AJP - Lung Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 286: L1075-L1083, 2004; doi:10.1152/ajplung.00438.2002
1040-0605/04 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (9)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kong, Y.
Right arrow Articles by Sunday, M. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kong, Y.
Right arrow Articles by Sunday, M. E.

Functional diversity of notch family genes in fetal lung development

Yanping Kong,1 Jonathon Glickman,2 Meera Subramaniam,1 Aliakbar Shahsafaei,2 K. P. Allamneni,1 Jon C. Aster,2 Jeffrey Sklar,2 and Mary E. Sunday1,2

1Departments of Pathology, Children's Hospital and Harvard Medical School; and 2Departments of Pathology, Brigham & Women's Hospital and Harvard Medical School, Boston, Massachusetts 02115

Submitted 17 December 2002 ; accepted in final form 28 November 2003


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
In Drosophila, developmental signaling via the transmembrane Notch receptor modulates branching morphogenesis and neuronal differentiation. To determine whether the notch gene family can regulate mammalian organogenesis, including neuroendocrine cell differentiation, we evaluated developing murine lung. After demonstrating gene expression for notch-1, notch-2, notch-3, and the Notch ligands jagged-1 and jagged-2 in embryonic mouse lung, we tested whether altering expression of these genes can modulate branching morphogenesis. Branching of embryonic day (E) 11.5 lung buds increased when they were treated with notch-1 antisense oligodeoxynucleotides in culture compared with the corresponding sense controls, whereas notch-2, notch-3, jagged-1, or jagged-2 antisense oligos had no significant effect. To assess cell differentiation, we immunostained lung bud cultures for the neural/neuroendocrine marker PGP9.5. Antisense to notch-1 or jagged-1 markedly increased numbers of PGP9.5-positive neuroendocrine cells alone without affecting neural tissue, whereas only neural tissue was promoted by notch-3 antisense in culture. There was no significant effect on cell proliferation or apoptosis in these antisense experiments. Cumulatively, these observations suggest that interactions between distinct Notch family members can have diverse tissue-specific regulatory functions during development, arguing against simple functional redundancy.

branching morphogenesis; cell differentiation; neuroendocrine cells; neurons; antisense oligonucleotides; mouse embryos; immunohistochemistry


NOTCH WAS INITIALLY IDENTIFIED as a transmembrane signaling protein that is located on the cell surface and is involved in Drosophila neurogenesis (4, 17). Whereas "proneural" genes promote neuronal cell commitment, "neurogenic" genes such as notch restrict neurogenesis (4, 40). Complete loss of function of a neurogenic gene such as notch can lead to massive neuronal hyperplasia. Notch, Delta, and Serrate/Jagged are transmembrane molecules with EGF-like repeats (3, 4). Delta and Serrate act as Notch ligands, activating a common intracellular signaling pathway leading to cleavage of the cytoplasmic domain of Notch, which then translocates to the nucleus (3, 4). It is generally believed that all notch genes can interact functionally in similar developmental pathways in vertebrates and invertebrates (17). In vertebrates, multiple notch genes have been identified as well as multiple genes encoding the Notch ligands Delta and Jagged/Serrate (3, 17).

The observation that neuroblasts rapidly decrease Notch expression as they begin to differentiate suggested that Notch functions to inhibit the neuronal phenotype (10). However, notch gene expression occurs in many fetal and adult tissues, especially central nervous system, hematopoietic tissues, and the lung (1, 5, 9, 20, 33, 34, 36, 40). Although different Notch ligands might have distinct functions in hematopoiesis (11, 16), there has been little evidence for divergent functions of the multiple Notch proteins (11), especially with regard to specific developmental processes.

The function of Notch has been recently explored in genetically deficient cells and mice and by antisense oligonucleotide strategies. In the vertebrate retina, Austin et al. (6) used antisense oligonucleotides to demonstrate that the number of ganglion cells produced was inversely related to the level of Notch-1 activity. This is a versatile system for examining the Notch pathway in a specific cell fate decision. It is clear that Notch is effectively an ideal morphogen that can influence cell fate, proliferation, apoptosis, cell-cell adhesion (3, 10), and border formation: that is, everything that goes into building a tissue. Furthermore, the outcome of Notch signaling is not stereotyped but highly dependent on dose, timing, and context (5). Therefore, we investigated how Notch signaling influences branching morphogenesis and neuroendocrine cell differentiation during murine lung development.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Animals. Timed pregnant Swiss-Webster mice were obtained from Taconic Laboratories (Germantown, NY) at gestational day 7 (E7). The National Research Council Guide for the Care and Use of Laboratory Animals was strictly adhered to throughout all phases of this study. The Animal Care Committee of the Brigham & Women's Hospital and Children's Hospital reviewed and approved the protocols used in this study.

Preparation of RNA and cDNA. Lungs were harvested from E12 to E18 fetal mice and from neonatal mice between the day of birth (postnatal day 1 = P1). Total RNA was prepared from snap-frozen lung tissue with TRI reagent (Molecular Research Center, Cincinnati, OH) according to the manufacturer's instructions as described previously (42). RNA integrity was evaluated by examination of 18S and 28S bands after separation on ethidium bromide-stained 1.5% agarose/formaldehyde gels. cDNA was prepared using SuperScript 2 RNase Reverse Transcriptase (GIBCO-BRL) according to the manufacturer's instructions.

RNA analysis: RT-PCR. Synthetic oligodeoxynucleotides were designed to span at least one intron and were purchased from Oligos Etc. (Wilsonville, OR). The conditions for semiquantitative RT-PCR were determined such that 40 cycles for notch and jagged RT-PCR yielded a positive control signal in the midlinear region of the curve (cycle number vs. integrated band intensity). RT-PCR was carried out as described previously (42) with the following primer pairs for PCR, based on murine sequences from GenBank (accession numbers given below). Notch-1 forward (F), aacgtggtcttcaagcgtgatg; Notch-1 reverse (R), cacagcccacaaagaacaggag; Notch-1 probe, caatgtgtgcagtcatcctc; Notch-1 band size, 421 bp; Notch-1 GenBank accession number, NM_008714 [GenBank] . Notch-2 F, gccaacatcatcacagacttggtc; Notch-2 R, tgggagtcacgttatactcgtccag; Notch-2 probe, tcatcacagacttggtctacc; Notch-2 band size, 643 bp; Notch-2 GenBank accession number, D32210 [GenBank] . Notch-3 F, tgtgtggatggggaaaatgg; Notch-3 R, tcgaggcaagaacaggaaaagg; Notch-3 probe, cactttgcctacctgcgaac; Notch-3 band size, 617 bp; Notch-3 GenBank accession number, X74760 [GenBank] . Jag-1 F, cagagggttgcagtcattggtg; Jag-1 R, accatcgccaagaacagcag; Jag-1 probe, cagatgcaggagaaagagtc; Jag-1 band size, 147 bp; Jag-1 GenBank accession number, AA020103 [GenBank] . Jag-2 F, atgagtgtgcctctaacccatgtg; Jag-2 R, tgagcagttcttgccaccaaagtc; Jag-2 probe, gccattgcgaactagagtac; Jag-2 band size, 557 bp; Jag-2 GenBank accession number, AF010137 [GenBank] .

Band identities were verified by DNA sequencing and by probing RT-PCR Southerns with an internal primer (sequences of which are given above).

PCR reactions were carried out with Taq polymerase (Boehringer Mannheim, Indianapolis, IN) as described previously (42). Each reaction was subjected to 40 cycles, except {beta}-actin was amplified for 22 cycles. Each cycle included denaturation for 1 min at 94°C, annealing for 1.5 min, and extension for 2 min at 72°C with a thermal cycler (M. J. Research, Watertown, MA). Negative controls consisted of an equal volume of diethyl pyrocarbonate-treated water substituted for the volume of RNA in the above reaction.

PCR products were fractionated on 1.5% agarose gels and blotted onto nitrocellulose according to standard protocols (42). Internal oligonucleotide probes were end-labeled with T4 polynucleotide kinase and hybridized according to standard protocols (42). These conditions were defined to yield semiquantitative results as previously described (42), with linear detection of positive control bands over a 2-log range of input-positive control RNA. Relative amounts of specific mRNAs could subsequently be normalized with actin mRNA in the same RT reaction mixture.

Immunoperoxidase analyses. Murine E14 lung tissues were fixed for 12–18 h in 4% paraformaldehyde before being processed into paraffin. Three-micrometer paraffin sections were prepared on Fisher "Plus" slides. Immunostaining was carried out via the avidin-biotin complex immunoperoxidase technique, with diaminobenzidine as substrate, as described (42). Either hematoxylin or methyl green was used as counterstain. Affinity-purified antibodies to Notch-1, Pan-Notch, Jagged-1, and Jagged-2 were described previously (5, 12, 27). Brief descriptions are given as follows. The Notch-1 antibody preparation is an affinity-purified polyclonal rabbit antiserum against a cytoplasmic domain of human Notch-1, termed TC, which shows no homology to Notch-2 or Notch-3. The "anti-Pan-Notch antibodies" are affinity-purified rabbit antibodies specific for a cytoplasmic domain of human Notch-1, termed T3, which is specific for Notch-1, -2, and -3. Similarly, Jagged-1- and Jagged-2-specific antibodies were raised against unique cytoplasmic domains of the two molecules that were used to immunize rabbits. The anti-Jagged antibodies were affinity purified with the appropriate antigen as described (27). Negative controls run in parallel consisted of normal preimmune rabbit IgG.

Branching morphogenesis of lung buds cultured with antisense oligonucleotides. Embryonic lung branching morphogenesis was assayed after 48 h of culture as described previously (21) using E11.5 murine lung buds (7–13 branch points per lung bud at time zero) treated with antisense or sense phosphorothioate oligodeoxynucleotides (1 µM). The culture medium containing fresh oligodeoxynucleotides was refreshed daily. The number of branch points per lung bud was close to identical within each litter (variability ± 1–2 branch points at E11.5). The sequences of the notch-1 antisense and sense oligonucleotides have been previously published (6). The sequences of the remaining oligodeoxynucleotides are given as follows: Notch-2 (corresponds to bp 1,953–1,971): antisense 5' CACTACAGATGGCTCCCAT, sense 5' ATGGGAGCCATCGTAGTG; Notch-3 (corresponds to bp 2,132–2,150): antisense 5' GTTCGCAGGTAGGCAAAGT, sense 5' ACTTTGCCTACCTGCGAAC; Jagged-1 (corresponds to bp 726–749): antisense 5' GTTTATCATGCCTGAGTGAGAAGC, sense 5' GCTTCTCACTCAGGCATGATAAAC; Jagged-2 (corresponds to bp 817–836): antisense 5' CTCGTCACAGAACTTGCCCT, sense 5' AGGGCAAGTTCTGTGACGAG.

To verify the specificity of the antisense-mediated effects, we immunostained paraffin sections of the cultured lung buds for Notch-1, Pan-Notch, Jagged-1, and Jagged-2 with the same antibodies as given in Fig. 2.



View larger version (119K):
[in this window]
[in a new window]
 
Fig. 2. Immunohistochemical analyses for notch family proteins in E14 murine lung. Antibodies to Notch-1, Pan-Notch, Jagged-1, and Jagged-2 were described previously (4). Immunoperoxidase staining was carried out using paraffin sections of fetal murine lung harvested at E14, as described (33). Diaminobenzidine was used as the chromogen. Either hematoxylin or methyl green was used as counterstain. A: murine lung was immunostained for Notch-1 (left, x200 magnification) and Pan-Notch (right, x100 magnification, hematoxylin counterstain). Middle: negative control section of the same lung stained in parallel using normal rabbit IgG instead of affinity-purified antibodies (x100 magnification). The negative controls were run in parallel at the same concentration as the IgG of the affinity-purified antibodies. Both Notch-1 and Pan-Notch immunoreactivities are localized to epithelium and mesenchyme, with sparing only of airway-associated smooth muscle (right, arrow). More intense Notch-1 immunostaining occurs on mitotic figures in anaphase (left, arrow). B: strong Jagged-1 immunostaining (left) is present in the cytoplasm and on the cell surface of distal (undifferentiated) airway epithelium and scattered undifferentiated mesenchymal cells. Epithelial cells of proximal conducting airways have little to no detectable Jagged-1 (arrow). In contrast, Jagged-2 immunoreactivity (right) is strongly detected in all epithelial cells (undifferentiated) and undifferentiated mesenchyme, but not in airway-associated smooth muscle (arrow). Jagged-2 immunostaining is visible in the cytoplasm of many cells. aw, Airway; v, blood vessel; n, neuronal ganglion.

