|
|
||||||||
-p38 kinase-linked cascade mediates the TNF-
-induced leukocyte adhesion and emigration in the lung airway epithelium
School of Life Sciences and Biotechnology, Korea University, Seoul, Korea
Submitted 22 March 2004 ; accepted in final form 13 October 2004
| ABSTRACT |
|---|
|
|
|---|
. In the present study, we show that pretreatment with rottlerin, a specific inhibitor of protein kinase C (PKC)-
, or transient transfection with antisense PKC
oligonucleotides significantly inhibits TNF-
-induced expression of VCAM-1, but not of intercellular adhesion molecule (ICAM)-1 in human lung epithelium A549 cells. In addition, TNF-
was shown to induce the expression of VCAM-1 in a p38 kinase-dependent manner; also, TNF-
-induced p38 kinase activation was blocked by inhibition of PKC
, suggesting that p38 kinase is apparently situated downstream of PKC
in the TNF-
-signaling pathway to VCAM-1 expression. Notably, inhibition of the PKC
-p38 kinase cascade also attenuated the TNF-
-induced adhesion of neutrophils to lung epithelium and the trafficking of leukocytes across the epithelium into the airway lumen in vivo. Together, these findings indicate that signaling via PKC
-p38 kinase-linked cascade specifically induces expression of VCAM-1 in lung epithelium in response to TNF-
and that this effect is both functionally and clinically significant.
lung inflammation; protein kinase C-
; vascular cell adhesion molecule-1
activates the rapid expression of vascular cell adhesion molecule (VCAM)-1 and intercellular adhesion molecule (ICAM)-1 on the surface of vascular endothelial cells and epithelial cells (3, 9, 33). Although previous studies have shown that TNF-
-induced transcription of VCAM-1 and ICAM-1 is critically dependent on the activation of nuclear factor-
B (NF-
B) (2, 7, 12, 21), alternative signaling pathways have also been suggested (11, 18, 29, 27). For example, recent reports suggest that protein kinase C (PKC) is involved in TNF-
-induced adhesion molecule expression in endothelial cells (27) and that inhibition of p38 mitogen-activated protein (MAP) kinase impairs TNF-
-induced VCAM-1 expression in human umbilical vein endothelial cells (HUVECs) (26), implying that PKC and the p38 kinase-activated pathway are likely involved in the upregulation of VCAM-1 in endothelium. Similarly, TNF-
is known to stimulate NF-
B, PKC, and MAP kinase in other cell types (17, 39).
There are at least 11 PKC isozymes that can be subdivided into four groups based on their structure and cofactor requirements: conventional (cPKC
, cPKC
I, cPKC
II, cPKC
), novel (nPKC
, nPKC
, nPKC
, nPKC
), atypical (aPKC
, aPKC
, aPKC
), and PKCµ (PKD) (19, 22). The conventional PKCs are activated by Ca2+, PMA, and phosphatidyl-serine (PS), whereas the novel isozymes are Ca2+ independent and are activated by PMA and PS. The atypical types are dependent only on PS. PMA can substitute for diacylglycerol (DAG) as a high-affinity ligand for conventional PKC and novel PKC isoforms.
There are three well-known MAP kinase family members including p38 kinase, ERKs, and JNKs that mediate various cellular functions. In particular, it has been established that p38 kinase plays a role in inflammatory process such as asthma and chronic obstructive pulmonary disease (COPD). A growing body of evidence suggests that p38 regulates adhesion molecule expression at the transcriptional or translational level (26, 28). Despite these reports, little is known about the TNF-
-induced signaling pathway in airway epithelium, especially regarding the signaling pathway leading to VCAM-1 upregulation. In addition, the differential signaling mechanism underlying the upregulation of VCAM-1 and ICAM-1 may exist depending on the cell types; this possibility has yet to be examined. Importantly, the role of VCAM-1 during the TNF-
-induced elevation of leukocyte adhesion and emigration in the lung airway epithelium in an in vivo model remains to be characterized.
Leukocyte emigration into the alveolar compartments is a prominent feature of acute and chronic inflammatory lung injury, during which monocyte recruitment from the circulation is controlled by sequential activation of adhesive proteins and their ligands on leukocytes, epithelial cells, and vascular endothelial cells (16, 37, 38). During this process, alveolar epithelial cells are likely important not only for retention and activation of leukocytes, but also for regulating their passage into the airway. Moreover, it was recently suggested that transepithelial migration into the alveolar compartment and transendothelial migration into the interstitial space are regulated via separate signaling pathways (32). Given the functional and clinical implications of these findings, we sought to better understand the mechanism underlying the upregulation of cell adhesion molecules such as VCAM-1 or ICAM-1 in airway epithelium.
In the present study, we provide the first evidence that PKC
is specifically required for TNF-
-induced expression of VCAM-1 in lung epithelium, but not for expression of ICAM-1, and that p38 kinase is likewise required for the TNF-
signaling to VCAM-1 expression, acting downstream of PKC
. In addition, our results suggest that VCAM-1 upregulation via the PKC
-p38 kinase cascade critically mediates TNF-
- or lipopolysaccharide (LPS)-induced elevation of leukocyte adhesion and emigration through airway epithelium both in vitro and in vivo, pointing to the biological relevance of this cascade to the process of inflammation in the lung.
| MATERIALS AND METHODS |
|---|
|
|
|---|
, LPS, PMA, gelatin, bovine serum albumin (BSA), and dimethyl sulfoxide (DMSO) were all from Sigma (St. Louis, MO). The following were obtained from Sigma and Calbiochem (La Jolla, CA): staurosporine, a broad-spectrum inhibitor of PKCs with IC50 = 0.7 nM; GF-109203X, a general PKC inhibitor with IC50 = 0.2 µM; Gö-6976, a potent inhibitor for Ca2+-dependent PKC isozymes with IC50 = 6.2 nM; rottlerin, a PKC
inhibitor with IC50 = 36 µM; calphostin C, a DAG-dependent PKC inhibitor with IC50 = 50 nM; PD-98059, an MEK inhibitor with IC50 = 2 µM; SB-203580, a p38 inhibitor with IC50 = 0.6 µM; SP-600125, a JNK inhibitor with IC50 = 0.19 µM; and pyrrolidine dithiocarbamate (PDTC), an NF-
B inhibitor. Fetal bovine serum (FBS), RPMI 1640, gentamicin, and nonessential amino acids were from Life Technologies (Gaithersburg, MD). Antibodies to p38 MAP kinase, phospho-PKC
, and I
B
were from New England Biolabs. Antibodies to VCAM-1 and ICAM-1 were from Santa Cruz Biotechnology (Santa Cruz, CA). PKC sampler kit and human anti-VCAM-1 blocking antibody were from BD Biosciences Pharmingen (San Diego, CA) and R&D Systems (Minneapolis, MN), respectively. All other chemicals were obtained from standard sources and were molecular biology grade or higher. Cell culture and polymorphonuclear neutrophil isolation. The A549 human alveolar type II epithelial cell line was obtained from the American Type Culture Collection (ATCC, CCL-185). A549 cells were grown in RPMI 1640 supplemented with 10% heat-inactivated FBS, 0.1 mM nonessential amino acids, 50 units/ml penicillin, and 50 µg/ml streptomycin at 37°C under a humidified 95%/5% (vol/vol) mixture of air and CO2. Blood samples were collected from healthy volunteers into tubes containing heparin sodium salt (100 units, Sigma H-3149), after which polymorphonuclear neutrophils (PMNs) were separated on a Ficoll-plaque density gradient (1.077 ± 0.001 g/ml) followed by 2% dextran sedimentation to remove the majority of red blood cells. Any remaining red blood cells were then lysed in 0.15 M ammonium chloride solution. The remaining cells were suspended in RPMI for the cell adhesion assay.
Transfection of PKC
antisense oligonucleotides.
Sense (TTTTCCGAGGTAGTACCGTG) and antisense (GTGCCATGATGGAG CCTTTT) PKC
oligonucleotides were obtained from GenoTech (Taejon, Korea) and phosphothioated at their 5' and 3' ends. For transient transfection of antisense PKC
oligonucleotides,
2 x 105 A549 cells were plated in 60-mm dishes for 24 h, after which Lipofectamine Plus/DNA complex was added. We held the amount of DNA used in each transfection constant (1.8 µg) by adding sonicated calf thymus DNA. After 3-h incubation with the Lipofectamine Plus/DNA mixture, the cells were rinsed with PBS and incubated for 2436 h in fresh RPMI 1640 supplemented with 10% FBS. The cells were then stimulated with TNF-
for the indicated times and subjected to Western blot analysis of the expression of VCAM-1, ICAM-1, and PKC
. Downregulation of PKC
was achieved by prolonged exposure PMA (50 nM, 12 h) as previously reported (28).
RNA isolation and RT-PCR. Total cellular RNA was extracted from A549 cells using easy-BLUE (iNtRON) dissolved in diethyl pyrocarbonate-treated water and quantified by ultraviolet scanning. We then reverse-transcribed 1 µg of the extracted RNA by incubating it for 60 min at 37°C in 20 µl of buffer containing 10 mM Tris (pH 8.3), 50 mM KCl, 5 mM MgCl2, and 1 mM each of dATP, dCTP, dGTP, and dTTP, and oligo-dT primers. Hot-start PCR was used to increase the specificity of the amplification with specific primers for human VCAM-1 (sense, 5'-AGTGGTGGCCTCGTGAATGG; antisense, 5'-CTGTGTCTCTCTCCGCC) and human GAPDH. The PCR protocol entailed 25 cycles of denaturation at 94°C for 45 s, annealing at 55°C for 45 s, and elongation at 55°C for 1 min in a Mygene Thurmal Block from Bioneer (Daejon, Korea). The amplified products were subjected to electrophoresis on 1% agarose gels, after which the bands were visualized by ethidium bromide staining.
SDS-PAGE and immunoblot analysis. Protein samples were heated at 95°C for 5 min and then subjected to SDS-PAGE on 10% acrylamide gels, followed by transfer to polyvinylidene difluoride membranes with a Novex wet transfer unit (for 2 h at 100 V). The membranes were then blocked for 1 h with Tris-buffered saline (TBS) containing 0.05% (vol/vol) Tween 20 plus 5% (wt/vol) nonfat dry milk, incubated for 2 h with the primary antibody in TBS containing 0.05% (vol/vol) Tween 20 plus 3% (wt/vol) BSA, and then for 1 h with horseradish peroxidase-conjugated secondary antibody before development with an enhanced chemiluminescence kit (ECL, Amersham Pharmacia Biotech).
Cell adhesion assay.
A549 cells were grown to confluence in 35-mm plates and then incubated in RPMI 1640 for an additional 12 h. In addition, PMNs were prelabeled with fluorescent calcein-AM (10 µM, 30 min; Molecular Probes; Eugene, OR) in phenol red-free RPMI 1640 containing 0.5% FBS. After stimulating the A549 cells with 10 ng/ml TNF-
or control buffer for 12 h, we washed them three times with PBS and resuspended them in phenol red-free RPMI 1640 containing 0.5% FBS, and the fluorescently labeled PMNs were added (1 x 106/ml). After incubation for 30 min at 37°C, nonadherent PMNs were removed by washing four times with PBS. Adhesion of PMNs was observed under a fluorescence microscope (Diagnostic Instruments) and counted.
Neutrophilia mouse model and intratracheal instillation.
Pathogen-free female BALB/c mice (8 wk) were purchased from the Korea Research Institute of Chemistry Technology (Taejon, Korea). They were then housed throughout the experiments in a laminar flow cabinet and maintained on standard laboratory chow and water ad libitum. All procedures involving animals were reviewed and approved by the Institutional Animal Care and Use Committee of Korea University. For intratracheal instillation, animals were anesthetized by intraperitoneal injection of 150 µl of saline containing 13 mg/ml ketamine hydrochloride (Yuhan) and 88.6 µg/ml xylazine (Bayer). The necks of the anesthetized mice were shaved and then opened by a midline incision of
1 cm on the ventral aspect, after which the trachea was exposed by careful dissection of the surrounding tissues with blunt forceps. Once the trachea was exposed, a catheter was inserted
0.5 cm into the trachea, and 50 µl of LPS and TNF-
(Sigma) in PBS (final concentration, 20 µg/ml and 2 µg/ml, respectively) were instilled into the lungs via a pipette with a gel-loading tip. The agents were then flushed through the catheter with air, and the surrounding tissue was pinched together to close the incision. The animals remained on their backs in a warmed cage until conscious, at which time they were given food and water.
Bronchoalveolar lavage and histological analysis of neutrophil migration.
Twenty-four hours after the instillation described above, bronchoalveolar lavage (BAL) fluid was recovered and placed on ice. Briefly, the chest cavity was carefully opened to allow the lung to fully expand, after which the trachea was exposed and catheterized at the same point of entry as was previously used to instill LPS and TNF-
. The catheter was tied in place, and 800 µl of prewarmed 0.9% NaCl solution were slowly infused into the lung and withdrawn. The aliquots were then pooled and stored at 4°C. Total cell counts were made with a hemocytometer. In addition, cytospins were carried out for each BAL sample, which were then stained with Diff-Quick (Merck, Dorset, UK), enabling differential cell counts to be made. In this case, the cells were counted under a microscope by two independent investigators blinded to the study. Approximately 400 cells were counted in each of four randomly selected locations. The percentage of neutrophils was multiplied by the total cell number to obtain the numbers of neutrophils. For histological analysis, the lungs were removed from mice 24 h after LPS challenge. Sections of lung tissue were then stained with hematoxylin-eosin (Sigma) and examined as described previously (40).
Gelatin zymography. Samples of BAL fluid were collected and immediately frozen in liquid nitrogen so as to preserve the gelatinolytic activity. The samples were then added Laemmli's buffer without reducing agent and separated on 7.5% SDS-polyacrylamide gels containing 0.2% gelatin (vol/vol) as a substrate, after which the separated gels were rinsed three times with 2.5% Triton X-100 for 30 min in room temperature. To assess matrix metalloproteinase (MMP)-dependent gelatinolytic activity, we incubated the gels for 24 h at 37°C in substrate buffer (50 mM Tris·Cl pH 7.6, 150 mM NaCl, 5 mM CaCl2, and 200 µg/ml Brij-35) in the presence or absence of EDTA. The purified proteins and standard markers were used to determine MMP-9 and molecular mass, respectively. The gels were stained with Coomassie brilliant blue solution. After destaining, a white gelatinolytic band was detected in the blue background.
NF-
B reporter gene assay.
We carried out transient transfection by plating
2 x 105 cells in 60-mm dishes for 24 h and then adding Lipofectamine Plus/DNA complex prepared with 1.8 µg of DNA/dish. We held the quantity of DNA used in each transfection constant by adding sonicated calf thymus DNA. To control for variations in cell number and transfection efficiency, all clones were cotransfected with 0.4 µg of pSV40-
GAL, a eukaryotic expression vector containing the Escherichia coli
-galactosidase (lacZ) structural gene under the transcriptional control of the simian virus 40 promoter. After incubating the cells for 3 h with the Lipofectamine Plus/DNA complex, we rinsed them with PBS before incubating them in fresh RPMI 1640 supplemented with 10% FBS. Each dish of cells was then rinsed twice with PBS and lysed in 0.1 ml of lysis solution [0.2 M Tris·Cl (pH 7.6), 0.1% Triton X-100], after which the lysed cells were scraped and spun for 1 min. The resultant supernatants were assayed for protein and
-galactosidase activity. Luciferase activity was assayed in 10-µl samples of extract; the luciferase luminescence was counted in luminometer (Turner Design, TD-20/20) and normalized to the cotransfected
-galactosidase activity, as described elsewhere (41). Transfection experiments were performed in triplicate with two independently isolated sets of cells, and the results were averaged.
Statistical analysis. Data are expressed as the means ± SD or the mean of percentages of control ± SD. Statistical comparisons between groups were made using Student's t-tests or ANOVA tests. Values of P < 0.05 were considered significant.
| RESULTS |
|---|
|
|
|---|
-induced VCAM-1 expression in A549 lung epithelial cells.
We initially evaluated TNF-
-induced expression of VCAM-1 and ICAM-1 in A549 human lung epithelial cells. As shown in Fig. 1, expression of both was time dependent, with maximum expression occurring within 12 h, after which the levels declined. To assess the role of PKC isozymes, A549 cells were exposed to PMA for 12 h to deplete the conventional and novel PKC isozymes, leaving only atypical isozymes active. Depletion of PKC inhibited TNF-
-induced expression of VCAM-1 but had no effect on expression of ICAM-1 (Fig. 2A). This suggests that the signaling mechanisms for the expression of VCAM-1 and ICAM-1 by TNF-
are probably different in A549 human lung epithelial cells: one leading to expression of VCAM-1 via a PMA-sensitive pathway and the other to expression of ICAM-1 via a PMA-insensitive pathway.
|
|
-induced VCAM-1 expression in more detail, we first examined their patterns of downregulation in A549 lung epithelial cells. Western hybridization showed that the levels of PKC
, PKC
, PKC
, PKC
, PKC
, and PKC
were all downregulated by prolonged exposure with PMA in A549 cells, whereas the levels of PKC
, PKC
, and PKC
/
were unaffected (Fig. 2B).
PKC
is critical for the TNF-
-induced VCAM-1 expression in A549 lung epithelium.
We next tested the effects of inhibitors of PKC isozymes with the aim of resolving which PMA-sensitive PKC isozymes are involved in VCAM-1 expression. We found that pretreating A549 cells with staurosporine (a broad-spectrum inhibitor of PKCs) or rottlerin (a PKC
inhibitor) inhibited TNF-
-induced VCAM-1 expression, whereas GF-109203X (a general PKC inhibitor) and Gö-6976 (a potent inhibitor of Ca2+-dependent PKC isozymes) had no effect (Fig. 3A). On the basis of these findings, we hypothesize that PKC
was at least one of the principal PKC isoforms necessary for TNF-
-induced VCAM-1 expression in this cell type.
|
in the TNF-
signaling to VCAM-1 in A549 cells, we first examined the effect of antisense oligonucleotides directed against PKC
mRNA. The Western blots in Fig. 3B show that transient transfection of A549 cells with PKC
antisense oligonucleotide markedly reduced VCAM-1 expression without affecting ICAM-1 expression. By contrast, transfection of the sense oligonucleotide had no effect. Under the experimental conditions, the antisense oligonucleotide shows a specific antisense effect only on PKC
, but not on PKC
, PKC
, or PKC
(Fig. 3B), demonstrating the specificity of an antisense PKC
oligonucleotide. We then analyzed the phosphorylation and translocation of PKC
and found that addition of TNF-
to A549 cells induced both phosphorylation (Fig. 3C) and membrane translocation (Fig. 3D) of PKC
, suggesting PKC
is activated in response to TNF-
.
TNF-
induces VCAM-1 expression via a PKC
-p38 kinase cascade.
It was previously reported that inhibition of p38 MAP kinase impairs TNF-
-induced endothelial VCAM-1 expression (12). To test whether this is also true in A549 lung epithelium, we pretreated the cells with SB-203580, a p38 kinase inhibitor, and found that inhibition of p38 kinase selectively diminished TNF-
-induced VCAM-1 expression without affecting ICAM-1 expression (Fig. 4A). Moreover, inhibition of PKC
with rottlerin remarkably reduced TNF-
-induced phosphorylation of p38 kinase, suggesting that p38 kinase acts downstream of PKC
(Fig. 4B). Similarly, pretreatment with staurosporine, prolonged exposure of PMA (12 h), or transfection of cells with PKC
antisense oligonucleotide all markedly inhibited TNF-
-induced p38 kinase phosphorylation (Fig. 4, B and C). Together, these data clearly demonstrate that PKC
modulates TNF-
signaling to VCAM-1 expression via p38 MAP kinase. On the other hand, pretreatment with PD-98059, an MEK inhibitor, or SP-600125, a c-Jun amino-terminal kinase (JNK) inhibitor, had no detectable effect on the expression of either VCAM-1 or ICAM-1 (Fig. 4A). RT-PCR analysis shows that pretreatment of A549 cells with rottlerin, a PKC
inhibitor, or SB-203580, a p38 kinase inhibitor, clearly blocked TNF-
-induced VCAM-1 mRNA expression (Fig. 4D). Together, our results suggest a potential role of PKC
-p38 kinase cascade in the signaling mechanism of TNF-
-induced VCAM-1 gene transcription.
|
-p38 kinase cascade is not related to TNF-
-induced NF-
B stimulation.
NF-
B is an important transcription factor involved in TNF-
-induced expression of cell adhesion molecules, including VCAM-1 and ICAM-1. This heterodimer comprises p50 and p65 subunits and exists in the cytoplasm in an inactive form bound to the inhibitory protein I
B through p65. Phosphorylation of I
B and its subsequent degradation are a critical step in NF-
B activation. In that regard, TNF-
induced both phosphorylation and degradation of I
B
in A549 cells within several minutes (Fig. 5A).
|
B serves as a downstream target of the PKC
-p38 kinase cascade in TNF-
signaling to VCAM-1 expression, we tested the effects of rottlerin and SB-203580 on TNF-
-induced I
B
degradation. Pretreating A549 cells for 30 min with rottlerin or SB-203580 failed to block the TNF-
-induced I
B
degradation, whereas PDTC, an inhibitor of NF-
B, attenuated both I
B
degradation and VCAM-1 expression (Fig. 5, B and C). Likewise, PMA-mediated depletion of PKC
had no effect on TNF-
-induced I
B
degradation (data not shown). Analysis of reporter gene expression following transient transfection of cells with
B-luciferase, which contains five copies of the consensus NF-
B binding sequence, shows that TNF-
stimulated NF-
B-dependent promoter activity (Fig. 5D), that rottlerin had little effect on TNF-
-induced NF-
B-dependent promoter activity, and that PDTC diminished NF-
B-dependent promoter activity (Fig. 5D).
To further assess the role of PKC
-p38 kinase cascade in the TNF-
signaling to NF-
B, we examined NF-
B reporter assay using dominant mutant form of PKC
(pPKC
K376R) or p38 kinase (pp38AGF). As shown in Fig. 5E, the TNF-
-induced NF-
B activation was not inhibited by the expression of pPKC
KD or pp38AGF, suggesting that PKC
-p38 cascade is not involved for the TNF-
-induced NF-
B activation. Apparently, NF-
B is not a principal target for the PKC
-p38 kinase-linked signaling cascade leading to VCAM-1 expression, although it does appear to be a target of TNF-
in its signaling to VCAM-1 expression.
PKC
-p38 MAP kinase cascade is critical for leukocyte adhesion to lung epithelium.
To assess the role of PKC
-p38 kinase-mediated VCAM-1 expression in the cell adhesion process, we first investigated the function of VCAM-1 in TNF-
-induced adhesion of leukocytes to lung epithelial cells in vitro. Under control conditions, TNF-
increased the number of PMNs adhering to A549 cells by about fivefold. Pretreating the cells with anti-VCAM-1 neutralizing antibody before incubating them with PMNs dose dependently reduced the numbers of adherent cells (Fig. 6A). As shown in Fig. 6B, moreover, pretreating the cells with rottlerin or SB-203580 also significantly reduced TNF-
-induced adhesion of PMNs to A549 cells, whereas PD-98059 had no effect. Thus inhibition of PKC
or p38 kinase significantly attenuates PMN adhesion to lung epithelial cells, indicating that the PKC
-p38 kinase cascade plays an essential role in leukocyte adhesion to lung epithelium.
|
in vivo.
To validate the functional roles of PKC
and p38 kinase in the regulation of VCAM-1 expression in vivo, we treated BALB/c mice with TNF-
, after which VCAM-1 expression in the lung tissue was evaluated. Intratracheal instillation of TNF-
elicited a rapid increase in VCAM-1 expression within lung tissue (Fig. 7). Western blot analysis shows that maximum VCAM-1 expression occurred
24 h after TNF-
administration, though increases were detectable within 12 h (data not shown). Intraperitoneal administration of rottlerin or SB-203580 at least 1 h before TNF-
clearly diminished the level of VCAM-1 expression in lung tissue, suggesting that PKC
and p38 kinase do indeed play a role in the TNF-
signaling to VCAM-1 expression in vivo. Notably, TNF-
induced little accumulation of neutrophils or eosinophils in the lung airway despite its effect on VCAM-1 expression (data not shown), indicating VCAM-1 expression is not sufficient, by itself, to elicit neutrophilic accumulation in the lung airway.
|
and chemokines such as interleukin (IL)-8 are essential for early LPS-mediated pulmonary neutrophil recruitment (23). We also observed that intratracheal instillation of LPS elicited acute neutrophil accumulation within the airway lumen (Fig. 8, A and B). This accumulation reached a maximum within 2448 h after LPS administration and then declined (data not shown). To quantify the relative levels of neutrophil accumulation in the lung, we measured MMP-9 in BAL fluid (Fig. 8C, bottom). Consistent with the histochemical findings, MMP-9 activity was increased 2448 h after LPS instillation; moreover, there was a concomitant increase in VCAM-1 expression in lung tissue (Fig. 8C, top). No neutrophil accumulation was observed in the lungs of saline-treated control mice (Fig. 8, A and B), nor was any MMP-9 activity detected in their BAL fluid. As shown in Fig. 9C, LPS-induced neutrophil accumulation into the lung was significantly inhibited by prior intraperitoneal administration of neutralizing antibody against murine TNF-
, suggesting that TNF-
plays a critical role in the LPS-mediated neutrophil trafficking into the airway. Additionally, pretreatment with rottlerin or SB-203580 significantly reduced LPS-induced VCAM-1 expression (Fig. 9A) and neutrophil accumulation (Fig. 9B), together indicating systemic inhibition of PKC
and p38 kinase leads to a loss of both VCAM-1 expression and accumulation of neutrophils into the lung airway.
|
|
| DISCUSSION |
|---|
|
|
|---|
-induced expression of VCAM-1 and ICAM-1 is differentially regulated in lung epithelium and that activation of PKC
and, subsequently, p38 kinase is a critical signaling component mediating VCAM-1 expression in the lung epithelium. In addition, we provide evidence suggesting that VCAM-1 upregulation via PKC
-p38 kinase cascade critically mediates TNF-
/or LPS-induced elevation of leukocyte adhesion and emigration in the airway epithelium both in vitro and in vivo.
VCAM-1 was first identified as an adhesion molecule induced on endothelial cells by inflammatory cytokines IL-1 and TNF-
or by LPS. Much less is known about the signaling to VCAM-1 expression in the lung airway epithelium. Our data have shown the specificity of the activities of PKC
and p38 kinase in mediating TNF-
-induced VCAM-1 expression. p38 kinase has been implicated in the regulation of NF-
B activity through direct phosphorylation and, thus, transactivation of the NF-
B p65 subunit without affecting its DNA binding activity (8, 28, 36). This makes NF-
B p65 a potential target of the PKC
-p38 kinase-linked cascade in our cell type. Still, inhibition of PKC
by rottlerin had little or no inhibitory effect on TNF-
-induced NF-
B activation (Fig. 5C). We therefore believe the role of NF-
B p65 in the PKC
-p38 kinase-linked cascade to be negligible. Nonetheless, the fact that PDTC inhibited TNF-
-induced VCAM-1 expression (Fig. 5B) clearly shows NF-
B to be involved in the TNF-
-induced expression of VCAM-1. We therefore propose that both a PKC
-p38 kinase-dependent and an NF-
B-dependent cascade contribute to the efficient expression of VCAM-1 in response to TNF-
in A549 epithelium.
Our findings are consistent with an earlier report that suggested p38 kinase regulates VCAM-1 expression without affecting ICAM-1 expression, although the detailed signaling mechanism was not presented in that earlier study (26, 28). In addition, rottlerin-dependent PKC
activity was shown to modulate p38 kinase phosphorylation and I
B
degradation in thrombin signaling to ICAM-1 in HUVECs (28). In contrast to us, however, those investigators found NF-
B to be a downstream target of p38 kinase leading to ICAM-1 expression (28). The reason for this discrepancy is not clear, but it may reflect differences in the stimuli or cell type used in the experiments.
Although the mechanism by which the PKC
-p38 kinase-linked cascade exerts its effect on VCAM-1 expression in lung epithelium is not completely clear, we suspect that GATA cis elements within the cytokine response region of the VCAM-1 promoter (20, 21, 24, 34) may serve as a downstream target of this cascade. Consistent with that idea, p38 kinase has been shown to mediate both GATA-3 phosphorylation and GATA-4 DNA binding activity (6, 15). We cannot exclude the possibility that other transcription factors are involved, however. For instance, it was previously suggested that TATA-binding protein (TBP), one of the subunits of basal transcription machinery transcription factor IID, might be a downstream target of p38 kinase, and phosphorylation of TBP by p38 kinase is known to be necessary for TBP binding to the TATA box (4, 28). In any event, our finding that a PKC
-p38 kinase-linked cascade mediates an alternative signaling pathway to VCAM-1 expression in lung epithelium, without affecting ICAM-1, appears to be novel and to have significant clinical implications.
VCAM-1 participates in the inflammation process via its ligand, the leukocyte
1-integrin very late antigen-4 (CD49/CD29) (1, 10, 30). Expression of VCAM-1 and ICAM-1 on both epithelial and endothelial cells is associated with a number of inflammatory diseases, including acute respiratory distress syndrome (ARDS), COPD, inflammatory bowel disease, and rheumatoid arthritis (5, 35). Recently, Ridger et al. (31) found that the VCAM-1/
1-integrin interaction was involved in the migration of neutrophils from the interstitium into the alveolus rather than in neutrophil-endothelial cell adhesion. In the present study, VCAM-1 expression induced via the PKC
-p38 kinase-linked cascade, in vivo, was found to be crucial for mediating adhesion of PMNs (virtually all neutrophils) to airway epithelium and infiltration into the airway lumen (Figs. 69).
Given that neutrophil migration into lung plays a pivotal role in the pathogenesis of acute lung injury during sepsis (13); that blood neutrophils from septic patients express
4
1-integrin, which in turn caused increased adhesion to immobilized VCAM-1 (14); that an influx of neutrophils into the airway is a common feature of ARDS, COPD, and severe asthma (25, 13); and that increased numbers of neutrophils are recovered from the airways of patients with severe asthma and subjects undergoing acute asthma exacerbation (39), our findings appear to be both functionally and clinically significant. The extent to which these finding can serve as the basis for the development of new therapies for the treatment of the aforementioned ailments remains unknown, but the prospects are intriguing.
In summary, our findings suggest that a PKC
-p38-linked cascade plays a pivotal role in TNF-
signaling to VCAM-1 expression in lung epithelium in vitro and in vivo, which in turn supports neutrophil accumulation in the lung airway. To our knowledge, this is the first evidence showing that separate signaling mechanisms underlie the upregulation of VCAM-1 and ICAM-1 and the first demonstration of the role of VCAM-1 upregulation via PKC
-p38 kinase-linked cascade for the TNF-
-induced elevation of leukocyte adhesion and emigration in the airway epithelium. Although further studies are needed to clarify the molecular linkage between the PKC
-p38-linked cascade and potential targets (e.g., GATA-binding proteins), our findings have important implications as to the molecular mechanism underlying several inflammatory lung diseases.
| GRANTS |
|---|
|
|
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
mediates TNF-
-induced ICAM-1 gene transcription in endothelial cells. Am J Physiol Cell Physiol 279: C906C914, 2000.This article has been cited by other articles:
![]() |
K. Vardarova, S. Scharf, F. Lang, B. Schmeck, B. Opitz, J. Eitel, A. C. Hocke, H. Slevogt, A. Flieger, S. Hippenstiel, et al. PKC{alpha} and PKC{epsilon} differentially regulate Legionella pneumophila-induced GM-CSF Eur. Respir. J., November 1, 2009; 34(5): 1171 - 1179. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Clarke, J. M. Guthrie, and Y. A. Hannun Regulation of Neutral Sphingomyelinase-2 (nSMase2) by Tumor Necrosis Factor-{alpha} Involves Protein Kinase C-{delta} in Lung Epithelial Cells Mol. Pharmacol., October 1, 2008; 74(4): 1022 - 1032. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Jing, J. A. Dowdy, M. R. Van Scott, and J. S. Fedan Hyperosmolarity-Induced Dilation and Epithelial Bioelectric Responses of Guinea Pig Trachea in Vitro: Role of Kinase Signaling J. Pharmacol. Exp. Ther., July 1, 2008; 326(1): 186 - 195. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Slevogt, L. Maqami, K. Vardarowa, W. Beermann, A. C. Hocke, J. Eitel, B. Schmeck, A. Weimann, B. Opitz, S. Hippenstiel, et al. Differential regulation of Moraxella catarrhalis-induced interleukin-8 response by protein kinase C isoforms Eur. Respir. J., April 1, 2008; 31(4): 725 - 735. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Tong, L. Zheng, L. Lin, B. Li, D. Wang, and D. Li Hypoxia-Induced Mitogenic Factor Promotes Vascular Adhesion Molecule-1 Expression via the PI-3K/Akt-NF-{kappa}B Signaling Pathway Am. J. Respir. Cell Mol. Biol., October 1, 2006; 35(4): 444 - 456. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Kuwahara, E. P. Lillehoj, W. Lu, I. S. Singh, Y. Isohama, T. Miyata, and K. C. Kim Neutrophil elastase induces IL-8 gene transcription and protein release through p38/NF-{kappa}B activation via EGFR transactivation in a lung epithelial cell line Am J Physiol Lung Cell Mol Physiol, September 1, 2006; 291(3): L407 - L416. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. N. Ogawa, A. Ishizaka, S. Tasaka, H. Koh, H. Ueno, F. Amaya, M. Ebina, S. Yamada, Y. Funakoshi, J. Soejima, et al. Contribution of High-Mobility Group Box-1 to the Development of Ventilator-induced Lung Injury Am. J. Respir. Crit. Care Med., August 15, 2006; 174(4): 400 - 407. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Menne, J.-K. Park, R. Agrawal, C. Lindschau, J. T. Kielstein, T. Kirsch, A. Marx, D. Muller, F. H. Bahlmann, M. Meier, et al. Cellular and molecular mechanisms of tissue protection by lipophilic calcium channel blockers FASEB J, May 1, 2006; 20(7): 994 - 996. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |