AJP - Lung Columbus Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 286: L293-L300, 2004; doi:10.1152/ajplung.00228.2003
1040-0605/04 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (20)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shi, W.
Right arrow Articles by Warburton, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shi, W.
Right arrow Articles by Warburton, D.

Overexpression of Smurf1 negatively regulates mouse embryonic lung branching morphogenesis by specifically reducing Smad1 and Smad5 proteins

Wei Shi,1,2 Hui Chen,1 Jianping Sun,2 Cheng Chen,1,3 Jingsong Zhao,1 Yan-Ling Wang,1 Kathryn D. Anderson,2 and David Warburton2

1Center for Craniofacial Molecular Biology, University of Southern California, Los Angeles 90033; 2Developmental Biology Program, Children's Hospital Los Angeles Research Institute, Los Angeles, California 90027; and 3Developmental Biology Division, China Medical University, Shenyang, People's Republic of China 110001

Submitted 14 July 2003 ; accepted in final form 6 October 2003


    ABSTRACT
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Early embryonic lung branching morphogenesis is regulated by many growth factor-mediated pathways. Bone morphogenetic protein 4 (BMP4) is one of the morphogens that stimulate epithelial branching in mouse embryonic lung explant culture. To further understand the molecular mechanisms of BMP4-regulated lung development, we studied the biological role of Smad-ubiquitin regulatory factor 1 (Smurf1), an ubiquitin ligase specific for BMP receptor-regulated Smads, during mouse lung development. The temporo-spatial expression pattern of Smurf1 in mouse embryonic lung was first determined by quantitative real-time PCR and immunohistochemistry. Overexpression of Smurf1 in airway epithelial cells by intratracheal introduction of recombinant adenoviral vector dramatically inhibited embryonic day (E) 11.5 lung explant growth in vitro. This inhibition of lung epithelial branching was restored by coexpression of Smad1 or by addition of soluble BMP4 ligand into the culture medium. Studies at the cellular level show that overexpression of Smurf1 reduced epithelial cell proliferation and differentiation, as documented by reduced PCNA-positive cell index and by reduced mRNA levels for surfactant protein C and Clara cell protein 10 expression. Further studies found that overexpression of Smurf1 reduced BMP-specific Smad1 and Smad5, but not Smad8, protein levels. Thus overexpression of Smurf1 specifically promotes Smad1 and Smad5 ubiquitination and degradation in embryonic lung epithelium, thereby modulating the effects of BMP4 on embryonic lung growth.

lung development; bone morphogenetic protein; Smad-ubiquitin regulatory factor 1


LUNG DEVELOPMENT IS INITIATED by the formation of a pair of primary buds that evaginate from the laryngo-tracheal groove, located in the ventral foregut endoderm, into the surrounding splanchnic mesenchyme (8). The respiratory tree then develops by branching morphogenesis, in which reiterated outgrowth, elongation, and subdivision of epithelial buds occur (11, 12). This stereotypic pattern of early lung budding and branching is retained even in chemically defined embryonic lung explant culture, which makes early embryonic lung organ culture a very useful model for studying the basic mechanisms of lung development (13). In the mouse, lung branching morphogenesis begins at embryonic day (E) 10.5 and is regulated by many peptide growth factors, including the transforming growth factor (TGF)-{beta} protein superfamily (23).

Bone morphogenetic proteins (BMPs) are a subgroup of the TGF-{beta} superfamily that is involved in many embryonic patterning events (10). In the developing embryonic lung, BMP4 is expressed in the distal epithelial cells and the adjacent mesenchyme and plays an important role in regulating early branching morphogenesis (1, 3, 22, 25). Previous studies have shown that addition of BMP4 into the embryonic lung explant culture medium dramatically stimulates lung branching (2, 21), whereas an inhibitory effect of BMP4 on the growth of isolated epithelium has been reported (24). Therefore, although BMP4 seems to be one of the key growth factors essential for fetal lung development, the precise mechanism by which BMP4 regulates embryonic lung morphogenesis is unclear.

As a secreted ligand, BMP4 binds and activates its cognate transmembrane receptors, resulting in activation of downstream receptor-regulated Smads (R-Smads: Smad1, -5, -8). Phosphorylated R-Smads form protein complexes with the common mediator Smad4 and translocate to the nucleus, where they modulate specific target gene expression (17). This signal transduction pathway is fine tuned at several levels.

Smad ubiquitin regulatory factor 1 (Smurf1) is an important intracellular negative regulator of BMP signaling (28). Protein homology analysis indicated that Smurf1 is a member of the Hect family of E3 ubiquitin ligases, which transfer ubiquitin to their specifically bound target proteins for proteasome-mediated degradation. Previous studies indicate that Smurf1 interacts with phosphorylated Smad1 and Smad5 and facilitates their ubiquitination and degradation in cultured cell lines in vitro (28). Smurf1 also mediates ubiquitination and degradation of phosphorylated TGF-{beta} receptor II through interacting with Smad7 (5). However, the biological functions of Smurf1 in mammalian organogenesis have not been explored.

Herein, we report that overexpression of Smurf1 in early murine embryonic lungs by means of a recombinant adenoviral vector inhibits lung branching morphogenesis in lung explant culture, including reduced peripheral epithelial cell proliferation and differentiation. This inhibitory effect can be partially reversed by either co-overexpression of Smad1 or by addition of exogenous BMP4 into the culture medium. Further studies on R-Smad protein levels in lung explants overexpressing Smurf1 found that only Smad1 and Smad5, but not Smad8, are downregulated. This protein specificity for the Smurf1 regulatory effect was further supported by coexpression of Smurf1 and BMP-specific R-Smads in a cultured lung epithelial cell line. Therefore, the results suggested that Smurf1 provides an additional modulation of BMP4-stimulated embryonic lung growth by downregulating BMP-specific Smad1 and 5.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Mouse lung samples. Swiss-Webster mice were purchased from Simonsen Laboratories (Gilroy, CA). To study the embryonic lungs at different developmental stages, we killed timed-pregnant mice at the desired stages, and the embryos were removed by cesarean section. The embryonic lung was excised en bloc and processed for organ culture, fixation, or RNA extraction. The animal protocol used herein was approved by the University of Southern California Institutional Animal Care and Use Committee.

