|
|
||||||||
Division of Neonatology, Department of Pediatrics, University of Pennsylvania School of Medicine, Children's Hospital of Philadelphia, Philadelphia, Pennsylvania 19104-4318
Submitted 5 September 2003 ; accepted in final form 14 October 2003
| ABSTRACT |
|---|
|
|
|---|
pepsinogen C; alveolar type 2 cell; cell differentiation
In studying the differentiation of the alveolar epithelium, many of these markers are inadequate to establish the temporal sequence of early events. Expression of some markers by Clara cells, as in SP-A and -B, in small airways limits their usefulness in marking alveolar epithelial events. In addition, there is discordance between the onset of RNA expression and mature protein expression, as in the hydrophobic proteins SP-B and -C. SP-B and -C mRNA are expressed early in human lung development, whereas the mature protein products are not detectable until the late second and early third trimester of human gestation. With the use of currently available markers, it is well-established that increased SP-B RNA expression, SP-B processing to produce mature SP-B, lamellar body formation, and the completion of SP-C processing occur sequentially during type 2 cell differentiation. In human infants with inherited SP-B deficiency (6), mice with inactivation of the SP-B gene (5), and isolated alveolar epithelial cells treated with antisense to SP-B (10), lamellar body genesis is perturbed. This is dependent on the production of mature SP-B, since lamellar body genesis is also altered in alveolar epithelial cells treated with a cysteine protease inhibitor (E-64) that blocks SP-B proteolytic processing (13). In each of these cases, the absence of 8-kDa SP-B results in abnormal type 2 cell phenotype and the abnormal processing of SP-C. Therefore, one of the earliest identifiable events in type 2 cell differentiation is SP-B proteolytic processing.
In a recent report describing an in vitro model of type 2 cell differentiation (11), we showed that pepsinogen C, also known as pepsinogen II or gastricsin (EC 3.4.23.3 [EC] ), was induced under culture conditions that promote a type 2 cell phenotype. In this report, we show that pepsinogen C is indeed a type 2 cell-specific product in the lung and, unlike SP-B, is absent from Clara cells. Pepsinogen C exhibits tight developmental regulation in vivo during human gestation and in our model of type 2 cell differentiation. Furthermore, we show that pepsinogen C is rapidly downregulated in type 2 cells allowed to dedifferentiate, taking on type 1 cell characteristics. These data show that pepsinogen C is a novel marker of type 2 cells with advantages over many of the current markers used to identify type 2 cells in the developing lung.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Antisera used in these studies included rabbit polyclonal antisera to mature human SP-B (14), sheep polyclonal antibody to human pepsinogen C (Abcam, Cambridge, UK), and mouse monoclonal antibodies to GAPDH (Chemicon, St. Louis, MO) and plasminogen activator inhibitor (PAI-1; BD Transduction Laboratories, Lexington, KY). Species-specific, horseradish peroxidase-conjugated secondary antisera for immunoblotting were obtained from Jackson ImmunoResearch Laboratories (West Grove, PA).
Lung explant and primary cell culture. Human fetal lung from second-trimester therapeutic abortions (1423 wk estimated gestational age) were obtained under protocols approved by the Committee for Human Research, Children's Hospital of Philadelphia. Postmortem samples from infants delivered in the third trimester who died within 24 h after birth and lung transplantation donor tissues were available through NIH SCOR HL-56401 (Pathobiology of Lung Development and Bronchopulmonary Dysplasia), which was approved by the Committee for Human Research, Children's Hospital of Philadelphia.
Fetal lung parenchyma was dissected free of large airways, chopped into 1-mm3 explants, and cultured in Waymouth media on a rocking platform, as previously described, for up to 5 days (12). Undifferentiated epithelial cells were isolated from explants before culture by digestion with trypsin, collagenase, and DNase followed by panning on plastic culture dishes to remove adherent fibroblasts, as described previously. Cells were then cultured for up to 7 days in 10 nM dexamethasone, 0.1 mM 8-BrcAMP, and 0.1 mM IBMX in 95% air-5% CO2 to induce type 2 cell differentiation (11). To promote dedifferentiation of type 2 cells, cells cultured for 4 days in the presence of IBMX were subsequently cultured for an additional 4 days in Waymouth media alone before obtaining cell pellets.
Multiplex RT-PCR. RNA was prepared using RNA STAT (Tel-Test, Friendswood, TX) per the manufacturer's instructions. Purity was confirmed by the ratio of optical density at 260 nm to 280 nm. Samples were then treated with RQ1 RNase-free DNase (Promega, Madison, WI) and ethanol precipitated after phenol-chloroform extraction. cDNA was synthesized from RNA samples using the Super-Script First-Strand RT-PCR kit (Life Technologies) using the manufacturer's instructions. Final concentrations of the specific primers (SP-B, pepsinogen C) were 0.5 µM and for GAPDH 0.1 µM. The following primers were used for RT-PCR: SP-B forward, 5'-AGGACATCGTCCACATCCTT-3' and SP-B reverse, 5'-GAGCAGGATGACGGAGTAGC-3' with an amplicon length of 556 corresponding to bases 218774 of the human SP-B mRNA sequence (GenBank reference NM_000542 [GenBank] ); pepsinogen C forward, 5'-AGTACCGCTTTGGTGAGCTC-3' and reverse, 5'-TACAGGCTGCTATCCACACC-3' with an amplicon length of 546 corresponding to bases 208754 of the human pepsinogen C mRNA sequence (GenBank reference NM_002630 [GenBank] ); GAPDH forward, 5'-ACCACAGTCCATGCCATCAC-3' and GAPDH reverse, 5'-TCCACCACCCTGTTGCTGTA-3' with an amplicon length of 451 corresponding to bases 6011052 of the human GAPDH mRNA sequence (GenBank reference NM_002046 [GenBank] ). Each PCR product was sequenced by the Nucleic Acid and Protein Core Facility of the Children's Hospital of Philadelphia, and the sequence was confirmed by BLAST search. PCR was performed on 1 µg cDNA with PCR conditions of 94°C for 5 min (94°C for 30 s, annealing temperature 57°C for SP-B/GAPDH and 55°C for antisense SP-B/GAPDH for 30 s, 72°C for 30 s) for 30 cycles and 72°C for 10 min. Cycle number was determined to be in the linear response range for each amplicon. Samples of the final reaction (5 µl) were run on 2% agarose gels with ethidium bromide, and ultraviolet images were obtained using a Kodak Digital Science Imaging System 1D 2.0.2 (New Haven, CT). Images were scanned and quantified using MacBas v2.4 software (Fuji Photo Film, Tokyo, Japan) and analyzed by ANOVA with SPSS Software (SPSS v11.0; SPSS, Chicago, IL).
Real-time RT-PCR. Real-time PCR reactions using a singleplex format were performed using an ABI Prism 7000 (Applied Biosystems, Foster City, CA). The two-step PCR protocol involved 2 min at 50°C and 10 min at 95°C followed by (95°C for 15 s, 60°C for 1 min) x40 cycles. The 2-min, 50°C step is required for optimal AmpErase UNG activity when using TaqMan Universal PCR Master Mix (Applied Biosystems). The reactions contained 1x Assay-on-Demand Gene Expression Assay Mix (Applied Biosystems), 1x TaqMan Universal PCR Master Mix, and cDNA diluted in RNase-free water in 25 µl total reaction volume. Assay-on-Demand Gene Expression Assay Mix contains both the forward and reverse primers plus MGB Eclipse probe. Fluorescence intensity was recorded during the annealing step of each cycle of the reaction. The following primer and probe sets as found in the Applied Biosystems web site (http://www.allgenes.com) were used for these studies: SP-B Hs00167036, pepsinogen C Hs00160052, and GAPDH Hs99999905. The primer and probe sequences are proprietary, but contextual sequences in each gene are as follows: SP-B GCCATGATTCCCAAGGGTGCGCTAC (exon 67 junction with midpoint at base 670 of GenBank sequence NM_000542 [GenBank] ), pepsinogen C CAGTGGTCAAAGTGCCCCTGAAGAA (exon 12 junction with midpoint at base 112 of GenBank sequence NM_002630 [GenBank] ), and GAPDH GGGCGCCTGGTCACCAGGGCTGCTT (exon 3 with midpoint at base 130 of GenBank sequence NM_002046 [GenBank] ). The assays were determined to be in the linear amplification range using cDNA standards derived from RNA from type 2 cells treated for 5 days in hormones to allow for comparisons both within and between experiments.
Western immunoblotting. Western immunoblotting was accomplished using previously described procedures (14), using NuPAGE Bis-Tris gels with MES Running Buffer (Invitrogen) and transferring as per the manufacturer's protocol to Duralose membranes (Stratagene, La Jolla, CA). Immunoblots were developed using Pierce SuperSignal West Pico Chemiluminescent Substrate (Pierce, Rockford, IL).
Immunostaining. Paraffin sections of lung tissues were deparaffined and permeabilized in a series of graded alcohols. Nonspecific staining was inhibited by blocking in 1.5% nonimmune goat serum in Trisbuffered saline (TBS). Slides were incubated overnight at 4°C in primary antisera to SP-B (1:500) or pepsinogen C (1:2,000) in 0.01 M TBS/1.5% blocking serum, or in rabbit or sheep IgG at a similar dilution. Slides were incubated with biotinylated goat anti-rabbit or goat anti-sheep IgG for 1 h at room temperature, followed by blocking endogenous peroxidase activity with 0.6% H2O2 in methanol. Avidinbiotin complex was prepared using the Vectastain ABC kit (Vector Laboratories, Burlingame, CA), and the slides were color-developed using diaminobenzidine hydrochloride. Slides were then counterstained with methyl green and coverslips applied. Slides were examined with an Olympus 1X70 microscope and Metamorph imaging system (Universal Imaging, West Chester, PA).
In situ hybridization. Nonisotopic in situ hybridization on paraffin sections was performed using a variation of previously published methods (22). Adult, neonatal, and fetal lung, both before and after explant culture, were obtained and processed for paraffin sections as described previously. Sections (10 µm) were cut and picked up on polylysine (Sigma)-coated slides. After deparaffinizing, the sections were fixed in 4% paraformaldehyde, treated with Proteinase K, and then refixed in 4% paraformaldehyde, acetylated, and dehydrated. Pepsinogen C antisense probe was prepared using the Dig RNA Labeling kit (Roche, Indianapolis, IN), producing a 1,200-base cRNA product using RNA polymerase T7 and linearized TA plasmid containing the pepsinogen C cDNA. A sense probe was made in a similar fashion using RNA polymerase Sp6. DIG-labeled probe (2.5 µg) was diluted in 1 ml hybridization solution. Probe mixture (100 µl) was placed on each slide, and the slides were incubated overnight at 70°C without coverslips in an In Slide Out hybridization oven (Boekel, Feasterville, PA). After hybridization, slides were washed briefly in 5x SSC. They were then washed in high-stringency wash solution and treated with RNase A. After further washing, the slides were blocked with 1% Blocking Reagent (Roche) and incubated overnight at 4°C with alkaline phosphatase-coupled sheep anti-digoxigenin Fab fragments (Roche) diluted 1:5,000 in 1% Blocking Reagent in 1x PBS-0.1% Tween. Alkaline phosphatase activity was detected by incubation in 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium mixture. The color was allowed to develop in the dark at room temperature for 24 h. The slides were counterstained with methyl green, allowed to air-dry, and mounted with VectaMount (Vector Laboratories). Slides were examined with an Olympus 1X70 microscope and Metamorph imaging system (Universal Imaging).
| RESULTS |
|---|
|
|
|---|
22 wk gestation samples but was present in all postnatal and adult samples (Fig. 1A). By comparison, SP-B mRNA was present from 15 wk through 2122 wk in increasing amounts, as previously described (17), and in the postnatal and adult lung samples. Pepsinogen C protein was not detected in the second-trimester samples analyzed (Fig. 1B), whereas all postnatal and adult samples expressed pepsinogen C protein. As we have previously shown (14), pro-SP-B was detected in most of the second-trimester fetal lung samples (data not shown). However, mature 8-kDa SP-B was not demonstrated in the second-trimester samples and was seen only in the preterm, postnatal samples representative of third-trimester lung and in the adult samples analyzed.
|
Pepsinogen C expression during in vitro type 2 cell differentiation. We examined the expression of pepsinogen C in an in vitro model of type 2 cell differentiation (Fig. 2). Our previous studies using microarray analysis indicated that pepsinogen C was induced in this model (11). By RT-PCR, low-level pepsinogen C and SP-B mRNA, each <10% of peak levels, was detected in isolated lung epithelial cells before the addition of hormones (Fig. 2, A and B). Both pepsinogen C and SP-B mRNA increased within 24 h after the addition of hormones. Pepsinogen C mRNA peaked rapidly and remained stable over 4 days in culture, whereas SP-B mRNA increased steadily, reaching stable levels by 4 days in culture. Immunoblotting also revealed a rapid induction of pepsinogen C protein within 24 h of hormone induction (Fig. 2C). By comparison, although pro-SP-B was detected within 24 h of hormone induction (data not shown), mature SP-B was expressed at low levels after 24 h of hormones, increasing over 3 days in culture to stable levels, comparable to the increase in SP-B RNA.
|
Pepsinogen C localizes to type 2 cells but not Clara cells in human lung. To determine whether pepsinogen C was unique to type 2 cells in the mature lung, we performed immunostaining on second-trimester human fetal lung, lung explants cultured in IBMX, and samples of postnatal and adult lung tissue. As expected, pepsinogen C immunoreactivity was not seen in epithelial cells lining potential airspaces in preculture, second-trimester fetal lung (Fig. 3A), whereas there was some staining for SP-B (Fig. 3C), as previously described (2). Induction of type 2 cell differentiation by treating lung explants for 5 days in hormones resulted in robust expression of both pepsinogen C and SP-B in the epithelial cells of presumptive air spaces with immunoreactive material also seen secreted in the potential airspaces (Fig. 3, B and D).
|
In adult lung tissue (Fig. 4A), SP-B and pepsinogen C immunostaining identified alveolar type 2 cells, often at the intersection of alveolar walls. Pepsinogen C expression was not detected in type 1 epithelial cells, airway epithelial cells, endothelial cells, or fibroblasts within the lung parenchyma. Intracellular staining was seen only in type 2 cells. In situ hybridization of mature lung (Fig. 4B) using a 1,200-base antisense probe from the pepsinogen C cDNA also demonstrated endogenous pepsinogen C RNA only in type 2 epithelial cells. No hybridization was noted in the columnar epithelial cells lining airways.
|
Pepsinogen C expression is rapidly downregulated during in vitro dedifferentiation of type 2 cells. To further demonstrate the specificity of pepsinogen C expression, we withdrew hormones from alveolar epithelial cells allowed to differentiate into type 2 cells. This method has been used by others as a model for transdifferentiation of rat type 1 cells from freshly isolated type 2 cells (3, 4, 8, 9, 21). By real-time RT-PCR, SP-B and pepsinogen C mRNA decreased to 47% and 13%, respectively, within 24 h of the withdrawal of hormones from the cell culture media and continued to decrease over 4 days in the absence of hormones (Fig. 5A). By immunoblotting (Fig. 5B), pepsinogen C protein was undetectable within 24 h after withdrawing hormones, whereas SP-B protein decreased more slowly because of its retention within lamellar bodies. To confirm that these cells were indeed developing type 1 cell characteristics, we found that expression of PAI-1, recently described as type 1 cell-specific in a model of dedifferentiating rat type 2 cells (21), increased over the 4-day culture period.
|
| DISCUSSION |
|---|
|
|
|---|
Pepsinogen C (EC 3.4.23.3 [EC] ) is an aspartic protease produced primarily by the gastric chief cells. Unlike pepsinogen A, early studies showed that pepsinogen C was also produced at sites distant from the gut, specifically, the pancreas, prostate, seminal vesicle, and lung (20). Pepsinogen C was also found to be a marker of breast cancers, with a more favorable response to hormone-based chemotherapy (7, 24). This led to studies of the hormone responsiveness of a 1,438-base segment of the pepsinogen C promoter, which demonstrated a 15-bp hormoneresponsive element that resembles the consensus sequence for glucocorticoid, androgen, and progesterone receptors (1). Our observation that hormonal induction of type 2 cell phenotype during in vitro differentiation also results in pepsinogen C expression is consistent with these promoter studies. It will be interesting to further delineate the hormonal responsiveness of pepsinogen C, since expression is so tightly regulated compared with the regulation of SP-B and SP-C.
SP-B and SP-C have been used frequently to identify type 2 cells in mature lung. However, their utility in identifying the immediate precursor of the type 2 cell is limited. Expression of SP-B and SP-C mRNA begins as early as 1214 wk gestation in human fetal lung (17), increasing toward term such that SP-B mRNA approaches 50% and SP-C 25% of adult mRNA levels by the end of the second trimester. Although expression of the SP-B and -C proproteins is detectable by immunostaining by mid-second trimester (14, 23), mature SP-B is only detectable after 24 wk gestation (2). This complicates their usefulness for studying the regulation of type 2 cell differentiation because, although these markers can identify progenitor epithelial cells destined to become type 2 cells, they imprecisely identify the point at which a progenitor is first identifi-able as a type 2 cell. By comparison, pepsinogen C is very tightly regulated during this process. During the second trimester, as SP-B mRNA accumulates and pro-SP-B is expressed by the undifferentiated epithelial cells, pepsinogen C is not expressed. Although we were unable to present a complete ontogeny through human gestation, pepsinogen C is clearly expressed in representative samples from the third trimester. Moreover, our data using a reproducible in vitro model of type 2 cell differentiation support the in vivo ontogeny studies, indicating that pepsinogen C expression is an early event in the process of type 2 cell differentiation.
Another drawback of some current type 2 cell markers is expression in other pulmonary cell types. Unlike SP-C, which is both lung- and type 2 cell-specific, SP-A and SP-B are both expressed by Clara cells. Pepsinogen C, although expressed in other organs, is type 2 cell-specific in the lung. Furthermore, pepsinogen C mRNA and protein expression are rapidly downregulated during in vitro transdifferentiation of type 2 cells into cells expressing the type 1 cell marker PAI-1. SP-B mRNA is also rapidly downregulated during this process; however, protein levels can take several days to decline because of the stability of intracellular lamellar bodies. Together, the tightly controlled expression during type 2 cell differentiation, short half-life of pepsinogen C in the transition to a type 1 cell-like phenotype, and absence of pepsinogen C from type 1 cells and Clara cells in vivo make pepsinogen C an ideal marker of type 2 cells during lung development.
At this time, we can only speculate on the role of pepsinogen C in type 2 cells. Our prior studies indicate that SP-B proteolytic processing is developmentally regulated, which explains why mature 8-kDa SP-B is not detectable in second-trimester human fetal lung despite detectable pro-SP-B expression. As an aspartic protease, pepsinogen C is an attractive candidate protease for SP-B processing, since a cathepsin D-like aspartic protease was previously implicated in SP-B processing in type 2 cells (25). The expression pattern that we observed during in vitro differentiation of type 2 cells, with rapid, robust expression of pepsinogen C followed by gradual accumulation of mature SP-B, is also suggestive of a primary role for pepsinogen C in SP-B processing. Furthermore, Clara cells do not express pepsinogen C and also cannot process SP-B beyond a 25-kDa intermediate (18). Additional gain-of-function and loss-of-function studies on pepsinogen C will be required to clarify this association and are currently underway.
| ACKNOWLEDGMENTS |
|---|
C. Foster and A. Aktar contributed equally to this work.
GRANTS
These studies were supported by National Institutes of Health Grants HL-56401 and HL-59959 (to S. H. Guttentag) and HD-043245 (to C. Foster).
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
V. Starosta, R. Kitz, D. Hartl, V. Marcos, D. Reinhardt, and M. Griese Bronchoalveolar Pepsin, Bile Acids, Oxidation, and Inflammation in Children With Gastroesophageal Reflux Disease Chest, November 1, 2007; 132(5): 1557 - 1564. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Kolla, L. W. Gonzales, J. Gonzales, P. Wang, S. Angampalli, S. I. Feinstein, and P. L. Ballard Thyroid Transcription Factor in Differentiating Type II Cells: Regulation, Isoforms, and Target Genes Am. J. Respir. Cell Mol. Biol., February 1, 2007; 36(2): 213 - 225. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. McDevitt, L. W. Gonzales, R. C. Savani, and P. L. Ballard Role of endogenous TGF-beta in glucocorticoid-induced lung type II cell differentiation Am J Physiol Lung Cell Mol Physiol, January 1, 2007; 292(1): L249 - L257. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. C. Wade, S. H. Guttentag, L. W. Gonzales, K. L. Maschhoff, J. Gonzales, V. Kolla, S. Singhal, and P. L. Ballard Gene Induction during Differentiation of Human Pulmonary Type II Cells In Vitro Am. J. Respir. Cell Mol. Biol., June 1, 2006; 34(6): 727 - 737. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |