observations indicate that new challenges by Ova or LT on airway epithelial cells full of mucus promote mucus release and bronchial obstruction [as described with rmIL-13 (47)].
Cell proliferation and mucus or remodeling: role of LT. A single instillation of Ova (10 µg it) induced only a very limited BrdU labeling of the nuclei at the basal pole of mucus-producing cells (1 ± 2% in saline vs. 5 ± 2% 72 h after Ova). Three instillations of Ova (10 µg per day for 3 days) were more efficacious, the number of labeled nuclei increasing to 8 ± 3% (n = 4), which was not affected by zileuton (not shown). This agrees with earlier observations, which do not indicate a role of LT in mucus cell proliferation (47).
Finally, alveolar macrophages also showed a marked BrdU labeling, possibly related to their morphological alterations observed in the BALF.
Collagen deposition in the airways and remodeling: role of LT. As early as 72 h after the intratracheal instillation of Ova, collagen deposition was observed around bronchioles, highlighted by acidic picrofuschine staining from van Gieson (Fig. 7, G and H), as well as DNA synthesis at the same site, as evaluated by BrdU labeling (Fig. 7F). Zileuton, as well as the LTB4-ra PH-163 and the Cys-LT-ra (LY-171883 and MK-571), reduced collagen deposition around the airways (Fig. 7, C-E), as confirmed by quantification with the Optilab system (Table 1). Contrary to rmIL-13 (47), Ova did not induce a marked vascular endothelium remodeling 72 h after challenge (Fig. 7H).
Smooth muscle thickening around the airways. The thickening of smooth muscle cells around the airways induced by Ova challenge, as observed by
-SMA immunocytochemistry (Fig. 7J), was reduced by zileuton (Fig. 7K and Table 1). No clear augmentation of BrdU-labeled cells was observed at this site after a single Ova challenge (Fig. 7F), but an increased
-SMA protein expression was detected. In this case, three challenges with Ova (once a day for 3 days) were needed to detect a statistically significant cell proliferation (not shown).
Thus LT mediate various and important effects of antigen, in addition to those of IL-13 (47).
EGFR-TK inhibitor AG-1478 reduces BHR, eosinophilic inflammation, and mucus accumulation after challenge with Ova or with its potential mediators. Because the EGFR pathway is involved in mucus accumulation induced by Ova (and by IL-13) (35, 40, 50), we hypothesized that a similar pathway might be implicated in BHR and inflammation induced by Ova or by molecules generated by Ova, such as LT, IL-13, and MCP-1, which we previously studied (39, 46, 47). Therefore, we used the specific inhibitor of the EGFR-TK AG-1478, which, administered 1 h before challenge, dose dependently inhibited BHR due to the intratracheal instillation of Ova, LT (LTC4 and LTB4), rmIL-13, or MCP-1 (Fig. 8A).

View larger version (40K):
[in this window]
[in a new window]
|
Fig. 8. Dose-dependent interference of the EGF receptor tyrosine kinase (EGFR-TK) inhibitor AG-1478 (AG, at 0.5, 4, or 20 mg/kg) with BHR to MCh (expressed as the AUC, A), eosinophil recruitment into the BALF (in terms of cell count; when the number of eosinophils is low, only the effect of the higher dose of AG-1478 is presented; B), and MUC5AC release in the BALF (by ELISA, C) after intratracheal instillation of Ova (10 µg), LTC4 (1 µg/day for 2 days), LTB4 (1 µg/day for 2 days), recombinant murine (rm) IL-13 (4 µg), or MCP-1 (1 µg). BHR and MUC5AC were reduced in all cases by AG-1478. Eosinophilia, induced only after Ova, LTC4, and IL-13 challenges, was inhibited by AG-1478 only in these cases. Statistical significance compared with saline challenged state and *statistical significance compared with specific challenged state (P < 0.05).
|
|
The recruitment of eosinophils into the lungs and consequently their passage into the BALF after challenge with Ova, with LTC4, or with rmIL-13 were also reduced by AG-1478 (Fig. 8B). This was confirmed by hematoxylin-eosin staining of lung sections (not shown).
