|
|
||||||||
1Department of Chest Medicine, 2Division of Chest Surgery, Taipei Veterans General Hospital; and 3School of Medicine, National Yang-Ming University, Taipei 11217, Taiwan
Submitted 7 June 2002 ; accepted in final form 20 June 2003
| ABSTRACT |
|---|
|
|
|---|
1-antitrypsin blocked NE-induced PGE2 release. The production of PGE2 was also inhibited by indomethacin; a selective cyclooxygenase (COX)-2 inhibitor, celecoxib; and dexamethasone. Moreover, the mRNA expression for COX-2 relative to that for a housekeeping gene was approximately eightfold that of the unstimulated cells. Dexamethasone inhibited COX-2 gene transcription. We further observed that NE-induced PGE2 release involved activation of p44/42, but not p38, MAP kinases. Such p44/42 MAP kinases were rapidly phosphorylated, with the concentration of phosphorylated p44/42 MAP kinases peaking at 10 min after stimulation and declining in culture at 90 min. The specific p44/42 MAP kinase inhibitor UO126 completely blocked p44/42 phosphorylation and, subsequently, PGE2 production. The airway epithelium may play important bronchoprotective and immunomodulatory roles in chronic neutrophilic inflammation. human bronchial epithelial cell; prostaglandin E2; chronic neutrophilic inflammation
; or PGE2 (5, 16, 21, 30). PGE2, a metabolite of cyclooxygenase (COX), has been shown to exert a variety of anti-inflammatory and bronchoprotective effects both in vitro and in vivo. PGE2 may prevent allergen-induced bronchoconstriction (9), relax airway smooth muscle (17), inhibit cholinergic neurotransmission (12), and modulate fibroblast proliferation (20). Neutrophil elastase (NE), stored in the azurophilic granules, has been reported to play an important role in stimulating mucus secretion (7), decreasing ciliary function (3), and increasing epithelial permeability (27) and tissue destruction (15). NE may contribute to several inflammatory disorders, including emphysema (29), chronic bronchitis (32), bronchiectasis (31), cystic fibrosis (13), and adult respiratory distress syndrome (18).
Mitogen-activated protein kinases (MAP kinases), a widely studied family of serine/threonine protein kinases, have been reported to participate in multiple directions of cellular programs (28). These MAP kinases are activated by dual phosphorylation on tyrosine/threonine residues by distinct MAP kinase kinases. c-Jun NH2-terminal kinase and p38 MAP kinase can be activated by a variety of extracellular stimuli and may play critical roles in regulating cytokine production. ERK1 (p44) and -2 (p42) are considered to be involved mostly in cell growth, differentiation, and development.
Airway epithelium is likely to be exposed to high levels of NE in chronic neutrophilic inflammation. This investigation attempts to determine the effects of NE on airway epithelium and its signaling pathways. Human airway epithelial cells (HAEC) were grown on modified air-liquid interface culture inserts. NE was employed to stimulate epithelial cells in both the apical and basal directions. We report that NE activates MAP kinases p44/42 and upregulates COX-2 gene expression, which subsequently enhances PGE2 production from HAEC. These results demonstrate that human airway epithelium may play an important bronchoprotective and immunomodulatory roles in chronic neutrophilic inflammation.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Modified air-liquid interface culture for HAEC. This cell culture procedure was modified from methods described previously (33, 34). Human bronchus, obtained from surgical lobectomy for lung cancer, was rinsed several times with Leibovitz's L-15 medium containing penicillin (100 U/ml), streptomycin (100 µg/ml), and amphotericin B (0.25 µg/ml). The tissue was cut into 1- to 2-mm2 pieces, and 3-4 pieces of tissue were planted with the epithelium side facing down onto six-well culture inserts (growth area of membrane 4.2 cm2, pore size 0.4 µm) coated with type IV collagen (50 µg/cm2). Two milliliters of medium containing antibiotics/antimycotic, human epidermoid growth factor (1 ng/ml), insulin (2.5 µg/ml), transferrin (2.5 µg/ml), hydrocortisone (1 µg/ml), 2 mM glutamine, and 0.1% FBS in RPMI 1640 and Medium 199 (vol/vol 1:1) were added to the basal chamber, and 100 µl were added to the insert. Culture medium in the basal chamber was changed every 48-72 h, and no medium was added to the insert. The airway epithelial cells were grown on a porous membrane, on which they formed a continuous epithelial sheet with the basal aspect exposed to medium and the apical surface exposed to air.
Cells grown on the inserts were confluent after 7-10 days of incubation. The tissue fragments were then transferred to fresh inserts to obtain new growth of epithelial cells. Cells were then dissociated using 0.02% trypsin-EDTA solution and seeded in 24-well culture inserts (growth area of membrane 0.3 cm2, pore size 0.4 µm) coated with collagen to determine the extent of mediator release following NE stimulation.
Mediator release. Cells (100 µl) were seeded in 24-well culture inserts at a density of 1 x 105 cells/ml and grown in culture medium (500 µl per basal chamber). The purity of epithelial cells appeared to be >98%, as determined by morphology and by immunocytochemistry with antibodies against cytokeratin for epithelial cells, vimentin for fibroblasts, and myosin for smooth muscle cells. At confluence, NE was added to either apical or basal compartment at a concentration of 5-20 µg/ml. To suppress the effect of mediator release induced by NE, we treated cells with
1-antitrypsin (200 µg/ml), dexamethasone (1-100 µM), indomethacin (0.1-1 µM), or celecoxib (0.5-10 µM suspended in dimethyl sulfoxide). Supernatants were collected at each time point and stored at -80°C until assayed for mediators. Cell viability was determined by light microscopy and dye exclusion with trypan blue. Levels of PGE2 were assayed by ELISA according to the manufacturer's instructions.
Analysis of COX-2 mRNA expression. After the removal of supernatants for mediator measurement, total cellular RNA was isolated from cell monolayers using a high pure RNA isolation kit. The RNA (1 µg) was reverse transcribed into cDNA using Superscript II RNase H- reverse transcriptase. An aliquot of cDNA was then subjected to 35 cycles of PCR using a standard procedure denaturing at 94°C for 1 min, annealing at 52°C for COX-2 for 30 s, and elongating at 72°C for 1.2 min. The COX-2-specific primer pair amplified a 769-bp PCR product composed of 5' primer GGTCTGGTG CCTGGTCTGATGATG and 3' primer CCAGTAGGCAGGAGAACATATAACA. The constitutively expressed gene adenine phosphoribosyltransferase (APRT) was used as an internal control. The primers for APRT were 5' primer GCTGCGTGCTCATCCGAAAG and 3' primer CCTTAAGCGAGGTCAGCTCC, generating a 246-bp PCR product. The respective amplified products were subjected to electrophoresis in a 2% agarose gel containing ethidium bromide (0.5 µg/ml) and visualized under a UV illuminator. The image was photographed, stored, and analyzed by a photodocumentation system with Photo-Capt software (ETS Vilber-Lourmat, Marne LuVallee Cedex, France). Each band was quantified by calculating the ratio of target cDNA signal to the APRT control, and the mRNA expression was presented as a percentage of the APRT signal.
Western blot analysis of MAP kinases. The primary epithelial cells were exposed to NE in the presence or absence of inhibitors for various time intervals. At the end of treatment, cells were lysed on ice in lysis buffer containing 50 mM Tris · HCl at pH 8.0, 150 mM NaCl, 1% Nonidet P-40, 0.5% deoxycholate, 0.1% SDS, 1 mM phenylmethylsulfonyl fluoride, pepstatin A (1 µg/ml), aprotinin (0.2 U/ml), leupeptin (0.5 µg/ml), and 1 mM Na3VO4. The protein concentration was determined by using a bicinchoninic acid protein assay (Pierce Chemicals, Rockford, IL) with bovine serum albumin as the standard. Equal amounts of total cell lysates (15 µg) were solubilized in a sample buffer by boiling for 10 min, fractionated on a 14% SDS-polyacrylamide gel, and transferred onto a nitrocellulose membrane. The membrane was washed with 0.1% Tween 20 supplemented with Tris-buffered saline (TBS) and incubated in a blocking buffer (TBS containing 5% nonfat dry milk and 0.1% Tween 20). Anti-phospho-p44/42 (Th202/Tyr204) antibody or anti-phospho-p38 (Th180/Try182) antibody (Cell Signaling Technology, Beverly, MA) in a 1/1,000 dilution was then applied at 4°C overnight with gentle shaking. After being washed with TBS three times, blots were incubated with a 1/2,000 dilution of a horseradish peroxidase-conjugated secondary antibody (Cell Signaling Technology) for 1 h. The protein bands were visualized using enhanced chemiluminescence (Amersham Pharmacia Biotech, Sunnyvale, CA) and autoradiography with Kodak X-ray film.
Statistics. Data were expressed as means ± SE. Statistical analysis for multiple comparisons was performed by ANOVA. Student's t-test (for cytokine assay data) or the paired Student's t-test (for the mRNA expression data) was employed. Differences at P < 0.05 were considered significant.
| RESULTS |
|---|
|
|
|---|
|
Inhibition of NE-induced PGE2 release. To suppress the NE-induced PGE2 release, we treated HAEC with dexamethasone (1-100 µM), indomethacin (0.1-10 µM), or celecoxib (0.1-10 µM). NE-induced PGE2 generation was abolished by coincubation of cells with dexamethasone (10 µM), indomethacin (1 µM), or celecoxib (1 µM) (Fig. 2). Dexamethasone, indomethacin, or celecoxib alone had no effect on PGE2 release (data not shown). The induction of PGE2 release required proteolytic activity. Preincubation of NE (20 µg/ml) with
1-antitrypsin (200 µg/ml) blocked NE's ability to increase PGE2 release (Fig. 2).
|
COX-2 mRNA expression. To determine how PGE2 synthesis was related to regulation of the amount of COX-2, a reverse transcription-polymerase chain reaction (RT-PCR) was employed. Although PGE2 release increased 10 min after the addition of NE, a significant induction of COX-2 mRNA expression was detectable at only 1 h (Fig. 3A). After stimulation of HAEC with NE (20 µg/ml) for 3 h, the COX-2 mRNA expression relative to that for the APRT housekeeping gene was approximately eight times that for unstimulated cells (Fig. 3B). Dexamethasone (10 µM) inhibited the gene transcription for COX-2 to a substantial extent (Fig. 4).
|
|
NE-induced p44/42 MAP kinase phosphorylation. We further investigated whether NE induced PGE2 release through MAP kinase phosphorylation, a step necessary for MAP kinase activation. This was confirmed by the detection of phosphorylated forms for MAP kinases by Western blot analysis using specific phospho-MAP kinase antibodies. After NE stimulation, p44/42 MAP kinases were rapidly phosphorylated, with the concentration of phosphorylated p44/42 MAP kinases peaking at 10 min and declining at 90 min (Fig. 5A). For resting cells, p44/42 phosphorylation was detectable, whereas no p38 phosphorylation was observed in either the presence or absence of NE stimulation (Fig. 5B). To determine the effect of UO126 on p44/42 MAP kinase activation, we examined the phosphorylation status of these enzymes. Coincubation of cells with NE and UO126 resulted in an inhibition of p44/42 MAP kinase phosphorylation in a dose-dependent pattern (Fig. 6).
|
|
Effect of UO126 on NE-induced COX-2 expression and PGE2 release. We have observed that the NE-induced PGE2 release from HAEC involved p44/42 MAP kinase activation and that the phosphorylation was abolished by UO126. Pretreatment of cells with UO126 (10 µM) caused a substantial suppression of COX-2 mRNA expression (Fig. 7A) and a complete inhibition of NE-induced PGE2 production (Fig. 7B), which confirmed that p44/42 MAP kinase was involved in NE-induced PGE2 release. UO126 alone did not affect the levels of PGE2.
|
| DISCUSSION |
|---|
|
|
|---|
Within the range of concentrations that could be detected in patients with asthma or cystic fibrosis (27 ± 11 vs. 466 ± 121 µg/ml) (6), NE (20 µg/ml) significantly increased PGE2 release into the cell culture supernatants. This increase was abrogated by dexamethasone and nonsteroid anti-inflammatory drugs such as indomethacin and the selective COX-2 inhibitor celecoxib. To identify the upstream enzyme that is responsible for PGE2 production, we used semiquantitative RT-PCR to examine expression of COX-2. COX-1 is constitutively expressed, whereas COX-2 is highly inducible by a number of cytokines and is associated with inflammatory processes (21, 23). We observed that COX-1 expression appeared to be constant at a very low level and not inducible (data not shown). By contrast, COX-2 expression following NE stimulation rose in a time- and dose-dependent pattern, which was mimicked by subsequent PGE2 release. Recent evidence has suggested that COX-2-dependent PGE2 release may play a role in the resolution of inflammation (10). The transcription of COX-2 gene was completely blocked by dexamethasone, and this blockage resulted in substantial reduction of PGE2 production. The mechanism and therapeutic effects of steroids for treatment of inflammatory airway disorders (such as asthma) appear to be well understood. However, the beneficial or deleterious consequences of dexamethasone resulting in the suppression of COX-2 expression and PGE2 production remain to be elucidated.
At a concentration of >40 µg/ml, NE elicited cell detachment. The NE-induced shedding of airway epithelium is thought to be due to proteolytic cleavage of the extracellular matrix. This may result in goblet cell metaplasia and an impaired mucociliary clearance, which have been observed in several inflammatory lung diseases (11). Proteolytic activity was required for NE to induce PGE2 production as this activity was abolished by coincubation of cells with
1-antitrypsin. The culture medium has some growth factors as described previously. However, PGE2 levels in the control groups did not change significantly within 24 h of incubation. The only difference between control and treatment groups was the presence of NE. It is unlikely that some protein, released following protease reaction, stimulates PGE2 production in an autocrine manner within a few minutes. It is possible that NE stimulates PGE2 production through activation of protease-activated receptors (PAR), especially PAR-2, which is specific for serine proteases such as NE. A blocking antibody for PAR-2 will need to be developed to clarify whether NE stimulates epithelial cells through the activation of PAR-2 or via other mechanisms that subsequently enhance phosphorylation of MAP kinases and COX-2 gene transcription.
It has been reported that IL-1
can induce PGE2 production in human bronchial epithelial cells (22) and gastric epithelial cells (8) through the activation of p38 and p44/42 MAP kinases and upregulation of COX-2. Proinflammatory mediators, such as TNF-
, IL-1
, and platelet-activating factor, can induce IL-8 expression within bronchial epithelial cells via a p38 MAP kinase-dependent pathway (19). To identify the mechanism of NE-induced PGE2 production, we have investigated the signal pathways including p38 and p44/42 MAP kinases. Our results have shown that p44/42, but not p38, MAP kinases were rapidly phosphorylated following NE stimulation, and this phosphorylation was inhibited by UO126. UO126, specific inhibitor of p44/42 MAP kinases, suppressed NE-induced COX-2 mRNA expression and PGE2 release. However, p38 phosphorylation was not observed even in the presence of NE stimulation.
Rather than using bronchial epithelium-derived cell lines, cells employed in this study were primary epithelial cells explanted from human bronchus. The characteristics and responses are believed to be more authentic than those of cell lines. Our preliminary experiments have indicated that most of the stimulated release of PGE2 was in the direction of the submucosa (data not shown). This observation would appear to be consistent with a previous study suggesting that >95% of the PGE2 produced by dog trachea epithelium is released in the submucosal direction following eosinophil major basic protein stimulation (14). This provides the opportunity for epithelium-released PGE2 to influence the underlying tissues, such as nerves, smooth muscle, and inflammatory cells.
PGE2 possesses potentially important bronchoprotective and anti-inflammatory properties in vitro and may elicit bronchodilation when introduced into asthmatic airways in vivo (24). PGE2, the so-called "epithelium-derived relaxing factor," may play an important role in regulating airway tone. Airway epithelium removal prevented PGE2 production and thus increased the contractile response of smooth muscles evoked by acetylcholine, histamine, and PGF2
(1). Furthermore, PGE2 is able to inhibit the release of mediators from lung mast cells (26) and inhibit eosinophil chemotaxis and cytokine-stimulated eosinophil survival as well as IL-2 production by T lymphocytes and IL-4-induced IgE production by B lymphocytes (2, 4, 25).
In summary, bronchial epithelium is an effector and regulator of airway inflammation and smooth muscle tone. The ways to enhance bronchoprotection by bronchial epithelium may be of great value in the future treatments of chronic inflammatory disorders of the airways.
| DISCLOSURES |
|---|
|
|
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
* Y.-C. Wu and D.-W. Perng contributed equally to this study. ![]()
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
Y.-C. Wu, P.-K. Hsu, K.-C. Su, L.-Y. Liu, C.-C. Tsai, S.-H. Tsai, W.-H. Hsu, Y.-C. Lee, and D.-W. Perng Bile Acid Aspiration in Suspected Ventilator-Associated Pneumonia Chest, July 1, 2009; 136(1): 118 - 124. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Saleh, T. S. Mann, T. Peters, R. J. Betts, and P. J. Henry Influence of Dexamethasone on Protease-Activated Receptor 2-Mediated Responses in the Airways J. Pharmacol. Exp. Ther., February 1, 2008; 324(2): 622 - 630. [Abstract] [Full Text] [PDF] |
||||
![]() |
D.-W. Perng, K.-T. Chang, K.-C. Su, Y.-C. Wu, M.-T. Wu, W.-H. Hsu, C.-M. Tsai, and Y.-C. Lee Exposure of Airway Epithelium to Bile Acids Associated With Gastroesophageal Reflux Symptoms: A Relation to Transforming Growth Factor-{beta}1 Production and Fibroblast Proliferation Chest, November 1, 2007; 132(5): 1548 - 1556. [Abstract] [Full Text] [PDF] |
||||
![]() |
D.-W. Perng, Y.-C. Wu, K.-T. Chang, M.-T. Wu, Y.-C. Chiou, K.-C. Su, R.-P. Perng, and Y.-C. Lee Leukotriene C4 Induces TGF-{beta}1 Production in Airway Epithelium via p38 Kinase Pathway Am. J. Respir. Cell Mol. Biol., January 1, 2006; 34(1): 101 - 107. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Nemoto, S. Kanaya, M. Minamibuchi, and H. Shimauchi Cleavage of PDGF Receptor on Periodontal Ligament Cells by Elastase Journal of Dental Research, July 1, 2005; 84(7): 629 - 633. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. H. Schonthal, C. R. Herzog, M. V. Swamy, and C. V. Rao Correspondence re: M. V. Swamy et al., Inhibition of COX-2 in Colon Cancer Cell Lines by Celecoxib Increases the Nuclear Localization of Active p53. Cancer Res 2003;63:5239-42. Cancer Res., April 15, 2004; 64(8): 2937 - 2938. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |