AJP - Lung Journal of Applied Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 286: L382-L387, 2004. First published October 24, 2003; doi:10.1152/ajplung.00310.2003
1040-0605/04 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
286/2/L382    most recent
00310.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Foster, C.
Right arrow Articles by Guttentag, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Foster, C.
Right arrow Articles by Guttentag, S.

Pepsinogen C: a type 2 cell-specific protease

Cherie Foster, Amana Aktar, Denel Kopf, Peggy Zhang, and Susan Guttentag

Division of Neonatology, Department of Pediatrics, University of Pennsylvania School of Medicine, Children's Hospital of Philadelphia, Philadelphia, Pennsylvania 19104-4318

Submitted 5 September 2003 ; accepted in final form 14 October 2003


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Pepsinogen C, also known as progastricsin or pepsinogen II, is an aspartic protease expressed primarily in gastric chief cells. Prior microarray studies of an in vitro model of type 2 cell differentiation indicated that pepsinogen C RNA was highly induced, comparable to surfactant protein RNA induction. Using second-trimester human fetal lung, third-trimester postnatal and adult lung, and a model of type 2 cell differentiation, we examined the specificity of pepsinogen C expression in lung. Pepsinogen C RNA and protein were only detected in >22 wk gestation samples of neonatal lung or in adult lung tissue. By immunohistochemistry and in situ hybridization, pepsinogen C expression was restricted to type 2 cells. Pepsinogen C expression was rapidly induced during type 2 cell differentiation and rapidly quenched with dedifferentiation of type 2 cells after withdrawal of hormones. In all samples, pepsinogen C expression occurred concomitantly with or in advance of processing of surfactant protein-B to its mature 8-kDa form. Our results indicate that pepsinogen C is a type 2 cell-specific marker that exhibits tight developmental regulation in vivo during human lung development, as well as during in vitro differentiation and dedifferentiation of type 2 cells.

pepsinogen C; alveolar type 2 cell; cell differentiation


NUMEROUS MARKERS OF alveolar type 2 cells have been used to study alveolar epithelial cell differentiation and the response of the epithelium to acute and chronic injury. The structural hallmark of the type 2 cell is the lamellar body, and its surfactant-specific products, the surfactant proteins, are commonly used to follow type 2 cell differentiation from less recognizable progenitor epithelial cells. Their utility is based on either absolute specificity of expression in type 2 cells, as in the case of surfactant protein (SP)-C, which is not expressed in any other organ, or specific association with type 2 cells in the lung in addition to more distant expression, as in the case of SP-A, -B, and -D, which are expressed by epithelia lining other mucosal surfaces in addition to the lung (15, 16, 19).

In studying the differentiation of the alveolar epithelium, many of these markers are inadequate to establish the temporal sequence of early events. Expression of some markers by Clara cells, as in SP-A and -B, in small airways limits their usefulness in marking alveolar epithelial events. In addition, there is discordance between the onset of RNA expression and mature protein expression, as in the hydrophobic proteins SP-B and -C. SP-B and -C mRNA are expressed early in human lung development, whereas the mature protein products are not detectable until the late second and early third trimester of human gestation. With the use of currently available markers, it is well-established that increased SP-B RNA expression, SP-B processing to produce mature SP-B, lamellar body formation, and the completion of SP-C processing occur sequentially during type 2 cell differentiation. In human infants with inherited SP-B deficiency (6), mice with inactivation of the SP-B gene (5), and isolated alveolar epithelial cells treated with antisense to SP-B (10), lamellar body genesis is perturbed. This is dependent on the production of mature SP-B, since lamellar body genesis is also altered in alveolar epithelial cells treated with a cysteine protease inhibitor (E-64) that blocks SP-B proteolytic processing (13). In each of these cases, the absence of 8-kDa SP-B results in abnormal type 2 cell phenotype and the abnormal processing of SP-C. Therefore, one of the earliest identifiable events in type 2 cell differentiation is SP-B proteolytic processing.

In a recent report describing an in vitro model of type 2 cell differentiation (11), we showed that pepsinogen C, also known as pepsinogen II or gastricsin (EC 3.4.23.3 [EC] ), was induced under culture conditions that promote a type 2 cell phenotype. In this report, we show that pepsinogen C is indeed a type 2 cell-specific product in the lung and, unlike SP-B, is absent from Clara cells. Pepsinogen C exhibits tight developmental regulation in vivo during human gestation and in our model of type 2 cell differentiation. Furthermore, we show that pepsinogen C is rapidly downregulated in type 2 cells allowed to dedifferentiate, taking on type 1 cell characteristics. These data show that pepsinogen C is a novel marker of type 2 cells with advantages over many of the current markers used to identify type 2 cells in the developing lung.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Reagents. Dexamethasone, isobutyl methylxanthine (IBMX), and 8-bromo-cAMP (8-BrcAMP) were obtained from Sigma Chemical (St. Louis, MO). All other reagents were electrophoretic grade and were purchased from either Bio-Rad Laboratories (Hercules, CA) or Invitrogen (Carlsbad, CA). Culture media were produced by the Cell Center Facility, University of Pennsylvania School of Medicine.

Antisera used in these studies included rabbit polyclonal antisera to mature human SP-B (14), sheep polyclonal antibody to human pepsinogen C (Abcam, Cambridge, UK), and mouse monoclonal antibodies to GAPDH (Chemicon, St. Louis, MO) and plasminogen activator inhibitor (PAI-1; BD Transduction Laboratories, Lexington, KY). Species-specific, horseradish peroxidase-conjugated secondary antisera for immunoblotting were obtained from Jackson ImmunoResearch Laboratories (West Grove, PA).

Lung explant and primary cell culture. Human fetal lung from second-trimester therapeutic abortions (14–23 wk estimated gestational age) were obtained under protocols approved by the Committee for Human Research, Children's Hospital of Philadelphia. Postmortem samples from infants delivered in the third trimester who died within 24 h after birth and lung transplantation donor tissues were available through NIH SCOR HL-56401 (Pathobiology of Lung Development and Bronchopulmonary Dysplasia), which was approved by the Committee for Human Research, Children's Hospital of Philadelphia.

Fetal lung parenchyma was dissected free of large airways, chopped into 1-mm3 explants, and cultured in Waymouth media on a rocking platform, as previously described, for up to 5 days (12). Undifferentiated epithelial cells were isolated from explants before culture by digestion with trypsin, collagenase, and DNase followed by panning on plastic culture dishes to remove adherent fibroblasts, as described previously. Cells were then cultured for up to 7 days in 10 nM dexamethasone, 0.1 mM 8-BrcAMP, and 0.1 mM IBMX in 95% air-5% CO2 to induce type 2 cell differentiation (11). To promote dedifferentiation of type 2 cells, cells cultured for 4 days in the presence of IBMX were subsequently cultured for an additional 4 days in Waymouth media alone before obtaining cell pellets.

Multiplex RT-PCR. RNA was prepared using RNA STAT (Tel-Test, Friendswood, TX) per the manufacturer's instructions. Purity was confirmed by the ratio of optical density at 260 nm to 280 nm. Samples were then treated with RQ1 RNase-free DNase (Promega, Madison, WI) and ethanol precipitated after phenol-chloroform extraction. cDNA was synthesized from RNA samples using the Super-Script First-Strand RT-PCR kit (Life Technologies) using the manufacturer's instructions. Final concentrations of the specific primers (SP-B, pepsinogen C) were 0.5 µM and for GAPDH 0.1 µM. The following primers were used for RT-PCR: SP-B forward, 5'-AGGACATCGTCCACATCCTT-3' and SP-B reverse, 5'-GAGCAGGATGACGGAGTAGC-3' with an amplicon length of 556 corresponding to bases 218–774 of the human SP-B mRNA sequence (GenBank reference NM_000542 [GenBank] ); pepsinogen C forward, 5'-AGTACCGCTTTGGTGAGCTC-3' and reverse, 5'-TACAGGCTGCTATCCACACC-3' with an amplicon length of 546 corresponding to bases 208–754 of the human pepsinogen C mRNA sequence (GenBank reference NM_002630 [GenBank] ); GAPDH forward, 5'-ACCACAGTCCATGCCATCAC-3' and GAPDH reverse, 5'-TCCACCACCCTGTTGCTGTA-3' with an amplicon length of 451 corresponding to bases 601–1052 of the human GAPDH mRNA sequence (GenBank reference NM_002046 [GenBank] ). Each PCR product was sequenced by the Nucleic Acid and Protein Core Facility of the Children's Hospital of Philadelphia, and the sequence was confirmed by BLAST search. PCR was performed on 1 µg cDNA with PCR conditions of 94°C for 5 min (94°C for 30 s, annealing temperature 57°C for SP-B/GAPDH and 55°C for antisense SP-B/GAPDH for 30 s, 72°C for 30 s) for 30 cycles and 72°C for 10 min. Cycle number was determined to be in the linear response range for each amplicon. Samples of the final reaction (5 µl) were run on 2% agarose gels with ethidium bromide, and ultraviolet images were obtained using a Kodak Digital Science Imaging System 1D 2.0.2 (New Haven, CT). Images were scanned and quantified using MacBas v2.4 software (Fuji Photo Film, Tokyo, Japan) and analyzed by ANOVA with SPSS Software (SPSS v11.0; SPSS, Chicago, IL).

Real-time RT-PCR. Real-time PCR reactions using a singleplex format were performed using an ABI Prism 7000 (Applied Biosystems, Foster City, CA). The two-step PCR protocol involved 2 min at 50°C and 10 min at 95°C followed by (95°C for 15 s, 60°C for 1 min) x40 cycles. The 2-min, 50°C step is required for optimal AmpErase UNG activity when using TaqMan Universal PCR Master Mix (Applied Biosystems). The reactions contained 1x Assay-on-Demand Gene Expression Assay Mix (Applied Biosystems), 1x TaqMan Universal PCR Master Mix, and cDNA diluted in RNase-free water in 25 µl total reaction volume. Assay-on-Demand Gene Expression Assay Mix contains both the forward and reverse primers plus MGB Eclipse probe. Fluorescence intensity was recorded during the annealing step of each cycle of the reaction. The following primer and probe sets as found in the Applied Biosystems web site (http://www.allgenes.com) were used for these studies: SP-B Hs00167036, pepsinogen C Hs00160052, and GAPDH Hs99999905. The primer and probe sequences are proprietary, but contextual sequences in each gene are as follows: SP-B GCCATGATTCCCAAGGGTGCGCTAC (exon 6–7 junction with midpoint at base 670 of GenBank sequence NM_000542 [GenBank] ), pepsinogen C CAGTGGTCAAAGTGCCCCTGAAGAA (exon 1–2 junction with midpoint at base 112 of GenBank sequence NM_002630 [GenBank] ), and GAPDH GGGCGCCTGGTCACCAGGGCTGCTT (exon 3 with midpoint at base 130 of GenBank sequence NM_002046 [GenBank] ). The assays were determined to be in the linear amplification range using cDNA standards derived from RNA from type 2 cells treated for 5 days in hormones to allow for comparisons both within and between experiments.

Western immunoblotting. Western immunoblotting was accomplished using previously described procedures (14), using NuPAGE Bis-Tris gels with MES Running Buffer (Invitrogen) and transferring as per the manufacturer's protocol to Duralose membranes (Stratagene, La Jolla, CA). Immunoblots were developed using Pierce SuperSignal West Pico Chemiluminescent Substrate (Pierce, Rockford, IL).

Immunostaining. Paraffin sections of lung tissues were deparaffined and permeabilized in a series of graded alcohols. Nonspecific staining was inhibited by blocking in 1.5% nonimmune goat serum in Trisbuffered saline (TBS). Slides were incubated overnight at 4°C in primary antisera to SP-B (1:500) or pepsinogen C (1:2,000) in 0.01 M TBS/1.5% blocking serum, or in rabbit or sheep IgG at a similar dilution. Slides were incubated with biotinylated goat anti-rabbit or goat anti-sheep IgG for 1 h at room temperature, followed by blocking endogenous peroxidase activity with 0.6% H2O2 in methanol. Avidinbiotin complex was prepared using the Vectastain ABC kit (Vector Laboratories, Burlingame, CA), and the slides were color-developed using diaminobenzidine hydrochloride. Slides were then counterstained with methyl green and coverslips applied. Slides were examined with an Olympus 1X70 microscope and Metamorph imaging system (Universal Imaging, West Chester, PA).

In situ hybridization. Nonisotopic in situ hybridization on paraffin sections was performed using a variation of previously published methods (22). Adult, neonatal, and fetal lung, both before and after explant culture, were obtained and processed for paraffin sections as described previously. Sections (10 µm) were cut and picked up on polylysine (Sigma)-coated slides. After deparaffinizing, the sections were fixed in 4% paraformaldehyde, treated with Proteinase K, and then refixed in 4% paraformaldehyde, acetylated, and dehydrated. Pepsinogen C antisense probe was prepared using the Dig RNA Labeling kit (Roche, Indianapolis, IN), producing a 1,200-base cRNA product using RNA polymerase T7 and linearized TA plasmid containing the pepsinogen C cDNA. A sense probe was made in a similar fashion using RNA polymerase Sp6. DIG-labeled probe (2.5 µg) was diluted in 1 ml hybridization solution. Probe mixture (100 µl) was placed on each slide, and the slides were incubated overnight at 70°C without coverslips in an In Slide Out hybridization oven (Boekel, Feasterville, PA). After hybridization, slides were washed briefly in 5x SSC. They were then washed in high-stringency wash solution and treated with RNase A. After further washing, the slides were blocked with 1% Blocking Reagent (Roche) and incubated overnight at 4°C with alkaline phosphatase-coupled sheep anti-digoxigenin Fab fragments (Roche) diluted 1:5,000 in 1% Blocking Reagent in 1x PBS-0.1% Tween. Alkaline phosphatase activity was detected by incubation in 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium mixture. The color was allowed to develop in the dark at room temperature for 24 h. The slides were counterstained with methyl green, allowed to air-dry, and mounted with VectaMount (Vector Laboratories). Slides were examined with an Olympus 1X70 microscope and Metamorph imaging system (Universal Imaging).


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Pepsinogen C ontogeny in human fetal lung. We examined second-trimester human fetal lung from 12 to 22 wk gestation for expression of pepsinogen C and SP-B (n = 3 each at 12, 15, 18, and 21–22 wk). In addition, postmortem samples were available from infants dying in the 1st day of life (n = 2, 27, and 32 wk gestation) and from adult tissue samples from lung transplantation donors (n = 2). By RT-PCR, pepsinogen C mRNA was not detectable in any of the <=22 wk gestation samples but was present in all postnatal and adult samples (Fig. 1A). By comparison, SP-B mRNA was present from 15 wk through 21–22 wk in increasing amounts, as previously described (17), and in the postnatal and adult lung samples. Pepsinogen C protein was not detected in the second-trimester samples analyzed (Fig. 1B), whereas all postnatal and adult samples expressed pepsinogen C protein. As we have previously shown (14), pro-SP-B was detected in most of the second-trimester fetal lung samples (data not shown). However, mature 8-kDa SP-B was not demonstrated in the second-trimester samples and was seen only in the preterm, postnatal samples representative of third-trimester lung and in the adult samples analyzed.



View larger version (59K):
[in this window]
[in a new window]
 
Fig. 1. Ontogeny of pepsinogen C (PepC) during human gestation. A: multiplex RT-PCR using RNA prepared from 12, 15, 18, and 21 wk human fetal lung (n = 3 each) and postnatal lung samples at 27 and 32 wk (n = 1 each). B: Western immunoblots using tissue homogenate from the above samples. Neither pepsinogen C RNA nor protein is expressed at <22 wk human gestation. Surfactant protein (SP)-B RNA is expressed in samples >=15 wk, but mature 8-kDa SP-B protein is only detected in the 27-wk, 32-wk, and adult (A) samples.

 

Pepsinogen C expression during in vitro type 2 cell differentiation. We examined the expression of pepsinogen C in an in vitro model of type 2 cell differentiation (Fig. 2). Our previous studies using microarray analysis indicated that pepsinogen C was induced in this model (11). By RT-PCR, low-level pepsinogen C and SP-B mRNA, each <10% of peak levels, was detected in isolated lung epithelial cells before the addition of hormones (Fig. 2, A and B). Both pepsinogen C and SP-B mRNA increased within 24 h after the addition of hormones. Pepsinogen C mRNA peaked rapidly and remained stable over 4 days in culture, whereas SP-B mRNA increased steadily, reaching stable levels by 4 days in culture. Immunoblotting also revealed a rapid induction of pepsinogen C protein within 24 h of hormone induction (Fig. 2C). By comparison, although pro-SP-B was detected within 24 h of hormone induction (data not shown), mature SP-B was expressed at low levels after 24 h of hormones, increasing over 3 days in culture to stable levels, comparable to the increase in SP-B RNA.



View larger version (35K):
[in this window]
[in a new window]
 
Fig. 2. Pepsinogen C expression during in vitro type 2 cell differentiation. Multiplex RT-PCR using RNA prepared from isolated undifferentiated lung epithelial cells (0) and cells cultured for 1–4 days in hormones to promote type 2 cell differentiation (n = 3). A: pepsinogen C expression. B: SP-B expression. Results are expressed as %maximum induction after 4 days in culture (average ± SE, *P < 0.05 compared with day 4). C: Western immunoblotting using cell lysates from samples described above (*nonspecific band). Pepsinogen C expression increases within 24 h of hormone induction of type 2 cell differentiation, whereas SP-B expression increases more slowly over the 4-day culture period.

 

Pepsinogen C localizes to type 2 cells but not Clara cells in human lung. To determine whether pepsinogen C was unique to type 2 cells in the mature lung, we performed immunostaining on second-trimester human fetal lung, lung explants cultured in IBMX, and samples of postnatal and adult lung tissue. As expected, pepsinogen C immunoreactivity was not seen in epithelial cells lining potential airspaces in preculture, second-trimester fetal lung (Fig. 3A), whereas there was some staining for SP-B (Fig. 3C), as previously described (2). Induction of type 2 cell differentiation by treating lung explants for 5 days in hormones resulted in robust expression of both pepsinogen C and SP-B in the epithelial cells of presumptive air spaces with immunoreactive material also seen secreted in the potential airspaces (Fig. 3, B and D).



View larger version (168K):
[in this window]
[in a new window]
 
Fig. 3. Pepsinogen C induction with type 2 cell differentiation in lung explant culture. Immunohistochemistry of preculture (A and C) and hormone-treated (B and D) human fetal lung (representative of n = 4) using polyclonal antisera to identify pepsinogen C (A and B) and SP-B (C and D). Pepsinogen C is not expressed in preculture human fetal lung, but is expressed in both epithelial cells lining potential airspaces and secreted material within these airspaces. By comparison, low levels of immunoreactive SP-B are found in preculture epithelial cells within preculture lung tissue, with increased expression after culture in hormone-supplemented media. Bar = 10 µm.

 

In adult lung tissue (Fig. 4A), SP-B and pepsinogen C immunostaining identified alveolar type 2 cells, often at the intersection of alveolar walls. Pepsinogen C expression was not detected in type 1 epithelial cells, airway epithelial cells, endothelial cells, or fibroblasts within the lung parenchyma. Intracellular staining was seen only in type 2 cells. In situ hybridization of mature lung (Fig. 4B) using a 1,200-base antisense probe from the pepsinogen C cDNA also demonstrated endogenous pepsinogen C RNA only in type 2 epithelial cells. No hybridization was noted in the columnar epithelial cells lining airways.



View larger version (96K):
[in this window]
[in a new window]
 
Fig. 4. Pepsinogen C expression in adult lung tissue. A: immunohistochemistry (n = 3) of adult lung tissue using polyclonal antisera to identify SP-B (left) and pepsinogen C (right). B: in situ hybridization (n = 3) of adult lung tissue using digoxigenin-labeled antisense riboprobe (left) and sense riboprobe (right) to pepsinogen C. SP-B immunostaining identifies both alveolar type 2 epithelial cells (arrowheads) and Clara cells (arrows) in small airways (asterisk). Pepsinogen C immunostaining is also localized to type 2 cells with minor cross-reactivity at the cell surfaces of small airways. However, in situ hybridization indicates pepsinogen C RNA only in alveolar type 2 cells. Bar = 10 µm.

 

Pepsinogen C expression is rapidly downregulated during in vitro dedifferentiation of type 2 cells. To further demonstrate the specificity of pepsinogen C expression, we withdrew hormones from alveolar epithelial cells allowed to differentiate into type 2 cells. This method has been used by others as a model for transdifferentiation of rat type 1 cells from freshly isolated type 2 cells (3, 4, 8, 9, 21). By real-time RT-PCR, SP-B and pepsinogen C mRNA decreased to 47% and 13%, respectively, within 24 h of the withdrawal of hormones from the cell culture media and continued to decrease over 4 days in the absence of hormones (Fig. 5A). By immunoblotting (Fig. 5B), pepsinogen C protein was undetectable within 24 h after withdrawing hormones, whereas SP-B protein decreased more slowly because of its retention within lamellar bodies. To confirm that these cells were indeed developing type 1 cell characteristics, we found that expression of PAI-1, recently described as type 1 cell-specific in a model of dedifferentiating rat type 2 cells (21), increased over the 4-day culture period.



View larger version (37K):
[in this window]
[in a new window]
 
Fig. 5. Pepsinogen C expression is rapidly quenched during dedifferentiation of type 2 cells. Isolated undifferentiated epithelial cells were allowed to differentiate into type 2 cells over 4 days in hormone-supplemented media. Hormones were then withdrawn (day 0), and the cells were cultured for an additional 1–4 days (n = 2). A: real-time RT-PCR fluorescence was quantified, normalized for GAPDH expression, and compared (triplicate samples, duplicate experiments). Pepsinogen C expression fell to 13% by 24 h after hormone withdrawal and was only 3% of starting levels by day 4 without hormones. By comparison, SP-B fell to 47% by 24 h and 13% by 4 days. B: immunoblotting of cell lysates from dedifferentiating cells described above. Pepsinogen C was undetectable after 24 h without hormones, whereas mature 8-kDa SP-B decreased gradually over the 4-day culture period. By comparison, the type 1 cell marker plasminogen activator inhibitor (PAI)-1 increased over the period of hormone withdrawal.

 


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In this report, we present a detailed characterization using human lung models of the specific spatial and temporal distribution of pepsinogen C, which is expressed very specifically in alveolar epithelial type 2 cells. This expression is developmentally regulated both in vivo during human lung development and in vitro in a model of type 2 cell differentiation. Furthermore, pepsinogen C expression is rapidly downregulated upon transdifferentiation of type 2 cells in vitro into cells expressing specific markers of type 1 cells. We therefore conclude that pepsinogen C is a tightly regulated type 2 cell product that is one of the earliest markers of a differentiated type 2 cell and a useful marker in discriminating the temporal pattern of transdifferentiation of type 1 cells.

Pepsinogen C (EC 3.4.23.3 [EC] ) is an aspartic protease produced primarily by the gastric chief cells. Unlike pepsinogen A, early studies showed that pepsinogen C was also produced at sites distant from the gut, specifically, the pancreas, prostate, seminal vesicle, and lung (20). Pepsinogen C was also found to be a marker of breast cancers, with a more favorable response to hormone-based chemotherapy (7, 24). This led to studies of the hormone responsiveness of a 1,438-base segment of the pepsinogen C promoter, which demonstrated a 15-bp hormoneresponsive element that resembles the consensus sequence for glucocorticoid, androgen, and progesterone receptors (1). Our observation that hormonal induction of type 2 cell phenotype during in vitro differentiation also results in pepsinogen C expression is consistent with these promoter studies. It will be interesting to further delineate the hormonal responsiveness of pepsinogen C, since expression is so tightly regulated compared with the regulation of SP-B and SP-C.

SP-B and SP-C have been used frequently to identify type 2 cells in mature lung. However, their utility in identifying the immediate precursor of the type 2 cell is limited. Expression of SP-B and SP-C mRNA begins as early as 12–14 wk gestation in human fetal lung (17), increasing toward term such that SP-B mRNA approaches 50% and SP-C 25% of adult mRNA levels by the end of the second trimester. Although expression of the SP-B and -C proproteins is detectable by immunostaining by mid-second trimester (14, 23), mature SP-B is only detectable after 24 wk gestation (2). This complicates their usefulness for studying the regulation of type 2 cell differentiation because, although these markers can identify progenitor epithelial cells destined to become type 2 cells, they imprecisely identify the point at which a progenitor is first identifi-able as a type 2 cell. By comparison, pepsinogen C is very tightly regulated during this process. During the second trimester, as SP-B mRNA accumulates and pro-SP-B is expressed by the undifferentiated epithelial cells, pepsinogen C is not expressed. Although we were unable to present a complete ontogeny through human gestation, pepsinogen C is clearly expressed in representative samples from the third trimester. Moreover, our data using a reproducible in vitro model of type 2 cell differentiation support the in vivo ontogeny studies, indicating that pepsinogen C expression is an early event in the process of type 2 cell differentiation.

Another drawback of some current type 2 cell markers is expression in other pulmonary cell types. Unlike SP-C, which is both lung- and type 2 cell-specific, SP-A and SP-B are both expressed by Clara cells. Pepsinogen C, although expressed in other organs, is type 2 cell-specific in the lung. Furthermore, pepsinogen C mRNA and protein expression are rapidly downregulated during in vitro transdifferentiation of type 2 cells into cells expressing the type 1 cell marker PAI-1. SP-B mRNA is also rapidly downregulated during this process; however, protein levels can take several days to decline because of the stability of intracellular lamellar bodies. Together, the tightly controlled expression during type 2 cell differentiation, short half-life of pepsinogen C in the transition to a type 1 cell-like phenotype, and absence of pepsinogen C from type 1 cells and Clara cells in vivo make pepsinogen C an ideal marker of type 2 cells during lung development.

At this time, we can only speculate on the role of pepsinogen C in type 2 cells. Our prior studies indicate that SP-B proteolytic processing is developmentally regulated, which explains why mature 8-kDa SP-B is not detectable in second-trimester human fetal lung despite detectable pro-SP-B expression. As an aspartic protease, pepsinogen C is an attractive candidate protease for SP-B processing, since a cathepsin D-like aspartic protease was previously implicated in SP-B processing in type 2 cells (25). The expression pattern that we observed during in vitro differentiation of type 2 cells, with rapid, robust expression of pepsinogen C followed by gradual accumulation of mature SP-B, is also suggestive of a primary role for pepsinogen C in SP-B processing. Furthermore, Clara cells do not express pepsinogen C and also cannot process SP-B beyond a 25-kDa intermediate (18). Additional gain-of-function and loss-of-function studies on pepsinogen C will be required to clarify this association and are currently underway.


    ACKNOWLEDGMENTS
 
We acknowledge the assistance of Linda Gonzales, Sree Angampalli, and Ping Wang in the preparation of type 2 cells, Kathy Maschhoff with in situ hybridization, and Michael Beers for editorial suggestions.

C. Foster and A. Aktar contributed equally to this work.

GRANTS

These studies were supported by National Institutes of Health Grants HL-56401 and HL-59959 (to S. H. Guttentag) and HD-043245 (to C. Foster).


    FOOTNOTES
 

Address for reprint requests and other correspondence: S. Guttentag, Abramson Research Center 416G, Children's Hospital of Philadelphia, 3516 Civic Center Blvd., Philadelphia, PA 19104-4318 (E-mail: guttentag{at}email.chop.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Balbin M and Lopez-Otin C. Hormonal regulation of the human pepsinogen C gene in breast cancer cells. Identification of a cis-acting element mediating its induction by androgens, glucocorticoids, and progesterone. J Biol Chem 271: 15175-15181, 1996.[Abstract/Free Full Text]
  2. Beers M, Shuman H, Liley H, Floros J, Gonzales LW, Yue N, and Ballard PL. Surfactant protein B in human fetal lung: Developmental and glucocorticoid regulation. Pediatr Res 38: 668-695, 1995.[Web of Science][Medline]
  3. Campbell L, Hollins AJ, Al-Eid A, Newman GR, von Ruhland C, and Gumbleton M. Caveolin-1 expression and caveolae biogenesis during cell transdifferentiation in lung alveolar epithelial primary cultures. Biochem Biophys Res Commun 262: 744-751, 1999.[CrossRef][Web of Science][Medline]
  4. Christensen PJ, Kim S, Simon RH, Toews GB, and Paine R 3rd. Differentiation-related expression of ICAM-1 by rat alveolar epithelial cells. Am J Respir Cell Mol Biol 8: 9-15, 1993.
  5. Clark JC, Wert SE, Bachurski CJ, Stahlman MT, Stripp BR, Weaver TE, and Whitsett JA. Targeted disruption of the surfactant protein B gene disrupts surfactant homeostasis, causing respiratory failure in newborn mice. Proc Natl Acad Sci USA 92: 7794-7798, 1995.[Abstract/Free Full Text]
  6. deMello DE, Heyman S, Phelps DS, Hamvas A, Nogee L, Cole FS, and Colten R. Ultrastructure of the lung in surfactant protein B deficiency. Am J Respir Cell Mol Biol 11: 230-239, 1994.[Abstract]
  7. Diez-Itza I, Merino AM, Tolivia J, Vizoso F, Sanchez LM, and Lopez-Otin C. Expression of pepsinogen C in human breast tumours and correlation with clinicopathologic parameters. Br J Cancer 68: 637-640, 1993.[Web of Science][Medline]
  8. Dobbs LG, Williams MC, and Gonzalez R. Monoclonal antibodies specific to apical surfaces of rat alveolar type I cells bind to surfaces of cultured, but not freshly isolated, type II cells. Biochim Biophys Acta 970: 146-156, 1988.[Medline]
  9. Forbes B, Wilson CG, and Gumbleton M. Temporal dependence of ectopeptidase expression in alveolar epithelial cell culture: implications for study of peptide absorption. Int J Pharm 180: 225-234, 1999.[CrossRef][Web of Science][Medline]
  10. Foster CD, Zhang PX, Gonzales LW, and Guttentag SH. In vitro surfactant protein B deficiency inhibits lamellar body formation. Am J Respir Cell Mol Biol 29: 259-266, 2003.[Abstract/Free Full Text]
  11. Gonzales L, Guttentag S, Wade K, Postle A, and Ballard P. Differentiation of human pulmonary type II cells in vitro by glucocorticoid plus cyclic AMP. Am J Physiol Lung Cell Mol Physiol 283: L940-L951, 2002.[Abstract/Free Full Text]
  12. Gonzales LW, Ballard PL, Ertsey R, and Williams MC. Glucocorticoids and thyroid hormones stimulate biochemical and morphological differentiation of human fetal lung in organ culture. J Clin Endocrinol Metab 62: 678-696, 1986.[Abstract/Free Full Text]
  13. Guttentag S, Robinson L, Zhang P, Brasch F, Buhling F, and Beers M. Cysteine protease activity is required for surfactant protein B processing and lamellar body genesis. Am J Respir Cell Mol Biol 28: 69-79, 2003.[Abstract/Free Full Text]
  14. Guttentag SH, Beers MF, Bieler BM, and Ballard PL. Surfactant protein B processing in human fetal lung. Am J Physiol Lung Cell Mol Physiol 275: L559-L566, 1998.[Abstract/Free Full Text]
  15. Khoor A, Gray ME, Hull WM, Whitsett JA, and Stahlman MT. Developmental expression of SP-A and SP-A mRNA in the proximal and distal respiratory epithelium in the human fetus and newborn. J Histochem Cytochem 41: 1311-1319, 1993.[Abstract]
  16. Khoor A, Stahlman MT, Gray ME, and Whitsett JA. Temporal-spatial distribution of SP-B and SP-C proteins and mRNAs in developing respiratory epithelium of human lung. J Histochem Cytochem 42: 1187-1199, 1994.[Abstract]
  17. Liley HG, White RT, Warr RG, Benson BJ, Hawgood S, and Ballard PL. Regulation of messenger RNAs for the hydrophobic surfactant proteins in human lung. J Clin Invest 83: 1191-1197, 1989.[Web of Science][Medline]
  18. Lin S, Na CL, Akinbi HT, Apsley KS, Whitsett JA, and Weaver TE. Surfactant protein B (SP-B) -/mice are rescued by restoration of SP-B expression in alveolar type II cells but not Clara cells. J Biol Chem 274: 19168-19174, 1999.[Abstract/Free Full Text]
  19. Mori K, Kon Y, Konno A, and Iwanaga T. Cellular distribution of napsin (kidney-derived aspartic protease-like protein, KAP) mRNA in the kidney, lung and lymphatic organs of adult and developing mice. Arch Histol Cytol 64: 319-327, 2001.[CrossRef][Web of Science][Medline]
  20. Moriyama A, Kageyama T, and Takahashi K. Identification of monkey lung procathepsin D-II as a pepsinogen-C-like acid protease zymogen. Eur J Biochem 132: 687-692, 1983.[Web of Science][Medline]
  21. Qiao R, Zhou B, Liebler JM, Li X, Crandall ED, and Borok Z. Identification of three genes of known function expressed by alveolar epithelial type I cells. Am J Respir Cell Mol Biol 29: 98-105, 2003.[Abstract/Free Full Text]
  22. Schaeren-Wiemers N and Gerfin-Moser A. A single protocol to detect transcripts of various types and expression levels in neural tissue and cultured cells: in situ hybridization using digoxigenin-labelled cRNA probes. Histochemistry 100: 431-440, 1993.[CrossRef][Web of Science][Medline]
  23. Solarin KO, Ballard PL, Guttentag SH, Lomax CA, and Beers MF. Expression and glucocorticoid regulation of surfactant protein C in human fetal lung. Pediatr Res 42: 356-364, 1997.[Web of Science][Medline]
  24. Vizoso F, Sanchez LM, Diez-Itza I, Merino AM, and Lopez-Otin C. Pepsinogen C is a new prognostic marker in primary breast cancer. J Clin Oncol 13: 54-61, 1995.[Abstract/Free Full Text]
  25. Weaver TE, Lin S, Bogucki B, and Dey C. Processing of surfactant protein B proprotein by a cathepsin D-like protease. Am J Physiol Lung Cell Mol Physiol 263: L95-L103, 1992.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
ChestHome page
V. Starosta, R. Kitz, D. Hartl, V. Marcos, D. Reinhardt, and M. Griese
Bronchoalveolar Pepsin, Bile Acids, Oxidation, and Inflammation in Children With Gastroesophageal Reflux Disease
Chest, November 1, 2007; 132(5): 1557 - 1564.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
V. Kolla, L. W. Gonzales, J. Gonzales, P. Wang, S. Angampalli, S. I. Feinstein, and P. L. Ballard
Thyroid Transcription Factor in Differentiating Type II Cells: Regulation, Isoforms, and Target Genes
Am. J. Respir. Cell Mol. Biol., February 1, 2007; 36(2): 213 - 225.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
T. M. McDevitt, L. W. Gonzales, R. C. Savani, and P. L. Ballard
Role of endogenous TGF-beta in glucocorticoid-induced lung type II cell differentiation
Am J Physiol Lung Cell Mol Physiol, January 1, 2007; 292(1): L249 - L257.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
K. C. Wade, S. H. Guttentag, L. W. Gonzales, K. L. Maschhoff, J. Gonzales, V. Kolla, S. Singhal, and P. L. Ballard
Gene Induction during Differentiation of Human Pulmonary Type II Cells In Vitro
Am. J. Respir. Cell Mol. Biol., June 1, 2006; 34(6): 727 - 737.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
286/2/L382    most recent
00310.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Foster, C.
Right arrow Articles by Guttentag, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Foster, C.
Right arrow Articles by Guttentag, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2004 by the American Physiological Society.