 

Neuroendocrine/neural cell differentiation in lung buds cultured with antisense oligonucleotides: computerized image analysis. E11.5 murine lung buds were cultured for 7 days with antisense or sense oligonucleotides (sequences given above) before harvesting, fixation, and routine processing into paraffin blocks as described above. Serial sections through the whole block for each group of buds were immunostained for the neural/neuroendocrine cell-specific marker PGP9.5 (30, 39). Computerized image analysis (density slice determination) was used to measure the tissue area of the cross section of each lung bud as detailed below. Images were captured under a Nikon Eclipse E600 microscope with bright-field illumination at x20 magnification, which was connected to a Nikon digital camera DXM1200. The camera, in turn, interfaced with a Dell Dimension 8200 computer via Nikon ACT-I software for capturing digital images. Subsequently, we optimized contrast using Adobe Photoshop 6.0 before carrying out measurements using the Scion Image 1.62b program.

PGP9.5-positive neuroendocrine cells were quantified both as the number of PGP9.5-positive cell clusters per cm2 of tissue and as the total number of PGP9.5-positive cells per cm2 of tissue. Neuroendocrine cells in developing murine lung are localized to both the cartilaginous airways and the smaller, more distal airways. Due to this scattered distribution of PGP9.5-positive neuroendocrine cells, the results of quantitative morphometry were normalized for the area of lung tissue in the section.

Similarly, we used computerized image analysis to determine the relative area of PGP9.5-positive mesenchymal tissue by measuring the area of nonepithelial PGP9.5-positive tissue and normalizing this for the total area of the lung bud.

Statistical analyses. Numerical data were analyzed by unpaired Student's t-test and/or ANOVA. Results are expressed as mean group values ± SE.


    RESULTS AND DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Notch family gene expression in developing murine lung. In the present study, we investigated the expression of the genes encoding Notch-1, -2, -3 and Jagged-1 and -2 in developing murine lung between E10 and P14, corresponding to the period of morphogenesis and cytodifferentitation in this organ. We chose to investigate these selected genes encoding Notch and Notch ligands as a paradigm of Notch signaling, rather than an exhaustive analysis of all identified genes in the Notch signaling pathway. Results of representative semiquantitative RT-PCR analyses are given in Fig. 1. Murine notch-1, -2, and -3 genes are expressed from E11 through P14; only notch-1 mRNA is detected on E10. Similarly, notch-1 is the first of these genes to be expressed in the developing pancreas (23). In contrast, notch-3 mRNA is only marginally detectable on E14 and from E18 to P2. The RNA integrity is verified by comparable detection of {beta}-actin transcripts in all lanes. jagged-1 is also expressed from E11 through P14, except for E13. In contrast, jagged-2 is expressed in a more temporally restricted fashion: E11, E12, E16 (peak), E18, and P14, with marginally detected levels on P1 and P7. The expression of all three notch and two jagged genes within the time frame from E10 to E12 suggests that any of these could potentially function as regulators of early branching morphogenesis. Furthermore, the expression of all five notch family genes at some time point between E15 and E18 suggests that any of these could potentially function as regulators of cell differentiation, which takes place from E14 to P1. We focused the remainder of this investigation on distribution and function of Notch family members during fetal lung development.



View larger version (70K):
[in this window]
[in a new window]
 
Fig. 1. mRNAs encoding Notch-1 (N-1), N-2, N-3 (A) and Jagged-1 (Jag-1) and Jag-2 (B) in developing murine lung. Each lane represents RNA prepared from a pool of at least 10 murine lungs from 2 or more litters. Lung tissue was harvested daily between embryonic day (E) 10 (the initial lung bud forms ~E9.5) to E18, and postnatal day 1 (P1, defined as the day of birth) through P14, as indicated. This is 1 of 2 independent experiments carried out at separate times and with fresh RNA pools and freshly prepared oligonucleotides. Band identities were verified by DNA sequencing and by probing RT-PCR Southerns with an internal primer (sequences of which are given above).

 

Localization of Notch family proteins in E14 murine lung. To determine the cellular distribution of Notch and Jagged proteins, we carried out immunostaining of E14 fetal mouse lung using four different affinity-purified antisera specific for Notch-1, Pan-Notch (domains shared within the family), Jagged-1, or Jagged-2 (5). Representative photomicrographs are given in Fig. 2. On E14, Notch-1 and Pan-Notch immunoreactivities are clearly visible in both the epithelial and mesenchymal compartments. However, there is relative sparing of airway-associated smooth muscle. Also, on E14, Notch-1 and Pan-Notch immunoreactivities are localized to both cytoplasm and nuclei (Fig. 2A), suggesting that activated Notch-1 may be translocated to the nucleus. More intense Notch-1 immunostaining occurs on mitotic figures in anaphase (Fig. 2A).

By comparison, on E14, Jagged-1 is strongly detectable in distal (undifferentiated) airway epithelium and scattered undifferentiated mesenchymal cells (Fig. 2B). Epithelium of proximal conducting airways has low to undetectable levels of Jagged-1. However, Jagged-2 is strongly detected in all epithelial cells and undifferentiated mesenchyme, but not in airway-associated smooth muscle (Fig. 2B). Jagged-2 immunostaining is visible in both cytoplasm and nuclei of many cells.

Role of notch family members in lung branching morphogenesis. These observations prompted us to analyze potential functional roles for notch and jagged genes in E11.5 lung branching morphogenesis using lung buds treated with genespecific oligonucleotides (sense or antisense). Branching is regulated by epithelial-mesenchymal interactions (29). E10–E12 lung bud explants from embryonic rodents have been studied for decades as a simple, straightforward and yet elegant system for directly observing mammalian branching morphogenesis. The branching that occurs in vitro has been demonstrated to be highly similar to the in vivo process, although clearly lacking neural input and active circulation (8, 14, 29, 38, 41). We observed the most striking effects after 48 h with notch-1 antisense (Fig. 3). Compared with the corresponding sense controls using lung buds derived from the same litter of mice (Fig. 3, top, left), notch-1 antisense (Fig. 3, top, right) led to significantly increased numbers of peripheral branch points (P < 0.004).



View larger version (57K):
[in this window]
[in a new window]
 
Fig. 3. Functional role for Notch-1 in lung branching morphogenesis. Embryonic lung branching morphogenesis was assayed after 48 h of culture as described previously (17) using E11.5 murine lung buds treated with antisense or sense phosphorothioate oligodeoxynucleotides. Top: representative lung buds from the same litter after 48 h of treatment with notch-1 sense (middle) or notch-1 antisense (right). Compared with the sense controls (left), notch-1 antisense-treated buds had a marked increase in peripheral branch points. Bottom: pooled results of quantification of the numbers of peripheral branch points are presented from 5–6 independent experiments, with 3–6 buds per group per experiment. Data are expressed initially as the fold increase in branch points for each bud relative to the same lung bud at time 0 [baseline numbers of branch points ranged from 7 to 11 at time 0, with minimal variability within each litter (± 1–2 branch points)]. Then each individual result was expressed as its percent change compared with the mean of the corresponding sense control. notch-1 antisense (N1AS) resulted in ~30% more branching (P < 0.003) compared with the notch-1 sense control (N1S). The untreated negative controls (Neg) did not differ significantly from the sense controls. M5 is a 5-bp mismatched control for N1AS that yielded results similar to the sense and negative controls. There was no significant difference in branching morphogenesis between sense and antisense oligonucleotides for notch-2, notch-3, jagged-1, or jagged-2.

 

The results of quantification of the numbers of peripheral branch points were pooled and are summarized in Fig. 3 (bottom). notch-1 antisense resulted in a ~25% increase in branching compared with the notch-1 sense control (P < 0.002 by ANOVA). Intermediate results were obtained using a 5-bp mismatched "scrambled" oligonucleotide (M5) corresponding to the notch-1 antisense (6): cultures with M5 had a trend toward reduced branching compared with notch-1 antisense (P < 0.10 by ANOVA). Results with M5 were essentially identical to those with the notch-1 sense control (P = 0.42). There was no significant difference between the untreated negative control and N1S or M5. There was no reproducible effect on branching morphogenesis with notch-2, notch-3, jagged-1, or jagged-2 antisense oligonucleotides compared with the corresponding sense controls (data not shown).

Furthermore, there was no difference between any of the sense and antisense groups with regard to cell proliferation [assessed by 5-bromo-2'-deoxyuridine incorporation and proliferating cell nuclear antigen immunostaining (30)], nor with regards to numbers of apoptotic cells (as assessed by terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling staining in situ and nuclear morphology for apoptotic bodies) (42).

We verified the specificity of these antisense-mediated effects by immunostaining paraffin sections of the cultured lung buds for Notch family proteins (see Fig. 4).



View larger version (64K):
[in this window]
[in a new window]
 
Fig. 4. Pulmonary neuroendocrine cell differentiation is modulated by notch family genes. E11.5 murine lung buds were cultured for 7 days with antisense or sense oligonucleotides before harvest and routine processing into paraffin blocks. Serial sections through the whole block for each group of buds were immunostained for the neural/neuroendocrine cell-specific marker PGP9.5 (24, 31). L, airway lumen. Magnification: x200 in A and B, x400 in C and D. A and B: increased numbers of neuroendocrine cells are demonstrated in airway epithelium of lung buds cultured with notch-1 antisense (A, arrows) compared with buds from the same litters that were cultured with the corresponding sense control oligonucleotides (B). PGP9.5 immunoreactivity is also present in nerve fibers within the lung explants (B, medium arrow, bottom right corner). C and D: increased numbers of neuroendocrine cells are present in lung buds cultured with jagged-1 antisense (C, arrows) compared with control buds that were cultured with jagged-1 sense control oligonucleotides (D). PGP9.5 immunoreactivity is also present in small nerve fibers within the lung explants (D, small arrows).There was no significant effect of any of the other antisense oligonucleotides on PGP9.5-positive neuroendocrine (NE) cells. E and F: computerized image analysis was used to measure the tissue area of the cross section of each lung bud. The PGP9.5-positive cells were quantified both as the number of PGP9.5-positive cell clusters per cm2 of tissue (E) and as the total number of PGP9.5-positive cells per cm2 of tissue (F). In a representative experiment, treatment with notch-1 antisense resulted in a 4-fold increase in the numbers of PGP9.5-positive foci or cells (P < 0.0003 and 0.004, respectively). Similarly, jagged-1 antisense induced a ~4- to 10-fold increase in numbers of PGP9.5-positive foci or cells (P < 0.012 and 0.008, respectively). Similar results were obtained for 4 such experiments (6–9 buds per group). G: to verify the specificity of the above effects, we immunostained paraffin sections of lung buds cultured for 7 days with notch-1 antisense for Notch-1. Representative photomicrographs are given at top: Notch-1 positivity is present in airway epithelial cells of lung buds cultured with notch-1 sense (left) or notch-2 antisense (right) but is notably absent from buds treated with notch-1 antisense (middle). To verify the specificity of the jagged-1 antisense (J1AS)-mediated effect, we immunostained paraffin sections of the cultured lung buds for Jagged-1. Representative photomicrographs are given at bottom of G: Jagged-1 positivity is present in airway epithelial cells of lung buds cultured with jagged-1 sense (J1S, left) or jagged-2 antisense (J2AS, right) but was notably absent from buds treated with jagged-1 antisense (middle). L, airway lumen, circled for visibility in J1S and J2AS, bottom.

 

Notch family members regulate cell differentiation in cultured lung buds. To evaluate the potential role of these five genes in neuroendocrine cell differentiation, we maintained E11.5 lung buds in culture for 7 days before harvest and routine processing into paraffin blocks. Serial sections through the whole block for each group of buds were immunostained for the neural/neuroendocrine cell-specific marker PGP9.5 (30, 39). Increased numbers of neuroendocrine cells were demonstrated in airway epithelium of the lung buds cultured with antisense to notch-1 or jagged-1 (Fig. 4, A and C, respectively) compared with buds from the same litters that were cultured with the corresponding sense control oligonucleotides (Fig. 4, B and D). Treatment with the notch-1 antisense resulted in a fourfold increase in the numbers of PGP9.5-positive foci (Fig. 4E, P < 0.0003) or cells (Fig. 4F, P < 0.004). Likewise, jagged-1 antisense induced a ~4- to 10-fold increase in numbers of PGP9.5-positive foci or cells (P < 0.012 and 0.008, respectively). Comparable results were obtained for four such experiments (6-9 buds per group).

To verify the specificity of the notch-1 antisense-mediated effects, we immunostained paraffin sections of the cultured lung buds for Notch family proteins. Representative photomicrographs are given in Fig. 4G (top). In lung buds cultured with notch-1 sense or notch-2 antisense, Notch-1 immunopositivity is present in airway epithelial cells, but this immunoreactivity is notably absent from buds treated with notch-1 antisense (Fig. 4G). Similarly, notch-3, jagged-1, or jagged-2 antisense oligonucleotides had no effect on Notch-1 immunostaining (data not shown).

To verify the specificity of the jagged-1 antisense-mediated effect, we immunostained paraffin sections of the cultured lung buds for Jagged-1. Representative photomicrographs are given in Fig. 4G (bottom). Jagged-1 immunopositivity is present in airway epithelial cells of lung buds cultured with jagged-1 sense or jagged-2 antisense but is notably absent from buds treated with jagged-1 antisense. Similarly, antisense to notch-1, -2, or -3 had no effect on Jagged-1 immunostaining (data not shown).

In the course of these experiments, we made the unexpected observation that lung buds treated with notch-3 antisense oligonucleotides developed a marked (approximately fivefold) increase in the relative area of PGP9.5-immunopositive mesenchymal tissue (Fig. 5, A and C). This tissue is composed of two distinct groups of PGP9.5-positive cells. First, there are large clusters of cells that immunostain only weakly to moderately for PGP9.5 (Fig. 5, A and C) and have the morphology of neuroblasts. Second, there are strongly PGP9.5-positive cells with the morphology of mature neural tissue, including ganglia (in Fig. 5, B and D), delicate nerve fibers (Fig. 5, A–D), and larger nerve fibers (Fig. 5C). In contrast, lung buds cultured with notch-3 sense control oligonucleotides have no difference in quantities of PGP9.5-positive mesenchymal tissue compared with any of the other sense or antisense groups. One of the largest masses of PGP9.5-positive cells in a sense control is given in Fig. 5B, which is morphologically most consistent with more mature neural tissue, strong PGP9.5-positive immunostaining, and the appearance of ganglia. Most of the sense controls have smaller masses of PGP9.5-positive mesenchymal tissue (Fig. 5D), which consists of delicate nerve fibers and ganglia, as well as pulmonary neuroendocrine cells. However, there was no difference in relative numbers of neuroendocrine cells between the notch-3 sense and antisense groups (Fig. 5, C vs. D). The pooled quantitative results of three experiments are given in Fig. 5E. The buds cultured with notch-3 antisense oligonucleotides have greater than a fivefold increase in the proportional area of PGP9.5-positive mesenchymal tissue per lung bud (P < 0.007).



View larger version (87K):
[in this window]
[in a new window]
 
Fig. 5. Neuronal cell differentiation is regulated by Notch-3. E11.5 murine lung buds were cultured for 7 days, harvested, and immunostained for PGP9.5 as described in the legend to Fig. 4 (magnification A and B: x100; C and D: x200). The PGP9.5-positive tissue is composed of 2 distinct cell morphologies: 1) Large clusters of cells that immunostain only weakly to moderately for PGP9.5 (solid arrowheads in A and C) and have the morphology of neuroblasts; and 2) PGP9.5-positive cells with the morphology of mature neural tissue including ganglia (arrowhead in B and D), delicate nerve fibers (small thin arrows) (A–D), and larger nerve fibers (C, long double arrow). A and C: lung buds treated with notch-3 antisense developed a marked (approximately fivefold) increase in the relative area of PGP9.5-positive mesenchymal tissue (A and C). B and D: in contrast, control lung buds cultured with notch-3 sense oligonucleotides have no difference in quantities of PGP9.5-positive mesenchymal tissue compared with any of the other sense or antisense groups. One of the largest masses of PGP9.5-positive cells in a sense control is given in B (arrowhead), consistent with more mature neural tissue, with strong PGP9.5-positive immunostaining and the morphological appearance of ganglia. Most of the sense controls have smaller masses of PGP9.5-positive mesenchymal tissue (D), which consists of delicate nerve fibers (small arrows) and ganglia (arrowhead, D) as well as pulmonary neuroendocrine cells (red arrows in C and D). There was no difference in relative numbers of neuroendocrine cells between the notch-3 sense and antisense groups (red arrows, C vs. D). We applied computerized image analysis to determine the relative area of mesenchymal PGP9.5-positive staining by measuring the area of PGP9.5-positive tissue and normalizing this for the total area of the lung bud. The pooled results of 3 experiments are given in E. The buds cultured with notch-3 antisense oligonucleotides have a greater than fivefold increase in the proportion of PGP9.5-positive mesenchymal tissue (P < 0.007).

