AJP - Lung Journal of Neurophysiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 285: L925-L930, 2003. First published June 27, 2003; doi:10.1152/ajplung.00182.2002
1040-0605/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/4/L925    most recent
00182.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Perng, D.-W.
Right arrow Articles by Lee, Y.-C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Perng, D.-W.
Right arrow Articles by Lee, Y.-C.

Neutrophil elastase stimulates human airway epithelial cells to produce PGE2 through activation of p44/42 MAPK and upregulation of cyclooxygenase-2

Diahn-Warng Perng,1,3,* Yu-Chung Wu,2,3,* Mei-Chuan Tsai,1 Ching-Ping Lin,2 Wen-Hu Hsu,2 Reury-Perng Perng,1,3 and Yu-Chin Lee1,3

1Department of Chest Medicine, 2Division of Chest Surgery, Taipei Veterans General Hospital; and 3School of Medicine, National Yang-Ming University, Taipei 11217, Taiwan

Submitted 7 June 2002 ; accepted in final form 20 June 2003


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
The responses of airway epithelium following exposure to neutrophil elastase (NE) were investigated. Human bronchial epithelial cells were explanted on insert surfaces of a modified air-liquid interface culture system to which NE was added to stimulate epithelial cells. PGE2 release significantly increased within 10 min of incubation with NE and peaked 3 h after NE (20 µg/ml) stimulation. This action required proteolytic activity as {alpha}1-antitrypsin blocked NE-induced PGE2 release. The production of PGE2 was also inhibited by indomethacin; a selective cyclooxygenase (COX)-2 inhibitor, celecoxib; and dexamethasone. Moreover, the mRNA expression for COX-2 relative to that for a housekeeping gene was approximately eightfold that of the unstimulated cells. Dexamethasone inhibited COX-2 gene transcription. We further observed that NE-induced PGE2 release involved activation of p44/42, but not p38, MAP kinases. Such p44/42 MAP kinases were rapidly phosphorylated, with the concentration of phosphorylated p44/42 MAP kinases peaking at 10 min after stimulation and declining in culture at 90 min. The specific p44/42 MAP kinase inhibitor UO126 completely blocked p44/42 phosphorylation and, subsequently, PGE2 production. The airway epithelium may play important bronchoprotective and immunomodulatory roles in chronic neutrophilic inflammation.

human bronchial epithelial cell; prostaglandin E2; chronic neutrophilic inflammation


RATHER THAN FUNCTIONING as a passive barrier, the human airway epithelium can respond to injury, infection, or inflammation by producing various cytokines and mediators to modulate airway inflammation. Certain exogenous or endogenous stimuli can directly affect epithelial cells to increase the generation of IL-8; granulocyte-macrophage colony-stimulating factor; regulated on activation, normal T cell expressed, and presumably secreted; TNF-{alpha}; or PGE2 (5, 16, 21, 30). PGE2, a metabolite of cyclooxygenase (COX), has been shown to exert a variety of anti-inflammatory and bronchoprotective effects both in vitro and in vivo. PGE2 may prevent allergen-induced bronchoconstriction (9), relax airway smooth muscle (17), inhibit cholinergic neurotransmission (12), and modulate fibroblast proliferation (20).

Neutrophil elastase (NE), stored in the azurophilic granules, has been reported to play an important role in stimulating mucus secretion (7), decreasing ciliary function (3), and increasing epithelial permeability (27) and tissue destruction (15). NE may contribute to several inflammatory disorders, including emphysema (29), chronic bronchitis (32), bronchiectasis (31), cystic fibrosis (13), and adult respiratory distress syndrome (18).

Mitogen-activated protein kinases (MAP kinases), a widely studied family of serine/threonine protein kinases, have been reported to participate in multiple directions of cellular programs (28). These MAP kinases are activated by dual phosphorylation on tyrosine/threonine residues by distinct MAP kinase kinases. c-Jun NH2-terminal kinase and p38 MAP kinase can be activated by a variety of extracellular stimuli and may play critical roles in regulating cytokine production. ERK1 (p44) and -2 (p42) are considered to be involved mostly in cell growth, differentiation, and development.

Airway epithelium is likely to be exposed to high levels of NE in chronic neutrophilic inflammation. This investigation attempts to determine the effects of NE on airway epithelium and its signaling pathways. Human airway epithelial cells (HAEC) were grown on modified air-liquid interface culture inserts. NE was employed to stimulate epithelial cells in both the apical and basal directions. We report that NE activates MAP kinases p44/42 and upregulates COX-2 gene expression, which subsequently enhances PGE2 production from HAEC. These results demonstrate that human airway epithelium may play an important bronchoprotective and immunomodulatory roles in chronic neutrophilic inflammation.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
Reagents. RPMI 1640, Medium 199, Leibovitz's L-15 medium, fetal bovine serum (FBS), penicillin, streptomycin, amphotericin B, insulin, recombinant human epidermal growth factor, COX-2 oligonucleotides, and superscript preamplification systems for cDNA synthesis were obtained from GIBCO-BRL Life Technologies (Gaithersburg, MD); type IV collagen, all-trans retinoic acid, transferrin, hydrocortisone, dexamethasone, and indomethacin were from Sigma (St. Louis, MO); NE (16,000 units per mg of protein on the substrate MeO-Suc-AI-AI-Pro-Val-pNA; 1 unit hydrolyzes 1 µmol of substrate per min at pH 7.5 and 25°C) from Owensville Elastin Products (St. Louis, MO); cell culture inserts and plates from Becton Dickinson Labware (Lincoln Park, NJ); "high pure" RNA isolation kit from Roche Molecular Biochemicals (Mannheim, Germany); PGE2 ELISA kit from R&D Systems (Minneapolis, MN); Moloney murine leukemia virus reverse transcriptase, Taq DNA polymerase, and 1,4-diamino-2,3-dicyano-1,4-bis (2-aminophenylthio) butadiene (UO126), a selective p44/42 inhibitor from Promega (Madison, WI).

Modified air-liquid interface culture for HAEC. This cell culture procedure was modified from methods described previously (33, 34). Human bronchus, obtained from surgical lobectomy for lung cancer, was rinsed several times with Leibovitz's L-15 medium containing penicillin (100 U/ml), streptomycin (100 µg/ml), and amphotericin B (0.25 µg/ml). The tissue was cut into 1- to 2-mm2 pieces, and 3-4 pieces of tissue were planted with the epithelium side facing down onto six-well culture inserts (growth area of membrane 4.2 cm2, pore size 0.4 µm) coated with type IV collagen (50 µg/cm2). Two milliliters of medium containing antibiotics/antimycotic, human epidermoid growth factor (1 ng/ml), insulin (2.5 µg/ml), transferrin (2.5 µg/ml), hydrocortisone (1 µg/ml), 2 mM glutamine, and 0.1% FBS in RPMI 1640 and Medium 199 (vol/vol 1:1) were added to the basal chamber, and 100 µl were added to the insert. Culture medium in the basal chamber was changed every 48-72 h, and no medium was added to the insert. The airway epithelial cells were grown on a porous membrane, on which they formed a continuous epithelial sheet with the basal aspect exposed to medium and the apical surface exposed to air.

Cells grown on the inserts were confluent after 7-10 days of incubation. The tissue fragments were then transferred to fresh inserts to obtain new growth of epithelial cells. Cells were then dissociated using 0.02% trypsin-EDTA solution and seeded in 24-well culture inserts (growth area of membrane 0.3 cm2, pore size 0.4 µm) coated with collagen to determine the extent of mediator release following NE stimulation.

Mediator release. Cells (100 µl) were seeded in 24-well culture inserts at a density of 1 x 105 cells/ml and grown in culture medium (500 µl per basal chamber). The purity of epithelial cells appeared to be >98%, as determined by morphology and by immunocytochemistry with antibodies against cytokeratin for epithelial cells, vimentin for fibroblasts, and myosin for smooth muscle cells. At confluence, NE was added to either apical or basal compartment at a concentration of 5-20 µg/ml. To suppress the effect of mediator release induced by NE, we treated cells with {alpha}1-antitrypsin (200 µg/ml), dexamethasone (1-100 µM), indomethacin (0.1-1 µM), or celecoxib (0.5-10 µM suspended in dimethyl sulfoxide). Supernatants were collected at each time point and stored at -80°C until assayed for mediators. Cell viability was determined by light microscopy and dye exclusion with trypan blue. Levels of PGE2 were assayed by ELISA according to the manufacturer's instructions.

Analysis of COX-2 mRNA expression. After the removal of supernatants for mediator measurement, total cellular RNA was isolated from cell monolayers using a high pure RNA isolation kit. The RNA (1 µg) was reverse transcribed into cDNA using Superscript II RNase H- reverse transcriptase. An aliquot of cDNA was then subjected to 35 cycles of PCR using a standard procedure denaturing at 94°C for 1 min, annealing at 52°C for COX-2 for 30 s, and elongating at 72°C for 1.2 min. The COX-2-specific primer pair amplified a 769-bp PCR product composed of 5' primer GGTCTGGTG CCTGGTCTGATGATG and 3' primer CCAGTAGGCAGGAGAACATATAACA. The constitutively expressed gene adenine phosphoribosyltransferase (APRT) was used as an internal control. The primers for APRT were 5' primer GCTGCGTGCTCATCCGAAAG and 3' primer CCTTAAGCGAGGTCAGCTCC, generating a 246-bp PCR product. The respective amplified products were subjected to electrophoresis in a 2% agarose gel containing ethidium bromide (0.5 µg/ml) and visualized under a UV illuminator. The image was photographed, stored, and analyzed by a photodocumentation system with Photo-Capt software (ETS Vilber-Lourmat, Marne LuVallee Cedex, France). Each band was quantified by calculating the ratio of target cDNA signal to the APRT control, and the mRNA expression was presented as a percentage of the APRT signal.

Western blot analysis of MAP kinases. The primary epithelial cells were exposed to NE in the presence or absence of inhibitors for various time intervals. At the end of treatment, cells were lysed on ice in lysis buffer containing 50 mM Tris · HCl at pH 8.0, 150 mM NaCl, 1% Nonidet P-40, 0.5% deoxycholate, 0.1% SDS, 1 mM phenylmethylsulfonyl fluoride, pepstatin A (1 µg/ml), aprotinin (0.2 U/ml), leupeptin (0.5 µg/ml), and 1 mM Na3VO4. The protein concentration was determined by using a bicinchoninic acid protein assay (Pierce Chemicals, Rockford, IL) with bovine serum albumin as the standard. Equal amounts of total cell lysates (15 µg) were solubilized in a sample buffer by boiling for 10 min, fractionated on a 14% SDS-polyacrylamide gel, and transferred onto a nitrocellulose membrane. The membrane was washed with 0.1% Tween 20 supplemented with Tris-buffered saline (TBS) and incubated in a blocking buffer (TBS containing 5% nonfat dry milk and 0.1% Tween 20). Anti-phospho-p44/42 (Th202/Tyr204) antibody or anti-phospho-p38 (Th180/Try182) antibody (Cell Signaling Technology, Beverly, MA) in a 1/1,000 dilution was then applied at 4°C overnight with gentle shaking. After being washed with TBS three times, blots were incubated with a 1/2,000 dilution of a horseradish peroxidase-conjugated secondary antibody (Cell Signaling Technology) for 1 h. The protein bands were visualized using enhanced chemiluminescence (Amersham Pharmacia Biotech, Sunnyvale, CA) and autoradiography with Kodak X-ray film.

Statistics. Data were expressed as means ± SE. Statistical analysis for multiple comparisons was performed by ANOVA. Student's t-test (for cytokine assay data) or the paired Student's t-test (for the mRNA expression data) was employed. Differences at P < 0.05 were considered significant.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
Effects of NE on PGE2 release. The effect of NE upon the generation of PGE2 from HAEC is shown in Fig. 1. In our preliminary experiments, subsequent to the addition of NE (0.1-80 µg/ml, either to the luminal or submucosal side of the epithelial layers), most of the stimulated release of PGE2 appeared to be in the direction of the submucosa (data not shown). No significant increase in PGE2 production was observed when NE was <5 µg/ml. Cells incubated with NE (40 µg/ml) began to detach within 6 h of its addition. An increase in PGE2 release was observed after NE (20 µg/ml) had been added for a period of 10 min (417 ± 49 vs. 164 ± 25 pg/ml; P < 0.05, n = 4). The maximal concentration of PGE2 (1,387 ± 130 vs. 418 ± 34 pg/ml, stimulated vs. control) was detected in the presence of NE (20 µg/ml) at 3 h of incubation. Under the light microscope, cell monolayers appeared to be intact following incubation with NE at the concentration <20 µg/ml. The dye exclusion test using trypan blue indicated that cell viability was >98% at the end of each experiment.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 1. Effect of neutrophil elastase (NE) on PGE2 generation by human airway epithelial cells (HAEC). PGE2 level is determined in supernatants of epithelial cells incubated for 10 min, 30 min or 1, 3, 6, or 24 h with buffer alone or with various concentrations of NE at 1, 5, 10, or 20 µg/ml. Mean PGE2 values (± SE) are shown for 4-6 experiments performed in duplicate. *P < 0.05, **P < 0.005 compared with cells incubated with buffer alone.

 

Inhibition of NE-induced PGE2 release. To suppress the NE-induced PGE2 release, we treated HAEC with dexamethasone (1-100 µM), indomethacin (0.1-10 µM), or celecoxib (0.1-10 µM). NE-induced PGE2 generation was abolished by coincubation of cells with dexamethasone (10 µM), indomethacin (1 µM), or celecoxib (1 µM) (Fig. 2). Dexamethasone, indomethacin, or celecoxib alone had no effect on PGE2 release (data not shown). The induction of PGE2 release required proteolytic activity. Preincubation of NE (20 µg/ml) with {alpha}1-antitrypsin (200 µg/ml) blocked NE's ability to increase PGE2 release (Fig. 2).



View larger version (11K):
[in this window]
[in a new window]
 
Fig. 2. The inhibition of NE-induced PGE2 release by cells coincubated with dexamethasone, indomethacin, or celecoxib. Cells, stimulated by NE (10 µg/ml), were coincubated with {alpha}1-antitrypsin (200 µg/ml), dexamethasone (10 µM), indomethacin (1 µM), or celecoxib (1 µM) for 1 h. Mean values (± SE) are shown for 4 separate determinations. A significant inhibition ({ddagger}P < 0.05) compared with NE-stimulated cells is indicated.

 

COX-2 mRNA expression. To determine how PGE2 synthesis was related to regulation of the amount of COX-2, a reverse transcription-polymerase chain reaction (RT-PCR) was employed. Although PGE2 release increased 10 min after the addition of NE, a significant induction of COX-2 mRNA expression was detectable at only 1 h (Fig. 3A). After stimulation of HAEC with NE (20 µg/ml) for 3 h, the COX-2 mRNA expression relative to that for the APRT housekeeping gene was approximately eight times that for unstimulated cells (Fig. 3B). Dexamethasone (10 µM) inhibited the gene transcription for COX-2 to a substantial extent (Fig. 4).



View larger version (38K):
[in this window]
[in a new window]
 
Fig. 3. Semiquantitative RT-PCR analysis of expression of cyclooxygenase (COX)-2 mRNA and the housekeeping gene for adenine phosphoribosyl transferase (APRT) following incubation of epithelial cells for 1 and 3 h with various concentrations of NE. A: representative ethidium bromide-stained gels are shown for cells incubated with buffer alone or NE at a concentration of 5 (NE 5), 10 (NE 10), or 20 (NE 20) µg/ml. The PCR products were 769 bp in size for COX-2 and 246 bp for APRT. B: densitometry readings derived from PCR gels. The mean band density (± SE) relative to that of the APRT control is shown for 3 separate experiments. *P < 0.05, **P < 0.005 compared with cells incubated with buffer alone.

 


View larger version (34K):
[in this window]
[in a new window]
 
Fig. 4. The effect of dexamethasone on the induction of COX-2. RT-PCR analysis of COX-2 and APRT mRNA expressions in HAEC incubated for 3 h with buffer alone or NE (20 µg/ml) or NE (20 µg/ml) with dexamethasone (D) of various concentrations (1-100 µM) is shown.

 

NE-induced p44/42 MAP kinase phosphorylation. We further investigated whether NE induced PGE2 release through MAP kinase phosphorylation, a step necessary for MAP kinase activation. This was confirmed by the detection of phosphorylated forms for MAP kinases by Western blot analysis using specific phospho-MAP kinase antibodies. After NE stimulation, p44/42 MAP kinases were rapidly phosphorylated, with the concentration of phosphorylated p44/42 MAP kinases peaking at 10 min and declining at 90 min (Fig. 5A). For resting cells, p44/42 phosphorylation was detectable, whereas no p38 phosphorylation was observed in either the presence or absence of NE stimulation (Fig. 5B). To determine the effect of UO126 on p44/42 MAP kinase activation, we examined the phosphorylation status of these enzymes. Coincubation of cells with NE and UO126 resulted in an inhibition of p44/42 MAP kinase phosphorylation in a dose-dependent pattern (Fig. 6).



View larger version (74K):
[in this window]
[in a new window]
 
Fig. 5. Effect of NE on p44/42 (A) and p38 MAP kinase (B) activation. Cells were treated with NE (20 µg/ml) for the times indicated and harvested for Western blotting. Immunodetection was performed using specific antibodies to phosphorylated p44/42 and p38 (p44/42-p, p38-p) or pan-p44/42 and p38 (p44/42, p-38) MAP kinases. Data presented are representative of 3 separate experiments.

 


View larger version (35K):
[in this window]
[in a new window]
 
Fig. 6. Effect of UO126 on p44/42 MAP kinase phosphorylation. Cells were treated with UO126 (10 µM) alone, NE (20 µg/ml) alone, or with NE (20 µg/ml) and various concentrations of UO126 indicated. After incubation for 10 min, cells were harvested for Western blotting and subjected to analysis with specific antibodies to phosphorylated p44/42 (p44/42-p) or pan-p44/42 (p44/42) MAP kinases. Blots representative of 3 experiments are shown.

 

Effect of UO126 on NE-induced COX-2 expression and PGE2 release. We have observed that the NE-induced PGE2 release from HAEC involved p44/42 MAP kinase activation and that the phosphorylation was abolished by UO126. Pretreatment of cells with UO126 (10 µM) caused a substantial suppression of COX-2 mRNA expression (Fig. 7A) and a complete inhibition of NE-induced PGE2 production (Fig. 7B), which confirmed that p44/42 MAP kinase was involved in NE-induced PGE2 release. UO126 alone did not affect the levels of PGE2.



View larger version (54K):
[in this window]
[in a new window]
 
Fig. 7. Effect of UO126 on NE-induced COX-2 mRNA expression and PGE2 release. Cells were treated with buffer (control) or NE at 10 (NE10) or 20 (NE20) µg/ml or with NE (20 µg/ml) and 10 µM UO126 (NE20+UO-10) for 3 h. RT-PCR was performed for analysis of COX-2 mRNA. A representative gel of 3 separate experiments is shown. B: supernatants were collected for PGE2 release measurement following incubation of cells with buffer (control) or UO126 (10 µM) alone or with NE (20 µg/ml) and 5 (NE+UO-5) or 10 (NE+UO-10) µM UO126 for 3 h. Mean values (± SE) are shown for 3 separate experiments. A significant inhibition (*P < 0.05) compared with cells treated with NE is indicated.

 


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
Our findings have demonstrated that NE stimulates PGE2 production through COX-2 upregulation and that the activation of p44/42 MAP kinases is involved. Stimulated, airway epithelium may play an important role in modulating airway inflammation rather than act as a passive barrier. The NE-induced bronchoprotective activities of bronchial epithelium may represent a natural defense mechanism of the airways to regulate inflammatory processes in chronic neutrophilic inflammation.

Within the range of concentrations that could be detected in patients with asthma or cystic fibrosis (27 ± 11 vs. 466 ± 121 µg/ml) (6), NE (20 µg/ml) significantly increased PGE2 release into the cell culture supernatants. This increase was abrogated by dexamethasone and nonsteroid anti-inflammatory drugs such as indomethacin and the selective COX-2 inhibitor celecoxib. To identify the upstream enzyme that is responsible for PGE2 production, we used semiquantitative RT-PCR to examine expression of COX-2. COX-1 is constitutively expressed, whereas COX-2 is highly inducible by a number of cytokines and is associated with inflammatory processes (21, 23). We observed that COX-1 expression appeared to be constant at a very low level and not inducible (data not shown). By contrast, COX-2 expression following NE stimulation rose in a time- and dose-dependent pattern, which was mimicked by subsequent PGE2 release. Recent evidence has suggested that COX-2-dependent PGE2 release may play a role in the resolution of inflammation (10). The transcription of COX-2 gene was completely blocked by dexamethasone, and this blockage resulted in substantial reduction of PGE2 production. The mechanism and therapeutic effects of steroids for treatment of inflammatory airway disorders (such as asthma) appear to be well understood. However, the beneficial or deleterious consequences of dexamethasone resulting in the suppression of COX-2 expression and PGE2 production remain to be elucidated.

At a concentration of >40 µg/ml, NE elicited cell detachment. The NE-induced shedding of airway epithelium is thought to be due to proteolytic cleavage of the extracellular matrix. This may result in goblet cell metaplasia and an impaired mucociliary clearance, which have been observed in several inflammatory lung diseases (11). Proteolytic activity was required for NE to induce PGE2 production as this activity was abolished by coincubation of cells with {alpha}1-antitrypsin. The culture medium has some growth factors as described previously. However, PGE2 levels in the control groups did not change significantly within 24 h of incubation. The only difference between control and treatment groups was the presence of NE. It is unlikely that some protein, released following protease reaction, stimulates PGE2 production in an autocrine manner within a few minutes. It is possible that NE stimulates PGE2 production through activation of protease-activated receptors (PAR), especially PAR-2, which is specific for serine proteases such as NE. A blocking antibody for PAR-2 will need to be developed to clarify whether NE stimulates epithelial cells through the activation of PAR-2 or via other mechanisms that subsequently enhance phosphorylation of MAP kinases and COX-2 gene transcription.

It has been reported that IL-1{beta} can induce PGE2 production in human bronchial epithelial cells (22) and gastric epithelial cells (8) through the activation of p38 and p44/42 MAP kinases and upregulation of COX-2. Proinflammatory mediators, such as TNF-{alpha}, IL-1{alpha}, and platelet-activating factor, can induce IL-8 expression within bronchial epithelial cells via a p38 MAP kinase-dependent pathway (19). To identify the mechanism of NE-induced PGE2 production, we have investigated the signal pathways including p38 and p44/42 MAP kinases. Our results have shown that p44/42, but not p38, MAP kinases were rapidly phosphorylated following NE stimulation, and this phosphorylation was inhibited by UO126. UO126, specific inhibitor of p44/42 MAP kinases, suppressed NE-induced COX-2 mRNA expression and PGE2 release. However, p38 phosphorylation was not observed even in the presence of NE stimulation.

Rather than using bronchial epithelium-derived cell lines, cells employed in this study were primary epithelial cells explanted from human bronchus. The characteristics and responses are believed to be more authentic than those of cell lines. Our preliminary experiments have indicated that most of the stimulated release of PGE2 was in the direction of the submucosa (data not shown). This observation would appear to be consistent with a previous study suggesting that >95% of the PGE2 produced by dog trachea epithelium is released in the submucosal direction following eosinophil major basic protein stimulation (14). This provides the opportunity for epithelium-released PGE2 to influence the underlying tissues, such as nerves, smooth muscle, and inflammatory cells.

PGE2 possesses potentially important bronchoprotective and anti-inflammatory properties in vitro and may elicit bronchodilation when introduced into asthmatic airways in vivo (24). PGE2, the so-called "epithelium-derived relaxing factor," may play an important role in regulating airway tone. Airway epithelium removal prevented PGE2 production and thus increased the contractile response of smooth muscles evoked by acetylcholine, histamine, and PGF2{alpha} (1). Furthermore, PGE2 is able to inhibit the release of mediators from lung mast cells (26) and inhibit eosinophil chemotaxis and cytokine-stimulated eosinophil survival as well as IL-2 production by T lymphocytes and IL-4-induced IgE production by B lymphocytes (2, 4, 25).

In summary, bronchial epithelium is an effector and regulator of airway inflammation and smooth muscle tone. The ways to enhance bronchoprotection by bronchial epithelium may be of great value in the future treatments of chronic inflammatory disorders of the airways.


    DISCLOSURES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
This work was supported by National Science Council Research Grant NSC 91-2314-B075-063 and Taipei Veterans General Hospital Grant VGH90-274.


    FOOTNOTES
 

Address for reprint requests and other correspondence: D.-W. Perng and Y.-C. Lee, Dept. of Chest Medicine, Taipei Veterans General Hospital, 201, Section 2, Shih-Pai Rd., Taipei 11217, Taiwan (E-mail: dwperng{at}vghtpe.gov.tw).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

* Y.-C. Wu and D.-W. Perng contributed equally to this study. Back


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 

  1. Aizawa H, Miyazaki N, Shigematsu N, and Tomooka M. A possible role of airway epithelium in modulating hyperresponsiveness. Br J Pharmacol 93: 139-145, 1988.[Web of Science][Medline]
  2. Alam R, Dejarnatt A, Stafford S, Forsythe PA, Kumar D, and Grant JA. Selective inhibition of the cutaneous late but not immediate allergic response to antigens by misoprostol, a PGE analog. Results of a double-blind, placebo-controlled randomized study. Am Rev Respir Dis 148: 1066-1070, 1993.[Web of Science][Medline]
  3. Amitani R, Wilson R, Rutman A, Read R, Ward C, Burnett D, Stockley RA, and Cole PJ. Effects of human neutrophil elastase and Pseudomonas aeruginosa proteinases on human respiratory epithelium. Am J Respir Cell Mol Biol 4: 26-32, 1991.[Web of Science][Medline]
  4. Chouaib S, Robb RJ, Welte K, and Dupont B. Analysis of prostaglandin E2 effect on T lymphocyte activation. Abrogation of prostaglandin E2 inhibitory effect by the tumor promotor 120 tetradecanoyl phorbol-13 acetate. J Clin Invest 80: 333-340, 1987.[Web of Science][Medline]
  5. Churchill L, Friedman B, Schleimer RP, and Proud D. Production of granulocyte-macrophage colony-stimulating factor by cultured human tracheal epithelial cells. Immunology 75: 189-195, 1992.[Web of Science][Medline]
  6. Fahy JV, Kim KW, Liu J, and Boushey HA. Prominent neutrophilic inflammation in sputum from subjects with asthma exacerbation. J Allergy Clin Immunol 95: 843-852, 1995.[Web of Science][Medline]
  7. Fahy JV, Schuster A, Ueki I, Boushey HA, and Nadel JA. Mucus hypersecretion in bronchiectasis. The role of neutrophil proteases. Am Rev Respir Dis 146: 1430-1433, 1992.[Web of Science][Medline]
  8. Fan XM, Wong BC, Lin MC, Cho CH, Wang WP, Kung HF, and Lam SK. Interleukin-1beta induces cyclo-oxygenase-2 expression in gastric cancer cells by the p38 and p44/42 mitogen-activated protein kinase signaling pathways. J Gastroenterol Hepatol 16: 1098-1104, 2001.[Web of Science][Medline]
  9. Gauvreau GM, Watson RM, and O'Byrne PM. Protective effects of inhaled PGE2 on allergen-induced airway responses and airway inflammation. Am J Respir Crit Care Med 159: 31-36, 1999.[Abstract/Free Full Text]
  10. Gilroy DW, Colville-Nash PR, Willis D, Chivers J, Paul-Clark MJ, and Willoughby DA. Inducible cyclooxygenase may have anti-inflammatory properties. Nat Med 5: 698-701, 1999.[Web of Science][Medline]
  11. Hashimoto S, Maruoka S, Gon Y, Matsumoto K, Takeshita I, and Horie T. Mitogen-activated protein kinase involves neutrophil elastase-induced morphological changes in human bronchial epithelial cells. Life Sci 64: 1465-1471, 1999.[Web of Science][Medline]
  12. Ito I, Suzuki H, Aizawa H, Hirose T, and Hakoda H. Prejunctional inhibitory action of prostaglandin E2 on excitatory neuro-effector transmission in the human bronchus. Prostaglandins 39: 639-655, 1990.[Web of Science][Medline]
  13. Jackson AH, Hill SL, Afford SC, and Stockley RA. Sputum sol-phase proteins and elastase activity in patients with cystic fibrosis. Eur J Respir Dis 65: 114-124, 1984.[Web of Science][Medline]
  14. Jacoby DB, Ueki IF, Widdicombe JH, Loegering DA, Gleich GJ, and Nadel JA. Effect of human eosinophil major basic protein on ion transport in dog tracheal epithelium. Am Rev Respir Dis 137: 13-16, 1988.[Web of Science][Medline]
  15. Janoff A. Elastase in tissue injury. Annu Rev Med 36: 207-216, 1985.[Web of Science][Medline]
  16. Khair OA, Devalia JL, Abdelaziz MM, Sapsford RJ, Tarraf H, and Davies RJ. Effect of Haemophilus influenzae endotoxin on the synthesis of IL-6, IL-8, TNF-alpha and expression of ICAM-1 in cultured human bronchial epithelial cells. Eur Respir J 7: 2109-2116, 1994.[Abstract]
  17. Knight DA, Stewart GA, Lai ML, and Thompson PJ. Epithelium-derived inhibitory prostaglandins modulate human bronchial smooth muscle responses to histamine. Eur J Pharmacol 272: 1-11, 1995.[Web of Science][Medline]
  18. Lee CT, Fein AM, Lippmann M, Holtzman H, Kimbel P, and Weinbaum G. Elastolytic activity in pulmonary lavage fluid from patients with adult respiratory-distress syndrome. N Engl J Med 304: 192-196, 1981.[Abstract]
  19. Matsumoto K, Hashimoto S, Gon Y, Nakayama T, and Horie T. Proinflammatory cytokine-induced and chemical mediator-induced IL-8 expression in human bronchial epithelial cells through p38 mitogen-activated protein kinase-dependent pathway. J Allergy Clin Immunol 101: 825-831, 1998.[Web of Science][Medline]
  20. McAnulty RJ, Hernandez-Rodriguez NA, Mutsaers SE, Coker RK, and Laurent GJ. Indomethacin suppresses the anti-proliferative effects of transforming growth factor-beta isoforms on fibroblast cell cultures. Biochem J 321: 639-643, 1997.[Web of Science][Medline]
  21. Mitchell JA, Belvisi MG, Akarasereenont P, Robbins RA, Kwon OJ, Croxtall J, Barnes PJ, and Vane JR. Induction of cyclo-oxygenase-2 by cytokines in human pulmonary epithelial cells: regulation by dexamethasone. Br J Pharmacol 113: 1008-1014, 1994.[Web of Science][Medline]
  22. Newton R, Cambridge L, Hart LA, Stevens DA, Lindsay MA, and Barnes PJ. The MAP kinase inhibitors, PD098059, UO126 and SB203580, inhibit IL-1beta-dependent PGE(2) release via mechanistically distinct processes. Br J Pharmacol 130: 1353-1361, 2000.[Web of Science][Medline]
  23. Newton R, Kuitert LM, Slater DM, Adcock IM, and Barnes PJ. Cytokine induction of cytosolic phospholipase A2 and cyclooxygenase-2 mRNA is suppressed by glucocorticoids in human epithelial cells. Life Sci 60: 67-78, 1997.[Web of Science][Medline]
  24. Pavord ID and Tattersfield AE. Bronchoprotective role for endogenous prostaglandin E2. Lancet 345: 436-438, 1995.[Web of Science][Medline]
  25. Pene J, Rousset F, Briere F, Chretien I, Bonnefoy JY, Spits H, Yokota T, Arai N, Arai K, Banchereau J, and DeVries JE. IgE production by normal human lymphocytes is induced by interleukin 4 and suppressed by interferons gamma and alpha and prostaglandin E2. Proc Natl Acad Sci USA 85: 6880-6884, 1988.[Abstract/Free Full Text]
  26. Peters SP, Schulman ES, Schleimer RP, MacGlashan DW Jr, Newball HH, and Lichtenstein LM. Dispersed human lung mast cells. Pharmacologic aspects and comparison with human lung tissue fragments. Am Rev Respir Dis 126: 1034-1039, 1982.[Web of Science][Medline]
  27. Peterson MW, Walter ME, and Nygaard SD. Effect of neutrophil mediators on epithelial permeability. Am J Respir Cell Mol Biol 13: 719-727, 1995.[Abstract]
  28. Puddicombe SM and Davies DE. The role of MAP kinases in intracellular signal transduction in bronchial epithelium. Clin Exp Allergy 30: 7-11, 2000.[Web of Science][Medline]
  29. Snider GL, Ciccolella DE, Morris SM, Stone PJ, and Lucey EC. Putative role of neutrophil elastase in the pathogenesis of emphysema. Ann NY Acad Sci 624: 45-59, 1991.[Web of Science][Medline]
  30. Stellato C, Beck LA, Gorgone GA, Proud D, Schall TJ, Ono SJ, Lichtenstein LM, and Schleimer RP. Expression of the chemokine RANTES by a human bronchial epithelial cell line. Modulation by cytokines and glucocorticoids. J Immunol 155: 410-418, 1995.[Abstract]
  31. Stockley RA, Hill SL, Morrison HM, and Starkie CM. Elastolytic activity of sputum and its relation to purulence and to lung function in patients with bronchiectasis. Thorax 39: 408-413, 1984.[Abstract/Free Full Text]
  32. Weitz JI, Crowley KA, Landman SL, Lipman BI, and Yu J. Increased neutrophil elastase activity in cigarette smokers. Ann Intern Med 107: 680-682, 1987.[Abstract/Free Full Text]
  33. Whitcutt MJ, Adler KB, and Wu R. A biphasic chamber system for maintaining polarity of differentiation of cultured respiratory tract epithelial cells. In Vitro Cell Dev Biol 24: 420-428, 1988.[Web of Science][Medline]
  34. Yamaya M, Finkbeiner WE, Chun SY, and Widdicombe JH. Differentiated structure and function of cultures from human tracheal epithelium. Am J Physiol Lung Cell Mol Physiol 262: L713-L724, 1992.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
ChestHome page
Y.-C. Wu, P.-K. Hsu, K.-C. Su, L.-Y. Liu, C.-C. Tsai, S.-H. Tsai, W.-H. Hsu, Y.-C. Lee, and D.-W. Perng
Bile Acid Aspiration in Suspected Ventilator-Associated Pneumonia
Chest, July 1, 2009; 136(1): 118 - 124.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
S. M. Saleh, T. S. Mann, T. Peters, R. J. Betts, and P. J. Henry
Influence of Dexamethasone on Protease-Activated Receptor 2-Mediated Responses in the Airways
J. Pharmacol. Exp. Ther., February 1, 2008; 324(2): 622 - 630.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
D.-W. Perng, K.-T. Chang, K.-C. Su, Y.-C. Wu, M.-T. Wu, W.-H. Hsu, C.-M. Tsai, and Y.-C. Lee
Exposure of Airway Epithelium to Bile Acids Associated With Gastroesophageal Reflux Symptoms: A Relation to Transforming Growth Factor-{beta}1 Production and Fibroblast Proliferation
Chest, November 1, 2007; 132(5): 1548 - 1556.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
D.-W. Perng, Y.-C. Wu, K.-T. Chang, M.-T. Wu, Y.-C. Chiou, K.-C. Su, R.-P. Perng, and Y.-C. Lee
Leukotriene C4 Induces TGF-{beta}1 Production in Airway Epithelium via p38 Kinase Pathway
Am. J. Respir. Cell Mol. Biol., January 1, 2006; 34(1): 101 - 107.
[Abstract] [Full Text] [PDF]


Home page
JDRHome page
E. Nemoto, S. Kanaya, M. Minamibuchi, and H. Shimauchi
Cleavage of PDGF Receptor on Periodontal Ligament Cells by Elastase
Journal of Dental Research, July 1, 2005; 84(7): 629 - 633.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. H. Schonthal, C. R. Herzog, M. V. Swamy, and C. V. Rao
Correspondence re: M. V. Swamy et al., Inhibition of COX-2 in Colon Cancer Cell Lines by Celecoxib Increases the Nuclear Localization of Active p53. Cancer Res 2003;63:5239-42.
Cancer Res., April 15, 2004; 64(8): 2937 - 2938.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/4/L925    most recent
00182.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Perng, D.-W.
Right arrow Articles by Lee, Y.-C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Perng, D.-W.
Right arrow Articles by Lee, Y.-C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2003 by the American Physiological Society.