Am J Physiol Lung Cell Mol Physiol 286: L1143-L1153, 2004.
First published December 12, 2003; doi:10.1152/ajplung.00305.2003
1040-0605/04 $5.00
EDITORIAL FOCUS
VE-cadherin-p120 interaction is required for maintenance of endothelial barrier function
Seema Iyer,1
Deana M. Ferreri,1
Nina C. DeCocco,1
Fred L. Minnear,2 and
Peter A. Vincent1
1Center for Cardiovascular Sciences, Albany Medical College, Albany, New York 12208; and 2Department of Physiology and Pharmacology, School of Medicine, West Virginia University, Morgantown, West Virginia 26506
Submitted 3 September 2003
; accepted in final form 5 December 2003
 |
ABSTRACT
|
|---|
Interaction of p120 with juxtamembrane domain (JMD) of VE-cadherin has been implicated in regulation of endothelial cell-cell adhesion. We used a number of approaches to alter the level of p120 available for binding to VE-cadherin as a means to investigate the role of p120-VE-cadherin interaction in regulation of barrier function in confluent endothelial monolayers. Expression of an epitope-tagged fragment corresponding to JMD of VE-cadherin resulted in a decrease in endothelial barrier function as assessed by changes in albumin clearance and electrical resistance. Binding of JMD-Flag to p120 resulted in a decreased level of p120. In addition to decreasing p120 level, expression of JMD also decreased level of VE-cadherin. Expression of JMD also caused an increase in MLC phosphorylation and rearrangement of actin cytoskeleton, which, coupled with decreased cadherin, can contribute to loss of barrier function. Reducing p120 by siRNA resulted in a decrease in VE-cadherin, whereas increasing the level of p120 increased the level of VE-cadherin, demonstrating that p120 regulates the level of VE-cadherin. Overexpression of p120 was, however, associated with decreased barrier function and rearrangement of the actin cytoskeleton. Interestingly, expression of p120 was able to inhibit thrombin-induced increases in MLC phosphorylation, suggesting that p120 inhibits activation of Rho/Rho kinase pathway in endothelial cells. Excess p120 also prevented JMD-induced increases in MLC phosphorylation, correlating this phosphorylation with Rho/Rho kinase pathway. These findings show p120 plays a major role in regulating endothelial barrier function, as either a decrease or increase of p120 resulted in disruption of permeability across cell monolayers.
vascular endothelial cadherin; p120-catenin; endothelial cell permeability;
-catenin
A SINGLE LAYER OF ENDOTHELIAL CELLS lines the vasculature and acts as a restrictive barrier to control the movement of solutes and fluid from the blood to the tissues. The movement of solutes and fluid across the endothelium occurs primarily through two pathways, a transcellular pathway mediated by vesicular transport through the cell and a paracellular pathway that allows the passage of solutes through junctions between adjacent cells (36). One junction implicated in regulating the paracellular pathway in vascular endothelial (VE) cells is the adherens junction. Adherens junctions are formed through the interactions between cadherins, a family of functionally related transmembrane glycoproteins that mediate calcium-dependent, homotypic cell-cell adhesion (4). VE-cadherin (also known as cadherin-5) is expressed specifically in endothelial cells and has been implicated in regulating a number of endothelial cell functions, including migration (7), survival (9), proliferation (10), and most notably endothelial cell barrier function (12).
Regulation of cadherin function occurs through the interaction of its cytoplasmic tail with cytoplasmic proteins called catenins.
-Catenin, plakoglobin (
-catenin), and
-catenin work in concert to associate the cadherin complex with the actin cytoskeleton. These catenins play an essential role in endothelial function as attachment of cadherin to the actin cytoskeleton is required for the formation of a restrictive monolayer (25, 28). A fourth catenin, p120, associates with the cadherin cytoplasmic domain just proximal to the membrane, a region termed the juxtamembrane domain (JMD) (2, 16). p120-Catenin belongs to the armadillo family of proteins, which includes
-catenin and plakoglobin, and was initially identified as a Src substrate (2). Previous studies have presented conflicting roles for p120 in cadherin function. Some showed that p120 was required for strong cell adhesion (42), whereas others showed that p120 exerted a negative effect on adhesion strength (33). This discrepancy was resolved by studies showing that the phosphorylation state of p120 plays an important role in regulating cadherin function (5, 32). Indeed, phosphorylation of p120 on serine and threonine residues at the NH2 terminus results in a decrease in cell-cell adhesion, whereas inhibition of serine/threonine phosphorylation using staurosporine or deletion of the NH2 terminus results in an increase in cadherin-mediated cell-cell adhesion (5, 32). Together, these studies demonstrate the importance of the p120-JMD interaction in the regulation of cadherin function.
A recent study has shown that the deletion of eight amino acids in the core region of the JMD of VE-cadherin results in the loss of p120 binding and a decrease in the strength of cell-cell adhesion when this mutant VE-cadherin is expressed in Chinese hamster ovary cells (16). In addition, changes in p120 phosphorylation have been found after treatment of endothelial cells with inflammatory mediators. Both histamine and VEGF inhibit basal serine/threonine phosphorylation of p120 but have no effects on tyrosine phosphorylation (35, 39), whereas treatment of endothelial monolayers with thrombin leads to an increase in tyrosine phosphorylation of p120 (37). As each of these mediators has been found to decrease endothelial barrier function, the implication put forth by these studies is that changes in p120 phosphorylation or attachment of p120 to the JMD region of VE-cadherin will regulate endothelial barrier function. The direct effect of the p120-JMD interaction on the maintenance of endothelial barrier function, however, has not been tested in confluent endothelial cell monolayers. In addition, recent data in Drosophila suggest that adherens junction regulation occurs independently of p120 (27). Therefore, additional studies are required to elucidate the role of p120-cadherin interactions in cell function.
The goal of this study was to determine whether a loss of p120 binding to VE-cadherin in confluent monolayers would decrease endothelial barrier function. We used adenovirus to overexpress an epitope-tagged JMD of VE-cadherin as a means to compete p120 away from intact, endogenous VE-cadherin. Our studies indicate that displacement of p120 from cell borders on overexpression of the JMD results in an increase in permeability across the endothelial monolayer. Surprisingly, the loss of p120 was associated with a decrease in the level of VE-cadherin in the endothelial cells. Although coexpression of p120-green fluorescent protein (GFP) with the JMD was able to restore the VE-cadherin level, the simple reintroduction of the depleted p120 in endothelial cells did not reverse the loss of barrier function. This may be the result of free cytoplasmic p120, as the presence of excess p120 can also disrupt barrier function by changing the morphology of the monolayer. The changes caused by fluctuating catenin levels appear to be selective to p120-catenin, since increasing the level of plakoglobin did not alter VE-cadherin levels or endothelial barrier function.
 |
MATERIALS AND METHODS
|
|---|
DNA constructs.
The JMD fragment was generated by PCR from our cloned bovine VE-cadherin (GenBank accession no. AY363224) with the use of a sense primer with a Flag epitope tag, a 5 XhoI restriction site (ctcgaggccaccatggattacaaggatgacgacgataagcggaggcggctccggaagcag), an antisense primer with a stop codon, and a 3' XbaI restriction site (tctagattagggtgcatgcgccccgggcgc). PCR products were cloned into PCR 2.1 using a TOPO cloning kit (Invitrogen) according to the manufacturer's instructions. The JMD-Flag was subcloned into pAdTrack-CMV using XhoI and XbaI for adenoviral production. The p120-GFP construct and plakoglobin were generous gifts obtained from the laboratories of Dr. Keith Burridge and Dr. Andrew Kowalczyk, respectively. The p120-GFP and plakoglobin constructs were used to generate adenovirus.
Adenovirus.
Adenovirus was produced using the pAdEasy system described by He et al. (21). The pAdTrack-CMV, pShuttle-CMV shuttle vector, and pAdEasy-1 vector were kindly provided by Dr. B. Vogelstein. Recombinant adenovirus was amplified in QBI-293A cells and purified using cesium chloride gradients. Multiplicity of infection (MOI) was determined using the method described by O'Carroll et al. (31). Infection rates were also monitored by assessing GFP, which is expressed in tandem with the gene of interest. All infections of the gene of interest were accompanied by a control infection of virus expressing GFP alone using an MOI at or higher than the greatest viral number used in the experimental groups.
Cell culture.
Bovine pulmonary artery endothelial cells (BPAECs) and human umbilical vein endothelial cells (HUVECs) were purchased from VEC Technologies (Rensselaer, NY). BPAECs were grown in MEM (GIBCO BRL) supplemented with 20% FBS (Atlanta Biologicals) and penicillin-streptomycin (Pen/Strep, GIBCO BRL). Cells were split 1:3 every third day. HUVECs were grown in MCDB-131 (GIBCO BRL) supplemented with 10% FBS, endothelial growth supplement (EndoGro, VEC Technologies), and Pen/Strep. HUVECs were split 1:2 every 7 days. Cells for experiments were seeded at confluence (1 x 105 cells/cm2) and allowed to develop mature junctions over a 3-day period. BPAECs were used in all experiments except for the small interfering RNA (siRNA) experiment in which HUVECs were used. The human embryonic kidney cell line QBI-293A (Quantum Biotechnologies), used for production of adenovirus, was maintained in DMEM containing 10% FBS and Pen/Strep.
Treatments.
Thrombin (Enzyme Research Labs) was used at 7 U/ml (0.1 µM). Cells infected with GFP or p120 for 48 h were used, and the media were removed before addition of thrombin for 1 min. After being incubated for 1 min with thrombin, the media were aspirated, and the cells were lysed in sample buffer. For experiments involving treatment with Y-27632, cells were infected as per protocol, and 3 h after infection, the Y compound was added to the media at a final concentration of 1 µM. This treatment was repeated every 20 h for the duration of the infection, at which point the cells were lysed and the lysates analyzed by Western blotting.
Immunoprecipitation.
Cells were lysed in 1 ml (per 100-mm plate) of cytoskeletal preserving buffer lysis buffer (10 mM PIPES, 100 mM NaCl, 300 mM sucrose, 3 mM MgCl2, 0.5% Igepal, 1 mM PMSF, 5 µg/ml leupeptin, 2 µg/ml aprotinin, 1 mM sodium orthovanadate, and 1 mM EDTA), and the lysates were centrifuged at 14,000 g to clear debris. The supernatant was removed and placed into a fresh tube and incubated at 4°C for 1 h with the primary antibody to VE-cadherin (Alexis) or COOH terminus of p120 (Santa Cruz). Magnetic beads (DynaBeads-M450) coated with sheep anti-mouse (Dynal) Fc were added and incubated for an additional hour. The beads were washed 4x in lysis buffer. Bound proteins were removed by boiling in sample buffer, and the entire sample was resolved by SDS-PAGE.
siRNA.
Knockdown of p120 was performed using double-stranded RNA directed to target sequences determined using the siRNA Target Finder program provided by Ambion (Austin, TX). Four 21-nucleotide dsRNA were prepared to specific sites in p120 using the Silencer siRNA Construction kit (Ambion). HUVECs were transfected with the 21-nucleotide duplexes using Oligofectamine (Invitrogen) according to the manufacturer's instructions (1 µl of Oligofectamine/200 µl of Optimem containing target sequence). After 72 h, cells were scraped into sample buffer for immunoblot analysis.
Gel electrophoresis and immunoblotting.
Cell lysates were collected from endothelial monolayers and placed into Laemmli gel sample buffer (24). For myosin light chain (MLC) phosphorylation blots, NaF was added at a final concentration of 0.1 µM to the lysis buffer before lysis. Samples were run on SDS-PAGE and transferred onto nitrocellulose. Immunoblot analysis was performed using primary antibodies directed to the cytoplasmic domain of VE-cadherin (Santa Cruz), Flag epitope tag (Sigma),
-actin (Sigma), COOH terminus of p120 (Santa Cruz), phospho-Ser19/Thr18 MLC (MLC-DiPhos; generated by Strategic BioSolutions), and MLC (Santa Cruz). The following secondary antibodies were used for the appropriate primary antibody: horseradish peroxidase (HRP)-conjugated goat anti-mouse, HRP-conjugated rabbit anti-goat, and HRP-conjugated goat anti-rabbit (Jackson Immunochemicals). Specific protein bands were detected by enhanced chemiluminescence (Super Signal West Pico Chemiluminescent Substrate, Pierce). Blots were stripped and reprobed for
-actin to ensure proper loading.
Immunofluorescence microscopy.
Cells were seeded (1.2 x 105 cells/cm2) on 18-mm round glass coverslips, and mature junctions were allowed to establish over 3 days. After the experimental protocol, cells were washed once for 1 min with PBS+ (Dulbecco's PBS with Ca2+/Mg2+, pH 7.4, Cellgro) and fixed for 15 min with 3% formaldehyde in PBS+. After being rinsed once with PBS+, cells were permeabilized with HEPES+ (300 mM sucrose, 50 mM NaCl, 1.4 mM MgCl2, and 40 mM HEPES) containing 0.5% Triton X-100 for 5 min on ice. After being washed 3x with PBS+ for 1 min, cells were blocked with 2% BSA, 50 mM glycine, and 0.2% Tween 20 in PBS+ for 1 h at room temperature. Primary antibodies (VE-cadherin, Santa Cruz and p120, Santa Cruz) were applied in 0.2% BSA, 50 mM glycine, and 0.2% Tween 20 in PBS+ and incubated overnight at 4°C. Cells were then washed 3x for 1 min in PBS+. Secondary antibodies conjugated to fluorescent probes (rhodamine red X-conjugated rabbit anti-goat or goat anti-rabbit, Jackson Immunochemicals, and Alexa Fluor 594 donkey anti-goat, Molecular Probes) were applied for 1 h at room temperature. Cells were washed 4x with PBS+ for 5 min per wash and mounted using the ProLong Antifade kit (Molecular Probes) or Gel Mount (Biomedia).
Protein permeability.
Endothelial permeability to albumin was determined by measuring 125I-labeled albumin clearance (in µl/min) as described by Cooper et al. (11) and as previously reported from this laboratory (22). Endothelial barrier function was also assessed using an electric cell-substrate impedance sensor (ECIS) to measure real-time changes in electrical resistance across endothelial cell monolayers. ECIS has been previously described in detail by Giaever and Keese (19) and has been used extensively to assess changes in endothelial barrier function (18, 22). Cells are plated on a small gold electrode (103 cm2), and culture medium is used as an electrolyte. The major impedance at 4,000 Hz is found at the electrode-electrolyte interface, allowing the morphology of cells seeded at this interface to be assessed. The small electrode and the larger counter electrode are connected to a phase-sensitive lock-in amplifier. A 1-V, 4,000-Hz alternate current signal is then supplied through a 1-M
resistor to approximate a constant current. This has the advantage of having the measured in-phase voltage proportional to the resistance and the out-of-phase voltage proportional to the reactance.
 |
RESULTS
|
|---|
The binding of p120 to VE-cadherin has been shown to enhance the strength of cell-cell adhesion and to be required for the contact inhibition observed with formation of VE-cadherin-mediated cell-cell junctions (16). As shown in Fig. 1A, p120 binds to VE-cadherin in confluent monolayers of BPAECs. Immunoprecipitation of VE-cadherin coprecipitates p120, but this complex does not include paxillin, an abundant protein associated with the cytoskeleton through integrins. To determine whether binding of p120 is required for VE-cadherin to maintain barrier function, we generated a fragment corresponding to the JMD, amino acids 600697 of bovine VE-cadherin (GenBank accession no. AY363224), to compete p120 away from endogenous VE-cadherin (Fig. 1B). This fragment contained a Flag epitope tag on the COOH terminus (Fig. 1B) and was cloned into an adenoviral vector using the pAdEasy system of He et al. (21). This adenovirus expresses GFP as a means to track infection, and as seen in Fig. 1C, adenoviral infection of a confluent monolayer resulted in protein expression in 9599% of the cells. Increases in the number of infectious adenoviral particles resulted in increases in JMD protein expression as assessed using antibodies against the Flag epitope tag (Fig. 1D). Immunoprecipitation of JMD-Flag with antibodies to the Flag epitope tag pulled down p120, demonstrating that the JMD peptide does bind to p120 and would compete with endogenous VE-cadherin for p120 binding (Fig. 1E).

View larger version (50K):
[in this window]
[in a new window]
|
Fig. 1. Production and characterization of epitope-tagged juxtamembrane domain (JMD). A: uninfected cells were lysed in a cytoskeleton preserving buffer, and lysates were used to immunoprecipitate (IP) with beads alone or with antibodies to vascular endothelial (VE)-cadherin (VE-cad) or p120. Western blots for p120, VE-cadherin, or paxillin detected specific complexes of VE-cadherin and p120. Blot is representative of 2 separate experiments. B: schematic of full-length VE-cadherin and JMD tagged with Flag epitope tag. JMD spans 98 amino acids (AA 600697) from full-length sequence. C: endothelial monolayers were infected with either green fluorescent protein (GFP) or JMD adenovirus at multiplicity of infection (MOI) = 100 for 24 h. Monolayers were viewed for fluorescence under live conditions showing that 90100% of cells were infected and expressing GFP. Bar = 200 µm. D: Western blot of lysates generated from cells infected with MOI = 5, 20, 50, or 100 of either GFP adenovirus (lanes 14) or JMD adenovirus (lanes 58) for 24 h. Blot was probed with Flag antibody (Ab) that detects the Flag epitope tag on JMD fragment. Blot is representative of 3 separate experiments. E: cell lysates were collected 24 h after infection with either GFP or JMD adenovirus. Immunoprecipitation was performed with either beads alone or with Flag IgG-coated beads. Western blots for p120 show that JMD-Flag coprecipitates with p120. Blot is representative of 3 separate experiments. IB, immunoblot.
|
|
To determine whether expression of the JMD peptide would disrupt the barrier function of endothelial monolayers, we measured changes in electrical resistance using an ECIS and changes in albumin clearance across the monolayer using a Transwell filter assay. ECIS was performed to determine the time course of the JMD-induced change in electrical resistance. A decrease in barrier function of the endothelial monolayer began
20 h postadenoviral infection using an MOI of 50 (Fig. 2A). Increased levels of JMD expression produced proportional decreases in electrical resistance, and the decrease in electrical resistance occurred earlier in monolayers infected with an MOI of 100 (Fig. 2A). The measurement of albumin clearance allowed us to determine the effect of JMD expression on changes in protein flux across a confluent endothelial monolayer. Monolayers were infected with either the JMD virus (MOI 100), a control virus containing only GFP (MOI 100), or were left uninfected and incubated for 24 h. Expression of the JMD resulted in a fourfold increase in albumin permeability across the endothelial monolayer compared with infection with the control GFP virus (Fig. 2B).
Previous investigations using mutant VE-cadherin with the p120 binding site deleted have demonstrated that VE-cadherin can localize at sites of cell-cell adhesion independently of p120 even though the strength of cell-cell adhesion is diminished (16). Immunofluorescence microscopy was used to determine whether JMD expression would displace p120 from the cell-cell junction without affecting the localization of VE-cadherin. As shown in Fig. 3A, both p120 and VE-cadherin localized to sites of cell-cell contacts in control monolayers infected with GFP virus. Expression of JMD resulted in a loss of p120 from the cell-cell junctions consistent with p120 binding to the freely soluble, cytoplasmic JMD fragment. Interestingly, there was also a loss of VE-cadherin from the cell borders, indicating that the loss of p120 is accompanied by a loss of VE-cadherin from the cell-cell junction.

View larger version (85K):
[in this window]
[in a new window]
|
Fig. 3. JMD expression results in loss of p120 and VE-cadherin. A: confluent monolayers were infected with either GFP adenovirus (left) or JMD adenovirus (right). At 48 h postinfection, cells were fixed in formaldehyde, permeabilized with Triton X-100, and processed for immunofluorescence microscopy using antibodies directed against either p120 (top) or VE-cadherin (bottom). Bar = 50 µm. B: cells were infected for 24 h with either GFP adenovirus (lanes 14) or JMD adenovirus (lanes 58) at MOI = 5, 20, 50, and 100, and lysates were immunoblotted for p120, VE-cadherin, and Flag. Blot is representative of 3 separate experiments.
|
|
Western blot analysis was used to determine whether the loss of immunofluorescent staining from cell borders was due to depletion of the protein levels of p120 and/or VE-cadherin or due to a displacement of p120 and VE-cadherin from the cell-cell junction. Increasing levels of GFP viral load did not have any effect on the levels of either p120 or VE-cadherin in endothelial cells 24 h postinfection (Fig. 3B). However, as the level of JMD was increased in the cells, there was a concurrent loss of both p120 and VE-cadherin in the infected cells (Figs. 3B and 4, A and B). This effect was not a result of differences in protein load, viral dose, or GFP expression, since a fivefold greater infection with the control GFP virus at 48 h postinfection showed no changes in p120 or VE-cadherin (Fig. 4A). The loss of p120 was associated with an increase in the level of a 35-kDa fragment of p120-catenin that was specific to expression of the JMD (Fig. 4A). The loss of VE-cadherin in JMD-expressing endothelial cells was not a global effect on all cadherins but was specific to VE-cadherin, as JMD-Flag, even at 48 h postinfection, did not affect the level of neural (N)-cadherin, another cadherin expressed in bovine endothelial cells (Fig. 4B). In addition, JMD expression did not have a significant effect on the protein levels of
-catenin (Fig. 4B),
-catenin, or plakoglobin (data not shown).
The decrease in VE-cadherin coupled with the decrease in p120 suggested that the availability of p120 could determine the level of VE-cadherin within the endothelial cell. To test this hypothesis, we used siRNA to knock down the level of p120. Two target sequences were generated and transfected into HUVEC monolayers. Target sequence 114 (5'-AACGAGGTTATCGCTGAGAAC-3') reduced the level of p120 by 100% compared with cells treated with Oligofectamine alone when normalized to
-actin (Fig. 4C). Target sequence 114 also reduced the level of VE-cadherin by 98% in conjunction with decreasing the level of p120. A second target sequence (lane 75) slightly reduced the levels of p120 and VE-cadherin. Other experiments using the Ambion Silencer negative control siRNA did not result in a loss of p120 or VE-cadherin (data not shown), demonstrating the specificity of the siRNA response.
A p120-GFP adenovirus was used to coexpress exogenous p120 in confluent monolayers that were also expressing JMD (Fig. 5B). Expression of p120-GFP could be detected as a third band when probed with a p120 antibody and a specific single band when GFP was detected (Fig. 5A). Coexpression of p120 with JMD resulted in the reversal of the decrease in VE-cadherin level, demonstrating that the removal of p120, as opposed to other molecules that may bind to the JMD region, is responsible for the decrease in VE-cadherin (Fig. 5B). In addition to maintaining the level of VE-cadherin, coexpression of p120 with JMD prevented the loss of VE-cadherin at cell-cell junctions as viewed by immunofluoresence microscopy (Fig. 5C).

View larger version (78K):
[in this window]
[in a new window]
|
Fig. 5. Expression of p120 rescues JMD-induced loss of VE-cadherin. A: confluent monolayers were infected for 48 h with either GFP adenovirus or p120-GFP adenovirus (MOI = 4). Lysates were IB for p120 to show endogenous isoforms of p120/p100 and for GFP to show expression of p120-GFP. Blot is representative of 3 separate experiments. B: cells were infected for 48 h with GFP adenovirus, JMD adenovirus (MOI = 100), p120-GFP adenovirus (MOI = 4), or JMD adenovirus plus increasing MOI of p120-GFP adenovirus. Lysates were IB for VE-cadherin to test the ability of p120 to rescue JMD-induced decrease in VE-cadherin (top) and for p120 (bottom) to show expression of p120 and p120 in the presence of JMD. Blot is representative of 3 separate experiments. C: cells were infected with either GFP adenovirus (left), JMD adenovirus MOI = 100 (middle), or JMD adenovirus MOI = 100 and p120-GFP adenovirus MOI = 4 (right) for 48 h. After being infected, cells were fixed, permeabilized, and processed for immunofluorescence microscopy using antibodies against VE-cadherin. Bar = 50 m. Images in C are representative of 3 separate experiments.
|
|
Interestingly, we were unable to prevent the decrease in barrier function by the coexpression of p120-GFP with JMD (data not shown). To determine whether other factors were altered by the expression of JMD, we assessed changes in the actin cytoskeleton. Expression of JMD induced a rearrangement in actin fibers with a loss of the peripheral band and an increase in actin stress fibers as shown by immunofluorescence microscopy (Fig. 6A). Increases in stress fiber formation led us to determine whether JMD expression increased MLC phosphorylation. Indeed, expression of JMD increased the levels of MLC phosphorylation (Fig. 6, B and C). The increase in MLC phosphorylation requires the activity of Rho kinase, as treatment with the Rho kinase inhibitor Y-27632 reversed MLC phosphorylation (Fig. 6, B and C).

View larger version (80K):
[in this window]
[in a new window]
|
Fig. 6. Expression of JMD causes rearrangement of the actin cytoskeleton and increases myosin light chain (MLC) phosphorylation. A: confluent monolayers were infected with either GFP adenovirus (left) or JMD adenovirus MOI = 100 (right) for 48 h. After being infected, cells were fixed, permeabilized, and processed for immunofluorescence microscopy using Alexa Fluor-phalloidin to detect actin. Top: images at x40 magnification (mag); bottom: images at x60 magnification (bar = 50 µm). Images are representative of 3 separate experiments. B: confluent monolayers were infected for 48 h with either GFP adenovirus MOI = 100 or JMD adenovirus MOI = 100 and were either left untreated or treated with 0.1 µM Y-27632 (Y), a Rho kinase inhibitor. Lysates were immunoblotted for MLC-DiPhos. Blot is representative of 3 separate experiments. C: immunoblots for MLC-DiPhos and total MLC were quantitated by densitometric scanning. Values for MLC-DiPhos blots were normalized to total MLC, and data are presented as means ± SE for 3 experiments.
|
|
To further investigate the inability of p120 coexpression with JMD to rescue barrier function, p120-GFP alone was expressed in confluent endothelial monolayers. As shown in Fig. 7A, increases in the expression of p120 resulted in corresponding increases in the level of VE-cadherin. This response was specific to p120, as overexpression of plakoglobin did not produce similar increases in VE-cadherin (Fig. 7B). The increase in VE-cadherin induced by the expression of p120 did not result in an increase in barrier function but caused a decrease in electrical resistance, indicating a disruption of monolayer integrity (Fig. 7C). Similar to the response of VE-cadherin, the decrease in electrical resistance was specific to p120, as increasing the levels of plakoglobin did not alter the electrical resistance (Fig. 7D).

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 7. Expression of p120-GFP increases VE-cadherin but decreases barrier function. A: lysates of cells infected with either GFP or p120-GFP adenovirus MOI = 1, 2, 3, and 4 for 48 h were probed for VE-cadherin and p120. Blot is representative of 3 separate experiments. B: lysates of cells infected with GFP or plakoglobin (plak) adenovirus MOI = 1, 2, 3, and 4 for 48 h were probed for VE-cadherin and plakoglobin (g-cat). Blot is representative of 3 separate experiments. C: confluent monolayers were treated with no virus (+), GFP ( ), p120-GFP adenovirus MOI = 1 ( ), p120 MOI = 2 ( ), p120 MOI = 3 ( ), or p120 MOI = 4 ( ), and changes in electrical resistance were monitored for 48 h on ECIS. Data are plotted as means ± SE (minimum n = 3 per group) at 2-h intervals. D: confluent monolayers were treated with no virus, GFP, plak adenovirus MOI = 1 ( ), plak MOI = 2 ( ), plak MOI = 3 ( ), or plak MOI = 4 ( ), and changes in electrical resistance were monitored for 48 h on ECIS. Data are plotted as means ± SE (minimum n = 3 per group) at 2-h intervals.
|
|
The decrease in electrical resistance produced by overexpression of p120 was associated with changes in the morphology of endothelial cells within the monolayer (Fig. 8). We assessed changes in the actin cytoskeleton to determine whether these changes contributed to the loss of electrical resistance found with p120 expression. Expression of p120 resulted in a loss in the peripheral actin bands but did not show an increase in thick stress fibers as seen with JMD expression. In addition, no increase in MLC phosphorylation was observed (Fig. 9). The presence of excess p120 in the cytoplasm has been linked with an inhibition of the activity of the small GTPase Rho (1). To test whether p120 inhibits Rho-GTPase in endothelial cells, we used thrombin to increase MLC phosphorylation, which is known to require Rho/Rho kinase activation (15). As shown in Fig. 9, the thrombin-induced increase in MLC phosphorylation can indeed be inhibited by the presence of excess p120. If JMD-induced MLC phosphorylation (Fig. 6, B and C) is occurring through Rho/Rho kinase similar to the thrombin pathway, then overexpression of p120 should inhibit the JMD-induced increase in MLC phosphorylation as it did with thrombin (Fig. 9A). The data in Fig. 9B show that JMD-induced MLC phosphorylation can in fact be reversed by introduction of high levels of p120 expression, consistent with the inhibition of MLC phosphorylation by the Rho kinase inhibitor Y-27632 (Fig. 6).

View larger version (127K):
[in this window]
[in a new window]
|
Fig. 8. Expression of p120-GFP causes rearrangement of the actin cytoskeleton. Confluent monolayers were infected with either GFP adenovirus (A and C) or p120 adenovirus (B and D). Monolayers were prepared for immunofluorescence 48 h after infection. Images show differences in cell morphology between cells infected with GFP adenovirus vs. p120 adenovirus when observed by immunofluorescent staining of VE-cadherin (A and B) and actin (C and D). Bar = 50 µm.
|
|

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 9. Excess p120 in the cytoplasm can inhibit thrombin-induced MLC phosphorylation and JMD-induced MLC phosphorylation. A: confluent monolayers were infected for 48 h with either GFP adenovirus MOI >8 or p120-GFP adenovirus MOI = 8 and were either left untreated or were treated with 7 U/ml (0.1 µm) of thrombin. Lysates were immunoblotted for MLC-DiPhos. Blot is representative of 3 separate experiments. Bar graph is the densitometric analysis of all the experiments in which the MLC-DiPhos blots were normalized to total MLC, and the average of the 3 separate experiments are represented as arbitrary densitometric units. B: confluent monolayers were infected for 48 h with GFP adenovirus, JMD adenovirus MOI = 100, p120-GFP adenovirus MOI = 8, or JMD adenovirus plus p120-GFP adenovirus MOI = 8. Lysates were immunoblotted for MLC-DiPhos. Blot is representative of 3 separate experiments. Bar graph is the densitometric analysis of all the experiments in which the MLC-DiPhos blots were normalized to total MLC, and the average of the 3 separate experiments are represented as arbitrary densitometric units.
|
|
 |
DISCUSSION
|
|---|
We have used the overexpression of the JMD region of VE-cadherin as a method to disrupt the interaction of p120 with endogenous VE-cadherin. Previous investigations have used expression of extracellular deleted mutants of epithelial (E)- or N-cadherin to decrease the level of endogenous cadherin (29, 43). Interestingly, Nieman et al. (29) found that only membrane-associated cadherin cytoplasmic domains would change epithelial phenotype and decrease cadherin levels. These investigators used the development of stable cell lines to study the role of soluble, dominant negative cadherin cytoplasmic domains in cadherin function. When expressed, these soluble, dominant negative cytoplasmic domains bound to
-catenin,
-catenin, and plakoglobin; however, it was not apparent that the level of soluble peptide was high enough to compete for catenin binding to endogenous cadherin. In addition, changes in p120 were not assessed. We used adenovirus to deliver the JMD construct to confluent endothelial monolayers, resulting in high levels of expression that could compete with endogenous cadherin for binding to p120. This is supported by experiments showing that the expressed JMD-Flag bound to p120 (Fig. 1E) and that this binding caused a decrease in p120 level (Figs. 3B and 4A). The restoration of VE-cadherin by the coexpression of p120 with JMD (Fig. 5B) further demonstrates that JMD competes for p120 binding with endogenous VE-cadherin. Interestingly, exogenous expression of p120 alone also increases VE-cadherin, suggesting that p120 level affects the level of VE-cadherin in endothelial cell monolayers.
The decrease in p120 level by the expression of JMD may have been the result of degradation, as the loss was associated with the appearance of a low-molecular-weight fragment of p120 (Fig. 4A). Binding of
-catenin to cadherins has been shown to protect
-catenin from degradation through the ubiquitin-proteasome pathway and to prevent this protein from acting as a transcriptional regulator of the T-cell factor/lymphoid enhancer factor signaling pathway (44). Soluble cytoplasmic p120 has also been implicated in transcriptional regulation through interaction with the transcriptional repressor Kaiso (34). A degradation pathway for p120 similar to that for
-catenin has yet to be identified but is suggested by the appearance of a p120 fragment of
35 kDa on JMD expression. This is further supported by the appearance of similar low-molecular-weight fragments of p120 on expression of p120-GFP (data not shown), as overexpression may result in the presence of freely soluble p120 in the cytoplasm of endothelial cell monolayers. As shown in Fig. 4B,
-catenin levels did not drop upon JMD expression. This may be due to
-catenin binding to N-cadherin, which was also not depleted by the expression of JMD, and demonstrates that
-catenin can bind cadherins in the absence of p120.
The decrease in p120 following JMD expression was associated with a loss of VE-cadherin as shown by a lack of VE-cadherin staining at cell-cell junctions (Fig. 3A) and by a decrease in VE-cadherin content in Western blots (Figs. 3B and 4, A and B). The decrease in VE-cadherin level may be due to its entrance into a degradative pathway. Recently, Xiao et al. (41) found that expression of the membrane-associated cytoplasmic domain of VE-cadherin increases the endocytosis and degradation of VE-cadherin in microvascular endothelial cells. A second publication from this group has now shown that binding of p120 to the JMD of VE-cadherin prevents the endocytosis of VE-cadherin and maintains VE-cadherin level in endothelial cells (40). Endocytosis has been shown to regulate the E-cadherin level in epithelial cells. In epithelial cells expressing activated Src, internalized E-cadherin is targeted for degradation via a process that requires binding of Hakai, an E3 ubiquitin ligase, to the JMD of E-cadherin (17). Alternatively, E-cadherin can be internalized and recycled to the cell surface (26). The fate of VE-cadherin appears to depend on endocytosis. Further studies should allow for the endocytic pathways to be elucidated.
The ability of p120 binding to regulate the level of VE-cadherin is further supported by the finding that depletion of p120 by siRNA results in a loss of VE-cadherin (Fig. 4C), whereas the overexpression of p120 increases the level of VE-cadherin (Figs. 5B and 6A). This is consistent with the findings from the Reynolds laboratory (13, 23) where it has been demonstrated that depletion of p120 using siRNA decreases the level of E-cadherin in tumor cells, VE-cadherin in aortic endothelial cells, and N-cadherin in cardiac myocytes. Although we also found a decrease in VE-cadherin upon depletion of p120 with siRNA as well as with JMD expression, the loss of p120 did not decrease the level of N-cadherin in JMD-expressing cells (Fig. 4B). This suggests that endothelial cells process cadherins differently than myocytes; in endothelial cells, the level of VE-cadherin is dependent on p120, whereas the level of N-cadherin does not require the presence of p120. The maintenance of VE-cadherin level by the interaction of p120 with VE-cadherin may not be specific to p120 but may also result from the binding of other proteins to the JMD region. This is suggested by the ability of p0071 overexpression to also increase the level of VE-cadherin (A. Kowalczyk, personal communication). p0071 is a member of the p120 family consisting of p120,
-catenin, armadillo repeat gene deleted in velo-cardio-facial syndrome, and plakophilin that was recently found to associate with VE-cadherin at the same site as p120 (8). One should note, however, that although p0071 can bind to the JMD of VE-cadherin, the level of p0071 or other p120 family members in human endothelial cells (HUVECs and human dermal microvascular endothelial cells) is not sufficient to maintain the levels of VE-cadherin on decreases in the level of p120.
The decrease in barrier function induced by the expression of JMD was not solely the result of a loss of VE-cadherin. As shown in Fig. 6, JMD expression also resulted in rearrangement of the actin cytoskeleton and an increase in MLC phosphorylation. The morphological changes of endothelial monolayers observed in Fig. 6 are similar to those observed after the addition of an inflammatory mediator such as thrombin or transforming growth factor-
, both of which decrease monolayer integrity through changes in the actin cytoskeleton (14, 22). Coexpression of p120 with the JMD restored the level of VE-cadherin but did not prevent the decrease in barrier function. Interestingly, overexpression of p120-GFP alone resulted in the elevation of VE-cadherin level and decrease in endothelial barrier function (Fig. 7C). The loss of monolayer integrity caused by p120 overexpression or by expression of the JMD may be due to the effects of p120 on the activity of small GTPases and on the actin cytoskeleton (3).
Overexpression of p120 in fibroblasts results in an extensive branching phenotype that is associated with a decrease in RhoA activity (1). In addition to inhibiting RhoA, p120 overexpression results in activation of Rac1 and Cdc42 (30). An increase in Rac1 activity has been shown to decrease endothelial monolayer integrity, whereas changes in Cdc42 or Rho activity do not appear to change basal endothelial monolayer permeability (38). Interestingly, overexpression of p120 in sparse cultures of Madin-Darby canine kidney (MDCK) cells disrupted adherens junction structure, as assessed by alterations in immunofluorescent staining of p120 (20), similar to the changes in VE-cadherin and in cell shape that we observed (Fig. 8). In contrast to sparse cultures, overexpression of p120 in dense cultures of MDCK cells did not alter adherens junction morphology. We have shown that p120 overexpression in monolayers that had been confluent for a minimum of 48 h before infection did produce changes in cell morphology characterized by a loss of actin peripheral bands (Fig. 8). The different response of confluent endothelial cells compared with confluent epithelial cells may be due to the differences in the responses of these cells to small GTPases. Indeed, Braga et al. (6) demonstrated that Rho activity is required for the formation of adherens junctions in epithelial cells but not in endothelial cells. Although some actin fibers are found in cells expressing p120-GFP, the fibers are not as thick as the fibers that result from JMD expression. This is consistent with the lack of change or slight decrease in MLC phosphorylation found after expression of p120. We used activation of endothelial cells by thrombin to determine whether p120 could inhibit increases in MLC phosphorylation known to require activation of the Rho/Rho kinase pathway (15). As shown in Fig. 9, overexpression of p120 was able to inhibit the thrombin-induced increase in MLC phosphorylation. This is similar to the findings that show p120 inhibits the increase in Rho activity after addition of lysophosphatidic acid to 293T cells (1). Interestingly, the increase in MLC phosphorylation observed upon JMD expression was also inhibited by the coexpression of p120 and JMD. This suggests that the JMD region of VE-cadherin can activate the Rho/Rho kinase pathway, consistent with the ability of the Rho kinase inhibitor Y-27632 to inhibit JMD-induced increases in MLC phosphorylation. Together, the experiments in Figs. 6 and 9 demonstrate that the JMD region of VE-cadherin and p120 can act together to regulate changes in the actin cytoskeleton, potentially through changes in the activity of small Rho GTPases. Ongoing studies in our laboratory are investigating possible mechanisms for this regulation.
The studies reported here demonstrate that the interaction of p120 with VE-cadherin is required for the maintenance of endothelial barrier function. We have demonstrated that inhibition of p120 binding to VE-cadherin, by competitive binding or by depletion with siRNA, results in a decrease in the level of VE-cadherin and a loss of barrier function. In addition to the loss of VE-cadherin, expression of the JMD peptide also increases MLC phosphorylation and actin rearrangement, both of which are known to contribute to alterations in endothelial barrier function. Conversely, when p120 expression exceeds the binding capacity of VE-cadherin, allowing for p120 to be soluble in the cytoplasm of the endothelial cell, there is also a loss of barrier function. This may also be due to changes in the activity of small GTPases, as thrombin-induced MLC phosphorylation, known to require Rho/Rho kinase activity, is inhibited by p120 expression. Together, the findings presented in this study demonstrate that the interaction of p120 with the JMD of VE-cadherin may serve to regulate endothelial monolayer integrity by regulating the levels of VE-cadherin and the actin cytoskeleton.
 |
GRANTS
|
|---|
This study was supported by National Heart, Lung, and Blood Institute (NHLBI) Grants K02-HL-04332, R29-HL-54206 (to P. A. Vincent), and R01-HL-68079 (to F. L. Minnear). S. Iyer was supported by a predoctoral fellowship from the American Heart Association (0110125T) and by NHLBI predoctoral training Grant T32-HL-07194.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Dr. Andrew Kowalczyk for critical review of this paper. We also thank Wendy Hobb and Debbie Moran for efforts in preparation of this manuscript.
 |
FOOTNOTES
|
|---|
Address for reprint requests and other correspondence: P. A. Vincent, Center for Cardiovascular Sciences (Mail Code 8), Albany Medical College, 47 New Scotland Ave., Albany, NY 12208 (E-mail: vincenp{at}mail.amc.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
 |
REFERENCES
|
|---|
- Anastasiadis PZ, Moon SY, Thoreson MA, Mariner DJ, Crawford HC, Zheng Y, and Reynolds AB. Inhibition of RhoA by p120 catenin. Nat Cell Biol 2: 637644, 2000.[CrossRef][Web of Science][Medline]
- Anastasiadis PZ and Reynolds AB. The p120 catenin family: complex roles in adhesion, signaling and cancer. J Cell Sci 113: 13191334, 2000.[Abstract]
- Anastasiadis PZ and Reynolds AB. Regulation of Rho GTPases by p120-catenin. Curr Opin Cell Biol 13: 604610, 2001.[CrossRef][Web of Science][Medline]
- Angst BD, Marcozzi C, and Magee AI. The cadherin superfamily: diversity in form and function. J Cell Sci 114: 629641, 2001.[Abstract]
- Aono S, Nakagawa S, Reynolds AB, and Takeichi M. p120(ctn) acts as an inhibitory regulator of cadherin function in colon carcinoma cells. J Cell Biol 145: 551562, 1999.[Abstract/Free Full Text]
- Braga VM, Del Maschio A, Machesky L, and Dejana E. Regulation of cadherin function by Rho and Rac: modulation by junction maturation and cellular context. Mol Biol Cell 10: 922, 1999.[Abstract/Free Full Text]
- Breviario F, Caveda L, Corada M, Martin-Padura I, Navarro P, Golay J, Introna M, Gulino D, Lampugnani MG, and Dejana E. Functional properties of human vascular endothelial cadherin (7B4/cadherin-5), an endothelium-specific cadherin. Arterioscler Thromb Vasc Biol 15: 12291239, 1995.[Abstract/Free Full Text]
- Calkins CC, Hoepner BL, Law CM, Novak MR, Setzer SV, Hatzfeld M, and Kowalczyk AP. The armadillo family protein p0071 is a VE-cadherin- and desmoplakin-binding protein. J Biol Chem 278: 17741783, 2003.[Abstract/Free Full Text]
- Carmeliet P, Lampugnani MG, Moons L, Breviario F, Compernolle V, Bono F, Balconi G, Spagnuolo R, Oostuyse B, Dewerchin M, Zanetti A, Angellilo A, Mattot V, Nuyens D, Lutgens E, Clotman F, de Ruiter MC, Gittenberger-de Groot A, Poelmann R, Lupu F, Herbert JM, Collen D, and Dejana E. Targeted deficiency or cytosolic truncation of the VE-cadherin gene in mice impairs VEGF-mediated endothelial survival and angiogenesis. Cell 98: 147157, 1999.[CrossRef][Web of Science][Medline]
- Caveda L, Martin-Padura I, Navarro P, Breviario F, Corada M, Gulino D, Lampugnani MG, and Dejana E. Inhibition of cultured cell growth by vascular endothelial cadherin (cadherin-5/VE-cadherin). J Clin Invest 98: 886893, 1996.[Web of Science][Medline]
- Cooper JA, Del Vecchio PJ, Minnear FL, Burhop KE, Selig WM, Garcia JGN, and Malik AB. Measurement of albumin permeability across endothelial monolayers in vitro. J Appl Physiol 62: 10761083, 1987.[Abstract/Free Full Text]
- Corada M, Liao F, Lindgren M, Lampugnani MG, Breviario F, Frank R, Muller WA, Hicklin DJ, Bohlen P, and Dejana E. Monoclonal antibodies directed to different regions of vascular endothelial cadherin extracellular domain affect adhesion and clustering of the protein and modulate endothelial permeability. Blood 97: 16791684, 2001.[Abstract/Free Full Text]
- Davis MA, Ireton RC, and Reynolds AB. A core function for p120-catenin in cadherin turnover. J Cell Biol 163: 525534, 2003.[Abstract/Free Full Text]
- DeMichele MAA and Minnear FL. Modulation of vascular endothelial permeability by thrombin. Semin Thromb Hemost 18: 287295, 1992.[Web of Science][Medline]
- Essler M, Amano M, Kruse HJ, Kaibuchi K, Weber PC, and Aepfelbacher M. Thrombin inactivates myosin light chain phosphatase via Rho and its target Rho kinase in human endothelial cells. J Biol Chem 273: 2186721874, 1998.[Abstract/Free Full Text]
- Ferber A, Yaen C, Sarmiento E, and Martinez J. An octapeptide in the juxtamembrane domain of VE-cadherin is important for p120ctn binding and cell proliferation. Exp Cell Res 274: 3544, 2002.[CrossRef][Web of Science][Medline]
- Fujita Y, Krause G, Scheffner M, Zechner D, Leddy HE, Behrens J, Sommer T, and Birchmeier W. Hakai, a c-Cbl-like protein, ubiquitinates and induces endocytosis of the E-cadherin complex. Nat Cell Biol 4: 222231, 2002.[CrossRef][Web of Science][Medline]
- Gainor JP, Morton CA, Roberts JT, Vincent PA, and Minnear FL. Platelet-conditioned medium increases endothelial electrical resistance independently of cAMP/PKA and cGMP/PKG. Am J Physiol Heart Circ Physiol 281: H1992H2001, 2001.[Abstract/Free Full Text]
- Giaever I and Keese CR. Micromotion of mammalian cells measured electrically. Proc Natl Acad Sci USA 88: 78967900, 1991.[Abstract/Free Full Text]
- Grosheva I, Shtutman M, Elbaum M, and Bershadsky AD. p120 catenin affects cell motility via modulation of activity of Rho-family GTPases: a link between cell-cell contact formation and regulation of cell locomotion. J Cell Sci 114: 695707, 2001.[Abstract]
- He TC, Zhou S, da Costa LT, Yu J, Kinzler KW, and Vogelstein B. A simplified system for generating recombinant adenoviruses. Proc Natl Acad Sci USA 95: 25092514, 1998.[Abstract/Free Full Text]
- Hurst V, Goldberg PL, Minnear FL, Heimark RL, and Vincent PA. Rearrangement of adherens junction by transforming growth factor
: role of contraction. Am J Physiol Lung Cell Mol Physiol 276: L582L595, 1999.[Abstract/Free Full Text]
- Ireton RC, Davis MA, van Hengel J, Mariner DJ, Barnes K, Thoreson MA, Anastasiadis PZ, Matrisian L, Bundy LM, Sealy L, Gilbert B, Van Roy F, and Reynolds AB. A novel role for p120 catenin in E-cadherin function. J Cell Biol 159: 465476, 2002.[Abstract/Free Full Text]
- Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680685, 1970.[CrossRef][Medline]
- Lampugnani MG, Corada M, Caveda L, Breviario F, Ayalon O, Geiger B, and Dejana E. The molecular organization of endothelial cell to cell junctions: differential association of plakoglobin,
-catenin, and
-catenin with vascular endothelial cadherin. J Cell Biol 129: 203217, 1995.[Abstract/Free Full Text]
- Le TL, Joseph SR, Yap AS, and Stow JL. Protein kinase C regulates endocytosis and recycling of E-cadherin. Am J Physiol Cell Physiol 283: C489C499, 2002.[Abstract/Free Full Text]
- Myster SH, Cavallo R, Anderson CT, Fox DT, and Peifer M. Drosophila p120 catenin plays a supporting role in cell adhesion but is not an essential adherens junction component. J Cell Biol 160: 433449, 2003.[Abstract/Free Full Text]
- Navarro P, Caveda L, Breviario F, Mandoteanu I, Lampugnani MG, and Dejana E. Catenin-dependent and -independent functions of vascular endothelial cadherin. J Biol Chem 270: 3096530972, 1995.[Abstract/Free Full Text]
- Nieman MT, Kim JB, Johnson KR, and Wheelock MJ. Mechanism of extracellular domain-deleted dominant negative cadherins. J Cell Sci 112: 16211632, 1999.[Abstract]
- Noren NK, Liu BP, Burridge K, and Kreft B. p120 Catenin regulates the actin cytoskeleton via Rho family GTPases. J Cell Biol 150: 567580, 2000.[Abstract/Free Full Text]
- O'Carroll SJ, Hall AR, Myers CJ, Braithwaite AW, and Dix BR. Quantifying adenoviral titers by spectrophotometry. Biotechniques 28: 408410, 412, 2000.[Web of Science][Medline]
- Ohkubo T and Ozawa M. p120(ctn) binds to the membrane-proximal region of the E-cadherin cytoplasmic domain and is involved in modulation of adhesion activity. J Biol Chem 274: 2140921415, 1999.[Abstract/Free Full Text]
- Ozawa M and Kemler R. The membrane-proximal region of the E-cadherin cytoplasmic domain prevents dimerization and negatively regulates adhesion activity. J Cell Biol 142: 16051613, 1998.[Abstract/Free Full Text]
- Prokhortchouk A, Hendrich B, Jorgensen H, Ruzov A, Wilm M, Georgiev G, Bird A, and Prokhortchouk E. The p120 catenin partner Kaiso is a DNA methylation-dependent transcriptional repressor. Genes Dev 15: 16131618, 2001.[Abstract/Free Full Text]
- Ratcliffe MJ, Smales C, and Staddon JM. Dephosphorylation of the catenins p120 and p100 in endothelial cells in response to inflammatory stimuli. Biochem J 338: 471478, 1999.
- Renkin EM. Cellular and intercellular transport pathways in exchange vessels. Am Rev Respir Dis 146: S28S31, 1992.[Web of Science][Medline]
- Ukropec JA, Hollinger MK, Salva SM, and Woolkalis MJ. SHP2 association with VE-cadherin complexes in human endothelial cells is regulated by thrombin. J Biol Chem 275: 59835986, 2000.[Abstract/Free Full Text]
- Wojciak-Stothard B, Potempa S, Eichholtz T, and Ridley AJ. Rho and Rac but not Cdc42 regulate endothelial cell permeability. J Cell Sci 114: 13431355, 2001.[Abstract]
- Wong EY, Morgan L, Smales C, Lang P, Gubby SE, and Staddon JM. Vascular endothelial growth factor stimulates dephosphorylation of the catenins p120 and p100 in endothelial cells. Biochem J 346: 209216, 2000.
- Xiao K, Allison DF, Buckley KM, Kottke MD, Vincent PA, Faundez V, and Kowalczyk AP. Cellular levels of p120 catenin function as a set point for cadherin expression levels in microvascular endothelial cells. J Cell Biol 163: 535545, 2003.[Abstract/Free Full Text]
- Xiao K, Allison DF, Kottke MD, Summers S, Sorescu GP, Faundez V, and Kowalczyk AP. Mechanisms of VE-cadherin processing and degradation in microvascular endothelial cells. J Biol Chem 278: 1919919208, 2003.[Abstract/Free Full Text]
- Yap AS, Niessen CM, and Gumbiner BM. The juxtamembrane region of the cadherin cytoplasmic tail supports lateral clustering, adhesive strengthening, and interaction with p120ctn. J Cell Biol 141: 779789, 1998.[Abstract/Free Full Text]
- Zhu AJ and Watt FM. Expression of a dominant negative cadherin mutant inhibits proliferation and stimulates terminal differentiation of human epidermal keratinocytes. J Cell Sci 109: 30133023, 1996.[Abstract]
- Zhurinsky J, Shtutman M, and Ben Ze'ev A. Plakoglobin and
-catenin: protein interactions, regulation and biological roles. J Cell Sci 113: 31273139, 2000.[Abstract]
This article has been cited by other articles:

|
 |

|
 |
 
P. Alcaide, G. Newton, S. Auerbach, S. Sehrawat, T. N. Mayadas, D. E. Golan, P. Yacono, P. Vincent, A. Kowalczyk, and F. W. Luscinskas
p120-Catenin regulates leukocyte transmigration through an effect on VE-cadherin phosphorylation
Blood,
October 1, 2008;
112(7):
2770 - 2779.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Guo, J. W. Breslin, M. H. Wu, C. J. Gottardi, and S. Y. Yuan
VE-cadherin and {beta}-catenin binding dynamics during histamine-induced endothelial hyperpermeability
Am J Physiol Cell Physiol,
April 1, 2008;
294(4):
C977 - C984.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. A. Komarova, D. Mehta, and A. B. Malik
Dual Regulation of Endothelial Junctional Permeability
Sci. Signal.,
November 13, 2007;
2007(412):
re8 - re8.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Navaratna, P. G. McGuire, G. Menicucci, and A. Das
Proteolytic Degradation of VE-Cadherin Alters the Blood-Retinal Barrier in Diabetes
Diabetes,
September 1, 2007;
56(9):
2380 - 2387.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. A. Birukova, I. Malyukova, V. Poroyko, and K. G. Birukov
Paxillin-beta-catenin interactions are involved in Rac/Cdc42-mediated endothelial barrier-protective response to oxidized phospholipids
Am J Physiol Lung Cell Mol Physiol,
July 1, 2007;
293(1):
L199 - L211.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Carlile-Klusacek and V. Rizzo
Endothelial cytoskeletal reorganization in response to PAR1 stimulation is mediated by membrane rafts but not caveolae
Am J Physiol Heart Circ Physiol,
July 1, 2007;
293(1):
H366 - H375.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Boguslavsky, I. Grosheva, E. Landau, M. Shtutman, M. Cohen, K. Arnold, E. Feinstein, B. Geiger, and A. Bershadsky
p120 catenin regulates lamellipodial dynamics and cell adhesion in cooperation with cortactin
PNAS,
June 26, 2007;
104(26):
10882 - 10887.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Sheets, J. Potempa, J. Travis, H. M. Fletcher, and C. A. Casiano
Gingipains from Porphyromonas gingivalis W83 Synergistically Disrupt Endothelial Cell Adhesion and Can Induce Caspase-Independent Apoptosis.
Infect. Immun.,
October 1, 2006;
74(10):
5667 - 5678.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Sakurai, S. Fukuhara, A. Yamagishi, K. Sako, Y. Kamioka, M. Masuda, Y. Nakaoka, and N. Mochizuki
MAGI-1 Is Required for Rap1 Activation upon Cell-Cell Contact and for Enhancement of Vascular Endothelial Cadherin-mediated Cell Adhesion
Mol. Biol. Cell,
February 1, 2006;
17(2):
966 - 976.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. T. Broman, P. Kouklis, X. Gao, R. Ramchandran, R. F. Neamu, R. D. Minshall, and A. B. Malik
Cdc42 Regulates Adherens Junction Stability and Endothelial Permeability by Inducing {alpha}-Catenin Interaction With the Vascular Endothelial Cadherin Complex
Circ. Res.,
January 6, 2006;
98(1):
73 - 80.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Mehta and A. B. Malik
Signaling Mechanisms Regulating Endothelial Permeability
Physiol Rev,
January 1, 2006;
86(1):
279 - 367.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Trian, P.-O. Girodet, O. Ousova, R. Marthan, J. M. Tunon-de-Lara, and P. Berger
RNA Interference Decreases PAR-2 Expression and Function in Human Airway Smooth Muscle Cells
Am. J. Respir. Cell Mol. Biol.,
January 1, 2006;
34(1):
49 - 55.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. E. Bodmer, A. English, M. Brady, K. Blackwell, K. Haxhinasto, S. Fotedar, K. Borgman, E.-W. Bai, and A. B. Moy
Modeling error and stability of endothelial cytoskeletal membrane parameters based on modeling transendothelial impedance as resistor and capacitor in series
Am J Physiol Cell Physiol,
September 1, 2005;
289(3):
C735 - C747.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Mehta
p120: the guardian of endothelial junctional integrity
Am J Physiol Lung Cell Mol Physiol,
June 1, 2004;
286(6):
L1140 - L1142.
[Full Text]
[PDF]
|
 |
|
Copyright © 2004 by the American Physiological Society.