AJP - Lung Journal of Applied Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 285: L1354-L1361, 2003. First published July 25, 2003; doi:10.1152/ajplung.00091.2003
1040-0605/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/6/L1354    most recent
00091.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Linden, B. C.
Right arrow Articles by Cornfield, D. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Linden, B. C.
Right arrow Articles by Cornfield, D. N.

Chronic intrauterine pulmonary hypertension compromises fetal pulmonary artery smooth muscle cell O2 sensing

Bradley C. Linden,2 Ernesto R. Resnik,1 Kristine J. Hendrickson,1 Jean M. Herron,1 Timothy J. O'Connor,1 and David N. Cornfield1,2,3

Division of Pediatric Pulmonology and Critical Care Medicine, Departments of 1Pediatrics, 2Surgery, and 3Physiology, University of Minnesota Medical School, Minneapolis, Minnesota 55455

Submitted 1 April 2003 ; accepted in final form 24 June 2003


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
To test the hypothesis that chronic intrauterine pulmonary hypertension (PHTN) compromises pulmonary artery (PA) smooth muscle cell (SMC) O2 sensing, fluorescence microscopy was used to study the effect of an acute increase in PO2 on the cytosolic Ca2+ concentration ([Ca2+]i) of chronically hypoxic subconfluent monolayers of PA SMC in primary culture. PA SMCs were derived from fetal lambs with PHTN due to intrauterine ligation of the ductus arteriosus. Acute normoxia decreased [Ca2+]i in control but not PHTN PA SMC. In control PA SMC, [Ca2+]i increased after Ca2+-sensitive (KCa) and voltage-sensitive (Kv) K+ channel blockade and decreased after diltiazem treatment. In PHTN PA SMC, KCa blockade had no effect, whereas Kv blockade and diltiazem increased [Ca2+]i. Inhibition of sarcoplasmic reticulum Ca2+ ATPase activity caused a greater increase in [Ca2+]i in controls compared with PHTN PA SMC. Conversely, ryanodine caused a greater increase of [Ca2+]i in PHTN compared with control PA SMC. KCa channel mRNA is decreased and Kv channel mRNA is unchanged in PHTN PA SMC compared with controls. We conclude that PHTN compromises PA SMC O2 sensing, alters intracellular Ca2+ homeostasis, and changes the predominant ion channel that determines basal [Ca2+]i from KCa to Kv.

fetus; cytosolic calcium; potassium channel


THE MECHANISMS RESPONSIBLE for the maintenance of the high tone, low-flow fetal pulmonary vasculature and the rapid increase in pulmonary blood flow that occurs at birth are not completely understood. At birth, pulmonary blood flow increases 8- to 10-fold and pulmonary artery (PA) pressure declines steadily over the first several hours of life (27). While physical factors and vasoactive products elaborated by the pulmonary vascular endothelium are involved in the regulation of perinatal pulmonary vascular tone (1, 4, 10), sustained and progressive perinatal pulmonary vasodilation requires PA smooth muscle cell (PA SMC) K+ channel activation (33). PA SMC K+ channel activation causes membrane hyperpolarization, closure of voltage-operated Ca2+ channels, a decrease in cytosolic Ca2+ concentration ([Ca2+]i), and subsequent vasodilation (21).

Recent studies (9) from our laboratory have demonstrated that fetal PA SMC respond directly to changes in PO2. Fetal PA SMC respond to acute hypoxia with an increase in [Ca2+]i. In response to an acute increase in PO2 (acute normoxia), fetal PA SMC [Ca2+]i decreases (26). O2 causes a decrease in PA SMC [Ca2+]i via activation of a cGMP-sensitive kinase that mediates localized Ca2+ release from a ryanodine-sensitive intracellular Ca2+ store (24). Localized Ca2+ release results in activation of the Ca2+-sensitive K+ (KCa) channel and PA SMC membrane hyperpolarization, which leads to vasodilation (21).

Interestingly, the response of PA SMC to changes in PO2 is developmentally regulated. Fetal, but not adult, PA SMC respond to an acute increase in PO2 with a decrease in [Ca2+]i (23, 26). In contrast, adult PA SMC respond to acute hypoxia with a more rapid and greater increase in [Ca2+]i than fetal PA SMC (8). The differential response to PO2 between fetal and adult PA SMC may derive, in part, from changes in the predominant ion channel population that controls resting membrane potential (Em). In the fetus, the KCa channel determines Em, and, therefore, through subsequent effects on voltage-gated Ca2+ channels, basal levels of PA SMC [Ca2+]i. In contrast, the Em and basal [Ca2+]i of PA SMC from the adult pulmonary circulation is mediated by voltage-sensitive K+ channels (Kv) (25). Thus fetal PA SMC are uniquely well adapted to respond to an acute increase in PO2 and thereby enhance postnatal adaptation of the pulmonary circulation, whereas adult PA SMC are adapted to respond to an acute decrease in PO2 and thereby match ventilation and perfusion to prevent intrapulmonary shunting and subsequent hypoxemia (36).

In some newborn infants, pulmonary vascular resistance remains elevated after birth, resulting in a clinical syndrome termed persistent pulmonary hypertension of the newborn (PPHN). PPHN is characterized by extrapulmonary right-to-left shunting of blood across the ductus arteriosus or patent foramen ovale causing severe hypoxemia (16). Infants with PPHN respond incompletely to perinatal pulmonary vasodilator stimuli. Evidence suggests that adverse intrauterine stimuli, such as chronic hypoxia or hypertension (19), can decrease endothelial nitric oxide (NO) synthase (eNOS) gene and protein expression, NOS activity, and limit perinatal NO production, thereby contributing to the pathophysiology of PPHN (2, 30, 35). A recent study (7) from an animal model of PPHN demonstrated a decrease in KCa channel gene expression in whole lung tissue of fetal lambs with chronic intrauterine pulmonary hypertension. It remains unknown whether 1) the decrease in fetal lung KCa channel gene expression is sufficient to compromise fetal pulmonary vascular oxygen sensing; and 2) chronic intrauterine pulmonary hypertension directly affects PA SMC oxygen sensing.