Total RNA isolation and reverse transcription. The total RNA was isolated from lung using a Qiagen RNeasy kit (Qiagen, Santa Clarita, CA). The quality of isolated RNA was checked by formaldehyde agarose gel electrophoresis before the reverse transcription reaction. Two micrograms of total RNA were added to 20 µl of reverse transcription reaction mixture containing 0.5 µg oligo dT, 50 mM Tris·HCl, pH 8.3, 75 mM KCl, 3 mM MgCl2, 0.5 mM dNTPs, 10 mM DTT, 40 units RNaseOUT ribonuclease inhibitor, and 200 units Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA) and incubated at 42°C for 60 min. The product of reverse transcription was diluted 10-fold and applied to polymerase chain reaction (PCR) analysis.

Primers and real-time PCR. Real-time quantitative PCR analysis was performed on iCycler-iQ system (Bio-Rad Laboratories, Hercules, CA) by SYBR Green I dye detection. The reactions were assembled following the manufacturer's recommendation. Briefly, 25 µl of reaction mixture contain 1x buffer (iQ SYBR Green Supermix, Bio-Rad), 200 nM forward and reverse primers, and the cDNA template from the sample. The PCR conditions are 3 min at 95°C, followed by 40 cycles of 10 s at 95°C, 30 s at annealing temperature, and 30 s at 72°C. We verified the specificity of PCR by measuring the melting curve of the PCR product at the end of reaction. Fluorescent data are specified for collection during primer extension. The relative cDNA ratio was calculated using the value of threshold cycles (19). The PCR primer sequences for mouse Smurf1 are AATCCAGCTGTCGGACCTGGAG and CTGGTCAAAGGGCTTCAGCAAG. GAPDH was used as reference control to normalize equal loading of template cDNA. In addition, the primer sequences for BMP R-Smad RT-PCR are 1) Smad1, AGCCCAACAGCCACCCGT and GCAACTGCCTGAACATCTCCT; 2) Smad5, GCTGAACCCCATTTCTTCTG and CGTTCCAGGTTAAGATCAATGC; and 3) Smad8, TCCAGCAGTCTCTCTGTCCG and GTGCTGGGGTTCCTCGTAG.

E11.5 lung culture. The procedure for lung organ culture was previously described (21). Briefly, timed-pregnant mice were killed at E11.5, and the lung primordia were isolated from the embryos under a dissecting microscope. Lung explants were placed on 0.80-µm MF-Millipore filters, supported by a stainless-steel grid in a Grobstein culture dish. An appropriate amount of BGJb serum-free medium (Invitrogen) was added to each dish to establish an air-fluid interface at the level of the explants. The E11.5 embryonic lungs were cultured for 4 days in 100% humidity and 95% air-5% CO2. The medium was changed every 2 days. Branching morphogenesis was measured as the number of epithelial sacs visible around the periphery of the lung explants under the microscope. Cultured lungs were also processed for RNA isolation, protein lysate preparation, or fixation. At least 10 lung explants were used for each condition, and individual experiments were repeated at least three times.

Immunostaining of lung tissue sections. PCNA staining was performed using a kit from Zymed Laboratories (South San Francisco, CA). The PCNA index was measured as the percentage of the PCNA-positive epithelial or mesenchymal cells out of the total counted same type of cells. Smurf1 was detected using a polyclonal antibody from Santa Cruz Biotechnology (Santa Cruz, CA) at a dilution of 1/50 and an overnight incubation at 4°C. Zymed Histostain-Plus kit was used for the immunostaining.

Production and administration of adenoviral vector. The cDNA for human Smurf1 was kindly provided by Dr. Gerald H. Thomsen at SUNY-Stony Brook. The Smurf1 open reading frame fragment was subcloned into pcDNA3 with addition of the Kozak consensus sequence in front of ATG translation coden and an influenza hemagglutinin (HA) epitope tag in the NH2 terminus of the protein. A replication-deficient recombinant adenovirus expressing Smurf1 under control of the cytomegalovirus (CMV) promoter was made using a simplified system kindly provided by Dr. Bert Vogelstein (9). Briefly, the smurf1 cDNA was first subcloned into pAd-Track-CMV vector, and the homologous recombination between pAd-Track-CMV-Smurf1 and adenoviral backbone pAd-Easy was carried out in bacteria strain BJ5183. The recombined pAd-Smurf1 was used to transfect 293A cells, and the recombinant adenovirus-Smurf1 (AdSmurf1) was then harvested from the cell lysate by repeated freezing and thawing and purified by cesium chloride gradient ultracentrifugation. Viral infection was monitored by virally produced green fluorescence protein (GFP). We confirmed Smurf1 production from the recombinant adenovirus in mouse tissues by RT-PCR using human Smurf1-specific primers and by Western blot with anti-HA antibody. Smad1 and Smad5 adenoviral vectors were kindly provided by Dr. Makiko Fuji at National Cancer Institute (6). The mouse Smad8 cDNA was kindly provided by Dr. Shinji Kawai (Aventis Pharma) and subcloned into an adenoviral vector as described above.

To overexpress exogenous gene products in local airway epithelium of E11.5 lung explants, we microinjected high-titer adenoviral vectors (>1 x 1012 plaque-forming U/ml) intratracheally to fill the embryonic lung airway as previously described (26). Injected lungs were then incubated for 1 h at room temperature for viral infection before culture. At least 10 lung explants were infected for each experiment, and each individual experiment was repeated at least three times.

