AJP - Lung Columbus Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 285: L1132-L1136, 2003. First published August 1, 2003; doi:10.1152/ajplung.00216.2003
1040-0605/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/5/L1132    most recent
00216.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (35)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bonfield, T. L.
Right arrow Articles by Thomassen, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bonfield, T. L.
Right arrow Articles by Thomassen, M. J.

PU.1 regulation of human alveolar macrophage differentiation requires granulocyte-macrophage colony-stimulating factor

Tracey L. Bonfield,1 Baisakhi Raychaudhuri,1 Anagha Malur,1 Susamma Abraham,1 Bruce C. Trapnell,3 Mani S. Kavuru,1 and Mary Jane Thomassen1,2

Departments of 1Pulmonary and Critical Care Medicine and 2Cell Biology, The Cleveland Clinic Foundation, Cleveland 44195-5038; and 3Department of Pediatric Medicine, University of Cincinnati College of Medicine, Cincinnati, Ohio 45267

Submitted 3 July 2003 ; accepted in final form 31 July 2003


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is critically implicated in lung homeostasis in the GM-CSF knockout mouse model. These animals develop an isolated lung lesion reminiscent of pulmonary alveolar proteinosis (PAP) seen in humans. The development of the adult form of human alveolar proteinosis is not due to the absence of a GM-CSF gene or receptor defect but to the development of an anti-GM-CSF autoimmunity. The role of GM-CSF in the development of PAP is unknown. Studies in the GM-CSF knockout mouse have shown that lack of PU.1 protein expression in alveolar macrophages is correlated with decreased maturation, differentiation, and surfactant catabolism. This study investigates PU.1 expression in vitro and in vivo in human PAP alveolar macrophages as well as the regulation of PU.1 by GM-CSF. We show for the first time that PU.1 mRNA expression in PAP bronchoalveolar lavage cells is deficient compared with healthy controls. PU.1-dependent terminal differentiation markers CD32 (FC{gamma}II), mannose receptor, and macrophage colony-stimulating factor receptor (M-CSFR) are decreased in PAP alveolar macrophages. In vitro studies demonstrate that exogenous GMCSF treatment upregulated PU.1 and M-CSFR gene expression in PAP alveolar macrophages. Finally, in vivo studies showed that PAP patients treated with GM-CSF therapy have higher levels of PU.1 and M-CSFR expression in alveolar macrophages compared with healthy control and PAP patients before GM-CSF therapy. These observations suggest that PU.1 is critical in the terminal differentiation of human alveolar macrophages.

PU-1; c-fms; alveolar proteinosis


GRANULOCYTE-MACROPHAGE COLONY-STIMULATING FACTOR (GM-CSF) is critically implicated in lung homeostasis in the GM-CSF knockout mouse model. These animals developed an isolated lung lesion reminiscent of pulmonary alveolar proteinosis (PAP) seen in patients (3, 16). PAP is a rare disease (estimated 3.7 cases per million population) that results in the accumulation of surfactant protein and phospholipids in the terminal alveoli of the lung (12). The development of alveolar proteinosis, in adult patients with PAP, is not due to the absence of a GM-CSF gene or a receptor defect but to the development of an anti-GM-CSF autoimmunity (7, 17). All adult patients with PAP have circulating and localized levels of neutralizing anti-GM-CSF antibodies (2, 7, 17). Pilot clinical studies indicate that GM-CSF therapy maybe effective in resolving the lung disease in some patients (1, 6, 10, 11, 13). We have previously published that response to systemic GMCSF therapy depends on the level of circulating neutralizing anti-GM-CSF, with individuals with higher titers less likely to respond to the GM-CSF (1). Therefore, both the GM-CSF-deficient murine model of PAP and human PAP support the notion that GM-CSF is essential in keeping the lungs free of lipoproteinaceous material and in the functional absence of GM-CSF (either by gene knockout or neutralization by anti-GMCSF) that results in PAP. We believe that PAP provides a unique opportunity to study the role of GM-CSF in lung homeostasis and verify conclusions from the GM-CSF knockout mouse.

The exact mechanism of how GM-CSF is related to lung homeostasis and surfactant catabolism is unknown. Inefficient surfactant catabolism by alveolar macrophages and type 2 bronchoalveolar epithelial cells is related to GM-CSF deficiency and lack of maturation and/or differentiation of monocyte/macrophage lineage (19). Data by Shibata et al. (14) indicate that the GM-CSF-deficient state in the GM-CSF knockout mouse is associated with decreased expression of the transcription factor PU.1. In these studies, the absence of PU.1 protein expression in the alveolar macrophage correlated with decreased maturation, differentiation, and surfactant catabolism (14). Correction of the GMCSF defect in vitro resulted in increased expression of PU.1 and upregulation of PU.1-dependent markers CD32, mannose receptor (MR), and macrophage colony-stimulating factor receptor (M-CSFR) (14). This resulted in improved surfactant catabolism, adherence, and maturation. Whether PU.1 plays a pivotal role in healthy human alveolar macrophages in vivo or in PAP has not been previously described.

We therefore hypothesize that GM-CSF exerts its regulatory effects in the human lung through the regulation of PU.1 analogous to those observations in the GM-CSF knockout mouse model (14, 19). The purpose of the current study is to investigate PU.1 expression in human alveolar macrophages in vitro and in vivo in the context of human PAP. We further propose that decreased PU.1 expression downregulates markers of maturation including M-CSFR. We believe that these studies will provide important information on the role of GM-CSF in healthy lung homeostasis as well as PAP.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
Study population. This protocol was approved by the Cleveland Clinic Foundation Institutional Review Board, and written informed consent was obtained from all subjects. Healthy control individuals had no history of lung disease and were not on medication. The diagnosis of idiopathic PAP was established by histopathological examination of material from open lung or transbronchial biopsies and exclusion of secondary etiologies (1, 2, 6). All PAP patients were symptomatic with dyspnea, hypoxemia, and typical alveolar infiltrates on radiographs. Patients participated in a prospective clinical trial of recombinant human GM-CSF (Leukine; Berlex, Seattle, WA) as described previously (1, 6). Treatment consisted of 250 µg/day by subcutaneous administration with increased dosage every 2 wk and maximum daily dose of 18 µg · kg-1 · day-1 by 8 wk. Median duration of therapy was 25.5 wk.

Bronchoalveolar lavage fluid. Bronchoalveolar lavage (BAL) was performed as previously described (18). Differential cell counts were obtained from cytospins stained with a modified Wright's stain. Mean viability of lavage cells was >95% as determined by trypan blue dye exclusion. For culture, BAL cells were plated into six-well plates with or without 100 ng/ml of human GM-CSF for 48 h in RPMI 1640 medium supplemented with 5% human blood type AB serum (Gemini, Calabasas, CA), L-glutamine, and antibiotics. The BAL cell pellet was used to determine lavage cell differentials, cell culture for M-CSF, and real-time PCR for PU.1, M-CSF, and M-CSFR using primers from Applied Biomedical Incorporated (ABI, Foster City, CA). We used 300,000 BAL macrophages in 24-well plates for 24-h basal secretion of M-CSF. The median differentials from PAP patient BAL cells (n = 17) were as follows: alveolar macrophages, 87%; lymphocytes, 7%; and polymorphonuclear cells (PMN), 6%. In healthy controls (n = 12), BAL cells consisted of alveolar macrophages, 96%; lymphocytes, 3%; and PMN, 1%.

Cytokine assays. Supernatants from BAL cell cultures from PAP patients and healthy volunteers were assayed for M-CSF (R&D Systems, Minneapolis, MN) by ELISA with the sensitivity of 31.2-1,000 pg/ml for M-CSF. Samples below the sensitivity were reported as the lowest value, and samples above the sensitivity were diluted to obtain a value within the assay range. The coefficient of variation was <10%. All assays were carried out in duplicate.