Because PA SMC KCa channel activity determines resting membrane potential (25) and mediates the response of fetal PA SMC to an acute increase in PO2 (24), as well as NO (29), we hypothesized that chronic intrauterine pulmonary hypertension has direct effects on PA SMC O2 sensing. To test this hypothesis, we used fluorescence microscopy to study the effect of an acute increase in PO2 on [Ca2+]i of PA SMC isolated from fetal lambs with chronic intrauterine pulmonary hypertension.

To determine any changes in K+ channel activity due to chronic intrauterine pulmonary hypertension, the effect of K+ channel antagonists (5) was studied. PA SMC isolated from normotensive and hypertensive fetal ovine PAs were treated with iberiotoxin, a selective KCa channel antagonist, and 4-aminopyridine (4-AP), a Kv antagonist on PA SMC [Ca2+]i. The effect of chronic intrauterine hypertension on intracellular calcium homeostasis was addressed by treating PHTN and normotensive PA SMC with thapsigargin, an inhibitor of sarcoplasmic reticulum (SR) ATPase, and ryanodine, a stimulant of Ca2+ release from ryanodine-sensitive intracellular Ca2+ stores (17). KCa channel mRNA levels were determined with the use of quantitative internally controlled RT-PCR.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
Cell culture. The techniques used for isolation and culture of ovine PA SMC have been previously described (9). Distal PAs were quickly excised from pentobarbital-anesthetized ovine fetuses ranging in gestational age from 135 to 140 days (term = 147 days) and placed in physiological saline solution composed of (in mM) 120 NaCl, 5.9 KCl, 11.5 dextrose, 25 NaHCO3, 1.2 NaH2PO4, 1.2 MgCl2, and 1.5 CaCl2. PA SMC were isolated from fourth- or fifth-generation resistance PAs. Loose connective tissue and adventitia were removed and the vessels were liberally rinsed with minimal essential medium (MEM; 0.2 mM Ca2+). Vessel segments were carefully cut into small pieces and placed into 50-ml conical flasks containing 5.0 ml of the enzymatic dissociation mixture, which consisted of 0.125 mg/ml elastase (Sigma; St. Louis, MO), 1 mg/ml collagenase (Worthington Biochemical; Freehold, NJ), 2.0 mg/ml bovine serum albumin (Sigma), 0.375 mg/ml soybean trypsin inhibitor (Sigma), and 4 ml of MEM. After incubation at 37°C for 60 min in a shaking bath, the tissue suspension was triturated 10 times every 15 min in a plastic pipette for a total incubation period of 90-120 min. The tissue suspension was then passed through a 100-µm nylon mesh (Nitex, Tetka; Elmsford, NJ) to separate dispersed cells from undigested vessel wall fragments and debris. The filtered suspension was centrifuged (200 g for 10 min) and the cell pellet was resuspended in 10 ml of MEM supplemented with 10% fetal bovine serum. The dispersed cell suspension was aliquoted onto 25-mm2 glass coverslips and into 25-cm2 tissue culture flasks (Falcon Plastics; Oxnard, CA) at a density of 5-10 x 103 cells/cm2. The cells were incubated at 37°C in a humidified 10% O2-5% CO2-balance N2 atmosphere (hypoxia) or humidified 95% air-5% CO2. After 18-24 h, the cultures were washed once with Hanks' balanced salt solution to remove nonadherent cells and debris and refed with fresh medium. Medium was routinely exchanged at 72-h intervals. Cells were studied between day 5 and day 14 of culture. Cell density stabilized as subconfluent monolayers after 3-5 days in culture. To verify the uniformity of the cell population, PA SMCs were routinely stained with {alpha}-actinspecific antibody after 5, 10, and 14 days in culture.

Solutions. Recording solutions consisted of (in mM) 10 HEPES, 10 glucose, 135 NaCl, 5.6 KCl, 1.8 CaCl2, and 1.2 MgCl2. All solutions were made with the use of nanopure distilled water. Osmolality was adjusted to ~300 mosM, and pH adjusted to 7.4.

RT-PCR. Arterial tissue was removed from the lung. Tissue was taken from pulmonary arteries that were greater than or equal to fourth generation. Pulmonary arterial tissue was suspended in liquid N2 and ground to powder with a prechilled mortar and pestle. Total RNA was extracted with the use of the guanidium thiocyanate-phenol-chloroform method (Trireagent; Sigma). After homogenization, the samples were processed according to the reagent instructions and the RNA was dissolved in diethyl pyrocarbonate-treated water and stored at -70°C. Optical density was measured to determine the RNA concentration. One microgram of RNA was added to 11 µl of First Strand cDNA Synthesis reagent (Pharmacia) with random hexamers as primers in a final volume of 33 µl. Two microliters of this RT reaction were added to each PCR reaction. Oligonucleotide primers used to amplify Kv 2.1 cDNA were based on the human sequence (3) and were (forward) 5' ACAGAGCAAACCAAAGGAAGAAC 3' and (reverse) 5' CACCCTCCATGAAGTTGACTTTA 3'. The use of these primers yielded a PCR product consistent with that expected for a fragment of the human Kv 2.1 mRNA. The fragment size was 385 base pairs. The identity of the product was confirmed with sequence analysis. Oligonucleotide primers used to amplify KCa cDNA were based on the human sequence (34) and were (forward) 5' CTACTGGGATGTTTCACTGGTGT 3' and (reverse) 5' TGCTGTCATCAAACTGCATA 3'. The use of these primers yielded a PCR product consistent with that expected for a fragment of the human KCa mRNA. The fragment size was 446 base pairs. Identity of the product was confirmed with sequence analysis.