In addition, no mucus-containing epithelial cells were observed in the airways of AG-1478-treated animals exposed to antigen (Table 1), and, as a consequence, no mucus was released in the BALF (MUC5AC by ELISA, Fig. 8C). Similar results were obtained after challenge with LT, rmIL-13, or rmMCP-1 (Fig. 8C). Finally, AG-1478 also reduced collagen deposition around the airways after challenge with antigen (Table 1).
These experiments strongly suggest the involvement of EGFR in BHR, inflammation, and remodeling, in addition to its known involvement in mucus accumulation.
 |
DISCUSSION
|
|---|
Our earlier results suggest that LT mediate the major effects of rmIL-13 (47) on murine lungs. Indeed, when instilled intratracheally, LT induce typical sequelae of allergy such as BHR, inflammatory cell recruitment, edema, lung remodeling, and collagen deposition in case of LTB4 challenge (M. Singer, unpublished observation). We show here that Cys-LT and LTB4 also participate in the mediation of the effects of Ova and postulate that Cys-LT, released just after antigenic challenge and before IL-13, probably constitute the initial step of the inflammatory reaction. Indeed, the rapid 5-LO activation and LT synthesis after challenge may occur within several minutes via activation of constitutive enzymes in cells (ATP, Ca, or glutathione dependent) (6). LT synthesis takes place in the nuclear envelope of activated cells, where their local high concentration might favor the direct activation of LT nuclear receptors and transcription factors or of signaling pathways (6) that promote the subsequent effects of antigen. This might include the EGFR pathway. LT would also amplify the reaction by inducing cytokine and chemokine expression (46).
Our results suggest that Cys-LT are directly involved in eosinophilic inflammation. Indeed, the LTD4-ra reduced eosinophil counts after Ova, and the intratracheal instillation of LTC4 or of LTD4 promoted their recruitment (47). By contrast, the effects of LTB4 may be indirect.
LTB4, which induced a poor recruitment of eosinophils when instilled intratracheally, has been shown to cooperate with eotaxin for eosinophil recruitment (24). Accordingly, the LTB4-ra PH-163 may have inhibited eosinophilia by suppressing this cooperation.
LT inhibition reduced a variety of parameters of allergic inflammation, such as eosinophil recruitment, Th2 cytokine (IL-4 and IL-13), and chemokine expression (MCP-1, MCP-5, KC, and eotaxin). This agrees with the reduced cell response to Ova observed in 5-LO-deficient mice (13). Globally, our present observations support the concept of a basic cooperation among LT, cytokines, and chemokines in promoting positive loops of regulation that amplify inflammation, as we have previously described (46). In addition, we now show that repeated exposures to some of these molecules (such as Ova, LT, or IL-13) promote mucus secretion favoring bronchial obstruction, as observed in asthma.
LT are potent bronchoconstrictor agents in humans and induce BHR in BP2 mice (47). Our results show that Ova-induced BHR was only halved by LT inhibition or antagonism via oral or intravenous zileuton (Fig. 3) or LT-ra. Other as-yet unidentified eicosanoids may account for these residual effects (10, 38, 43). By contrast, 5-LO inhibition failed to inhibit BHR after multiple antigen challenge (19, 20). LT may also potentiate or cooperate with other agents likely to induce BHR, such as IL-13, cytokines, or chemokines (46, 47).
EGFR has been claimed to be implicated in the regulation of smooth muscle cell functions (22, 49), and EGFR immunoreactivity is increased in bronchial smooth muscle of asthmatics (35, 38, 49). Therefore, we investigated whether EGFR is involved in the cascade of reactions triggered by antigen. The EGFR-TK inhibitor AG-1478 indeed reduced BHR after Ova, at least to the same extent as zileuton or the LT-ra, suggesting EGFR involvement. Cholinergic muscarinic receptors stimulated by methacholine might transduce the signal to EGFR (45). Indeed, the latter is activated by a ligand-dependent mechanism [via EGF or transforming growth factor (TGF)-
; see Refs. 22, 29], a ligand-independent mechanism (41, 45), or the direct G protein coupled-mediated NF-
B activation via MAP/ERK kinases (50). Notably, EGF induces airway contractions via the cascade of tyrosine kinase and LT production (31). Finally, these numerous pathways converge on the EGFR and promote the syndrome observed.