RNA purification and analysis. Total RNA was extracted from BAL cells by RNeasy protocol (Qiagen, Valencia, CA). Expression of mRNA was determined by real-time RT-PCR using the ABI Prism 7000 Detection System (TaqMan; Applied Biosystems, Foster City, CA) according to the manufacturer's instructions. RNA specimens were analyzed in duplicate with primer sets for a housekeeping gene (GAPDH) and PU.1, M-CSF, or M-CSFR (ABI). Threshold cycle values for genes of interest were normalized to GAPDH and used to calculate the relative quantity of mRNA expression in PAP (or GM-CSF-treated) samples relative to untreated or healthy control values. Data are expressed as fold difference in mRNA expression relative to control values.

Fluorescence-activated cell sorting analysis. Alveolar macrophages obtained from PAP patients (n = 4) and healthy controls (n = 6) were stained for CD14, human leukocyte antigen (HLA)-DR, and MR. Briefly, 3 x 105 BAL macrophages were stained with FITC-labeled CD14, HLA-DR, or phycoerythrin-labeled CD32 or MR (PharMingen, San Diego, CA) for 30 min in cold PBS. Cells were washed and fixed in 2% paraformaldehyde. Cells were analyzed on a BD FACscan Analyzer compared with isotype-specific background controls. Results are expressed as mean percent positive-staining alveolar macrophages for 10,000 events.

Electrophoretic mobility shift assay. For electrophoretic mobility shift assay, 10 µg of each of the whole cell extracts were incubated in binding buffer (8 mM HEPES, pH 7.0, 10% glycerol, 20 mM KCl, 4 mM MgCl2, and 1 mM sodium pyrophosphate) containing 1 µg of poly(dI-dC) and 40,000 cpm probe for 20 min at room temperature as previously described (9). Specificity of the probe was shown by incubating the extract with a 1,000-fold molar excess of cold oligonucleotide. Sequence of the PU.1 binding site is as follows: 5'GGGGGGGAAAAACAGGAAGGGGGGGG3' and 5'CCCCCCCTTTTTGTCCTTCCCCCCCC3'.

Statistics. Data were analyzed by one-way analysis of variance and Student's t-test using Prism software (Graph-Pad, San Diego, CA). Significance was defined as P = 0.05.


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
PU.1 mRNA expression is deficient in BAL cells from PAP patients. BAL cells from nine PAP patients were evaluated for PU.1 expression by real-time PCR. The mRNA levels of PU.1 were modestly but significantly lower than those observed in seven healthy controls (Fig. 1, P = 0.003).



View larger version (8K):
[in this window]
[in a new window]
 
Fig. 1. PU.1 mRNA expression is deficient in bronchoalveolar lavage (BAL) cells from pulmonary alveolar proteinosis (PAP) patients. BAL cells from PAP patients (n = 9) and healthy controls (HC, n = 7) were evaluated for PU.1 expression using real-time PCR. PAP patients had deficient PU.1 expression compared with HC (P = 0.003).

 

PAP alveolar macrophages have decreased expression of terminal differentiation markers CD32 and MR. GM-CSF knockout studies have suggested that PU.1 is essential for terminal differentiation (14, 19). So, to determine whether PU.1 expression may alter human alveolar macrophage maturation in PAP, we evaluated healthy control (n = 6) and PAP (n = 4) alveolar macrophages for CD32 (FC{gamma}IIR), MR, and CD14 as markers of terminal differentiation. We found that both CD32 (P = 0.007) and MR (P = 0.001) expression was decreased on PAP alveolar macrophages, whereas the surface expression of CD14 (P = 0.216) was not significantly different than controls (Fig. 2). HLA-DR staining of PAP alveolar macrophages, 83 ± 4%, was similar to healthy controls, 84 ± 6%.



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 2. PAP alveolar macrophages have decreased expression of terminal differentiation markers CD32 and mannose receptor (MR). Healthy control (n = 5) and PAP (n = 4) alveolar macrophages were evaluated for CD32 (FC{gamma}IIR), MR, and CD14 by FACS analysis. PAP CD32 (P = 0.007) and MR (P = 0.001) expression was significantly less than healthy control alveolar macrophages. CD14 expression was not significantly different than controls (P = 0.216).