18S rRNA was analyzed concurrently in RT-PCR as an internal control. 18S cDNA was amplified with a Quantum-RNA primer/competimer set (Ambion) to act as an internal control for the quantitation of relative expression of the ethidium bromide-stained bands. This control band appears as 324 base pairs. Because 18S rRNA is far more abundant than the mRNA under study, the 18S amplification reaction was modulated by the addition of "competimers." These competimer primers are modified to block extension by DNA polymerase. When combined with the functional primers for 18S cDNA the amplification efficiency is reduced. Pilot experiments determined the correct ratio of primers/competimers, cycle number, and RT input to yield multiplex PCR products that are all in the linear range of amplification. The PCR cocktail consisted of 1x PCR buffer (Perkin Elmer) with 1.5 mM Mg2+, 10 pM each Kv 2.1 primer, 10 nM 2-deoxynucleotide 5'-trisphosphate mixture, 20 pM of 18S primer mixture (ratio of 1:9) of 18S primers/competimers, 1 U AmpliTaq polymerase and water to make 50 µl. PCR was performed in an MJ Research thermocycler with a heated lid and 0.2-ml thin-walled tubes. The PCR reaction was 2 min at 90°C, followed by 28-32 cycles of 1 min at 94°C, 1 min at 54°, 2 min at 72°, then an extension of 2 min at 65°. Samples without RT were evaluated in PCR; the products were absent. The identity of the band was confirmed by sequencing the product (>91% homology with known sequences). Densitometry was used to quantify the RT-PCR product (NIH Image software; Scion, Frederick, MD) and the internal control 18S rRNA to correct for variability in lane loading. Each gel contained PCR product from both hypertensive and control animals. The relative density of the 18S ribosomal and potassium channel PCR products were compared in each individual gel. PCR was run two times on each RNA sample.

Western blot analysis for KCa protein. Cultured smooth muscle cell monolayers were rinsed with cold PBS and scraped from their 25-mm coverslips in RIPA buffer with protease inhibitor cocktail and 0.1% Triton X-100. The homogenate was sonicated briefly (2 s) on ice and then centrifuged at 1,000 g for 5 min. The supernatant protein concentration was determined with the bicinchoninic acid protein assay (Pierce). Protein (75 µg) was combined with SDS-PAGE reducing sample buffer and electrophoresed in a 4-20% gradient gel. The proteins were electroblotted onto polyvinylidene difluoride membrane (Bio-Rad). Skim milk (6%) in 20 mM Tris-buffered saline (TBS) was used for blocking and washing the membranes. Antibody against KCa channel (Alomone) was diluted 1:200 in milk-TBS. In blocking experiments the antibody was incubated 1 h as recommended with specific antigen provided with the antibody and then diluted 1:200. The membranes were rotated in the solutions overnight at 4°C and washed. Second antibody was anti-rabbit IgG horseradish peroxidase conjugate (Jackson), 1:3,000 in milk-TBS with 0.01% Tween 20, rocked for 2 h at room temperature. After being washed, the membranes were incubated 10 min at room temperature with Super Signal West Pico chemiluminescent reagent (Pierce) and the membrane was exposed to Kodak X-omat fs-1 film. The KCa channel band was seen at 125 kDa, and antibody binding to these bands was blocked by antigen preincubation.

Animals. The procedures used in these studies were previously reviewed and approved by the Animal Care and Use Committee at the University of Minnesota Medical School. Fetal sheep were used in this study. At the time of tissue procurement, fetal ages ranged from 135 to 140 days gestation (term is 147 days). Ewes with time-dated pregnancies were fasted for 24 h and were sedated with pentobarbital sodium (10 g total dose). Fetal lambs were rapidly delivered through a hysterotomy, and an injection of pentobarbital sodium was given in the umbilical artery to prevent spontaneous breathing. After thoracotomy, the lungs were isolated, and samples were preserved for RNA analysis by freeze clamping and storage at -70°C.

Experimental model of chronic intrauterine pulmonary hypertension. Surgical ligation of the ductus arteriosus was performed as previously described (20, 28). Mixed-breed (Columbia-Rambouillet) pregnant ewes between 126 and 128 days gestation (term = 147 days) were fasted for 24 h before surgery. Ewes were sedated with intravenous pentobarbital sodium (total dose: 2-4 g) and anesthetized with 1% tetracaine hydrochloride (3 mg) by lumbar puncture. The ewes were kept sedated but breathed spontaneously throughout the operation. Under sterile conditions, the gravid uterus was delivered through a midline laparotomy. The fetal lamb's left forelimb was withdrawn through a small hysterotomy. A skin incision was made under the left forelimb after local infiltration with lidocaine (2-3 ml, 1% solution). A left thoracotomy exposed the heart and great vessels. The ductus arteriosus was visualized. A 2-0 silk suture was placed around the ductus arteriosus and tied. The ribs and skin were reapproximated. The hysterotomy was closed, and the uterus was returned into the maternal abdominal cavity. The ewes recovered rapidly from surgery and were generally standing in their pens within 6 h. Food and water were provided ad libitum. After 7-12 days, animals were euthanized rapidly after high-dose maternal and fetal infusions of pentobarbital sodium, and the lung tissue was harvested as described above.

Drugs used. Thapsigargin and 4-AP were obtained from Sigma. Fura 2-AM was obtained from Molecular Probes (Eugene, OR) and diluted in DMSO. Iberiotoxin and ryanodine were obtained from Alomone Laboratories (Jerusalem, Israel). Ionomycin and diltiazem were obtained from Calbiochem (La Jolla, CA). All drug solutions were adjusted to pH 7.4 before use and solubilized in normal saline.

Ca2+ imaging. To assess dynamic changes in [Ca2+]i in individual PA SMC, we used the Ca2+-sensitive fluorophore fura 2-AM (Molecular Probes). Subconfluent fetal PA SMC on 25-mm2 glass coverslips were placed on the stage of an inverted microscope (Nikon Diaphot). Cells were loaded with 100 nM fura 2-AM plus 2.5 mg/ml Pluronic acid (Molecular Probes) for 20 min in Ca2+-free solution, followed by a 20-min wash in calcium-containing solution before the start of the experiment. Ratiometric imaging was performed with the use of excitation wavelengths of 340 and 380 nm and an emission wavelength 560 nm. Imaging was performed with an ICCD camera (Photonic Science; Robertsbridge, UK) using Axon Instruments (Foster City, CA) image capture and analysis software. Ca2+ calibration was achieved by measuring a maximum (with ionomycin 1 mM) and a minimum (with EGTA 10 mM) for each cell. PO2 was controlled by aerating the recording solution reservoir with either 21% O2 with balance N2 or 100% N2. PO2 was monitored throughout with the use of an O2 electrode (Microelectrodes; Bedford, NH). Further control of PO2 was obtained by aerating the stage microincubator with 21% O2 with balanced N2 or 100% N2. pH was 7.40 ± 0.05 and did not change during the experiments. Intracellular free Ca2+ was calculated assuming a dissociation constant of 220 (31). For each experiment, 5-12 cells were visualized and cytosolic Ca2+ measurements were made from individual cells.

Measurement of [Ca2+]i. [Ca2+]i measurements were made after stable baseline Ca2+ values were obtained in either hypoxic (PO2 ~25 mmHg) or normoxic (21% O2; PO2 ~120 mmHg) recording solution. The recording solution was superfused over the cells at a rate of ~2 ml/min in all experiments. Measurements of [Ca2+]i were made for at least 10 min after a change in conditions or addition of a drug. KCl (60 meq, 60 K) was superfused over the cells at 2 ml/min at the conclusion of the experiment to ensure cellular viability.

Basal [Ca2+]i and the effect of an acute increase in PO2 on [Ca2+]i in chronically hypoxic PHTN and control fetal PA SMC. After stable baseline values in hypoxic recording solution were obtained, normoxic recording solution was superfused over the cells while [Ca2+]i was measured in PHTN (n = 96) and control (n = 117) PA SMC.

Effect of potassium and voltage-operated Ca2+ channel antagonists on basal [Ca2+]i in hypoxic PHTN and control fetal PA SMC. In separate experiments, [Ca2+]i was measured in control and PHTN PA SMC during the application of the following: 1) iberiotoxin (10-9 M) in PHTN (n = 17) and control (n = 51) PA SMC; 2) 4-AP (10-3 M) in PHTN (n = 47) and control (n = 38) PA SMC; and 3) diltiazem (10-5 M) in PHTN (n = 19) and control (n = 29) PA SMC.

Intracellular Ca2+ stores in hypoxic PHTN and control fetal PA SMC. After obtaining stable baseline values in hypoxic recording solution, the recording solution was changed to hypoxic solution without added Ca2+ for 2 min. Cells were then treated with thapsigargin (10-6 M) while [Ca2+]i was measured in PHTN (n = 27) and control (n = 30) PA SMC. In a separate series of experiments, cells were treated with ryanodine (5 x 10-5 M), whereas [Ca2+]i was measured in PHTN (n = 29) and control (n = 29) PA SMC.

Basal [Ca2+]i and the effect of an acute increase in PO2 on [Ca2+]i in serum-starved chronically hypoxic PHTN PA SMC. SMC from PHTN lambs were isolated and maintained in primary culture under hypoxic conditions as described above. In separate sets of experiments, the medium over the cells was changed from 10% to 0.1% fetal bovine serum for 1 or 7 days. Ca2+ imaging was performed while the conditions were changed to acute normoxia (n = 30 cells).

Statistical analysis. A two-way ANOVA with repeated measures and a Student-Newman-Keuls post hoc test were used to assess the differences between and among groups in each experimental protocol. Values are expressed as means ± SE. P values <0.05 were considered significant.

In each individual RNA experiment, the ratio of K+ channel to 18S rRNA content from hypertensive animals was compared with the ratio of K+ channel to 18S rRNA content in control animals. Total RNA was isolated from four control animals and six PHTN animals. The Student's t-test was used to assess differences between experimental groups. P values <0.05 were considered significant.


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
Basal [Ca2+]i and effect of acute increase in PO2 on [Ca2+]i in chronically hypoxic PHTN and control fetal PA SMC. Basal [Ca2+]i did not differ between PHTN and control cells. In control fetal PA SMC, acute normoxia decreased [Ca2+]i from 111 ± 10 to 83 ± 7 nM. Acute normoxia had no effect on PHTN PA SMC [Ca2+]i (Fig. 1) (24). The response to acute normoxia was not uniform. The heterogeneity of the response is illustrated in Fig. 2.



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 1. Effect of an acute increase in PO2 on fetal distal pulmonary artery (PA) smooth muscle cell (SMC), cytosolic Ca2+ concentration ([Ca2+]i) maintained in primary culture under hypoxic conditions. In pulmonary artery smooth muscle cells from normotensive (control; n = 117) animals, an acute increase in PO2 caused a decrease in [Ca2+]i (control data from Ref. 24). In pulmonary artery smooth muscle, cells from animals with chronic intrauterine pulmonary hypertension (n = 96), an acute increase in PO2 had no effect on [Ca2+]i. Values are means ± SE. *P < 0.05 vs. hypoxia.

 


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 2. Histogram demonstrating the distribution of PA SMC [Ca2+]i change in response to an acute increase in PO2. In control cells, [Ca2+]i decreased by 25%, whereas in pulmonary hypertension (PHTN) cells, the median change was -5%.

 

Effect of potassium and voltage-operated Ca2+ channel antagonists on basal [Ca2+]i in PHTN and control fetal PA SMC. In control cells, iberiotoxin (Fig. 3) caused an increase of 224 ± 25 nM. In PHTN fetal PA SMC, iberiotoxin had no effect. In control fetal PA SMC, 4-AP caused an increase of 15 ± 3 nM, whereas in PHTN cells, 4-AP caused an increase of 32 ± 3 nM. In control PA SMC, diltiazem caused [Ca2+]i to decrease by 34 ± 4 nM from baseline, whereas in PTHN PA SMC [Ca2+]i increased by 21 ± 5 nM.



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 3. Effect of potassium channel or voltage-operated Ca2+ channel blockade on [Ca2+]i of PA SMC from either control animals or animals with chronic intrauterine pulmonary hypertension. In control animals, blockade of the Ca2+-sensitive K+ (KCa) channels with 10-9 M iberiotoxin caused a substantial increase in PA SMC [Ca2+]i (n = 51; data from Ref. 24). In animals with chronic intrauterine pulmonary hypertension (n = 17), iberiotoxin had no effect on PA SMC [Ca2+]i. 4-Aminopyridine (4-AP) caused control (n = 38) PA SMC [Ca2+]i to increase 22 ± 5% and PHTN PA SMC (n = 19) [Ca2+]i to increase 32 ± 9%. Voltage-operated Ca2+ channel blockade with 10-5 M diltiazem led to a decrease in [Ca2+]i in controls but an increase in PHTN PA SMC [Ca2+]i. All experiments were performed under hypoxic conditions. *P < 0.01 vs. baseline, {dagger}P < 0.01 vs. control, {ddagger}P < 0.05 vs. baseline.

 

Intracellular Ca2+ stores in hypoxic PHTN and control fetal PA SMC. Ryanodine caused an increase in [Ca2+]i in both control and PHTN fetal PA SMC. In control PA SMC, ryanodine increased [Ca2+]i by 147 ± 28 nM, while in PHTN PA SMC [Ca2+]i increased by 347 ± 46 nM (Fig. 4A). In control fetal PA SMC, thapsigargin increased [Ca2+]i by 45 ± 12 nM. In PHTN fetal PA SMC, thapsigargin had no effect on [Ca2+]i (Fig. 4B).



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 4. Change in fetal distal PA SMC [Ca2+]i in response to ryanodine (A) or thapsigargin (B). Fetal PA SMC from normotensive control animals and animals with chronic intrauterine pulmonary hypertension were maintained in primary culture under hypoxic conditions. The effect of either ryanodine or thapsigargin on PA SMC [Ca2+]i is shown as change from baseline in nM. A: ryanodine (5 x 10-5 M) caused PA SMC [Ca2+]i to increase by 147 ± 28 nM (*P < 0.01 vs. baseline) in control fetuses (n = 32), compared with an increase of 346 ± 85 nM in animals with chronic intrauterine pulmonary hypertension ({dagger}P < 0.01 vs. baseline and controls). B: cells were superfused with an extracellular solution containing low extracellular Ca2+ (100 nM). Thapsigargin (1 µM) treatment of control PA SMC caused [Ca2+]i to increase by 45 ± 12 nM (*{dagger}P < 0.01 vs. baseline), whereas in PA SMC from animals with chronic intrauterine pulmonary hypertension [Ca2+]i did not change. All experiments were performed under hypoxic conditions.

 

Basal [Ca2+]i and effect of acute increase in PO2 on [Ca2+]i in serum-starved chronically hypoxic PHTN PA SMC. Serum deprivation had no effect on basal [Ca2+]i or on the response to an acute increase in PO2.

{alpha}KCa subunit and Kv channel RT-PCR. KCa mRNA expression was decreased in PHTN, compared with control fetal PA SMC as determined by quantitiative, internally controlled RT-PCR (Fig. 5, A and B). The ratio of {alpha}KCa RNA to 18S RNA levels was 1.562 ± 0.136 in controls (n = 4) and 1.41 ± 0.103 in animals with PHTN (n = 6 animals). Kv channel mRNA expression in PHTN PA SMC was not significantly different from control PA SMC.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 5. A: representative gel of a RT-PCR analysis of KCa channel {alpha}-subunit mRNA expression in control animal and animals with chronic intrauterine pulmonary hypertension. The {alpha}KCa channel band (446 bp) was compared with the 18S band (488 bp). B: KCa channel band intensity was determined by densitometry and normalized to that of the 18S band in several experiments. KCa channel mRNA levels are decreased in animals with chronic intrauterine pulmonary hypertension compared with controls (P < 0.05 vs. control).

 

KCa channel protein expression. Consistent with the observed effect on mRNA expression, Western blot analysis of KCa channel expression demonstrated decreased KCa channel protein (125-kDa band) in the PHTN PA SMC compared with controls (Fig. 6).



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 6. A representative Western blot for KCa channel protein expression in PA SMC from culture. The 125-kDa KCa channel band is shown above the {alpha}-smooth muscle actin-loading control band in SMC from control and PHTN animals. The bands were quantified by densitometry with the use of NIH Image software. The KCa protein band was normalized to the {alpha}-smooth muscle actin loading control by expressing the result as a ratio against the loading control signal (KCa/{alpha}-smooth muscle actin).

 


    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
The present series of experiments demonstrates that chronic intrauterine pulmonary hypertension compromises pulmonary artery O2 sensing, as PA SMC from normotensive, but not hypertensive, fetus can respond directly to an acute increase in PO2 with a decrease in [Ca2+]i. Under hypoxic conditions, basal [Ca2+]i in hypertensive fetal PA SMC is determined by 4-aminopyridine-sensitive K+ channels, whereas the KCa channel activity determines basal [Ca2+]i in normotensive fetal PA SMC (6). Furthermore, the voltage-operated Ca2+ channel blocker diltiazem increased [Ca2+]i in hypertensive fetal PA SMC, while causing a significant decrease in [Ca2+]i in normotensive fetal PA SMC. Molecular data provides further support for these observations as KCa channel expression is decreased and Kv channel gene expression is unchanged in hypertensive, compared with normotensive, fetal PA SMC. Whereas previous investigators (2, 20) have clearly demonstrated that chronic intrauterine pulmonary hypertension attenuates perinatal pulmonary vasodilation, the present study provides the first evidence that alterations in PA SMC O2 sensing and intracellular Ca2+ homeostasis may contribute to abnormal perinatal pulmonary vasoreactivity.