Recent genetic linkage studies support our present and previous findings (46, 47). Indeed, the EGF response factor 1 [on human chromosome (chr) 14q1] has been identified as a candidate for asthma (16), and the EGFR region (on chr 7) has been linked to BHR (8). Other studies identified LTC4 synthase and IL-13 among the key mediators regulating the susceptibility to asthma (26). In mice, quantitative trait loci were also identified for BHR, as well as MUC2, MUC5AC, and MUC6 (and MCP-5) in the central region of chr 11 (2, 9, 11, 22, 26).
We now show that LT mediate MUC5AC expression [which is regulated via EGFR (40, 41)] and that the intense mucous cell metaplasia observed 72 h after challenge with antigen is only marginally due to mucous cell proliferation, suggesting that mucus induction is independent of a growth factor (such as EGF). Indeed, TGF-
is the ligand for EGFR in this model (40, 41). Alternative mechanisms might be involved in mucus production, since MUC genes are induced by numerous cytokines, including IL-1
, TNF-
, IL-4, IL-13, and IL-9 (3) and by chemokines (46).
LT seem involved as well with tissue remodeling and airway obstruction after challenge with antigen (19). Indeed, zileuton, PH-163, and MK-571 reduced collagen deposition in the airways (Table 1). Our previous studies highlighted the fact that LT, when instilled intratracheally, promote cell recruitment in the lungs and airways and fibroblast growth in the vascular endothelium (47). In addition, LTB4 induces edema around the airways and vessels, as well as collagen deposition in and around the airways 72 h after challenge (M. Singer, unpublished observation). These observations agree with studies performed on LT-deficient mice, which are protected from fibrosis (34). Moreover, 5-LO and 5-LO-activating protein immunoreactivity has been described in endothelial cells and in (inflammatory) cells around the airways after Ova challenge (6), at the site where we observed remodeling and inflammation. These findings suggest a major role for LT in remodeling of the lungs after challenge with antigen. Furthermore, since AG-1478 reduced collagen deposition and mucus accumulation in the airways after antigen challenge (Table 1), EGFR is probably involved as well in airways remodeling. However, although the doses of AG-1478 in this study stay within the dose range recognized for EGFR-TK inhibition (5), we cannot rule out the possibility that this tyrosine kinase inhibitor modulates other kinases in vivo, which might contribute to a reduction of the severity of lung allergy and remodeling.
In conclusion, we demonstrate here that LT, released just after challenge with antigen, are involved in various of its pulmonary effects (BHR, eosinophilic inflammation, mucosal metaplasia, and lung remodeling). Because we previously demonstrated that LT directly promote BHR, inflammation, cytokines, and chemokine expression, as well as lung remodeling (46), we suggest that LT promote the inflammatory reaction and the asthma-like syndrome observed after challenge with antigen. Notably, Ova induces LT before IL-13 or chemokines such as MCP-1, which amplify the effects of Ova (46, 47). Now we suggest that these molecules may converge to the EGFR pathway to promote BHR, eosinophilic inflammation, and remodeling after challenge with antigen. This scenario may also occur in situations where these molecules are generated (25).
As a corollary, a strategy targeting EGFR merits further investigation, since it may prevent most effects of allergens, particularly if associated with LT-ra in asthma as in chronic obstructive diseases.
 |
DISCLOSURES
|
|---|
We thank Professor P. Sansonetti (Unité de Pathogénie Microbienne Moléculaire, Institut Pasteur, Paris, France) for the financial support of this publication and the publication of Refs. 46 and 47.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Drs. J. P. Girard, C. Bonne, and P. Hullot, from the laboratory of Chimie Biomoléculaire et Physiologie, (Centre National de la Recherche Scientifique ESA 5074, Université de Montpellier I, Faculté de Pharmacie, Paris, France), for providing the LTB4-ra PH-163 and its isomer, Dr. S. Ho (see Refs. 14, 15 in Ref. 39) for anti-MUC5AC antibody for ELISA, Dr. A. Minty (Sanofi Elf Biorecherches, Labège, France) for rmIL-13, Dr. M. Huerre, P. Ave, and H. Khun (Unité d'Histopathologie, Institut Pasteur, Paris, France) for technical advices and material, and Dr. L. Touqui for helpful discussions. The anti-
-SMA monoclonal antibody (Dako, France) was a gift of the laboratory of Professor M. Buckingham (Institut Pasteur, Paris, France). The Optilab system was kindly provided by Dr. B. Hurtrel (Institut Pasteur, Paris, France). We sincerely thank Dana Philpott for the critical reading of the manuscript.
Present address for M. Singer: Unité de Pathogénie Microbienne Moléculaire, Unité Associée Institut Pasteur-INSERM U389, Institut Pasteur, 25, rue du Dr Rous, 75015 Paris, France.
 |
FOOTNOTES
|
|---|
Address for reprint requests and other correspondence: M. Singer, Unité de Pathogénie Microbienne Moléculaire, Unité Associée Institut Pasteur-INSERM U389, Institut Pasteur, 25 rue du Dr Roux, 75015 Paris, France (E-mail: msinger{at}pasteur.fr).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
 |
REFERENCES
|
|---|
- Aharony D. Pharmacology of leukotriene receptor antagonists. Am J Respir Crit Care Med 157: S214-S219, 1998.[Medline]
- Amishima M, Munakata M, Nasuhara Y, Sato A, Takahashi T, Homma Y, and Kawakami Y. Expression of epidermal growth factor and epidermal growth factor receptor immunoreactivity in the asthmatic human airway. Am J Respir Crit Care Med 157: 1907-1912, 1998.[Medline]
- Basbaum C, Lemjabbar H, Longphre M, Li D, Gensch E, and McNamara N. Control of mucin transcription by diverse injury-induced signalling pathways. Am J Respir Crit Care Med 160: S44-S48, 1999.[Abstract/Free Full Text]
- Bonner JC. The epidermal growth factor receptor at the crossroads of airway remodeling. Am J Physiol Lung Cell Mol Physiol 283: L528-L530, 2002.[Free Full Text]
- Busse D, Doughty RS, Ramsey TT, Russell WE, Price JO, Flanagan WM, Shawver LK, and Arteaga CL. Reversible G1 arrest induced by inhibition of the epidermal growth factor receptor tyrosine kinase requires up-regulation of p27 Kip1 independent of MAPK activity. J Biol Chem 275: 6987-6995, 2000.[Abstract/Free Full Text]
- Chu SJ, Tang LO, Watney E, Chi E, and Henderson W. In situ amplification of 5-lipoxygenase-activating protein in allergic airway inflammation and inhibition by leukotriene blockade. J Immunol 163: 4640-4648, 2000.
- Colle JH, Falanga P, Singer M, Hevin B, and Milon G. Quantification of messenger RNA by competitive RT-PCR: a simplified read out assay. J Immunol Methods 210: 175-184, 1997.[Web of Science][Medline]
- Daniels SE, Bhattacharrya S, James A, Leaves NI, Young A, Hill MR, Faux JA, Ryan GF, le Souef PN, Lathrop GM, Musk AW, and Cookson WO. A genome-wide search for quantitative trait loci underlying asthma. Nature 383: 247-250, 1996.[Medline]
- Daser A, Daheshia M, and De Sanctis GT. Genetics of allergen-induced asthma. J Allergy Clin Immunol 108: 167-174, 2001.[Web of Science][Medline]
- Ediger TL, Danforth BL, and Toews ML. Lysophosphatidic acid upregulates the epidermal growth factor receptor in human airway smooth muscle cells. Am J Physiol Lung Cell Mol Physiol 282: L91-L98, 2002.[Abstract/Free Full Text]
- Ewart SL, Kuperman D, Schadt E, Tankersley C, Grupe A, Shubitowski DM, Peltz G, and Wills-Karp M. Quantitative trait loci controlling allergen-induced airway hyperresponsiveness in inbred mice. Am J Respir Cell Mol Biol 23: 537-545, 2000.[Abstract/Free Full Text]
- Fleisch JH, Rinkema LE, Haisch KD, Swanson-Bean D, Goodson T, Ho PPK, and Marshall WS. LY171883,1->2-hydroxy-3-propyl-4-(1H-tetrazol-5-yl) butoxy<phenyl<ethanone, an orally active leukotriene D4 antagonist. J Pharmacol Exp Ther 233: 148-157, 1984.
- Funk CD. Lipid-mediator-deficient mice in models of inflammation. In: Molecular and Cellular Basis of Inflammation, edited by Serhan CN and Ward PA. Totowa, NJ: Humana, 1999, p. 109-125.