 

BAL cells are not the primary source of the elevated levels of M-CSF in the BAL of PAP patients. BAL cells were obtained from healthy volunteers (n = 6) and PAP patients (n = 4) and evaluated for both M-CSF mRNA and protein secretion. BAL cell M-CSF mRNA expression was not different compared with healthy controls (P = 0.187). Similarly, PAP and healthy control BAL cell secretion of M-CSF protein (2,609 ± 219 pg/ml vs. 2,648 ± 633 pg/ml for PAP and healthy controls, respectively) was not different (P = 0.467, means ± SE).

M-CSFR expression is deficient in PAP BAL cells. PU.1 regulates c-fms (M-CSFR) and may affect BAL cell response to the elevated M-CSF in PAP BAL fluid (2). We examined PAP (n = 6) and healthy control (n = 6) BAL cells for expression of M-CSFR by real-time PCR and found that M-CSFR mRNA was deficient in PAP compared with healthy controls (Fig. 3, P = 0.003).



View larger version (9K):
[in this window]
[in a new window]
 
Fig. 3. Macrophage colony-stimulating factor receptor (M-CSFR) expression is deficient in PAP BAL cells. PU.1 regulates c-fms (M-CSFR) and may affect BAL cell response to the elevated M-CSF in PAP BAL fluid (2). We examined PAP (n = 6) and healthy control (n = 6) BAL cells for expression of M-CSFR with real-time PCR. PAP M-CSFR expression was significantly less than healthy control BAL M-CSFR expression (P = 0.003).

 

GM-CSF increases PU.1 expression in vitro. Because PAP is an anti-GM-CSF autoimmune disease and GMCSF can regulate PU.1 expression in the GM-CSF knockout mouse, we evaluated the effect of GM-CSF on PAP and healthy control BAL cells in vitro. Cultured BAL cells were rested for 24 h and were then incubated in the presence of GM-CSF for an additional 48 h. Healthy control BAL cells, as anticipated, did not have a significant increase in PU.1 mRNA expression relative to cells cultured in the absence of GM-CSF [1.6 ± 0.1-fold, n = 2, P > 0.05 (not significant)]; PU.1 is constitutively expressed at high levels in control BAL (14). In contrast, PAP cells cultured with GM-CSF had a significant increase in PU.1 mRNA (2.3 ± 0.6-fold, n = 2, P = 0.02). Furthermore, GM-CSF treatment of healthy control and PAP alveolar macrophages resulted in an increase in M-CSFR mRNA (healthy control: 9.6 ± 1.6-fold, n = 2, P = 0.01; PAP: 2.4 ± 0.6-fold, n = 2, P = 0.03).

GM-CSF therapy in PAP patients increases PU.1 protein expression. We evaluated PAP patients in a preliminary pilot study of GM-CSF therapy for changes in PU.1 binding activity. Before GM-CSF therapy, PAP patients (Fig. 4) have deficient PU.1 binding activity compared with healthy controls. Patients on GM-CSF therapy showed levels of PU.1 activity similar to healthy controls. This suggests that the deficient PU.1 activity in PAP patients is corrected by the GMCSF therapy.



View larger version (72K):
[in this window]
[in a new window]
 
Fig. 4. Granulocyte-macrophage colony-stimulating factor (GMCSF) therapy in PAP patients increases PU.1 protein expression. We evaluated PAP patients in a preliminary pilot study of GM-CSF therapy for changes in PU.1 binding activity by EMSA. Before GM-CSF therapy PAP patients (PAP 1 and 3) have deficient PU.1 binding activity compared with healthy controls (HC 1 and 2). Patients on GM-CSF therapy have levels of PU.1 binding activity similar to healthy controls (PAP 2 and 4). This suggests that the deficient PU.1 activity in PAP patients is corrected by the GM-CSF therapy.

 

GM-CSF therapy enhances PU.1 and M-CSFR expression in PAP patients. Both PU.1 (Fig. 5A) and M-CSFR (Fig. 5B) mRNA is decreased in PAP patients (n = 6) compared with healthy controls (n = 6). BAL cells from patients on therapy (n = 5) demonstrated increased PU.1 (P = 0.03) and M-CSFR (P = 0.01) expression compared with baseline.



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 5. GM-CSF therapy enhances PU.1 and M-CSFR expression in PAP patients. Baseline PAP patients (n = 6) and patients on GMCSF therapy (n = 5) were evaluated for expression of both PU.1 (A) and M-CSFR (B) and compared with healthy controls (n = 5) by real-time PCR. PU.1 mRNA is decreased in baseline PAP patients compared with healthy controls. BAL cells from patients on therapy had increased PU.1 (P = 0.03) and M-CSFR (P = 0.01) expression compared with baseline.

 


    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
We have shown for the first time that, in human PAP, a GM-CSF-deficient autoimmune disease, PU.1 mRNA expression in alveolar macrophages is significantly decreased compared with healthy controls. We have also shown decreased protein expression in PAP BAL cells compared with healthy controls. Furthermore, PU.1-dependent terminal differentiation markers CD32 (FC{gamma}II), MR, and M-CSFR were also decreased. In vitro studies demonstrated that GM-CSF treatment upregulates PU.1 and M-CSFR gene expression in alveolar macrophages from PAP patients. Finally, PAP patients treated with GM-CSF therapy have higher levels of PU.1 and M-CSFR expression in alveolar macrophages ex vivo compared with healthy control and PAP patients before GM-CSF treatment. These observations suggest that PU.1 is critical in the terminal differentiation of alveolar macrophages.

GM-CSF promotes monocytic and granulocytic progenitor cell growth, differentiation, and activation (3, 15). GM-CSF activates PU.1, which in turn interacts with transcription binding sites in gene expression differentiation markers such as CD32, MR, and MCSFR. This results in a complex series of reactions within the myeloid progenitor, which ultimately leads to terminal differentiation and the upregulation of these maturation markers (8, 19). Together with data from the GM-CSF knockout mouse model (14), data presented here with the rare PAP lung disease indicate that GM-CSF acts through PU.1 as a regulator of human alveolar macrophages both in vitro and ex vivo.

M-CSF shares important and overlapping properties with GM-CSF related to monocyte/macrophage differentiation (4). M-CSF levels are elevated in the lungs of both the murine GM-CSF knockout model of PAP as well as patients with PAP. Data from our study indicate that M-CSFR expression, which is regulated by PU.1, is markedly reduced in PAP compared with healthy controls and can be upregulated by GM-CSF. The lack of M-CSFR expression may prevent and/or decrease alveolar macrophage response to the elevated BAL M-CSF, which may be generated by a compensatory response to the lack of biologically active GM-CSF in both human and mouse PAP (2, 14). The source of enhanced M-CSF levels in BAL remains unknown. M-CSF gene expression and protein secretion did not differ between BAL cells from healthy controls and PAP patients.

PU.1 knockout mice do not produce lymphoid or myeloid cells and die before or shortly after birth (5, 8), whereas GM-CSF knockout mice are deficient in PU.1 protein and survive until the development of an alveolar proteinosis syndrome in the lung (14, 19). In the GM-CSF knockout mouse model, GM-CSF expression is absent throughout development, whereas in human PAP, GM-CSF is present but is neutralized by circulating levels of anti-GM-CSF, which appears most commonly in the second or third decade of life (12). We have shown here that BAL cells from PAP patients demonstrate a modest but significant decrease in PU.1, consistent with the GM-CSF knockout mouse. These results suggest that GM-CSF is important in the regulation of PU.1 expression in alveolar macrophages in the lung. The implication is that GM-CSF is required for healthy lung homeostasis through the regulation of PU.1 and myeloid terminal differentiation.

In summary, we demonstrate decreased PU.1 gene expression and activity in PAP BAL cells. Furthermore, expression of the PU.1-regulated differentiation-associated cell surface markers MR and CD32, as well as M-CSFR gene expression, are decreased. The addition of exogenous GM-CSF to alveolar macrophages in vitro and in vivo enhances the expression of PU.1 and M-CSFR. These findings support the critical role of GM-CSF in human lung homeostasis.