Previous studies have demonstrated that perinatal pulmonary vasodilator stimuli act, at least in part, through activation of the pulmonary vascular KCa channel. In specific ventilation (33) and shear stress (32), an acute increase in PO2 (6) and NO (29) causes perinatal pulmonary vasodilation through activation of the KCa channel. From a teleologic perspective, the normal perinatal pulmonary circulation is uniquely well adapted to respond to an acute increase in PO2 as fetal, but not adult, PA SMC respond to an acute increase in PO2 with a decrease in [Ca2+]i (26). The inability of PA SMC derived from fetal lambs with chronic intrauterine pulmonary hypertension to respond to an acute increase in PO2 is consistent with previous reports of a decrease in pulmonary KCa channel expression in this model (7). In addition, recently published electrophysiology data indicate that the predominant potassium channel contributing to Em shifts from the KCa channel to the Kv channel in PA SMC from lambs with chronic intrauterine pulmonary hypertension (22). Moreover, the present observation is consistent with the incomplete response to vasodilator stimuli that characterizes the clinical presentation of persistent pulmonary hypertension (16).

To address the possibility that the attenuated Ca2+ response in hypertensive PA SMC results from increased Ca2+-ATPase activity in the SR, cells were treated with thapsigargin. In normotensive fetal PA SMC maintained under hypoxic conditions, thapsigargin caused a substantial increase in [Ca2+]i, implying that Ca2+-ATPase activity plays a role in the maintenance of basal Ca2+ stores. In contrast, thapsigargin had no effect on the basal [Ca2+]i of hypertensive PA SMC maintained under hypoxic conditions. Thus, in PHTN SMC, the SR Ca2+-ATPase activity is diminished. Consequently, the absence of the normoxia-induced decrease in [Ca2+]i in PHTN SMC is unlikely to result from augmented Ca2+-ATPase activity. Further studies are necessary to determine the significance of the relatively diminished role of Ca2+-ATPase activity in the maintenance of basal [Ca2+]i in PA SMC from animals with chronic intrauterine pulmonary hypertension.

To further investigate the effect of chronic intrauterine hypertension on intracellular Ca2+ handling, PA SMC from hypoxic normotensive and hypertensive animals were treated with ryanodine, which causes release of calcium from ryanodine stores in the SR (14, 17). Ryanodine caused an increase in both normotensive and PHTN PA SMC [Ca2+]i. However, the effect of ryanodine was significantly greater in PHTN PA SMC. Previous work (23) suggests that oxygen causes a decrease in fetal PA SMC [Ca2+]i through the quantal, localized release of intracellular calcium from a ryanodine-sensitive store close to the cell membrane in the region of the calcium-sensitive K+ channel. These small bursts of calcium have been termed calcium sparks. Ca2+ sparks are localized events that do not contribute to the global [Ca2+]i and do not reach a high enough concentration to cause contraction. Ca2+ spark activation of the KCa channel hyperpolarizes the cell, closing voltage-dependent Ca2+ channels and causing a decrease in cytosolic Ca2+ and, ultimately, vasodilation (11, 21). The relatively greater response to ryanodine in PHTN compared with normotensive PA SMC [Ca2+]i suggests chronic intrauterine hypertension affects the ryanodine-sensitive Ca2+ stores such that the stores contain Ca2+ in greater amounts than in controls. We speculate that Ca2+ spark release may no longer be localized or in the region of the KCa channel, and Ca2+ release from the store may lead to an increase in PA SMC [Ca2+]i from PHTN animals. While the underlying reason for the relatively replete ryanodine-sensitive stores is unknown, this observation seems to preclude the possibility that diminished KCa channel activation results primarily from depletion of the ryanodine-sensitive store.

Consideration of these data in concert with the decrease in KCa channel activity noted in PA SMC from hypertensive animals leads to the conclusion that release of Ca2+ from ryanodine-sensitive stores does not result in KCa channel activation. It is possible that chronic intrauterine pulmonary hypertension changes the relationship of the ryanodine-sensitive intracellular stores and the KCa channel as has been described in cardiac myocytes derived from animals with congestive heart failure (13). The inability of Ca2+ release from the ryanodine-sensitive Ca2+ store to activate KCa channels, thereby causing membrane hyperpolarization and closure of voltage-operated Ca2+ channels, may underlie the incomplete response to pulmonary vasodilator stimuli that characterizes persistent pulmonary hypertension of the newborn. Further support for this notion derives from the observation that both NO (29) and O2 (24) cause pulmonary vasodilation through ryanodine-dependent activation of KCa channels. Thus, if calcium release from ryanodine-sensitive stores cannot activate KCa channels, then both oxygen and NO-induced vasodilation may be compromised.

Given the generalized decrease in responsiveness of hypertensive PA SMC, intrauterine exposure to hypertension may prompt PA SMC to change from a contractile to a synthetic phenotype (12). To address such a possibility, PA SMC from hypertensive animals were serum deprived for periods of time ranging between 24 h and 7 days before the study. Serum deprivation had no effect on the responsiveness of these cells to any of the agents included in the present manuscript. On the basis of these results, we conclude that diminished responsiveness of these cell types cannot be explained on the basis of a change in phenotype.

There was no difference in basal [Ca2+]i between HTN and control PA SMC. Given clear evidence that chronic intrauterine pulmonary hypertension increases fetal pulmonary vascular tone, relatively higher levels of SMC [Ca2+]i might be anticipated in PHTN compared with control SMC. The similar levels of [Ca2+]i in these two cell populations suggests that the contractile state of the pulmonary vasculature is not determined solely by [Ca2+]i. Putative mechanisms include enhanced sensitivity of the contractile proteins to Ca2+, upregulation of Rho kinase activity, or a decrease in phosphatase activity (15). Alternatively, changes in intracellular calcium buffering, such as augmented cADP-ribose activity, may modulate SMC contractility (18).