Protein detection by Western blot. Detection of embryonic lung proteins has been previously described (26). Briefly, embryonic lung tissues were lysed on ice in radioimmunoprecipitation assay buffer: 1x PBS, 1% Nonidet P-40, 0.25% sodium deoxycholate, 0.1% SDS, 50 mM sodium fluoride, 5 mM EDTA, and freshly added 1 mM PMSF, 0.2 U/ml aprotinin, and 1 mM sodium orthovanadate. Total tissue lysate proteins (20-30 µg) were loaded for NuPAGE Novex gels (Invitrogen), and the separated proteins were transferred to Immobilon-P membrane (Millipore). We then blocked the membrane for nonspecific binding overnight at 4°C by incubating with 5% fat-free dry milk in TBST (10 mM Tris·HCl, pH 7.4, 150 mM NaCl, and 0.1% Tween 20). Primary antibody was diluted in blocking buffer and incubated with membrane for 1 h at room temperature. After being washed in TBST (10 min x 4), the membrane was incubated with horseradish peroxidase-conjugated secondary antibody for 45 min at room temperature. The antibody-detected protein bands were visualized by ECL reagent (Amersham). Antibodies for Smad1, -5, -8 (Santa Cruz Biotechnology), Flag (Sigma, St. Louis, MO), and HA (Covance, Princeton, NJ) were commercially purchased.

Coexpression of Smurf1 with BMP-specific R-Smads in A549 cell line. Lung epithelial carcinoma cell line A549 was cultured as monolayer cells in RPMI 1640 with 10% fetal calf serum. Equal titers of the various adenoviral vectors were added into the medium of cultured cells with 80% confluence. After 2-day culture, cell lysate proteins were prepared and analyzed by Western blot as described above.


    RESULTS
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Temporo-spatial expression pattern of Smurf1 in mouse embryonic lungs. To evaluate the role of Smurf1 during mouse embryonic lung development, we determined expression of Smurf1 mRNA in mouse fetal lung during different developmental stages by quantitative real-time PCR (Fig. 1A). Expression of Smurf1 mRNA was relatively low at the early embryonic stage (E11.5) and continuously increased until postnatal day (P) 1 (E14.5-P1). Interestingly, Smurf1 mRNA expression in mouse adult lung was reduced by ~45% compared with the level at P1 stage. This may indicate that Smurf1 is an important regulator during fetal lung development. Cellular localization of Smurf1 protein in early embryonic lungs was analyzed by immunohistochemistry (Fig. 1B). In E11.5 lung, Smurf1 was mainly detected in a small number of mesenchymal cells. However, after 1 day of culture, Smurf1 was detected in both sparsely distributed peripheral epithelial cells and mesenchymal cells, whereas after 4 days of culture, the majority of Smurf1 was expressed in epithelium even though Smurf1 mesenchymal expression was still detectable. Similarly, endogenous Smurf1 expression in E14.5 embryonic lung was mainly detected in some of the epithelial cells. Furthermore, endogenous Smurf1 expression in P1 neonatal lung was widespread in most pulmonary cells, but a higher intensity of expression was observed in bronchiolar epithelial cells (Fig. 1B).



View larger version (94K):
[in this window]
[in a new window]
 
Fig. 1. Temporo-spatial expression patterns of Smad ubiquitin regulatory factor (Smurf) 1 in mouse embryonic lungs. A: Smurf1 mRNA expression in mouse embryonic lungs at different embryonic stages was measured by quantitative real-time PCR and is presented as the relative ratio to the level of Smurf1 mRNA at embryonic day (E) 11. B: cellular localizations of Smurf1 protein in different developmental stages were determined by immunohistochemistry. The majority of Smurf1-positive staining was detected in a small number of mesenchymal cells (arrows) in E11.5 mouse embryonic lung. After 1-day culture (E11.5+1), Smurf1 was expressed equally in both epithelium (arrowheads) and mesenchyme. Furthermore, Smurf1 was mainly detected in the epithelium of the lung explants after 4-day culture (E11.5+4). Similarly, Smurf1 expression was mainly detected in the epithelium of E14.5 mouse lung (E14.5). The expression of Smurf1 in postnatal lung [postnatal day (P) 1] was also detected in most pulmonary cells, but a higher intensity of Smurf1 immunostaining in bronchiolar epithelium was observed. Normal serum was used as a negative control (Neg Ctrl). Scale bar: 50 µm.

 

Overexpression of Smurf1 inhibits lung branching morphogenesis. As Smurf1 is a negative regulator of the BMP/TGF-{beta} signaling, its functional role during lung branching morphogenesis was determined in our mouse embryonic lung explant culture system. To study its function, a Smurf1-expressing recombinant adenoviral vector (AdSmurf1) with GFP coexpression was constructed, and expression of the exogenous Smurf1 protein by AdSmurf1 was confirmed in cultured COS-1 cells. Overexpression of Smurf1 in airway epithelial cells of E11.5 mouse embryonic lung explants was achieved by intratracheal microinjection of AdSmurf1 before organ culture (21, 27). An empty viral vector (AdGFP) was used as a control. As shown in Fig. 2A, exogenous human HA-tagged Smurf1 was expressed in mouse lung explants as verified by RT-PCR and anti-HA Western blotting. At the end of 4-day culture, the overall size and the number of peripheral airway branches were determined. The lung explants with Smurf1 overexpression were reduced in size compared with the control (Fig. 2B). The number of terminal branches in Smurf1 overexpressing samples was significantly reduced by ~30% (P < 0.05) compared with that in controls (Fig. 2C).