    DISCLOSURES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
This work was supported by NIH Research Grant R01 HL-67676 funded by the National Heart, Lung, and Blood Institute and the National Institute of Allergy and Infectious Diseases.

We are also grateful for the generous support of Regina Taussig.


    FOOTNOTES
 

Address for reprint requests and other correspondence: M. J. Thomassen, Dept. of Pulmonary and Critical Care Medicine, 9500 Euclid Ave., Cleveland Clinic Foundation, Desk A90, Cleveland, OH 44195-5038 (E-mail: thomasm{at}ccf.org).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 

  1. Bonfield TL, Kavuru MS, and Thomassen MJ. Anti-GM-CSF titer predicts response to GM-CSF therapy in pulmonary alveolar proteinosis. Clin Immunol 105: 342-350, 2002.[Web of Science][Medline]
  2. Bonfield TL, Russell D, Burgess S, Malur A, Kavuru MS, and Thomassen MJ. Autoantibodies against granulocyte macrophage colony-stimulating factor are diagnostic for pulmonary alveolar proteinosis. Am J Respir Cell Mol Biol 27: 481-486, 2002.[Abstract/Free Full Text]
  3. Dranoff G, Crawford AD, Sadelain M, Ream B, Rashid A, Bronson RT, Dickersin GR, Bachurski CJ, Mark EL, Whitsett JA, and Mulligan RC. Involvement of granulocyte-macrophage colony-stimulating factor in pulmonary homeostasis. Science 264: 713-716, 1994.[Abstract/Free Full Text]
  4. Fixe P and Praloran V. Macrophage colony-stimulating-factor (M-CSF or CSF-1) and its receptor: structure-function relationships. Eur Cytokine Netw 8: 125-136, 1997.[Web of Science][Medline]
  5. Guerriero A, Langmuir PB, Spain LM, and Scott EW. PU.1 is required for myeloid-derived but not lymphoid-derived dendritic cells. Blood 95: 879-885, 2000.[Abstract/Free Full Text]
  6. Kavuru MS, Sullivan EJ, Piccin R, Thomassen MJ, and Stoller JK. Exogenous granulocyte-macrophage colony-stimulating factor administration for pulmonary alveolar proteinosis. Am J Respir Crit Care Med 161: 1143-1148, 2000.[Abstract/Free Full Text]
  7. Kitamura T, Tanaka N, Watanabe J, Uchida K, Kanegasaki S, Yamada Y, and Nakata K. Idiopathic pulmonary alveolar proteinosis as an autoimmune disease with neutralizing antibody against granulocyte/macrophage colony-stimulating factor. J Exp Med 190: 875-880, 1999.[Abstract/Free Full Text]
  8. Olson MC, Scott EW, Hack AA, Su GH, Tenen DG, Singh H, and Simon MC. PU.1 is not essential for early myeloid gene expression but is required for terminal myeloid differentiation. Immunity 3: 703-714, 1995.[Web of Science][Medline]
  9. Raychaudhuri B, Dweik RA, Connors M, Buhrow L, Malur A, Drazba J, Arroliga AC, Erzurum SC, Kavuru M, and Thomassen MJ. Nitric oxide blocks nuclear factor-{kappa}B activation in alveolar macrophages. Am J Respir Cell Mol Biol 21: 311-316, 1999.[Abstract/Free Full Text]
  10. Schoch OD, Schanz U, Koller M, Nakata K, Seymour JF, Russi EW, and Boehler A. BAL findings in a patient with pulmonary alveolar proteinosis successfully treated with GMCSF. Thorax 57: 277-280, 2002.[Abstract/Free Full Text]
  11. Seymour JF, Dunn AR, Vincent JM, Presneill JJ, and Pain MC. Efficacy of granulocyte-macrophage colony-stimulating factor in acquired alveolar proteinosis. N Engl J Med 335: 1924-1925, 1996.[Free Full Text]
  12. Seymour JF and Presneill JJ. Pulmonary alveolar proteinosis (progress in the first 44 years). Am J Respir Crit Care Med 166: 215-235, 2002.[Abstract/Free Full Text]
  13. Seymour JF, Presneill JJ, Schoch OD, Downie GH, Moore PE, Doyle IR, Vincent JM, Nakata K, Kitamura T, Langton D, Pain MC, and Dunn AR. Therapeutic efficacy of granulocyte-macrophage colony-stimulating factor in patients with idiopathic acquired alveolar proteinosis. Am J Respir Crit Care Med 163: 523-531, 2001.
  14. Shibata Y, Berclaz YP, Chroneos ZC, Yoshida M, Whitsett JA, and Trapnell BC. GM-CSF regulates alveolar macrophage differentiation and innate immunity in the lung through PU.1. Immunity 15: 1-20, 2001.[Web of Science][Medline]
  15. Sieff CA, Emerson SG, Donahue RE, Nathan DG, Wang EA, Wong GG, and Clark SC. Human recombinant granulocyte-macrophage colony-stimulating factor: a multilineage hematopoietin. Science 230: 1171-1173, 1985.[Abstract/Free Full Text]
  16. Stanley E, Lieschke GJ, Grail D, Metcalf D, Hodgson G, Gall JAM, Maher DW, Cebon J, Sinickas V, and Dunn AR. Granulocyte/macrophage colony-stimulating factor-deficient mice show no major perturbation of hematopoiesis but develop a characteristic pulmonary pathology. Proc Natl Acad Sci USA 91: 5592-5596, 1994.[Abstract/Free Full Text]
  17. Tanaka N, Watanabe J, Kitamura T, Yamada Y, Kanegasaki S, and Nakata K. Lungs of patients with idiopathic pulmonary alveolar proteinosis express a factor which neutralizes granulocyte-macrophage colony-stimulating factor. FEBS Lett 442: 246-250, 1999.[Web of Science][Medline]
  18. Thomassen MJ, Buhrow LT, Connors MJ, Kaneko FT, Erzurum SC, and Kavuru MS. Nitric oxide inhibits inflammatory cytokine production by human alveolar macrophages. Am J Respir Cell Mol Biol 17: 279-283, 1997.[Abstract/Free Full Text]
  19. Trapnell BC and Whitsett JA. GM-CSF regulates pulmonary surfactant homeostasis and alveolar macrophage-mediated innate host defense. Annu Rev Physiol 64: 775-802, 2002.[Web of Science][Medline]



This article has been cited by other articles:


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
F.-C. Cheah, J. J. Pillow, B. W. Kramer, G. R. Polglase, I. Nitsos, J. P. Newnham, A. H. Jobe, and S. G. Kallapur
Airway inflammatory cell responses to intra-amniotic lipopolysaccharide in a sheep model of chorioamnionitis
Am J Physiol Lung Cell Mol Physiol, March 1, 2009; 296(3): L384 - L393.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
L. D. Notarangelo and I. Pessach
Out of breath: GM-CSFR{alpha} mutations disrupt surfactant homeostasis
J. Exp. Med., November 24, 2008; 205(12): 2693 - 2697.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
P. C. Joshi, R. Raynor, X. Fan, and D. M. Guidot
HIV-1-Transgene Expression in Rats Decreases Alveolar Macrophage Zinc Levels and Phagocytosis
Am. J. Respir. Cell Mol. Biol., August 1, 2008; 39(2): 218 - 226.
[Abstract] [Full Text] [PDF]


Home page
ThoraxHome page
B G G Oliver, S Lim, P Wark, V Laza-Stanca, N King, J L Black, J K Burgess, M Roth, and S L Johnston
Rhinovirus exposure impairs immune responses to bacterial products in human alveolar macrophages
Thorax, June 1, 2008; 63(6): 519 - 525.
[Abstract] [Full Text] [PDF]


Home page
RadioGraphicsHome page
A. A. Frazier, T. J. Franks, E. O. Cooke, T.-L. H. Mohammed, R. D. Pugatch, and J. R. Galvin
From the Archives of the AFIP: Pulmonary Alveolar Proteinosis
RadioGraphics, May 1, 2008; 28(3): 883 - 899.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
Y. Inoue, B. C. Trapnell, R. Tazawa, T. Arai, T. Takada, N. Hizawa, Y. Kasahara, K. Tatsumi, M. Hojo, T. Ichiwata, et al.
Characteristics of a Large Cohort of Patients with Autoimmune Pulmonary Alveolar Proteinosis in Japan
Am. J. Respir. Crit. Care Med., April 1, 2008; 177(7): 752 - 762.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
L. L. Koth, B. Alex, S. Hawgood, M. A. Nead, D. Sheppard, D. J. Erle, and D. G. Morris
Integrin beta6 Mediates Phospholipid and Collectin Homeostasis by Activation of Latent TGF-beta1
Am. J. Respir. Cell Mol. Biol., December 1, 2007; 37(6): 651 - 659.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
B. M. Rotoli, V. Dall'Asta, A. Barilli, R. D'Ippolito, A. Tipa, D. Olivieri, G. C. Gazzola, and O. Bussolati
Alveolar Macrophages from Normal Subjects Lack the NOS-Related System y+ for Arginine Transport
Am. J. Respir. Cell Mol. Biol., July 1, 2007; 37(1): 105 - 112.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
K. Uchida, D. C. Beck, T. Yamamoto, P.-Y. Berclaz, S. Abe, M. K. Staudt, B. C. Carey, M.-D. Filippi, S. E. Wert, L. A. Denson, et al.
GM-CSF Autoantibodies and Neutrophil Dysfunction in Pulmonary Alveolar Proteinosis
N. Engl. J. Med., February 8, 2007; 356(6): 567 - 579.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
P.-Y. Berclaz, B. Carey, M.-D. Fillipi, K. Wernke-Dollries, N. Geraci, S. Cush, T. Richardson, J. Kitzmiller, M. O'Connor, C. Hermoyian, et al.
GM-CSF Regulates a PU.1-Dependent Transcriptional Program Determining the Pulmonary Response to LPS
Am. J. Respir. Cell Mol. Biol., January 1, 2007; 36(1): 114 - 121.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
P. C. Joshi, L. Applewhite, P. O. Mitchell, K. Fernainy, J. Roman, D. C. Eaton, and D. M. Guidot
GM-CSF receptor expression and signaling is decreased in lungs of ethanol-fed rats
Am J Physiol Lung Cell Mol Physiol, December 1, 2006; 291(6): L1150 - L1158.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
S. B. Venkateshiah, T. D. Yan, T. L. Bonfield, M. J. Thomassen, M. Meziane, C. Czich, and M. S. Kavuru
An open-label trial of granulocyte macrophage colony stimulating factor therapy for moderate symptomatic pulmonary alveolar proteinosis.
Chest, July 1, 2006; 130(1): 227 - 237.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
F. McAllister, C. Steele, M. Zheng, J. E. Shellito, and J. K. Kolls
In Vitro Effector Activity of Pneumocystis murina-Specific T-Cytotoxic-1 CD8+ T Cells: Role of Granulocyte-Macrophage Colony-Stimulating Factor
Infect. Immun., November 1, 2005; 73(11): 7450 - 7457.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
R. Tazawa, E. Hamano, T. Arai, H. Ohta, O. Ishimoto, K. Uchida, M. Watanabe, J. Saito, M. Takeshita, Y. Hirabayashi, et al.
Granulocyte-Macrophage Colony-Stimulating Factor and Lung Immunity in Pulmonary Alveolar Proteinosis
Am. J. Respir. Crit. Care Med., May 15, 2005; 171(10): 1142 - 1149.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
M. Ochs, L. Knudsen, L. Allen, A. Stumbaugh, S. Levitt, J. R. Nyengaard, and S. Hawgood
GM-CSF mediates alveolar epithelial type II cell changes, but not emphysema-like pathology, in SP-D-deficient mice
Am J Physiol Lung Cell Mol Physiol, December 1, 2004; 287(6): L1333 - L1341.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/5/L1132    most recent
00216.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (35)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bonfield, T. L.
Right arrow Articles by Thomassen, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bonfield, T. L.
Right arrow Articles by Thomassen, M. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2003 by the American Physiological Society.