In summary, the present study provides data that chronic intrauterine pulmonary hypertension has direct effects on PA SMC. PA SMC from animals with chronic intrauterine pulmonary hypertension do not respond to an acute increase in PO2 with a decrease in [Ca2+]i. Moreover, the K+ channel that determines basal [Ca2+]i changes from a KCa to a Kv channel. The physiological changes are consistent with changes in gene expression as KCa mRNA and protein levels are decreased and Kv mRNA levels are not significantly changed in PA SMC derived from animals with chronic intrauterine pulmonary hypertension. The observation that ryanodine causes a greater response in PA SMC [Ca2+]i in hypertensive compared with normotensive animals provides further insight into the mechanism whereby chronic intrauterine pulmonary hypertension alters perinatal pulmonary vascular reactivity. Further study is necessary to determine whether Ca2+ spark physiology is altered by chronic intrauterine pulmonary hypertension.


    DISCLOSURES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
This work was supported by National Heart, Lung, and Blood Institute Grants RO1 HL-60784 (to D. N. Cornfield) and F32 HL-68464 (to B. C. Linden), a Viking Children's Fund grant (to E. R. Resnik), an American Heart Association Established Investigator Award (to D. N. Cornfield), and the Richard Lewis Varco Surgical Research Fellowship (to B. C. Linden).


    ACKNOWLEDGMENTS
 
The authors thank Franklin O. Anderson for superb technical assistance in the laboratory.


    FOOTNOTES
 

Address for reprint requests and other correspondence: B. C. Linden, MMC 742, Univ. of Minnesota School of Medicine, 420 Delaware St. SE, Minneapolis, MN 55455 (E-mail: lind0186{at}umn.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 

  1. Abman SH, Chatfield BA, Hall SL, and McMurtry IF. Role of endothelium-derived relaxing factor during transition of pulmonary circulation at birth. Am J Physiol Heart Circ Physiol 259: H1921-H1927, 1990.[Abstract/Free Full Text]
  2. Abman SH, Shanley PF, and Accurso FJ. Failure of postnatal adaptation of the pulmonary circulation after chronic intrauterine pulmonary hypertension in fetal lambs. J Clin Invest 83: 1849-1858, 1989.[Web of Science][Medline]
  3. Albrecht B, Lorra C, Stocker M, and Pongs O. Cloning and characterization of a human delayed rectifier potassium channel gene. Receptors Channels 1: 99-110, 1993.[Web of Science][Medline]
  4. Cassin S, Dawes GS, Mott JC, Ross BB, and Strang LB. The vascular resistance of the fetal and newly ventilated lung of the lamb. J Physiol 171: 61-79, 1964.[Free Full Text]
  5. Cook N. The pharmacology of potassium channels and their therapeutic potential. Trends Pharmacol Sci 9: 21-28, 1988.[Medline]
  6. Cornfield DN, Reeve HL, Tolarova S, Weir EK, and Archer S. Oxygen causes fetal pulmonary vasodilation through activation of a calcium-dependent potassium channel. Proc Natl Acad Sci USA 93: 8089-8094, 1996.[Abstract/Free Full Text]
  7. Cornfield DN, Resnik ER, Herron JM, and Abman SH. Chronic intrauterine pulmonary hypertension decreases calcium-sensitive potassium channel mRNA expression. Am J Physiol Lung Cell Mol Physiol 279: L857-L862, 2000.[Abstract/Free Full Text]
  8. Cornfield DN, Saqueton CB, Porter VA, Herron J, Resnik E, Haddad IY, and Reeve HL. Voltage-gated K+-channel activity in ovine pulmonary vasculature is developmentally regulated. Am J Physiol Lung Cell Mol Physiol 278: L1297-L1304, 2000.[Abstract/Free Full Text]
  9. Cornfield DN, Stevens T, McMurtry IF, Abman SH, and Rodman DM. Acute hypoxia increases cytosolic calcium in fetal pulmonary artery smooth muscle cells. Am J Physiol Lung Cell Mol Physiol 265: L53-L56, 1993.[Abstract/Free Full Text]
  10. Dawes GS, Mott JC, Widdicombe JG, and Wyatt DG. Changes in the lungs of the newborn lamb. J Physiol 121: 141-162, 1953.[Free Full Text]
  11. Fay FS. Calcium sparks in vascular smooth muscle: relaxation regulators. Science 270: 588-589, 1995.[Abstract/Free Full Text]
  12. Frid MG, Aldashev AA, Dempsey EC, and Stenmark KR. Smooth muscle cells isolated from discrete compartments of the mature vascular media exhibit unique phenotypes and distinct growth capabilities. Circ Res 81: 940-952, 1997.[Abstract/Free Full Text]
  13. Gomez AM, Guatimosim S, Dilly KW, Vassort G, and Lederer WJ. Heart failure after myocardial infarction: altered excitation-contraction coupling. Circulation 104: 688-693, 2001.[Abstract/Free Full Text]
  14. Jaggar JH, Wellman GC, Heppner TJ, Porter VA, Perez GJ, Gollasch M, Kleppisch T, Rubart M, Stevenson AS, Lederer WJ, Knot HJ, Bonev AD, and Nelson MT. Ca2+ channels, ryanodine receptors and Ca2+-activated K+ channels: a functional unit for regulating arterial tone. Acta Physiol Scand 164: 577-587, 1998.[Web of Science][Medline]
  15. Kimura K, Ito M, Amano M, Chihara K, Fukata Y, Nakafuku M, Yamamori B, Feng J, Nakano T, Okawa K, Iwamatsu A, and Kaibuchi K. Regulation of myosin phosphatase by Rho and Rho-associated kinase (Rho-kinase). Science 273: 245-248, 1996.[Abstract]
  16. Kinsella JP and Abman SH. Recent developments in the pathophysiology and treatment of persistent pulmonary hypertension of the newborn. J Pediatr 126: 853-864, 1995.[Web of Science][Medline]
  17. Knot HJ, Standen NB, and Nelson MT. Ryanodine receptors regulate arterial diameter and wall [Ca2+] in cerebral arteries of rat via Ca2+-dependent K+ channels. J Physiol 508: 211-221, 1998.[Abstract/Free Full Text]
  18. Lee HC and Aarhus R. Functional visualization of the separate but interacting calcium stores sensitive to NAADP and cyclic ADP-ribose. J Cell Sci 113: 4413-4420, 2000.[Abstract]
  19. Levin DL, Heymann MA, Kitterman JA, Gregory GA, Phibbs RH, and Rudolph AM. Fetal hypertension and the development of increased pulmonary vascualr smooth muscle: a possible mechanism for the PPHN infant. J Pediatr 92: 265-269, 1976.
  20. Morin FC. Ligating the ductus arteriosus before birth causes persistent pulmonary hypertension in the newborn lamb. Peds Res 25: 245-250, 1989.
  21. Nelson MT and Quayle JM. Physiological roles and properties of potassium channels in arterial smooth muscle. Am J Physiol Cell Physiol 268: C799-C822, 1995.[Abstract/Free Full Text]
  22. Olschewski A, Hong Z, Linden BC, Porter VA, Weir EK, and Cornfield DN. Contribution of the KCa channel to membrane potential and O2 sensitivity is decreased in an ovine PPHN model. Am J Physiol Lung Cell Mol Physiol 283: L1103-L1109, 2002.[Abstract/Free Full Text]
  23. Porter VA, Reeve HL, and Cornfield DN. Fetal rabbit pulmonary artery smooth muscle cell response to ryanodine is developmentally regulated. Am J Physiol Lung Cell Mol Physiol 279: L751-L757, 2000.[Abstract/Free Full Text]
  24. Porter VA, Rhodes MT, Reeve HL, and Cornfield DN. Oxygen-induced fetal pulmonary vasodilation is mediated by intracellular calcium activation of KCa channels. Am J Physiol Lung Cell Mol Physiol 281: L1379-L1385, 2001.[Abstract/Free Full Text]
  25. Reeve HL, Weir EK, Archer SL, and Cornfield DN. A maturational shift in pulmonary K+ channels, from Ca2+ sensitive to voltage dependent. Am J Physiol Lung Cell Mol Physiol 275: L1019-L1025, 1998.[Abstract/Free Full Text]
  26. Rhodes MT, Porter VA, Saqueton CB, Herron JM, Resnik ER, and Cornfield DN. Pulmonary vascular response to normoxia and KCa channel activity is developmentally regulated. Am J Physiol Lung Cell Mol Physiol 280: L1250-L1257, 2001.[Abstract/Free Full Text]
  27. Rudolph A. Distribution and regulation of blood flow in the fetal and neonatal lamb. Circ Res 57: 811-821, 1985.[Free Full Text]
  28. Ruiz UPG, Balogh K, Polansky BJ, and Jackson BT. An experimental model for fetal pulmonary hypertension. A preliminary report. Am J Surg 123: 468-471, 1972.[Web of Science][Medline]
  29. Saqueton CB, Miller RB, Porter VA, Milla CE, and Cornfield DN. NO causes perinatal pulmonary vasodilation through K+-channel activation and intracellular Ca2+ release. Am J Physiol Lung Cell Mol Physiol 276: L925-L932, 1999.[Abstract/Free Full Text]
  30. Shaul PW, Yuhanna IS, German Z, Chen Z, Steinhorn RH, and Morin FC 3rd. Pulmonary endothelial NO synthase gene expression is decreased in fetal lambs with pulmonary hypertension. Am J Physiol Lung Cell Mol Physiol 272: L1005-L1012, 1997.[Abstract/Free Full Text]
  31. Stevens T, Cornfield DN, McMurtry IF, and Rodman DM. Acute reductions in PO2 depolarize pulmonary artery endothelial cells and decrease [Ca2+]i. Am J Physiol Heart Circ Physiol 266: H1416-H1421, 1994.[Abstract/Free Full Text]
  32. Storme L, Rairigh RL, Parker TA, Cornfield DN, Kinsella JP, and Abman SH. K+-channel blockade inhibits shear stress-induced pulmonary vasodilation in the ovine fetus. Am J Physiol Lung Cell Mol Physiol 276: L220-L228, 1999.[Abstract/Free Full Text]
  33. Tristani-Firouzi M, Martin EB, Tolarova S, Weir EK, Archer SL, and Cornfield DN. Ventilation-induced pulmonary vasodilation at birth is modulated by potassium channel activity. Am J Physiol Heart Circ Physiol 271: H2353-H2359, 1996.[Abstract/Free Full Text]
  34. Tseng-Crank J, Foster CD, Krause JD, Mertz R, Godinot N, DiChiara TJ, and Reinhart PH. Cloning, expression, and distribution of functionally distinct Ca2+-activated K+ channel isoforms from human brain. Neuron 13: 1315-1330, 1994.[Web of Science][Medline]
  35. Villamor E, Le Cras TD, Horan MP, Halbower AC, Tuder RM, and Abman SH. Chronic intrauterine pulmonary hypertension impairs endothelial nitric oxide synthase in the ovine fetus. Am J Physiol Lung Cell Mol Physiol 272: L1013-L1020, 1997.[Abstract/Free Full Text]
  36. Yuan XJ, Goldman WF, Tod ML, Rubin LJ, and Blaustein MP. Hypoxia reduces potassium currents in cultured rat pulmonary but not mesenteric arterial myocytes. Am J Physiol Lung Cell Mol Physiol 264: L116-L123, 1993.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
E. R. Resnik, M. Keck, D. J. Sukovich, J. M. Herron, and D. N. Cornfield
Chronic intrauterine pulmonary hypertension increases capacitative calcium entry in fetal pulmonary artery smooth muscle cells
Am J Physiol Lung Cell Mol Physiol, April 1, 2007; 292(4): L953 - L959.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
E. Resnik, J. Herron, M. Keck, D. Sukovich, B. Linden, and D. N. Cornfield
Chronic intrauterine pulmonary hypertension selectively modifies pulmonary artery smooth muscle cell gene expression
Am J Physiol Lung Cell Mol Physiol, March 1, 2006; 290(3): L426 - L433.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/6/L1354    most recent
00091.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Linden, B. C.
Right arrow Articles by Cornfield, D. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Linden, B. C.
Right arrow Articles by Cornfield, D. N.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2003 by the American Physiological Society.