- Ganter P and Jolles G. Histochimie normale et pathologique, T2. Paris: Gauthier-Villars, 1970, p. 1424-1425.
- Hailé S, Lefort J, Joseph D, Gounon P, Huerre M, and Vargaftig BB. Mucous-cell metaplasia and inflammatory-cell recruitment are dissociated in allergic mice after antibody- and drug-dependent cell depletion in a murine model of asthma. Am J Respir Cell Mol Biol 20: 1-12, 1999.[Abstract/Free Full Text]
- Hakonarson H, Bjornsdottir US, Halapi E, Palsson S, Adalsteinsdottir E, Gislason D, Finnbogason G, Gislason T, Kristjansson K, Arnason T, Birkisson I, Frigge ML, Kong A, Gulcher JR, and Stefansson K. A major susceptibility gene for asthma maps to chromosome 14q24. Am J Hum Genet 71: 483-491, 2002.[Web of Science][Medline]
- Hammelmann E, Takeda K, Haczku A, Cieslewicz G, Schultz L, Hamid Q, Xing Z, Gauldie J, and Gelfand EW. Interleukin-5 but not immunoglobulin E reconstitutes airway inflammation and airway hyperresponsiveness in IL-4 deficient mice. Am J Respir Cell Mol Biol 23: 327-334, 2000.[Abstract/Free Full Text]
- Henderson WR, Lewis DB, Albert RK, Zhang Y, Lamm WJE, Chiang GKS, Jones F, Eriksen P, Tien Y, Jonas M, and Chi E. The importance of leukotrienes in airway inflammation in a mouse model of asthma. J Exp Med 184: 1483-1494, 1996.[Abstract/Free Full Text]
- Henderson WR Jr, Tang L-O, Chu SJ, Tsao SM, Chiang GKS, Jones F, Jonas M, Pae C, Wang H, and Chi E. A role for cysteinyl leukotrienes in airway remodeling in a mouse asthma model. Am J Crit Care 165: 108-116, 2002.
- Hullot P, Poudrel JM, Muller A, Escale R, Rossi JC, Girard JP, and Bonne JC. Synthesis and biochemical/pharmacological profile of the novel leukotriene B4 receptor antagonist sodium (1S* ,3S*)-1-Hydroxy-3-{(3R* S* ,E)-3-hydroxy-7-phenyl-1-hepten-1yl}-1-cyclohexane acetate. Arzneim Forsch 47: 51-58, 1997.[Medline]
- Jones TR, Zamboni R, Belley M, Champion E, Charette L, Ford-Hutchinson AW, Frenette R, Gauthier JY, Leger S, and Masson P. Pharmacology of L-600,711 (MK-571): a novel potent and selective leukotriene D4 receptor antagonist. Can J Physiol Pharmacol 67: 17-28, 1989.[Web of Science][Medline]
- Kalmes A and Clowes AW. EGFR transactivation in the regulation of SMC function. Ann NY Acad Sci 947: 42-54, 2001.[Web of Science][Medline]
- Kim KC, Nassiri J, and Brody JS. Mechanisms of airway goblet cell mucin release: studies with cultured tracheal surface epithelial cells. Am J Respir Cell Mol Biol 1: 137-143, 1989.[Medline]
- Klein A, Talvani A, Silva PMR, Martins MA, Wells TNC, Proudfoot A, Luckacs NW, and Teixeira MM. Stem cell factor-induced leukotriene B4 production cooperates with eotaxin to mediate the recruitment of eosinophils during allergic pleuresy in mice. J Immunol 167: 524-531, 2001.[Abstract/Free Full Text]
- Konstant MW, Walenga RW, Hillard KA, and Hillard JB. Leukotriene B4 markedly elevated in the epithelial lining fluid of patients with cystic fibrosis. Am Rev Respir Dis 148: 896-901, 1993.[Web of Science][Medline]
- Lam BK. Biochemical and molecular characterization of LTC4 synthase. ACI International 9: 3-5, 1997.
- Lefort J, Singer M, Leduc D, Renesto P, Nahori MA, Huerre M, Creminon C, Chignard M, and Vargaftig BB. Systemic administration of endotoxin induces bronchopulmonary hyperreactivity dissociated from TNF-
formation and neutrophil sequestration into the murine lungs. J Immunol 161: 474-480, 1998.[Abstract/Free Full Text]
- Marom Z, Shelhamer JH, and Bach M. Slow-reacting substances, leukotrienes C4 and D4, increase the release of mucus from human airways in vitro. Am Rev Respir Dis 126: 449-454, 1982.[Web of Science][Medline]
- McCole DF, Keely SJ, Coffey RJ, and Barrett KE. Transactivation of the epidermal growth factor receptor in colonic epithelial cells by carbachol requires extracellular release of transforming growth factor-alpha. J Biol Chem 277: 42603-42712, 2002.[Abstract/Free Full Text]
- McGill KA and Busse WW. Zileuton. Lancet 348: 519-524, 1996.[Web of Science][Medline]
- Nasuhara Y, Munakata M, Sato A, Amishima M, Homma Y, and Kawakami Y. Mechanisms of epidermal growth factor-induced contraction of guinea-pig airways. Eur J Pharmacol 296: 161-168, 1996.[Web of Science][Medline]
- Newberry RD, Stenson WF, and Lorenz RG. Cyclooxygenase-2-dependent arachidonic acid metabolites are essential modulators of the intestinal immune response to dietary antigen. Nat Med 5: 900-906, 1999.[Web of Science][Medline]
- Peters-Golden M. Molecular mechanisms of leukotriene synthesis: the changing paradigm. Clin Exp Allergy 28: 1059-1065, 1998.[Web of Science][Medline]
- Peters-Golden M, Bailie M, Marshall T, Wilke C, Phan SH, Toews GB, and Moore BB. Protection from pulmonary fibrosis in leukotriene-deficient mice. Am J Respir Crit Care Med 165: 229-235, 2002.[Abstract/Free Full Text]
- Puddicombe SM, Polosa R, Richter A, Krishna MT, Howarth PH, Holgate ST, and Davies DE. Involvement of the epidermal growth factor receptor in epithelial repair in asthma. FASEB J 14: 1362-1374, 2000.[Abstract/Free Full Text]
- Richter A, Puddicombe SM, Lordan JL, Bucchieri F, Wilson SJ, Djukanovic R, Dent G, Holgate ST, and Davies DE. The contribution of (IL)-4 and IL-13 to the epithelial-mesenchymal tropic unit in asthma. Am J Respir Cell Mol Biol 25: 385-391, 2001.[Abstract/Free Full Text]
- Russi E, Chapman GA, Marchette B, Abraham WM, and Wanner A. Effects of leukotriene D4 on mucociliary function and airway mechanics in allergic sheep. J Appl Physiol 59: 1416-1422, 1983.
- Schmidt DJ, Watson NW, Dent G, Rühlmann E, Branscheid D, Magnussen H, and Rabe KF. The effect of selective and non-selective phosphodiesterase inhibitors on allergen- and leukotriene C4-induced contractions in passively sensitized human airways. Br J Pharmacol 131: 1607-1618, 2000.[Web of Science][Medline]
- Singer M, Lefort J, and Vargaftig BB. Granulocyte depletion and dexamethasone differentially modulate airways hyperreactivity, inflammation mucus accumulation and secretion induced by rmIL-13 or antigen. Am J Respir Cell Mol Biol 26: 74-84, 2002.[Abstract/Free Full Text]
- Takeyama K, Dabbagh K, Lee HM, Agusti C, Lausier JA, Ueki IF, Grattan KM, and Nadel JA. Epidermal growth factor system regulates mucin production in airways. Proc Natl Acad Sci USA 96: 3081-3086, 1999.[Abstract/Free Full Text]
- Takeyama K, Dabbagh K, Shim JJ, Dao-Pick T, Ueki IF, and Nadel JA. Oxidative stress causes mucin synthesis via transactivation of epidermal growth factor receptor: role of neutrophils. J Immunol 164: 1546-1552, 2000.[Abstract/Free Full Text]
- Tamaoki J, Kondo M, Sakai N, Nakata J, Takemura H, Nagai A, Takizawa T, and Konno K. Leukotriene antagonist prevents exacerbation of asthma during reduction of high-dose inhaled corticosteroid. Am J Crit Care 155: 1235-1240, 1997.
- Toews ML, Ustinova EE, and Schultz HD. Lysophosphatidic acid enhances contractility of isolated airway smooth muscle. J Appl Physiol 83: 1216-1222, 1997.[Abstract/Free Full Text]
- Trifilieff A, El-Hashim A, and Bertrand C. Time course of inflammatory and remodeling events in a murine model of asthma: effect of steroid treatment. Am J Physiol Lung Cell Mol Physiol 279: L1120-L1128, 2000.[Abstract/Free Full Text]
- Tsai W, Morielli AD, and Peralta EG. The m1 muscarinic acethylcholine receptor transactivates the EGF receptor to modulate ion channel activity. EMBO J 15: 1037-1044, 1997.[Web of Science]
- Vargaftig BB and Singer M. Leukotrienes, IL-13, and chemokines cooperate for BHR and mucipare metaplasia in allergic mouse lungs. Am J Physiol Lung Cell Mol Physiol 284: L260-L269, 2003.[Abstract/Free Full Text]
- Vargaftig BB and Singer M. Leukotrienes mediate murine bronchopulmonary hyperreactivity, inflammation, and part of mucosal metaplasia and tissue injury induced by rmIL-13. Am J Respir Cell Mol Biol 28: 410-419, 2003.[Abstract/Free Full Text]
- Wardlaw AJ, Hay H, Cromwell BO, Collins JV, and Kay AB. Leukotrienes LTC4, LTB4, in bronchoalveolar lavage in bronchial asthma and other respiratory diseases. J Allergy Clin Immunol 84: 19-26, 1989.[Web of Science][Medline]
- Yamanaka Y, Hayashi K, Komurasaki T, Morimoto S, Ogihara T, and Sobue K. EGF family ligand-dependent phenotypic modulation of smooth muscle cells through EGF receptor. Biochem Biophys Res Commun 281: 373-377, 2001.[Web of Science][Medline]
- Ye RD. Regulation of nuclear factor-
B activation by G protein-coupled receptors. J Leukoc Biol 70: 839-848, 2001.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
M. Tamaoka, M. Hassan, T. McGovern, D. Ramos-Barbon, T. Jo, Y. Yoshizawa, B. Tolloczko, Q. Hamid, and J. G. Martin
The epidermal growth factor receptor mediates allergic airway remodelling in the rat
Eur. Respir. J.,
November 1, 2008;
32(5):
1213 - 1223.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. D. Hardie, C. Davidson, M. Ikegami, G. D. Leikauf, T. D. Le Cras, A. Prestridge, J. A. Whitsett, and T. R. Korfhagen
EGF receptor tyrosine kinase inhibitors diminish transforming growth factor-{alpha}-induced pulmonary fibrosis
Am J Physiol Lung Cell Mol Physiol,
June 1, 2008;
294(6):
L1217 - L1225.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. P. L. de Oliveira, H. V. Domingos, G. Cavriani, A. S. Damazo, A. L. dos Santos Franco, S. M. Oliani, R. M. Oliveira-Filho, B. B. Vargaftig, and W. T. de Lima
Cellular recruitment and cytokine generation in a rat model of allergic lung inflammation are differentially modulated by progesterone and estradiol
Am J Physiol Cell Physiol,
September 1, 2007;
293(3):
C1120 - C1128.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. L. Kramer, G. H. Deutsch, M. A. Sartor, W. D. Hardie, M. Ikegami, T. R. Korfhagen, and T. D. Le Cras
Perinatal increases in TGF-{alpha} disrupt the saccular phase of lung morphogenesis and cause remodeling: microarray analysis
Am J Physiol Lung Cell Mol Physiol,
August 1, 2007;
293(2):
L314 - L327.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Boxall, S. T. Holgate, and D. E. Davies
The contribution of transforming growth factor-{beta} and epidermal growth factor signalling to airway remodelling in chronic asthma
Eur. Respir. J.,
January 1, 2006;
27(1):
208 - 229.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. D. Nelin, L. G. Chicoine, K. M. Reber, B. K. English, T. L. Young, and Y. Liu
Cytokine-Induced Endothelial Arginase Expression Is Dependent on Epidermal Growth Factor Receptor
Am. J. Respir. Cell Mol. Biol.,
October 1, 2005;
33(4):
394 - 401.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P-R Burgel and J A Nadel
Roles of epidermal growth factor receptor activation in epithelial cell repair and mucin production in airway epithelium
Thorax,
November 1, 2004;
59(11):
992 - 996.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Physiological Society.