 

Summary and interpretation of functional investigations. In summary, we observe increased branching morphogenesis in lung buds cultured with antisense to notch-1, increased neuroendocrine cell differentiation with notch-1 or jagged-1 antisense, and increased neural tissue with notch-3 antisense (Table 1). Several molecular mechanisms are suggested by these observations. With regard to regulation of branching morphogenesis, there appears to be a unique role for Notch-1 in the regulation of branching of the developing lung. With regard to the appearance of PGP9.5-positive neuroendocrine cells in lung buds, wild-type Notch-1 and Jagged-1 may function as a receptor-ligand pair to inhibit neuroendocrine cell differentiation in the lung, similar to Notch-mediated inhibition of neurogenesis in Drosophila (17). Surprisingly, only Notch-3 regulates the differentiation of PGP9.5-positive neural tissue. Cumulatively, these observations suggest that Notch ligands other than Jagged-1 or -2 may be involved in the Notch-mediated regulation of branching morphogenesis and neural differentiation.


View this table:
[in this window]
[in a new window]
 
Table 1. Summary of observations in murine lung buds cultured with antisense oligodeoxynucleotides

 

The effects of Notch signaling on branching morphogenesis could be mediated via altered cell adhesion to other cells and/or to extracellular matrix components and/or altered cell motility. This interpretation would be consistent with the observations that Notch signaling via Delta (26) or Jagged (25) can regulate cell adhesion and/or motility in neurons, keratinocytes, and endothelial cells, which may occur through a novel pathway involving the actin cytoskeleton (11, 26, 37). In the present study, the absence of changes in cell proliferation or apoptosis further suggests that altered cell adhesion and/or migration is a likely mechanism underlying altered branching with Notch family antisense oligonucleotides.

With regard to cell differentiation, diminished Notch-1 or Jagged-1 leads to increased pulmonary neuroendocrine cells, analogous to the function of Notch signaling during Drosophila neurogenesis. These data implicate Notch-1 and Jagged-1 as a receptor-ligand pair regulating differentiation of neuroendocrine cells in the developing lung, consistent with our observation of Jagged-1 immunostaining predominantly localized to epithelial cells in the fetal lung during the period of cell differentiation (E14). These data are consistent with the observation of Notch immunostaining only in nonneuroendocrine cells in the lung (15). In other murine systems, Notch signaling has been demonstrated to play a role in differentiation of pancreatic endocrine cells (2) and endodermal endocrine differentiation in the gut (18, 43).

Our unexpected observation of a specific role for Notch-3 in regulating neural (but not neuroendocrine) differentiation suggests two possibilities. Either these two cell types (neuroendocrine vs. neural) are derived from distinct pluripotent precursor cells (epithelial vs. mesenchymal) in the lung and/or a common precursor cell can follow one or the other lineage pathways, depending on whether Notch-1 and Jagged-1 or Notch-3 is downregulated.

Finally, our data suggest that the Notch ligand(s) interacting with Notch-1 and/or Notch-3 to regulate branching and neural differentiation is neither Jagged-1 nor Jagged-2. Delta-1 or -2 are likely candidates, but we cannot rule out the involvement of a novel Notch ligand.

Relevance to other cellular systems. Differential effects of Notch ligands have been observed in other systems. Exogenous Delta-1 or Jagged-1 promotes natural killer cell differentiation of hematopoietic progenitors, whereas only Delta-1 is permissive for the emergence of CD4/CD8-positive cells (16). Similar functions have been observed for Notch ligands in other systems (11). Soluble forms of both Delta-1 and Delta-4 regulate mitogenesis of cultured hematopoietic precursors (20). Jagged-1 deficiency causes Alagille syndrome in humans (24), whereas Notch-3 deficiency is associated with a degenerative vascular disorder (19). Mice deficient for Notch-2 or Jagged-1 have a similar phenotype with hypoplastic kidneys and myocardium (28). Evidence suggesting divergent functions for different notch genes comes from studies of transgenic mice overexpressing activated Notch-1 or Notch-3 in thymocytes (7, 35) or in the pancreas (2).

Conclusions. The present study demonstrates a major role for Notch signaling in the regulation of cytodifferentiation in murine embryonic lung, with additional involvement in branching morphogenesis of the developing bronchial tree. Cumulatively, our observations suggest that different Notch and Jagged family members can have diverse tissue-specific regulatory functions during development, with only partial redundancy (as with the effects of Notch-1 and Jagged-1 in neuroendocrine cell differentiation). This functional complexity could be due, in part, to Notch ectodomain-binding cofactors such as Fringe (13, 22, 32) or Scabrous (22, 31), which in turn could modulate ligand selection or signal transduction by Notch. The specification of unique cell fates by such combinatorial signaling is becoming recognized as an important mechanism in mammalian lung embryogenesis.


    ACKNOWLEDGMENTS
 
Present address of K. P. Allamneni: Titan Pharmaceuticals, 400 Oyster Point Blvd., Ste. 505, South San Francisco, CA 94080.


    FOOTNOTES
 

Address for reprint requests and other correspondence: M. E. Sunday, Brigham & Women's Hospital, Dept. of Pathology, 75 Francis St., Boston, MA 02115 (E-mail: sunday{at}tch.harvard.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 

  1. Anderson AC, Robey EA, and Huang YH. Notch signaling in lymphocyte development. Curr Opin Genet Dev 11: 554-560, 2001.[CrossRef][ISI][Medline]
  2. Apelqvist A, Li H, Sommer L, Beatus P, Anderson DJ, Honjo T, de Angelis MH, Lendahl U, and Edlund H. Notch signalling controls pancreatic cell differentiation. Nature 400: 877-881, 1999.[CrossRef][Medline]
  3. Artavanis-Tsakonas S, Delidakis C, and Fehon RG. The notch locus and the cell biology of neuroblast segregation. Annu Rev Cell Biol 7: 427-452, 1991.[CrossRef][ISI][Medline]
  4. Artavanis-Tsakonas S, Matsuno K, and Fortini ME. Notch signaling. Science 268: 225-232, 1995.[Abstract/Free Full Text]
  5. Aster J, Pear W, Hasserjian R, Erba H, Davi F, Luo B, Scott M, Baltimore D, and Sklar J. Functional analysis of the TAN-1 gene, a human homolog of Drosophila notch. Cold Spring Harb Symp Quant Biol 59: 125-136, 1994.[ISI][Medline]
  6. Austin CP, Feldman DE, Ida JA Jr, and Cepko CL. Vertebrate retinal ganglion cells are selected from competent progenitors by the action of Notch. Development 121: 3637-3650, 1995.[Abstract]
  7. Bellavia D, Campese AF, Alesse E, Vacca A, Felli MP, Balestri A, Stoppacciaro A, Tiveron C, Tatangelo L, Giovarelli M, Gaetano C, Ruco L, Hoffman ES, Hayday AC, Lendahl U, Frati L, Gulino A, and Screpanti I. Constitutive activation of NF-kappaB and T-cell leukemia/lymphoma in Notch3 transgenic mice. EMBO J 19: 3337-3348, 2000.[CrossRef][ISI][Medline]
  8. DeSanti AM, McDowell EM, and Strum JM. Airway branching patterns and cytodifferentiation in cultured fetal hamster lung. Tissue Cell 24: 853-868, 1992.[CrossRef][ISI][Medline]
  9. Ellisen LW, Bird J, West DC, Soreng AL, Reynolds TC, Smith SD, and Sklar J. TAN-1, the human homolog of the Drosophila Notch gene, is broken by chromosomal translocations in T lymphoblastic neoplasms. Cell 66: 649-661, 1991.[CrossRef][ISI][Medline]
  10. Fehon RG, Johansen K, Rebay I, and Artavanis-Tsakonas S. Complex cellular and subcellular regulation of Notch expression during embryonic and imaginal development of Drosophila: implications for notch function. J Cell Biol 113: 657-669, 1991.[Abstract/Free Full Text]
  11. Gridley T. Notch signaling during vascular development. Proc Natl Acad Sci USA 98: 5377-5378, 2001.[Free Full Text]
  12. Hasserjian RP, Aster JC, Davi F, Weinberg DS, and Sklar J. Modulated expression of Notch1 during thymocyte development. Blood 88: 970-976, 1996.[Abstract/Free Full Text]
  13. Hicks C, Johnston SH, diSibio G, Collazo A, Vogt TF, and Weinmaster G. Fringe differentially modulates Jagged1 and Delta1 signalling through Notch1 and Notch2. Nat Cell Biol 2: 515-520, 2000.[CrossRef][ISI][Medline]
  14. Hilfer SR, Rayner RM, and Brown JW. Mesenchymal control of branching pattern in the fetal mouse lung. Tissue Cell 17: 523-538, 1985.[CrossRef][ISI][Medline]
  15. Ito T, Udaka N, Yazawa T, Okudela K, Hayashi H, Sudo T, Guillemot F, Kageyama R, and Kitamura R. Basic helix-loop-helix transcription factors regulate the neuroendocrine differentiation of fetal mouse pulmonary epithelium. Development 127: 3913-3921, 2000.[Abstract]
  16. Jaleco AC, Neves H, Hooijberg E, Gameiro P, Clode N, Haury M, Henrique D, and Parreira L. Differential effects of Notch ligands Delta-1 and Jagged-1 in human lymphoid differentiation. J Exp Med 194: 991-1002, 2001.[Abstract/Free Full Text]
  17. Jan YN and Jan LY. HLH proteins, fly neurogenesis, and vertebrate myogenesis. Cell 75: 827-830, 1993.[CrossRef][ISI][Medline]
  18. Jensen J, Pedersen EE, Galante P, Hald J, Heller RS, Ishibashi M, Kageyama R, Guillemot F, Serup P, and Madsen OD. Control of endodermal endocrine development by Hes-1. Nat Genet 24: 36-44, 2000.[CrossRef][ISI][Medline]
  19. Joutel A, Corpechot C, Ducros A, Vahedi K, Chabriat H, Mouton P, Alamowitch S, Domenga V, Cecillion M, Marechal E, Maciazek J, Vayssiere C, Cruaud C, Cabanis EA, Ruchoux MM, Weissenbach J, Bach JF, Bousser MG, and Tournier-Lasserve E. Notch3 mutations in CADASIL, a hereditary adult-onset condition causing stroke and dementia. Nature 383: 707-710, 1996.[CrossRef][Medline]
  20. Karanu FN, Murdoch B, Miyabayashi T, Ohno M, Koremoto M, Gallacher L, Wu D, Itoh A, and Sakano S. Human homologues of Delta-1 and Delta-4 function as mitogenic regulators of primitive human hematopoietic cells. Blood 97: 1960-1967, 2001.[Abstract/Free Full Text]
  21. King KA, Torday JS, and Sunday ME. Bombesin and [leu8]phyllolitorin promote fetal mouse lung branching morphogenesis via a receptor-mediated mechanism. Proc Natl Acad Sci USA 92: 4357-4361, 1995.[Abstract/Free Full Text]
  22. Klein T and Arias AM. Interactions among Delta, Serrate and Fringe modulate Notch activity during Drosophila wing development. Development 125: 2951-2962, 1998.[Abstract]
  23. Lammert E, Brown J, and Melton DA. Notch gene expression during pancreatic organogenesis. Mech Dev 94: 199-203, 2000.[CrossRef][ISI][Medline]
  24. Li L, Krantz ID, Deng Y, Genin A, Banta AB, Collins CC, Qi M, Trask BJ, Kuo WL, Cochran J, Costa T, Pierpont MEM, Rand EB, Piccoli DA, Hood L, and Spinner NB. Alagille syndrome is caused by mutations in human Jagged1, which encodes a ligand for Notch1. Nat Genet 16: 243-251, 1997.[CrossRef][ISI][Medline]
  25. Lindner V, Booth C, Prudovsky I, Small D, Maciag T, and Liaw L. Members of the Jagged/Notch gene families are expressed in injured arteries and regulate cell phenotype via alterations in cell matrix and cell-cell interaction. Am J Pathol 159: 875-883, 2001.[Abstract/Free Full Text]
  26. Lowell S and Watt FM. Delta regulates keratinocyte spreading and motility independently of differentiation. Mech Dev 107: 133-140, 2001.[CrossRef][ISI][Medline]
  27. Luo B, Aster JC, Hasserjian RP, Kuo F, and Sklar J. Isolation and functional analysis of a cDNA for human jagged2, a gene encoding a ligand for the Notch1 receptor. Mol Cell Biol 17: 6057-6067, 1997.[Abstract]
  28. McCright B, Gao X, Shen L, Lozier J, Lan Y, Maguire M, Herzlinger D, Weinmeister G, Jiang R, and Griedley T. Defects in development of the kidney, heart and eye vasculature in mice homozygous for a hypomorphic Notch2 mutation. Development 128 Suppl: 491-502, 2001.[Abstract]
  29. Metzger RJ and Krasnow MA. Genetic control of branching morphogenesis. Science 284: 1635-1639, 1999.[Abstract/Free Full Text]
  30. Montuenga LM, Springall DR, Gaer J, Winter RJD, Zhao L, McBride JT, Taylor KM, Barer G, and Polak JM. CGRP-immunoreactive endocrine cell proliferation in normal and hypoxic rat lung studied by immunocytochemical detection of incorporation of 5'-bromodeoxyuridine. Cell Tissue Res 268: 9-15, 1992.[CrossRef][ISI][Medline]
  31. Morrison SJ, Perez SE, Qiao Z, Verdi JM, Hicks C, Weinmaster G, and Anderson DJ. Transient Notch activation initiates an irreversible switch from neurogenesis to gliogenesis by neural crest stem cells. Cell 101: 499-510, 2000.[CrossRef][ISI][Medline]
  32. Panin VM, Papayannopoulos V, Wilson R, and Irvine KD. Fringe modulates Notch-ligand interactions. J Clin Invest 99: 1313-1321, 1997.[ISI][Medline]
  33. Pui JC, Allman D, Xu L, DeRocco S, Karnell FG, Bakkour S, Lee JY, Kadesch T, Hardy RR, Aster JC, and Pear WC. Notch 1 expression in early lymphopoiesis influences B versus T lineage determination. Immunity 11: 299-308, 1999.[CrossRef][ISI][Medline]
  34. Rangarajan A, Talora C, Okuyama R, Nicolas M, Mammucari C, Oh H, Aster JC, Krishna S, Metzger D, Chambon P, Miele L, Aguet M, Radtke F, and Dotto GP. Notch signaling is a direct determinant of keratinocyte growth arrest and entry into differentiation. EMBO J 20: 3427-3436, 2001.[CrossRef][ISI][Medline]
  35. Robey E, Chang D, Itano A, Cado D, Alexander H, Lans D, Weinmaster G, and Salmon P. An activated form of notch influences the choice between CD4 and CD8 T cell lineages. Cell 87: 483-492, 1996.[CrossRef][ISI][Medline]
  36. Schroeder T and Just U. Notch signalling via RBP-J promotes myeloid differentiation. EMBO J 19: 2558-2568, 2000.[CrossRef][ISI][Medline]
  37. Sestan N, Artavanis-Tsakonas S, and Rakie P. Contact-dependent inhibition of cortical neurite growth mediated by notch signaling. Science 286: 689-690, 1999.[Free Full Text]
  38. Ten Have-Opbroek AAW. Lung development in the mouse embryo. Exp Lung Res 17: 111-130, 1991.[ISI][Medline]
  39. Thompson RJ, Doran JF, Jackson P, Dhillon AP, and Rode J. PGP 9.5.: a new marker for vertebrate neurons and neuroendocrine cells. Brain Res 278: 224-228, 1983.[CrossRef][ISI][Medline]
  40. Wakamatsu Y, Maynard TM, and Weston JA. Fate determination of neural crest cells by NOTCH-mediated lateral inhibition and asymmetrical cell division during gangliogenesis. Development 127: 2811-2821, 2000.[Abstract]
  41. Warburton D, Lee M, Berberich M, and Bernfield M. Molecular embryology and the study of lung development. Am J Respir Cell Mol Biol 9: 5-9, 1993.[Medline]
  42. Willett CG, Smith DI, Shridhar V, Wang MH, Emanuel RL, Patidar K, Graham SA, Zhang F, Hatch V, Sugarbaker DJ, and Sunday ME. Differential screening of a human chromosome 3 library identifies hepatocyte growth factor-like/macrophage-stimulating protein and its receptor in injured lung. Possible implications for neuroendocrine cell survival. J Clin Invest 99: 2979-2991, 1997.[ISI][Medline]
  43. Yang Q, Bermingham NA, Finegold MJ, and Zoghbi HY. Requirement of Math1 for secretory cell lineage commitment in the mouse intestine. Science 294: 2155-2158, 2001.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Respir. Cell Mol. Bio.Home page
B. M. Levesque, S. Zhou, L. Shan, P. Johnston, Y. Kong, S. Degan, and M. E. Sunday
NPAS1 Regulates Branching Morphogenesis in Embryonic Lung
Am. J. Respir. Cell Mol. Biol., April 1, 2007; 36(4): 427 - 434.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
J. Deimling, K. Thompson, I. Tseu, J. Wang, R. Keijzer, A. K. Tanswell, and M. Post
Mesenchymal maintenance of distal epithelial cell phenotype during late fetal lung development
Am J Physiol Lung Cell Mol Physiol, March 1, 2007; 292(3): L725 - L741.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
M. van Tuyl, F. Groenman, M. Kuliszewski, R. Ridsdale, J. Wang, D. Tibboel, and M. Post
Overexpression of lunatic fringe does not affect epithelial cell differentiation in the developing mouse lung
Am J Physiol Lung Cell Mol Physiol, April 1, 2005; 288(4): L672 - L682.
[Abstract] [Full Text] [PDF]


Home page
Proc Am Thorac SocHome page
J. B. Smith and H. R. Herschman
Targeted Identification of Glucocorticoid-attenuated Response Genes: In Vitro and in Vivo Models
Proceedings of the ATS, November 1, 2004; 1(3): 275 - 281.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (9)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kong, Y.
Right arrow Articles by Sunday, M. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kong, Y.
Right arrow Articles by Sunday, M. E.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2004 by the American Physiological Society.