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 2. Reduced branching morphogenesis of cultured mouse embryonic lungs in the presence of exogenous Smurf1 overexpression. A: exogenous human Smurf1 overexpression in cultured mouse embryonic lung explants. The influenza hemagglutinin (HA)-epitope tagged exogenous Smurf1 expression (AdSmurf1) in mouse embryonic lung explants was confirmed by RT-PCR using a pair of human Smurf1-specific primers and by an anti-HA Western blot. An empty adenoviral vector (AdGFP) was used as a negative control. B: 4-day cultured embryonic lung explants in the following different conditions: BGJb medium control (MC), adenoviral empty vector control (AdGFP), exogenous Smurf1 overexpression using a recombinant adenoviral vector (AdSmurf1), exogenous Smurf1 overexpression accompanying with soluble bone morphogenetic protein (BMP) 4 ligand addition into the medium (100 ng/ml), or a combination of both exogenous Smurf1 and Smad1 overexpression using recombinant adenoviral vectors. All pictures were photographed at the same magnification. Scale bar: 200 µm. C: comparison of the number of the peripheral epithelial sacs in cultured lung explants, presented as the percentage of the terminal branches in MC. There was no significant difference between MC (100 ± 7%) and AdGFP (95 ± 5%). However, significant reduction of terminal branches was noted in AdSmurf1 (67 ± 8%). Addition of BMP4 ligand into the medium or coexpression of Smad1 in the presence of Smurf1 overexpression partially and significantly rescued the Smurf1-mediated inhibitory effect on terminal branching (AdSmurf1+BMP4, 89 ± 8%; AdSmurf1+AdSmad1, 90 ± 7%). D: comparison of lung epithelial branching in different conditions. Overexpression of Smurf1 did not affect the TGF-{beta}1-induced inhibitory lung branching. Also, coexpression of Smad8 was unable to reverse the Smurf1-induced inhibitory effect on lung branching morphogenesis. TGF, transforming growth factor. *P < 0.05.

 

Smurf1 is known to be an E3 ubiquitin ligase targeting Smad degradation in the BMP4 pathway (28). We therefore tested the specificity of Smurf1 function, either by adding BMP4 ligand (100 ng/ml) into the culture medium or by coexpressing Smad1 with Smurf1 in the same lung explants. Interestingly, both approaches partially rescued the inhibitory phenotype of lung growth arising from Smurf1 overexpression. The number of terminal branches of the cultured embryonic lungs with Smurf1 overexpression was reduced only by 10-15% in the presence of BMP4 or Smad1 coexpression, compared with a 30% reduction with Smurf1 expression alone (Fig. 2C). In contrast, overexpression of Smurf1 in the presence of TGF-{beta}1 (20 ng/ml) did not affect the TGF-{beta}1-induced inhibitory lung branching morphogenesis that was previously reported (Fig. 2D), although Smurf1 has been reported to enhance TGF-{beta} receptor protein degradation in cultured cells (5). Also, coexpression of another BMP-specific Smad8 with Smurf1 was not able to rescue the inhibitory effect of Smurf1 on lung branching morphogenesis (Fig. 2D).

Decreased cell proliferation and peripheral epithelial differentiation in cultured lung with Smurf1 overexpression. Cell proliferation and differentiation were compared between the cultured lungs under different conditions. The proliferating cells were detected by PCNA immunostaining. In the cultured lungs with Smurf1 overexpression, cell proliferation was reduced to 13.1 ± 2.5% in epithelial cells and 6.6 ± 1.8% in mesenchymal cells, whereas 27.1 ± 3.0% PCNA-positive epithelial cells and 23.5 ± 3.6% PCNA-positive mesenchymal cells were detected in the control lungs (P < 0.05, Fig. 3A). To evaluate the epithelial cell differentiation of the cultured lung under different conditions, the mRNA levels of surfactant protein (SP)-C and Clara cell protein 10 (CC10), markers for peripheral epithelial cells and bronchial Clara cells, respectively, were quantified by quantitative real-time PCR. Overexpression of Smurf1 dramatically inhibited epithelial cell differentiation, as shown by 11.5-fold reduction of SP-C mRNA and 5.9-fold reduction of CC10 mRNA expression compared with medium control sample (Fig. 3B). Interestingly, addition of BMP4 into the culture medium of Smurf1-overexpressing lung explants fully restored the CC10 mRNA level but only partially restored SP-C mRNA level compared with medium control. On the other hand, coexpression of Smad1 with Smurf1 totally restored SP-C mRNA expression and only partially restored CC10 expression compared with the medium control samples.



View larger version (35K):
[in this window]
[in a new window]
 
Fig. 3. Smurf1 overexpression significantly reduced cell proliferation and differentiation in cultured mouse embryonic lung explants. A: proliferating cells were detected by PCNA immunostaining, and the PCNA indexes for epithelial and mesenchymal cells in Smurf1-overexpressing lung explants (AdSmurf1, 13.1 ± 2.5 and 6.6 ± 1.8%) were significantly reduced compared with in medium control (MC, 27.1 ± 3.0 and 23.5 ± 3.6%; P < 0.05). However, addition of exogenous BMP4 (100 ng/ml) or coexpression of Smad1 in the lung explants with Smurf1 overexpression significantly, but not fully, rescued inhibited cell proliferation (AdSmurf1+BMP4: 18.4 ± 2.1 and 11.3 ± 3.5%, P < 0.05; AdSmurf1+AdSmad1: 18.1 ± 4.1 and 15.7 ± 3.7%, P < 0.05). B: airway epithelial cell differentiation was evaluated by detection of surfactant protein (SP)-C and Clara cell protein 10 (CC10) expression using quantitative real-time PCR. Overexpression of Smurf1 significantly reduced the expression of SP-C (11.5-fold reduction, P < 0.05) and CC10 (5.9-fold reduction, P < 0.05). Addition of exogenous BMP4 (100 ng/ml) into the medium of the lungs with Smurf1 overexpression (AdSmurf1+BMP4) fully restored the expression of CC10 to the normal control level but only partially rescued the expression of SP-C (1.8-fold reduction, P < 0.05). In contrast, coexpression of Smad1 with Smurf1 (AdSmurf1+Smad1) fully rescued SP-C expression but only partially restored CC10 expression level (1.3-fold reduction, P < 0.05).

 

Overexpression of Smurf1 in cultured embryonic lungs specifically reduced Smad1 and Smad5 protein levels. Because Smurf1 is an E3 ubiquitin ligase that facilitates ubiquitination of its specific target proteins, resulting in proteasome-mediated degradation, we then examined endogenous Smad protein levels in cultured mouse embryonic lung explants in the presence of exogenous Smurf1 overexpression. As shown in Fig. 4A, only Smad1 and Smad5 proteins, not Smad8, were specifically reduced in Smurf1-overexpressing lungs. Smad1 coexpression was verified by the same anti-Smad1 blot, detected as a band with slightly high-molecular-weight resulting from addition of a Flag epitope tag. Because the mRNA levels of Smad1, -5, and -8 were not changed as confirmed by RT-PCR (Fig. 4B), the reduction of Smad1 and Smad5 proteins was likely due to facilitated protein degradation as a consequence of increased Smurf1-mediated ubiquitination. However, the unchanged Smad8 protein level in cultured lung explants with exogenous Smurf1 overexpression in airway epithelium may also possibly result from different protein cellular localization.



View larger version (42K):
[in this window]
[in a new window]
 
Fig. 4. Overexpression of Smurf1 downregulated BMP-specific Smad1 and Smad5, but not Smad8, protein levels in cultured lung explants. A: total protein lysate was prepared from cultured embryonic lung explants under the following culture conditions: medium control (MC), Smurf1 overexpression (AdSmurf1), co-overexpression of Smurf1 and Smad1 (AdSmurf1+AdSmad1), and overexpression of Smurf1 plus exogenous BMP4 ligand (100 ng/ml) addition. Endogenous BMP-specific R-Smads were individually detected by anti-Smad1, -5, and -8 immunoblotting. Smad1 and Smad5 proteins in AdSmurf1 were significantly reduced compared with in MC, but no change of Smad8 protein level was detected between MC and AdSmurf1. *Overexpressed Flag-tagged exogenous Smad1 was detected as a separate band with slightly high-molecular-weight due to addition of a Flag epitope tag. B: mRNA expression levels of Smads were compared by RT-PCR. Smad1 mRNA expression was comparable in different samples except the one with exogenous Smad1 overexpression (AdSmurf1+AdSmad1), in which increased Smad1 mRNA level was detected. Smad5 and Smad8 mRNAs were equally expressed among different samples. Detection of {beta}-actin was used as a control.

 

To further determine the specificity of Smurf1-regulated BMP-specific Smad protein degradation, we coexpressed various combinations of recombinant Flag-epitope tagged BMP-specific R-Smad proteins with exogenous HA-epitope tagged Smurf1 in cultured A549 lung epithelial cells using recombinant adenoviral vectors. As shown by the anti-Flag Western blot, only Smad1 and Smad5 protein expression, but not Smad8, was reduced when exogenous Smurf1 was coexpressed (Fig. 5). The latter result was consistent with the data obtained from embryonic lung organ culture. Therefore, these data indicate that Smurf1 specifically regulates Smad1 and Smad5, but not Smad8, protein degradation in response to BMP4 during early embryonic lung branching morphogenesis. Smad8 is not the Smurf1 targeting protein; therefore, unchanged Smad8 protein level in the presence of exogenous Smurf1 in cultured lung explants did not result from different protein localization.



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 5. Reduction of BMP-specific Smad protein levels in the presence of Smurf1 overexpression in cultured lung epithelial cells. Smurf1 was coexpressed with Flag-tagged Smads (AdSmad1, AdSmad5, or AdSmad8) in lung epithelial cell line A549 using recombinant adenoviral vectors. HA-tagged exogenous Smurf1 overexpression was confirmed by anti-HA immunoblotting. Smad protein level was detected by anti-Flag immunoblotting. Overexpression of Smurf1 significantly reduced the protein levels of coexpressed Smad1 and Smad5, but not Smad8. Equal amount of lysate proteins loaded in each lane was confirmed by equal level of {beta}-actin protein in each sample.

 


    DISCUSSION
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
BMPs, particularly BMP4, have been identified as key growth factors during embryonic organogenesis (10). Previous studies indicate that BMP4 acts as a morphogen to stimulate early mouse embryonic lung branching morphogenesis in intact lung explant culture (2, 21). BMP-activated R-Smads are very important intracellular signaling molecules that transmit BMP signals from cell surface into the nucleus where they participate in the regulation of gene expression (17). Therefore, the expression levels of R-Smad proteins are one of the determinants of BMP signaling activities. The intracellular protein level is determined by the rates of protein synthesis vs. protein degradation, so that changes in either process would result in alteration of intracellular protein concentration and the related biological activity. Although the regulation of BMP-mediated signaling pathway has been extensively studied in monolayer cell cultures in vitro, mechanisms of BMP pathway regulation in intact organs are still incompletely understood. We have utilized the mouse embryonic lung organ culture model to explore the biological role of Smurf1, a key regulator for Smads, during early lung development.

Ubiquitination-mediated protein degradation involves two successive steps: 1) covalent attachment of multiple ubiquitin molecules to the target protein and 2) degradation of the ubiquitin-tagged protein by proteasome pathway. Conjugation of ubiquitin to the specific protein substrates requires a chain of enzymatic reactions, including ubiquitin-activating enzyme (E1), ubiquitin-conjugating enzyme (E2), and ubiquitin-protein ligase (E3). Of these, a particular E3-mediated specific protein-protein interaction targets the degrading protein (4). Smurf1 is a member of the Hect family of E3 ubiquitin ligases and interacts with BMP-specific R-Smads as well as TGF-{beta} inhibitory Smad7, resulting in the related Smad ubiquitination, degradation, and inactivation (5, 20, 28). Previous studies have indicated that Smurf1 might be involved in early organogenesis in Xenopus and Drosophila (20, 28). Therefore, it would be very interesting to know whether Smurf1 plays a similar role in mammalian organogenesis. To understand the biological function of Smurf1 during mouse lung development, we first determined the temporo-spatial expression pattern of Smurf1 in embryonic lungs. The mRNA level of Smurf1 expressed in total lung tissues rose along with embryonic lung development and maturation until P1, then a moderate level of Smurf1 mRNA expression in adult lung was maintained. This might indicate that BMP signaling pathway activity is strictly regulated in fetal lung development, when activated phospho-Smad1 is quickly degraded through a Smurf1-mediated proteasome pathway to terminate the triggered signaling activity. However, in the adult lung, BMP signaling activity is still required for normal structural homeostasis and respiratory function of the lung. Therefore, a moderate level of Smurf1 was needed to regulate Smad activity. Aberrant activity of BMP signaling pathway has been detected in several pulmonary diseases, such as nonsmall cell lung carcinoma and pulmonary hypertension (15, 16).

The localization of Smurf1 in early embryonic lungs was studied by immunohistochemistry. Although Smurf1-positive cells were mainly detected within mesenchyme in E11.5 embryonic lungs, Smurf1 protein was detected in many sparsely distributed airway epithelial cells, as well as in surrounding mesenchymal cells in 4-day cultured lung explants, where extensive peripheral epithelial branching occurs. This suggests that Smurf1 might be actively involved in the regulation of rapidly growing embryonic lungs. Endogenous Smurf1 expression was also mainly detected in epithelium of the embryonic lungs from E14.5 to P1 stages. The high expression in bronchiolar epithelium in the neonatal stage may suggest a role for Smurf1 in maintaining differential BMP-Smad activity along the proximal-distal axis of the airway.

The roles of BMP4 and its signaling pathway in early embryonic lung development are controversial since contradictory results have been obtained from different experimental models. In cultures of isolated lung epithelial tubes, addition of BMP4 inhibited epithelial cell proliferation and migration (24). However, exogenous BMP4 stimulated early epithelial branching morphogenesis in intact lung explant culture (2, 21). Herein, we have used the same lung explant culture model to study one of the BMP4-pathway negative regulators, Smurf1. Using a previously published approach (21), we achieved exogenous Smurf1 overexpression in airway epithelium by intratracheal microinjection of a recombinant adenoviral vector, although endogenous Smurf1 was expressed at a relatively low level in the airway epithelium of cultured lung explants. Consistent with our previous findings related to the stimulatory effect of BMP4 in lung branching morphogeneis, overexpression of Smurf1 significantly reduced lung epithelial branching morphogenesis in terms of the number of peripheral branches. Also, reduction of both epithelial and mesenchymal cell proliferation and maturation was observed in the lung explants overexpressing Smurf1, as shown by reduced PCNA index and reduced expression of SP-C and CC10, the markers for lung epithelial cell differentiation. This indicates that endogenous BMP4 signaling in epithelial cells is essential for normal embryonic lung growth in the presence of intact epithelialmesenchymal interaction. Reduced BMP signaling activity in epithelium may indirectly contribute to the decreased cell proliferation in both epithelium and mesenchyme by changing other epithelium-derived factors.

Co-overexpression of Smad1 with Smurf1 in epithelial cells was able to partially overcome the inhibitory effects on epithelial branching and cell proliferation imposed by overexpressed Smurf1, which indicates that the Smurf1-negative regulation occurs mainly through BMP-specific R-Smads. Interestingly, peripheral airway epithelial cell differentiation was fully restored, as shown by normal level of SP-C mRNA, but proximal epithelial cell differentiation, shown as CC10 mRNA level, was only partially restored. This suggests that the BMP4-Smad pathway in embryonic lung epithelial cells may be involved in regulating peripheral growth. On the other hand, addition of BMP4-soluble ligand into the culture medium partially rescued the inhibitory effect of overexpressed Smurf1, even though Smurf1 is supposed to attenuate BMP4 downstream signaling, and hence the blockage of BMP4 signal by Smurf1 would be predicted to be unaffected by the upstream ligand. There are several possible mechanistic explanations for this apparent paradox. One is that BMP4 is able to stimulate Smad-independent pathways, such as several mitogen-activated protein kinases, in addition to activating the Smad-mediated canonical BMP signaling pathway (14, 18). Therefore, excessive BMP4 ligand could still effectively stimulate cells, bypassing the Smad pathway in the situation wherein Smad signaling was blocked by overexpression of the negative regulator Smurf1. Another possibility is that exogenous BMP4 stimulates mesenchymal cells through the Smad signaling, since exogenous Smurf1 was overexpressed only in epithelial cells. As a result, activated mesenchymal cells could produce many other paracrine growth factors to affect epithelial cell growth indirectly. Therefore, stimulation of epithelial branching morphogenesis by exogenous BMP4 in lung explant culture may be mediated by the integration of direct epithelial cell proliferation, as well as indirect mesenchymal cell-mediated growth. Moreover, exogenous BMP4 only partially restored peripheral epithelial cell marker SP-C mRNA level, yet it fully restored proximal epithelial cell marker CC10 mRNA level, supporting the observation that the BMP4-Smad pathway is involved in lung proximal-distal axis formation in lung epithelial cells (25).

As previously reported, Smurf1 is able to interact with Smad1 and Smad5 and mediates their ubiquitination and degradation (28). The specificity of Smurf1-catalyzed BMP RSmad degradation in epithelial cells of embryonic lung explants was also examined in our study. As detected by Western blot, overexpression of Smurf1 in airway epithelium of the lung explants reduced Smad1 and Smad5, but not Smad8, protein levels. This suggests that Smurf1 may specifically facilitate endogenous Smad1 and Smad5, but not Smad8, degradation in lung epithelial cells, as Smurf1 has proven to act as an ubiquitin ligase in ubiquitin-mediated protein degrading process (24).

The specificity of Smurf1-mediated BMP R-Smad degradation might result from differential cellular localization of Smad1, -5, and -8. Therefore, we coexpressed Smurf1 with one of the BMP R-Smads in cultured lung epithelial cells (A549 cell line) using the same recombinant adenoviral expression vectors as used in our organ culture. Interestingly, only Smad1 and Smad5, but not Smad8, showed Smurf1-mediated protein level reduction in this simple cell culture system. Also, coexpression of Smad8 with Smurf1 in lung epithelium was unable to reverse the Smurf1-induced inhibitory effect on lung epithelial branching in our lung organ culture experiment. Therefore, differential specificity exists for interaction between Smurf1 and BMP R-Smads, which subsequently catalyze specific Smad protein ubiquitination and degradation. As previous studies have shown, the sequence PPAY (residues 223-227) in the linker region of Smad1 and Smad5 mediates interaction with the WW domain in the Smurf1 protein (28). However, there is no PPXY conserved sequence motif in the Smad8 protein linker region. This may explain why no Smad8 protein degradation was detected in the presence of Smurf1 overexpression.

Finally, early mouse lung branching morphogenesis is coordinately regulated by many growth factors and related pathways, such as Sonic hedgehog, BMP, TGF-{beta}, and FGF (3, 22). Although Smurf1 was previously reported to promote nuclear Smad7 ubiquitination and degradation, resulting in enhanced TGF-{beta} pathway signaling (7), we found that overexpression of Smurf1 had no impact on the TGF-{beta}1-mediated inhibitory effect on lung branching morphogenesis. This suggests that Smurf1 is a specific negative regulator only for the BMP4 signaling pathway during early embryonic lung development. Therefore, we conclude that Smurf1 only behaves as a specific BMP R-Smad-restricted E3 ubiquitin ligase during early lung development, which facilitates protein turnover of Smad1 and Smad5, thereby regulating the BMP specific signaling pathway, rather than behaving as a broad-spectrum protein ubiquitin ligase.


    ACKNOWLEDGMENTS
 
We thank Dr. Makiko Fujii for kindly providing Smad1 and Smad5 adenoviral vectors.

GRANTS

This study is supported by National Heart, Lung, and Blood Institute Grants HL-61286, HL-68597 (W. Shi), HL-44060, HL-44977, HL-60231 (D. Warburton), American Lung Association Research Training Grants (W. Shi), and a Children's Hospital Los Angeles Research Institute Career Development Award (W. Shi).


    FOOTNOTES
 

Address for reprint requests and other correspondence: W. Shi, Developmental Biology Program, Dept. of Surgery, Children's Hospital Los Angeles, 4650 Sunset Blvd., MS 35, Los Angeles, CA 90027 (E-mail: wshi{at}chla.usc.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Bellusci S, Henderson R, Winnier G, Oikawa T, and Hogan BL. Evidence from normal expression and targeted misexpression that bone morphogenetic protein (Bmp-4) plays a role in mouse embryonic lung morphogenesis. Development 122: 1693-1702, 1996.[Abstract]
  2. Bragg AD, Moses HL, and Serra R. Signaling to the epithelium is not sufficient to mediate all of the effects of transforming growth factor beta and bone morphogenetic protein 4 on murine embryonic lung development. Mech Dev 109: 13-26, 2001.[CrossRef][Web of Science][Medline]
  3. Chinoy MR. Lung growth and development. Front Biosci 8: d392-d415, 2003.[Web of Science][Medline]
  4. Ciechanover A. The ubiquitin-proteasome pathway: on protein death and cell life. EMBO J 17: 7151-7160, 1998.[CrossRef][Web of Science][Medline]
  5. Ebisawa T, Fukuchi M, Murakami G, Chiba T, Tanaka K, Imamura T, and Miyazono K. Smurf1 interacts with transforming growth factor-beta type I receptor through Smad7 and induces receptor degradation. J Biol Chem 276: 12477-12480, 2001.[Abstract/Free Full Text]
  6. Fujii M, Takeda K, Imamura T, Aoki H, Sampath TK, Enomoto S, Kawabata M, Kato M, Ichijo H, and Miyazono K. Roles of bone morphogenetic protein type I receptors and Smad proteins in osteoblast and chondroblast differentiation. Mol Biol Cell 10: 3801-3813, 1999.[Abstract/Free Full Text]
  7. Gronroos E, Hellman U, Heldin CH, and Ericsson J. Control of Smad7 stability by competition between acetylation and ubiquitination. Mol Cell 10: 483-493, 2002.[CrossRef][Web of Science][Medline]
  8. Have-Opbroek AA. Lung development in the mouse embryo. Exp Lung Res 17: 111-130, 1991.[Web of Science][Medline]
  9. He TC, Zhou S, da Costa LT, Yu J, Kinzler KW, and Vogelstein B. A simplified system for generating recombinant adenoviruses. Proc Natl Acad Sci USA 95: 2509-2514, 1998.[Abstract/Free Full Text]
  10. Hogan BL. Bone morphogenetic proteins in development. Curr Opin Genet Dev 6: 432-438, 1996.[CrossRef][Web of Science][Medline]
  11. Hogan BL. Morphogenesis. Cell 96: 225-233, 1999.[CrossRef][Web of Science][Medline]
  12. Hogan BL, Grindley J, Bellusci S, Dunn NR, Emoto H, and Itoh N. Branching morphogenesis of the lung: new models for a classical problem. Cold Spring Harb Symp Quant Biol 62: 249-256, 1997.[Abstract/Free Full Text]
  13. Jaskoll TF, Don-Wheeler G, Johnson R, and Slavkin HC. Embryonic mouse lung morphogenesis and type II cytodifferentiation in serumless, chemically defined medium using prolonged in vitro cultures. Cell Differ 24: 105-117, 1988.[CrossRef][Web of Science][Medline]
  14. Kozawa O, Hatakeyama D, and Uematsu T. Divergent regulation by p44/p42 MAP kinase and p38 MAP kinase of bone morphogenetic protein-4-stimulated osteocalcin synthesis in osteoblasts. J Cell Biochem 84: 583-589, 2002.[CrossRef][Web of Science][Medline]
  15. Lane KB, Machado RD, Pauciulo MW, Thomson JR, Phillips JA III, Loyd JE, Nichols WC, and Trembath RC. Heterozygous germline mutations in BMPR2, encoding a TGF-beta receptor, cause familial primary pulmonary hypertension. The International PPH Consortium. Nat Genet 26: 81-84, 2000.[CrossRef][Web of Science][Medline]
  16. Langenfeld EM, Calvano SE, About-Nukta F, Lowry SF, Amenta P, and Langenfeld J. The mature bone morphogenetic protein-2 is aberrantly expressed in non-small cell lung carcinomas and stimulates tumor growth of A549 cells. Carcinogenesis 24: 1445-1454, 2003.[Abstract/Free Full Text]
  17. Massague J and Chen YG. Controlling TGF-beta signaling. Genes Dev 14: 627-644, 2000.[Free Full Text]
  18. Monzen K, Shiojima I, Hiroi Y, Kudoh S, Oka T, Takimoto E, Hayashi D, Hosoda T, Habara-Ohkubo A, Nakaoka T, Fujita T, Yazaki Y, and Komuro I. Bone morphogenetic proteins induce cardiomyocyte differentiation through the mitogen-activated protein kinase kinase kinase TAK1 and cardiac transcription factors Csx/Nkx-2.5 and GATA-4. Mol Cell Biol 19: 7096-7105, 1999.[Abstract/Free Full Text]
  19. Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29: e45, 2001.[Abstract/Free Full Text]
  20. Podos SD, Hanson KK, Wang YC, and Ferguson EL. The DSmurf ubiquitin-protein ligase restricts BMP signaling spatially and temporally during Drosophila embryogenesis. Dev Cell 1: 567-578, 2001.[CrossRef][Web of Science][Medline]
  21. Shi W, Zhao J, Anderson KD, and Warburton D. Gremlin negatively modulates BMP-4 induction of embryonic mouse lung branching morphogenesis. Am J Physiol Lung Cell Mol Physiol 280: L1030-L1039, 2001.[Abstract/Free Full Text]
  22. Warburton D, Bellusci S, Del Moral PM, Kaartinen V, Lee M, Tefft D, and Shi W. Growth factor signaling in lung morphogenetic centers: automaticity, stereotypy and symmetry. Respir Res 4: 5, 2003.[CrossRef][Medline]
  23. Warburton D, Schwarz M, Tefft D, Flores-Delgado G, Anderson KD, and Cardoso WV. The molecular basis of lung morphogenesis. Mech Dev 92: 55-81, 2000.[CrossRef][Web of Science][Medline]
  24. Weaver M, Dunn NR, and Hogan BL. Bmp4 and Fgf10 play opposing roles during lung bud morphogenesis. Development 127: 2695-2704, 2000.[Abstract]
  25. Weaver M, Yingling JM, Dunn NR, Bellusci S, and Hogan BL. Bmp signaling regulates proximal-distal differentiation of endoderm in mouse lung development. Development 126: 4005-4015, 1999.[Abstract]
  26. Zhao J, Shi W, Chen H, and Warburton D. Smad7 and Smad6 differentially modulate transforming growth factor beta -induced inhibition of embryonic lung morphogenesis. J Biol Chem 275: 23992-23997, 2000.[Abstract/Free Full Text]
  27. Zhao J, Sime PJ, Bringas P Jr, Gauldie J, and Warburton D. Epithelium-specific adenoviral transfer of a dominant-negative mutant TGF-beta type II receptor stimulates embryonic lung branching morphogenesis in culture and potentiates EGF and PDGF-AA. Mech Dev 72: 89-100, 1998.[CrossRef][Web of Science][Medline]
  28. Zhu H, Kavsak P, Abdollah S, Wrana JL, and Thomsen GH. A SMAD ubiquitin ligase targets the BMP pathway and affects embryonic pattern formation. Nature 400: 687-693, 1999.[CrossRef][Medline]



This article has been cited by other articles:


Home page
J Am Coll CardiolHome page
N. W. Morrell, S. Adnot, S. L. Archer, J. Dupuis, P. Lloyd Jones, M. R. MacLean, I. F. McMurtry, K. R. Stenmark, P. A. Thistlethwaite, N. Weissmann, et al.
Cellular and molecular basis of pulmonary arterial hypertension.
J. Am. Coll. Cardiol., June 30, 2009; 54(1 Suppl): S20 - S31.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Kotorashvili, S. J. Russo, S. Mulugeta, S. Guttentag, and M. F. Beers
Anterograde Transport of Surfactant Protein C Proprotein to Distal Processing Compartments Requires PPDY-mediated Association with Nedd4 Ubiquitin Ligases
J. Biol. Chem., June 12, 2009; 284(24): 16667 - 16678.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
M. K. Steiner, O. L. Syrkina, N. Kolliputi, E. J. Mark, C. A. Hales, and A. B. Waxman
Interleukin-6 Overexpression Induces Pulmonary Hypertension
Circ. Res., January 30, 2009; 104(2): 236 - 244.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
E. Glasgow and L. Mishra
Transforming growth factor-{beta} signaling and ubiquitinators in cancer
Endocr. Relat. Cancer, March 1, 2008; 15(1): 59 - 72.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
L. Whyte, Y.-Y. Huang, K. Torres, and R. G. Mehta
Molecular Mechanisms of Resveratrol Action in Lung Cancer Cells Using Dual Protein and Microarray Analyses
Cancer Res., December 15, 2007; 67(24): 12007 - 12017.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
Y. Maeda, V. Dave, and J. A. Whitsett
Transcriptional Control of Lung Morphogenesis
Physiol Rev, January 1, 2007; 87(1): 219 - 244.
[Abstract] [Full Text] [PDF]


Home page
Proc Am Thorac SocHome page
N. W. Morrell
Pulmonary Hypertension Due to BMPR2 Mutation: A New Paradigm for Tissue Remodeling?
Proceedings of the ATS, November 1, 2006; 3(8): 680 - 686.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
C. Chen, H. Chen, J. Sun, P. Bringas Jr., Y. Chen, D. Warburton, and W. Shi
Smad1 expression and function during mouse embryonic lung branching morphogenesis
Am J Physiol Lung Cell Mol Physiol, June 1, 2005; 288(6): L1033 - L1039.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
H. Beppu, F. Ichinose, N. Kawai, R. C. Jones, P. B. Yu, W. M. Zapol, K. Miyazono, E. Li, and K. D. Bloch
BMPR-II heterozygous mice have mild pulmonary hypertension and an impaired pulmonary vascular remodeling response to prolonged hypoxia
Am J Physiol Lung Cell Mol Physiol, December 1, 2004; 287(6): L1241 - L1247.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (20)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shi, W.
Right arrow Articles by Warburton, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shi, W.
Right arrow Articles by Warburton, D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2004 by the American Physiological Society.