AJP - Lung Columbus Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 288: L307-L316, 2005. First published October 15, 2004; doi:10.1152/ajplung.00105.2004
1040-0605/05 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
288/2/L307    most recent
00105.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (22)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Woo, C.-H.
Right arrow Articles by Kim, J.-H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Woo, C.-H.
Right arrow Articles by Kim, J.-H.

VCAM-1 upregulation via PKC{delta}-p38 kinase-linked cascade mediates the TNF-{alpha}-induced leukocyte adhesion and emigration in the lung airway epithelium

Chang-Hoon Woo, Jae-Hyang Lim, and Jae-Hong Kim

School of Life Sciences and Biotechnology, Korea University, Seoul, Korea

Submitted 22 March 2004 ; accepted in final form 13 October 2004


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Vascular cell adhesion molecule (VCAM)-1 plays a central role in the recruitment of inflammatory cells, and its expression is rapidly induced by proinflammatory cytokines such as TNF-{alpha}. In the present study, we show that pretreatment with rottlerin, a specific inhibitor of protein kinase C (PKC)-{delta}, or transient transfection with antisense PKC{delta} oligonucleotides significantly inhibits TNF-{alpha}-induced expression of VCAM-1, but not of intercellular adhesion molecule (ICAM)-1 in human lung epithelium A549 cells. In addition, TNF-{alpha} was shown to induce the expression of VCAM-1 in a p38 kinase-dependent manner; also, TNF-{alpha}-induced p38 kinase activation was blocked by inhibition of PKC{delta}, suggesting that p38 kinase is apparently situated downstream of PKC{delta} in the TNF-{alpha}-signaling pathway to VCAM-1 expression. Notably, inhibition of the PKC{delta}-p38 kinase cascade also attenuated the TNF-{alpha}-induced adhesion of neutrophils to lung epithelium and the trafficking of leukocytes across the epithelium into the airway lumen in vivo. Together, these findings indicate that signaling via PKC{delta}-p38 kinase-linked cascade specifically induces expression of VCAM-1 in lung epithelium in response to TNF-{alpha} and that this effect is both functionally and clinically significant.

lung inflammation; protein kinase C-{delta}; vascular cell adhesion molecule-1


THE PROINFLAMMATORY CYTOKINE tumor necrosis factor (TNF)-{alpha} activates the rapid expression of vascular cell adhesion molecule (VCAM)-1 and intercellular adhesion molecule (ICAM)-1 on the surface of vascular endothelial cells and epithelial cells (3, 9, 33). Although previous studies have shown that TNF-{alpha}-induced transcription of VCAM-1 and ICAM-1 is critically dependent on the activation of nuclear factor-{kappa}B (NF-{kappa}B) (2, 7, 12, 21), alternative signaling pathways have also been suggested (11, 18, 29, 27). For example, recent reports suggest that protein kinase C (PKC) is involved in TNF-{alpha}-induced adhesion molecule expression in endothelial cells (27) and that inhibition of p38 mitogen-activated protein (MAP) kinase impairs TNF-{alpha}-induced VCAM-1 expression in human umbilical vein endothelial cells (HUVECs) (26), implying that PKC and the p38 kinase-activated pathway are likely involved in the upregulation of VCAM-1 in endothelium. Similarly, TNF-{alpha} is known to stimulate NF-{kappa}B, PKC, and MAP kinase in other cell types (17, 39).

There are at least 11 PKC isozymes that can be subdivided into four groups based on their structure and cofactor requirements: conventional (cPKC{alpha}, cPKC{beta}I, cPKC{beta}II, cPKC{gamma}), novel (nPKC{delta}, nPKC{varepsilon}, nPKC{eta}, nPKC{theta}), atypical (aPKC{zeta}, aPKC{lambda}, aPKC{iota}), and PKCµ (PKD) (19, 22). The conventional PKCs are activated by Ca2+, PMA, and phosphatidyl-serine (PS), whereas the novel isozymes are Ca2+ independent and are activated by PMA and PS. The atypical types are dependent only on PS. PMA can substitute for diacylglycerol (DAG) as a high-affinity ligand for conventional PKC and novel PKC isoforms.

There are three well-known MAP kinase family members including p38 kinase, ERKs, and JNKs that mediate various cellular functions. In particular, it has been established that p38 kinase plays a role in inflammatory process such as asthma and chronic obstructive pulmonary disease (COPD). A growing body of evidence suggests that p38 regulates adhesion molecule expression at the transcriptional or translational level (26, 28). Despite these reports, little is known about the TNF-{alpha}-induced signaling pathway in airway epithelium, especially regarding the signaling pathway leading to VCAM-1 upregulation. In addition, the differential signaling mechanism underlying the upregulation of VCAM-1 and ICAM-1 may exist depending on the cell types; this possibility has yet to be examined. Importantly, the role of VCAM-1 during the TNF-{alpha}-induced elevation of leukocyte adhesion and emigration in the lung airway epithelium in an in vivo model remains to be characterized.

Leukocyte emigration into the alveolar compartments is a prominent feature of acute and chronic inflammatory lung injury, during which monocyte recruitment from the circulation is controlled by sequential activation of adhesive proteins and their ligands on leukocytes, epithelial cells, and vascular endothelial cells (16, 37, 38). During this process, alveolar epithelial cells are likely important not only for retention and activation of leukocytes, but also for regulating their passage into the airway. Moreover, it was recently suggested that transepithelial migration into the alveolar compartment and transendothelial migration into the interstitial space are regulated via separate signaling pathways (32). Given the functional and clinical implications of these findings, we sought to better understand the mechanism underlying the upregulation of cell adhesion molecules such as VCAM-1 or ICAM-1 in airway epithelium.

In the present study, we provide the first evidence that PKC{delta} is specifically required for TNF-{alpha}-induced expression of VCAM-1 in lung epithelium, but not for expression of ICAM-1, and that p38 kinase is likewise required for the TNF-{alpha} signaling to VCAM-1 expression, acting downstream of PKC{delta}. In addition, our results suggest that VCAM-1 upregulation via the PKC{delta}-p38 kinase cascade critically mediates TNF-{alpha}- or lipopolysaccharide (LPS)-induced elevation of leukocyte adhesion and emigration through airway epithelium both in vitro and in vivo, pointing to the biological relevance of this cascade to the process of inflammation in the lung.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Chemicals and antibodies. TNF-{alpha}, LPS, PMA, gelatin, bovine serum albumin (BSA), and dimethyl sulfoxide (DMSO) were all from Sigma (St. Louis, MO). The following were obtained from Sigma and Calbiochem (La Jolla, CA): staurosporine, a broad-spectrum inhibitor of PKCs with IC50 = 0.7 nM; GF-109203X, a general PKC inhibitor with IC50 = 0.2 µM; Gö-6976, a potent inhibitor for Ca2+-dependent PKC isozymes with IC50 = 6.2 nM; rottlerin, a PKC{delta} inhibitor with IC50 = 3–6 µM; calphostin C, a DAG-dependent PKC inhibitor with IC50 = 50 nM; PD-98059, an MEK inhibitor with IC50 = 2 µM; SB-203580, a p38 inhibitor with IC50 = 0.6 µM; SP-600125, a JNK inhibitor with IC50 = 0.19 µM; and pyrrolidine dithiocarbamate (PDTC), an NF-{kappa}B inhibitor. Fetal bovine serum (FBS), RPMI 1640, gentamicin, and nonessential amino acids were from Life Technologies (Gaithersburg, MD). Antibodies to p38 MAP kinase, phospho-PKC{delta}, and I{kappa}B{alpha} were from New England Biolabs. Antibodies to VCAM-1 and ICAM-1 were from Santa Cruz Biotechnology (Santa Cruz, CA). PKC sampler kit and human anti-VCAM-1 blocking antibody were from BD Biosciences Pharmingen (San Diego, CA) and R&D Systems (Minneapolis, MN), respectively. All other chemicals were obtained from standard sources and were molecular biology grade or higher.

Cell culture and polymorphonuclear neutrophil isolation. The A549 human alveolar type II epithelial cell line was obtained from the American Type Culture Collection (ATCC, CCL-185). A549 cells were grown in RPMI 1640 supplemented with 10% heat-inactivated FBS, 0.1 mM nonessential amino acids, 50 units/ml penicillin, and 50 µg/ml streptomycin at 37°C under a humidified 95%/5% (vol/vol) mixture of air and CO2. Blood samples were collected from healthy volunteers into tubes containing heparin sodium salt (100 units, Sigma H-3149), after which polymorphonuclear neutrophils (PMNs) were separated on a Ficoll-plaque density gradient (1.077 ± 0.001 g/ml) followed by 2% dextran sedimentation to remove the majority of red blood cells. Any remaining red blood cells were then lysed in 0.15 M ammonium chloride solution. The remaining cells were suspended in RPMI for the cell adhesion assay.

Transfection of PKC{delta} antisense oligonucleotides. Sense (TTTTCCGAGGTAGTACCGTG) and antisense (GTGCCATGATGGAG CCTTTT) PKC{delta} oligonucleotides were obtained from GenoTech (Taejon, Korea) and phosphothioated at their 5' and 3' ends. For transient transfection of antisense PKC{delta} oligonucleotides, ~2 x 105 A549 cells were plated in 60-mm dishes for 24 h, after which Lipofectamine Plus/DNA complex was added. We held the amount of DNA used in each transfection constant (1.8 µg) by adding sonicated calf thymus DNA. After 3-h incubation with the Lipofectamine Plus/DNA mixture, the cells were rinsed with PBS and incubated for 24–36 h in fresh RPMI 1640 supplemented with 10% FBS. The cells were then stimulated with TNF-{alpha} for the indicated times and subjected to Western blot analysis of the expression of VCAM-1, ICAM-1, and PKC{delta}. Downregulation of PKC{delta} was achieved by prolonged exposure PMA (50 nM, 12 h) as previously reported (28).

RNA isolation and RT-PCR. Total cellular RNA was extracted from A549 cells using easy-BLUE (iNtRON) dissolved in diethyl pyrocarbonate-treated water and quantified by ultraviolet scanning. We then reverse-transcribed 1 µg of the extracted RNA by incubating it for 60 min at 37°C in 20 µl of buffer containing 10 mM Tris (pH 8.3), 50 mM KCl, 5 mM MgCl2, and 1 mM each of dATP, dCTP, dGTP, and dTTP, and oligo-dT primers. Hot-start PCR was used to increase the specificity of the amplification with specific primers for human VCAM-1 (sense, 5'-AGTGGTGGCCTCGTGAATGG; antisense, 5'-CTGTGTCTCTCTCCGCC) and human GAPDH. The PCR protocol entailed 25 cycles of denaturation at 94°C for 45 s, annealing at 55°C for 45 s, and elongation at 55°C for 1 min in a Mygene Thurmal Block from Bioneer (Daejon, Korea). The amplified products were subjected to electrophoresis on 1% agarose gels, after which the bands were visualized by ethidium bromide staining.

SDS-PAGE and immunoblot analysis. Protein samples were heated at 95°C for 5 min and then subjected to SDS-PAGE on 10% acrylamide gels, followed by transfer to polyvinylidene difluoride membranes with a Novex wet transfer unit (for 2 h at 100 V). The membranes were then blocked for 1 h with Tris-buffered saline (TBS) containing 0.05% (vol/vol) Tween 20 plus 5% (wt/vol) nonfat dry milk, incubated for 2 h with the primary antibody in TBS containing 0.05% (vol/vol) Tween 20 plus 3% (wt/vol) BSA, and then for 1 h with horseradish peroxidase-conjugated secondary antibody before development with an enhanced chemiluminescence kit (ECL, Amersham Pharmacia Biotech).

Cell adhesion assay. A549 cells were grown to confluence in 35-mm plates and then incubated in RPMI 1640 for an additional 12 h. In addition, PMNs were prelabeled with fluorescent calcein-AM (10 µM, 30 min; Molecular Probes; Eugene, OR) in phenol red-free RPMI 1640 containing 0.5% FBS. After stimulating the A549 cells with 10 ng/ml TNF-{alpha} or control buffer for 12 h, we washed them three times with PBS and resuspended them in phenol red-free RPMI 1640 containing 0.5% FBS, and the fluorescently labeled PMNs were added (1 x 106/ml). After incubation for 30 min at 37°C, nonadherent PMNs were removed by washing four times with PBS. Adhesion of PMNs was observed under a fluorescence microscope (Diagnostic Instruments) and counted.

Neutrophilia mouse model and intratracheal instillation. Pathogen-free female BALB/c mice (8 wk) were purchased from the Korea Research Institute of Chemistry Technology (Taejon, Korea). They were then housed throughout the experiments in a laminar flow cabinet and maintained on standard laboratory chow and water ad libitum. All procedures involving animals were reviewed and approved by the Institutional Animal Care and Use Committee of Korea University. For intratracheal instillation, animals were anesthetized by intraperitoneal injection of 150 µl of saline containing 13 mg/ml ketamine hydrochloride (Yuhan) and 88.6 µg/ml xylazine (Bayer). The necks of the anesthetized mice were shaved and then opened by a midline incision of ~1 cm on the ventral aspect, after which the trachea was exposed by careful dissection of the surrounding tissues with blunt forceps. Once the trachea was exposed, a catheter was inserted ~0.5 cm into the trachea, and 50 µl of LPS and TNF-{alpha} (Sigma) in PBS (final concentration, 20 µg/ml and 2 µg/ml, respectively) were instilled into the lungs via a pipette with a gel-loading tip. The agents were then flushed through the catheter with air, and the surrounding tissue was pinched together to close the incision. The animals remained on their backs in a warmed cage until conscious, at which time they were given food and water.

Bronchoalveolar lavage and histological analysis of neutrophil migration. Twenty-four hours after the instillation described above, bronchoalveolar lavage (BAL) fluid was recovered and placed on ice. Briefly, the chest cavity was carefully opened to allow the lung to fully expand, after which the trachea was exposed and catheterized at the same point of entry as was previously used to instill LPS and TNF-{alpha}. The catheter was tied in place, and 800 µl of prewarmed 0.9% NaCl solution were slowly infused into the lung and withdrawn. The aliquots were then pooled and stored at 4°C. Total cell counts were made with a hemocytometer. In addition, cytospins were carried out for each BAL sample, which were then stained with Diff-Quick (Merck, Dorset, UK), enabling differential cell counts to be made. In this case, the cells were counted under a microscope by two independent investigators blinded to the study. Approximately 400 cells were counted in each of four randomly selected locations. The percentage of neutrophils was multiplied by the total cell number to obtain the numbers of neutrophils. For histological analysis, the lungs were removed from mice 24 h after LPS challenge. Sections of lung tissue were then stained with hematoxylin-eosin (Sigma) and examined as described previously (40).

Gelatin zymography. Samples of BAL fluid were collected and immediately frozen in liquid nitrogen so as to preserve the gelatinolytic activity. The samples were then added Laemmli's buffer without reducing agent and separated on 7.5% SDS-polyacrylamide gels containing 0.2% gelatin (vol/vol) as a substrate, after which the separated gels were rinsed three times with 2.5% Triton X-100 for 30 min in room temperature. To assess matrix metalloproteinase (MMP)-dependent gelatinolytic activity, we incubated the gels for 24 h at 37°C in substrate buffer (50 mM Tris·Cl pH 7.6, 150 mM NaCl, 5 mM CaCl2, and 200 µg/ml Brij-35) in the presence or absence of EDTA. The purified proteins and standard markers were used to determine MMP-9 and molecular mass, respectively. The gels were stained with Coomassie brilliant blue solution. After destaining, a white gelatinolytic band was detected in the blue background.

NF-{kappa}B reporter gene assay. We carried out transient transfection by plating ~2 x 105 cells in 60-mm dishes for 24 h and then adding Lipofectamine Plus/DNA complex prepared with 1.8 µg of DNA/dish. We held the quantity of DNA used in each transfection constant by adding sonicated calf thymus DNA. To control for variations in cell number and transfection efficiency, all clones were cotransfected with 0.4 µg of pSV40-{beta}GAL, a eukaryotic expression vector containing the Escherichia coli {beta}-galactosidase (lacZ) structural gene under the transcriptional control of the simian virus 40 promoter. After incubating the cells for 3 h with the Lipofectamine Plus/DNA complex, we rinsed them with PBS before incubating them in fresh RPMI 1640 supplemented with 10% FBS. Each dish of cells was then rinsed twice with PBS and lysed in 0.1 ml of lysis solution [0.2 M Tris·Cl (pH 7.6), 0.1% Triton X-100], after which the lysed cells were scraped and spun for 1 min. The resultant supernatants were assayed for protein and {beta}-galactosidase activity. Luciferase activity was assayed in 10-µl samples of extract; the luciferase luminescence was counted in luminometer (Turner Design, TD-20/20) and normalized to the cotransfected {beta}-galactosidase activity, as described elsewhere (41). Transfection experiments were performed in triplicate with two independently isolated sets of cells, and the results were averaged.

Statistical analysis. Data are expressed as the means ± SD or the mean of percentages of control ± SD. Statistical comparisons between groups were made using Student's t-tests or ANOVA tests. Values of P < 0.05 were considered significant.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Role of PKC isoforms in TNF-{alpha}-induced VCAM-1 expression in A549 lung epithelial cells. We initially evaluated TNF-{alpha}-induced expression of VCAM-1 and ICAM-1 in A549 human lung epithelial cells. As shown in Fig. 1, expression of both was time dependent, with maximum expression occurring within 12 h, after which the levels declined. To assess the role of PKC isozymes, A549 cells were exposed to PMA for 12 h to deplete the conventional and novel PKC isozymes, leaving only atypical isozymes active. Depletion of PKC inhibited TNF-{alpha}-induced expression of VCAM-1 but had no effect on expression of ICAM-1 (Fig. 2A). This suggests that the signaling mechanisms for the expression of VCAM-1 and ICAM-1 by TNF-{alpha} are probably different in A549 human lung epithelial cells: one leading to expression of VCAM-1 via a PMA-sensitive pathway and the other to expression of ICAM-1 via a PMA-insensitive pathway.



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 1. Expression of VCAM-1 and ICAM-1 in A549 human lung epithelium. Subconfluent A549 cells were challenged with 10 ng/ml TNF-{alpha} for the indicated time periods, after which total cell lysates were subjected to 10% SDS-PAGE and sequentially immunoblotted with antibodies against VCAM-1, ICAM-1, and tubulin. The results shown are representative of 3 independent experiments.

 


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 2. TNF-{alpha} induces VCAM-1 expression via a PMA-responsive PKC isoform. A: confluent A549 cells were treated with or without 50 nM PMA for 12 h before challenge with TNF-{alpha} for 12 h. Total cell lysates (20 µg/lane) were separated by 7.5% SDS-PAGE and immunoblotted with anti-VCAM-1 and anti-ICAM-1 antibodies. B: PMA (12 h, 50 nM)-mediated depletion of classical PKC and novel PKC isoforms was determined by Western blot analysis with PKC isoform-specific antibodies. The blot was also probed with antitubulin antibody for the loading control. Data are derived from 3 separate experiments.

 
To analyze the PMA-sensitive PKC isozyme(s) involved in TNF-{alpha}-induced VCAM-1 expression in more detail, we first examined their patterns of downregulation in A549 lung epithelial cells. Western hybridization showed that the levels of PKC{alpha}, PKC{gamma}, PKC{delta}, PKC{varepsilon}, PKC{eta}, and PKC{zeta} were all downregulated by prolonged exposure with PMA in A549 cells, whereas the levels of PKC{beta}, PKC{theta}, and PKC{lambda}/{iota} were unaffected (Fig. 2B).

PKC{delta} is critical for the TNF-{alpha}-induced VCAM-1 expression in A549 lung epithelium. We next tested the effects of inhibitors of PKC isozymes with the aim of resolving which PMA-sensitive PKC isozymes are involved in VCAM-1 expression. We found that pretreating A549 cells with staurosporine (a broad-spectrum inhibitor of PKCs) or rottlerin (a PKC{delta} inhibitor) inhibited TNF-{alpha}-induced VCAM-1 expression, whereas GF-109203X (a general PKC inhibitor) and Gö-6976 (a potent inhibitor of Ca2+-dependent PKC isozymes) had no effect (Fig. 3A). On the basis of these findings, we hypothesize that PKC{delta} was at least one of the principal PKC isoforms necessary for TNF-{alpha}-induced VCAM-1 expression in this cell type.



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 3. Role of PKC{delta} in TNF-{alpha}-induced VCAM-1 expression in A549 cells. A: cells were pretreated with staurosporine (50 nM), GF-109203X (100 nM), Gö-6976 (100 nM), or rottlerin (5 µM) for 20 min or with PMA (50 nM) for 12 h before challenge with TNF-{alpha} for 12 h. Cell lysates were then immunoblotted with anti-VCAM-1 antibody. B: A549 cells were transfected with sense or antisense PKC{delta} oligonucleotides. After 36 h, they were stimulated with TNF-{alpha} or control buffer for 12 h. Immunoblots show the expression levels of VCAM-1, ICAM-1, PKC{delta}, PKC{alpha}, PKC{gamma}, and PKC{eta}. C: A549 cells were treated with TNF-{alpha} for the indicated times, after which samples of total cell lysate were analyzed by SDS-PAGE and immunoblotted with antiphospho-PKC{delta} antibody. The blot was then stripped and reprobed with anti-PKC{delta} antibody. D: cells were exposed to 10 ng/ml TNF-{alpha} for 30 min, after which the cytosolic and particulate fractions were prepared as described in MATERIALS AND METHODS. Samples of cell lysate containing equal amounts of protein were then immunoblotted with anti-PKC{delta} antibody. The results shown are representative of at least 3 independent experiments. Cont, control; p, phosphorylated.

 
To further confirm the involvement of PKC{delta} in the TNF-{alpha} signaling to VCAM-1 in A549 cells, we first examined the effect of antisense oligonucleotides directed against PKC{delta} mRNA. The Western blots in Fig. 3B show that transient transfection of A549 cells with PKC{delta} antisense oligonucleotide markedly reduced VCAM-1 expression without affecting ICAM-1 expression. By contrast, transfection of the sense oligonucleotide had no effect. Under the experimental conditions, the antisense oligonucleotide shows a specific antisense effect only on PKC{delta}, but not on PKC{alpha}, PKC{gamma}, or PKC{eta} (Fig. 3B), demonstrating the specificity of an antisense PKC{delta} oligonucleotide. We then analyzed the phosphorylation and translocation of PKC{delta} and found that addition of TNF-{alpha} to A549 cells induced both phosphorylation (Fig. 3C) and membrane translocation (Fig. 3D) of PKC{delta}, suggesting PKC{delta} is activated in response to TNF-{alpha}.

TNF-{alpha} induces VCAM-1 expression via a PKC{delta}-p38 kinase cascade. It was previously reported that inhibition of p38 MAP kinase impairs TNF-{alpha}-induced endothelial VCAM-1 expression (12). To test whether this is also true in A549 lung epithelium, we pretreated the cells with SB-203580, a p38 kinase inhibitor, and found that inhibition of p38 kinase selectively diminished TNF-{alpha}-induced VCAM-1 expression without affecting ICAM-1 expression (Fig. 4A). Moreover, inhibition of PKC{delta} with rottlerin remarkably reduced TNF-{alpha}-induced phosphorylation of p38 kinase, suggesting that p38 kinase acts downstream of PKC{delta} (Fig. 4B). Similarly, pretreatment with staurosporine, prolonged exposure of PMA (12 h), or transfection of cells with PKC{delta} antisense oligonucleotide all markedly inhibited TNF-{alpha}-induced p38 kinase phosphorylation (Fig. 4, B and C). Together, these data clearly demonstrate that PKC{delta} modulates TNF-{alpha} signaling to VCAM-1 expression via p38 MAP kinase. On the other hand, pretreatment with PD-98059, an MEK inhibitor, or SP-600125, a c-Jun amino-terminal kinase (JNK) inhibitor, had no detectable effect on the expression of either VCAM-1 or ICAM-1 (Fig. 4A). RT-PCR analysis shows that pretreatment of A549 cells with rottlerin, a PKC{delta} inhibitor, or SB-203580, a p38 kinase inhibitor, clearly blocked TNF-{alpha}-induced VCAM-1 mRNA expression (Fig. 4D). Together, our results suggest a potential role of PKC{delta}-p38 kinase cascade in the signaling mechanism of TNF-{alpha}-induced VCAM-1 gene transcription.



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 4. TNF-{alpha} induces VCAM-1 expression via a PKC{delta}-p38 kinase cascade. A: A549 cells were pretreated with PD-98059 (10 µM), SB-203580 (10 µM), or SP-600125 (5 µM) for 20 min before application of TNF-{alpha} for 12 h. VCAM-1 and ICAM-1 expression was assess by immunoblotting as described in MATERIALS AND METHODS. B: TNF-{alpha} (10 ng/ml for 10 min)-triggered p38 kinase activation was assessed after cells were exposed to 50 nM staurosporine (Stauro), 100 nM Gö-6976, 5 µM rottlerin, or 100 nM calphostin C (Cal C) for 20 min or after 12 h of exposure to 50 nM PMA. Immunoblots were prepared from whole cell extracts and probed with antiphospho-p38 kinase antibody (top), after which the stripped and reprobed with anti-p38 kinase antibody (bottom). C: cells were transfected with sense or antisense PKC{delta} oligonucleotides to as described in Fig. 3 and then probed with antiphospho-p38 kinase antibody, after which they were stripped and reprobed with anti-p38 kinase antibody. In addition, cell lysates were immunoblotted with anti-PKC{delta}/{alpha} antibody. D: A549 cells were pretreated with rottlerin (5 µM) or SB-203580 (10 µM) for 20 min before application of TNF-{alpha} for 3 h. VCAM-1 mRNA expression was assessed by RT-PCR as described in MATERIALS AND METHODS. The results shown are representative of at least 3 independent experiments.

 
PKC{delta}-p38 kinase cascade is not related to TNF-{alpha}-induced NF-{kappa}B stimulation. NF-{kappa}B is an important transcription factor involved in TNF-{alpha}-induced expression of cell adhesion molecules, including VCAM-1 and ICAM-1. This heterodimer comprises p50 and p65 subunits and exists in the cytoplasm in an inactive form bound to the inhibitory protein I{kappa}B through p65. Phosphorylation of I{kappa}B and its subsequent degradation are a critical step in NF-{kappa}B activation. In that regard, TNF-{alpha} induced both phosphorylation and degradation of I{kappa}B{alpha} in A549 cells within several minutes (Fig. 5A).



View larger version (39K):
[in this window]
[in a new window]
 
Fig. 5. The PKC{delta}-p38 kinase cascade is not related to TNF-{alpha}-induced I{kappa}B{alpha} degradation and NF-{kappa}B activation. A: A549 cells were exposed to TNF-{alpha} for the indicated times followed by examination of TNF-{alpha}-induced I{kappa}B{alpha} phosphorylation and degradation. The data are representative of 3 independent experiments yielding similar results. B: confluent A549 cells were treated with or without the indicated concentration of pyrrolidine dithiocarbamate (PDTC) or PBS (0.1% BSA) for 12 h before challenge with TNF-{alpha} for 12 h. Total cell lysates (20 µg/lane) were separated by 7.5% SDS-PAGE and immunoblotted with anti-VCAM-1 antibodies. C: cells were pretreated with control buffer, rottlerin (5 µM), SB-203580 (10 µM), or PDTC (50 µM) for 20 min followed by examination of TNF-{alpha}-induced I{kappa}B{alpha} degradation. The results shown are representative of at least 3 independent experiments. D and E: after transient transfection with pNF-{kappa}B-luciferase (Luc), A549 cells were incubated in RPMI containing 10% FBS for 24 h before being treating with TNF-{alpha} for 6 h. The cells were pretreated for 20 min with rottlerin (5 µM) or PDTC (50 µM) before addition of the TNF-{alpha} (10 ng/ml). In some cases, A549 cells were transiently cotransfected with pMT (vector), pMT-PKC{delta}KR (pPKC{delta}KR), or pcDNA3-p38AGF (pp38AGF), after which the transfectants were further maintained for 24 h and then lysed. Luc activities were measured and normalized to cotransfected {beta}-galactosidase activities. Bars depict means of ± SD of 3 samples. **P < 0.01 compared with response without inhibitor.

 
To determine whether NF-{kappa}B serves as a downstream target of the PKC{delta}-p38 kinase cascade in TNF-{alpha} signaling to VCAM-1 expression, we tested the effects of rottlerin and SB-203580 on TNF-{alpha}-induced I{kappa}B{alpha} degradation. Pretreating A549 cells for 30 min with rottlerin or SB-203580 failed to block the TNF-{alpha}-induced I{kappa}B{alpha} degradation, whereas PDTC, an inhibitor of NF-{kappa}B, attenuated both I{kappa}B{alpha} degradation and VCAM-1 expression (Fig. 5, B and C). Likewise, PMA-mediated depletion of PKC{delta} had no effect on TNF-{alpha}-induced I{kappa}B{alpha} degradation (data not shown). Analysis of reporter gene expression following transient transfection of cells with {kappa}B-luciferase, which contains five copies of the consensus NF-{kappa}B binding sequence, shows that TNF-{alpha} stimulated NF-{kappa}B-dependent promoter activity (Fig. 5D), that rottlerin had little effect on TNF-{alpha}-induced NF-{kappa}B-dependent promoter activity, and that PDTC diminished NF-{kappa}B-dependent promoter activity (Fig. 5D).

To further assess the role of PKC{delta}-p38 kinase cascade in the TNF-{alpha} signaling to NF-{kappa}B, we examined NF-{kappa}B reporter assay using dominant mutant form of PKC{delta} (pPKC{delta}K376R) or p38 kinase (pp38AGF). As shown in Fig. 5E, the TNF-{alpha}-induced NF-{kappa}B activation was not inhibited by the expression of pPKC{delta}KD or pp38AGF, suggesting that PKC{delta}-p38 cascade is not involved for the TNF-{alpha}-induced NF-{kappa}B activation. Apparently, NF-{kappa}B is not a principal target for the PKC{delta}-p38 kinase-linked signaling cascade leading to VCAM-1 expression, although it does appear to be a target of TNF-{alpha} in its signaling to VCAM-1 expression.

PKC{delta}-p38 MAP kinase cascade is critical for leukocyte adhesion to lung epithelium. To assess the role of PKC{delta}-p38 kinase-mediated VCAM-1 expression in the cell adhesion process, we first investigated the function of VCAM-1 in TNF-{alpha}-induced adhesion of leukocytes to lung epithelial cells in vitro. Under control conditions, TNF-{alpha} increased the number of PMNs adhering to A549 cells by about fivefold. Pretreating the cells with anti-VCAM-1 neutralizing antibody before incubating them with PMNs dose dependently reduced the numbers of adherent cells (Fig. 6A). As shown in Fig. 6B, moreover, pretreating the cells with rottlerin or SB-203580 also significantly reduced TNF-{alpha}-induced adhesion of PMNs to A549 cells, whereas PD-98059 had no effect. Thus inhibition of PKC{delta} or p38 kinase significantly attenuates PMN adhesion to lung epithelial cells, indicating that the PKC{delta}-p38 kinase cascade plays an essential role in leukocyte adhesion to lung epithelium.



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 6. PKC{delta}-p38 kinase cascade mediates TNF-{alpha}-induced polymorphonuclear neutrophil (PMN) adhesion to A549 lung epithelial cells. A549 cells were grown to confluence in 35-mm dishes and stimulated for 12 h with 10 ng/ml TNF-{alpha} or control buffer after pretreatment for 20 min with the indicated concentrations of human VCAM-1 blocking antibody (A) or 5 µM rottlerin, 10 µM SB-203580, or 10 µM PD-98059 (B). For adhesion assays, fluorescently labeled PMNs were added to confluent monolayers of A549 cells and incubated for 30 min at 37°C. Nonadherent PMNs cells were then removed, and adherent PMNs were counted under a microscope. Data are expressed as mean percentages ± SD from 3 independent experiments. *P < 0.05 or **P < 0.01 compared with response without inhibitor.

 
Rottlerin and SB-203580 block VCAM-1 expression induced by intratracheal instillation of TNF-{alpha} in vivo. To validate the functional roles of PKC{delta} and p38 kinase in the regulation of VCAM-1 expression in vivo, we treated BALB/c mice with TNF-{alpha}, after which VCAM-1 expression in the lung tissue was evaluated. Intratracheal instillation of TNF-{alpha} elicited a rapid increase in VCAM-1 expression within lung tissue (Fig. 7). Western blot analysis shows that maximum VCAM-1 expression occurred ~24 h after TNF-{alpha} administration, though increases were detectable within 12 h (data not shown). Intraperitoneal administration of rottlerin or SB-203580 at least 1 h before TNF-{alpha} clearly diminished the level of VCAM-1 expression in lung tissue, suggesting that PKC{delta} and p38 kinase do indeed play a role in the TNF-{alpha} signaling to VCAM-1 expression in vivo. Notably, TNF-{alpha} induced little accumulation of neutrophils or eosinophils in the lung airway despite its effect on VCAM-1 expression (data not shown), indicating VCAM-1 expression is not sufficient, by itself, to elicit neutrophilic accumulation in the lung airway.



View larger version (37K):
[in this window]
[in a new window]
 
Fig. 7. Inhibitory effects of rottlerin and SB-203580 on TNF-{alpha}-induced VCAM-1 expression in vivo. Mice were challenged with intratracheal instillation of 40 ng/50 µl TNF-{alpha}. After 12 h, samples of lung tissue were collected, and lysates were separated with 10% SDS-PAGE. For inhibitor challenge, rottlerin, SB-203580, or control buffer was administrated (10 µg/mouse ip) at least 1 h before TNF-{alpha} administration. Samples of lung lysate containing equal amounts of cellular protein were then immunoblotted with anti-VCAM-1 or antitubulin antibody. The results shown are representative of at least 3 independent experiments.

 
Rottlerin and SB-203580 block leukocyte infiltration into the lung airway in vivo. It was recently reported that LPS induces neutrophil accumulation in the lung airway and that TNF-{alpha} and chemokines such as interleukin (IL)-8 are essential for early LPS-mediated pulmonary neutrophil recruitment (23). We also observed that intratracheal instillation of LPS elicited acute neutrophil accumulation within the airway lumen (Fig. 8, A and B). This accumulation reached a maximum within 24–48 h after LPS administration and then declined (data not shown). To quantify the relative levels of neutrophil accumulation in the lung, we measured MMP-9 in BAL fluid (Fig. 8C, bottom). Consistent with the histochemical findings, MMP-9 activity was increased 24–48 h after LPS instillation; moreover, there was a concomitant increase in VCAM-1 expression in lung tissue (Fig. 8C, top). No neutrophil accumulation was observed in the lungs of saline-treated control mice (Fig. 8, A and B), nor was any MMP-9 activity detected in their BAL fluid. As shown in Fig. 9C, LPS-induced neutrophil accumulation into the lung was significantly inhibited by prior intraperitoneal administration of neutralizing antibody against murine TNF-{alpha}, suggesting that TNF-{alpha} plays a critical role in the LPS-mediated neutrophil trafficking into the airway. Additionally, pretreatment with rottlerin or SB-203580 significantly reduced LPS-induced VCAM-1 expression (Fig. 9A) and neutrophil accumulation (Fig. 9B), together indicating systemic inhibition of PKC{delta} and p38 kinase leads to a loss of both VCAM-1 expression and accumulation of neutrophils into the lung airway.



View larger version (109K):
[in this window]
[in a new window]
 
Fig. 8. LPS-induced VCAM-1 expression and neutrophil accumulation in the lung airway. Mice were challenged with intratracheal administration of 5 µg/50 µl LPS. After 24 h, lung tissues were collected and stained with hematoxylin and eosin (A), and bronchoalveolar lavage (BAL) fluids were collected so that total and differential cell counts could be made (B). Arrows indicate neutrophils. The results shown are representative of at least 3 independent experiments. C, top: immunoblot showing levels of VCAM-1 expression; bottom: zymography gel. Samples (20 µl) were subjected to 7.5% SDS-PAGE, after which purified proteins and standard markers were used to determine matrix metalloproteinase (MMP)-9 and molecular mass, respectively. The results shown are representative of at least 3 independent experiments.

 


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 9. Effects of rottlerin and SB-203580 on LPS-induced VCAM-1 expression and pulmonary neutrophil migration into lung airway in vivo. Mice were challenged with intratracheal administration of LPS; 24 h later lung tissues were prepared as described in Fig. 8. Where indicated, rottlerin, SB-203580, PD-98059, or control buffer were administrated (10 µg/mouse ip) at least 1 h before LPS administration. A: Western blotting (for VCAM-1 and tubulin) was conducted as described in MATERIALS AND METHODS. The relative intensity was measured and expressed as percentages ± SD of control from 3 independent experiments. B: numbers of neutrophils within the lung airway (BAL fluids) were multiplied through total cell number and expressed as means ± SD from 3 independent experiments (**P < 0.01). C: in some experiments 1 µg/20 g body wt of the murine (m) TNF-{alpha} neutralizing antibody (TNF/Nab) was administrated intraperitoneally 2 h before intratracheal instillation of LPS. Each sample was assayed in duplicate; the results shown are representative of at least 3 independent experiments.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The present findings indicate that TNF-{alpha}-induced expression of VCAM-1 and ICAM-1 is differentially regulated in lung epithelium and that activation of PKC{delta} and, subsequently, p38 kinase is a critical signaling component mediating VCAM-1 expression in the lung epithelium. In addition, we provide evidence suggesting that VCAM-1 upregulation via PKC{delta}-p38 kinase cascade critically mediates TNF-{alpha}/or LPS-induced elevation of leukocyte adhesion and emigration in the airway epithelium both in vitro and in vivo.

VCAM-1 was first identified as an adhesion molecule induced on endothelial cells by inflammatory cytokines IL-1 and TNF-{alpha} or by LPS. Much less is known about the signaling to VCAM-1 expression in the lung airway epithelium. Our data have shown the specificity of the activities of PKC{delta} and p38 kinase in mediating TNF-{alpha}-induced VCAM-1 expression. p38 kinase has been implicated in the regulation of NF-{kappa}B activity through direct phosphorylation and, thus, transactivation of the NF-{kappa}B p65 subunit without affecting its DNA binding activity (8, 28, 36). This makes NF-{kappa}B p65 a potential target of the PKC{delta}-p38 kinase-linked cascade in our cell type. Still, inhibition of PKC{delta} by rottlerin had little or no inhibitory effect on TNF-{alpha}-induced NF-{kappa}B activation (Fig. 5C). We therefore believe the role of NF-{kappa}B p65 in the PKC{delta}-p38 kinase-linked cascade to be negligible. Nonetheless, the fact that PDTC inhibited TNF-{alpha}-induced VCAM-1 expression (Fig. 5B) clearly shows NF-{kappa}B to be involved in the TNF-{alpha}-induced expression of VCAM-1. We therefore propose that both a PKC{delta}-p38 kinase-dependent and an NF-{kappa}B-dependent cascade contribute to the efficient expression of VCAM-1 in response to TNF-{alpha} in A549 epithelium.

Our findings are consistent with an earlier report that suggested p38 kinase regulates VCAM-1 expression without affecting ICAM-1 expression, although the detailed signaling mechanism was not presented in that earlier study (26, 28). In addition, rottlerin-dependent PKC{delta} activity was shown to modulate p38 kinase phosphorylation and I{kappa}B{alpha} degradation in thrombin signaling to ICAM-1 in HUVECs (28). In contrast to us, however, those investigators found NF-{kappa}B to be a downstream target of p38 kinase leading to ICAM-1 expression (28). The reason for this discrepancy is not clear, but it may reflect differences in the stimuli or cell type used in the experiments.

Although the mechanism by which the PKC{delta}-p38 kinase-linked cascade exerts its effect on VCAM-1 expression in lung epithelium is not completely clear, we suspect that GATA cis elements within the cytokine response region of the VCAM-1 promoter (20, 21, 24, 34) may serve as a downstream target of this cascade. Consistent with that idea, p38 kinase has been shown to mediate both GATA-3 phosphorylation and GATA-4 DNA binding activity (6, 15). We cannot exclude the possibility that other transcription factors are involved, however. For instance, it was previously suggested that TATA-binding protein (TBP), one of the subunits of basal transcription machinery transcription factor IID, might be a downstream target of p38 kinase, and phosphorylation of TBP by p38 kinase is known to be necessary for TBP binding to the TATA box (4, 28). In any event, our finding that a PKC{delta}-p38 kinase-linked cascade mediates an alternative signaling pathway to VCAM-1 expression in lung epithelium, without affecting ICAM-1, appears to be novel and to have significant clinical implications.

VCAM-1 participates in the inflammation process via its ligand, the leukocyte {beta}1-integrin very late antigen-4 (CD49/CD29) (1, 10, 30). Expression of VCAM-1 and ICAM-1 on both epithelial and endothelial cells is associated with a number of inflammatory diseases, including acute respiratory distress syndrome (ARDS), COPD, inflammatory bowel disease, and rheumatoid arthritis (5, 35). Recently, Ridger et al. (31) found that the VCAM-1/{beta}1-integrin interaction was involved in the migration of neutrophils from the interstitium into the alveolus rather than in neutrophil-endothelial cell adhesion. In the present study, VCAM-1 expression induced via the PKC{delta}-p38 kinase-linked cascade, in vivo, was found to be crucial for mediating adhesion of PMNs (virtually all neutrophils) to airway epithelium and infiltration into the airway lumen (Figs. 69).

Given that neutrophil migration into lung plays a pivotal role in the pathogenesis of acute lung injury during sepsis (13); that blood neutrophils from septic patients express {alpha}4{beta}1-integrin, which in turn caused increased adhesion to immobilized VCAM-1 (14); that an influx of neutrophils into the airway is a common feature of ARDS, COPD, and severe asthma (25, 13); and that increased numbers of neutrophils are recovered from the airways of patients with severe asthma and subjects undergoing acute asthma exacerbation (39), our findings appear to be both functionally and clinically significant. The extent to which these finding can serve as the basis for the development of new therapies for the treatment of the aforementioned ailments remains unknown, but the prospects are intriguing.

In summary, our findings suggest that a PKC{delta}-p38-linked cascade plays a pivotal role in TNF-{alpha} signaling to VCAM-1 expression in lung epithelium in vitro and in vivo, which in turn supports neutrophil accumulation in the lung airway. To our knowledge, this is the first evidence showing that separate signaling mechanisms underlie the upregulation of VCAM-1 and ICAM-1 and the first demonstration of the role of VCAM-1 upregulation via PKC{delta}-p38 kinase-linked cascade for the TNF-{alpha}-induced elevation of leukocyte adhesion and emigration in the airway epithelium. Although further studies are needed to clarify the molecular linkage between the PKC{delta}-p38-linked cascade and potential targets (e.g., GATA-binding proteins), our findings have important implications as to the molecular mechanism underlying several inflammatory lung diseases.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by Korea Research Foundation Grant KRF-2002-041-C00227.


    FOOTNOTES
 

Address for reprint requests and other correspondence: J.-H. Kim, School of Life Sciences and Biotechnology, Korea Univ., 5-1 Anam-dong, Sungbuk-gu, Seoul, 136-701, Korea. (E-mail: jhongkim{at}korea.ac.kr)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Beck-Schimmer B, Schimmer RC, Madjdpour C, Bonvini JM, Pasch T, and Ward PA. Hypoxia mediates increased neutrophil and macrophage adhesiveness to alveolar epithelial cells. Am J Respir Cell Mol Biol 25: 780–787, 2001.[Abstract/Free Full Text]
  2. Blackwell TS and Christman JW. The role of nuclear factor-kappa B in cytokine gene regulation. Am J Respir Cell Mol Biol 17: 3–9, 1997.[Abstract/Free Full Text]
  3. Burke-Gaffney A and Hellewell PG. Tumour necrosis factor-alpha-induced ICAM-1 expression in human vascular endothelial and lung epithelial cells: modulation by tyrosine kinase inhibitors. Br J Pharmacol 119: 1149–1158, 1996.[Web of Science][Medline]
  4. Carter AB, Knudtson KL, Monick MM, and Hunninghake GW. The p38 mitogen-activated protein kinase is required for NF-kappaB-dependent gene expression. The role of TATA-binding protein (TBP). J Biol Chem 274: 30858–30863, 1999.[Abstract/Free Full Text]
  5. Carter RA, Campbell IK, O'Donnel KL, and Wicks IP. Vascular cell adhesion molecule-1 (VCAM-1) blockade in collagen-induced arthritis reduces joint involvement and alters B cell trafficking. Clin Exp Immunol 128: 44–51, 2002.[CrossRef][Web of Science][Medline]
  6. Chen CH, Zhang DH, LaPorte JM, and Ray A. Cyclic AMP activates p38 mitogen-activated protein kinase in Th2 cells: phosphorylation of GATA-3 and stimulation of Th2 cytokine gene expression. J Immunol 165: 5597–5605, 2000.[Abstract/Free Full Text]
  7. Collins T, Read MA, Neish AS, Whitley MZ, Thanos D, and Maniatis T. Transcriptional regulation of endothelial cell adhesion molecules: NF-kappa B and cytokine-inducible enhancers. FASEB J 9: 899–909, 1995.[Abstract]
  8. Craig R, Larkin A, Mingo AM, Thuerauf DJ, Andrews C, McDonough PM, and Glembotski CC. p38 MAPK and NF-kappa B collaborate to induce interleukin-6 gene expression and release. Evidence for a cytoprotective autocrine signaling pathway in a cardiac myocyte model system. J Biol Chem 275: 23814–23824, 2000.[Abstract/Free Full Text]
  9. Cybulsky MI, Liyama K, Li H, Zhu S, Chen M, Liyama M, Davis V, Gutierrez-Ramos JC, Connelly PW, and Milstone DS. A major role for VCAM-1, but not ICAM-1, in early atherosclerosis. J Clin Invest 107: 1255–1262, 2001.[Web of Science][Medline]
  10. Davenpeck KL, Sterbinsky SA, and Bochner BS. Rat neutrophils express alpha4 and beta1 integrins and bind to vascular cell adhesion molecule-1 (VCAM-1) and mucosal addressin cell adhesion molecule-1 (MAdCAM-1). Blood 91: 2341–2346, 1998.[Abstract/Free Full Text]
  11. Deisher TA, Haddix TL, Montgomery KF, Pohlman TH, Kaushansky K, and Harlan JM. The role of protein kinase C in the induction of VCAM-1 expression on human umbilical vein endothelial cells. FEBS Lett 331: 285–290, 1993.[CrossRef][Web of Science][Medline]
  12. Fan J, Ye RD, and Malik AB. Transcriptional mechanisms of acute lung injury. Am J Physiol Lung Cell Mol Physiol 281: L1037–L1050, 2001.[Abstract/Free Full Text]
  13. Guo RF, Riedemann NC, Laudes IJ, Sarma VJ, Kunkel RG, Dilley KA, Paulauskis KD, and Ward PA. Altered neutrophil trafficking during sepsis. J Immunol 169: 307–314, 2002.[Abstract/Free Full Text]
  14. Ibbotson GC, Doig C, Kaur J, Gill V, Ostrovsky L, Fairhead T, and Kubes P. Functional alpha4-integrin: a newly identified pathway of neutrophil recruitment in critically ill septic patients. Nat Med 7: 465–470, 2001.[CrossRef][Web of Science][Medline]
  15. Kerkela R, Pikkarainen S, Majalahti-Palviainen T, Tokola H, and Ruskoaho H. Distinct roles of mitogen-activated protein kinase pathways in GATA-4 transcription factor-mediated regulation of B-type natriuretic peptide gene. J Biol Chem 277: 13752–13760, 2002.[Abstract/Free Full Text]
  16. Kidney JC and Proud D. Neutrophil transmigration across human airway epithelial monolayers: mechanisms and dependence on electrical resistance. Am J Respir Cell Mol Biol 23: 389–395, 2000.[Abstract/Free Full Text]
  17. Kim BC, Lee MN, Kim JY, Lee SS, Chang JD, Kim SS, Lee SY, and Kim JH. Roles of phosphatidylinositol 3-kinase and Rac in the nuclear signaling by tumor necrosis factor-alpha in rat-2 fibroblasts. J Biol Chem 274: 24372–24379, 1999.[Abstract/Free Full Text]
  18. Mattila P, Majuri MI, Mattila PS, and Renkonen R. TNF alpha-induced expression of endothelial adhesion molecules, ICAM-1 and VCAM-1, is linked to protein kinase C activation. Scand J Immunol 36: 159–165, 1992.[CrossRef][Web of Science][Medline]
  19. Mellor H and Parker PJ. The extended protein kinase C superfamily. Biochem J 332: 281–292, 1998.[Web of Science][Medline]
  20. Minami T and Aird WC. Thrombin stimulation of the vascular cell adhesion molecule-1 promoter in endothelial cells is mediated by tandem nuclear factor-kappa B and GATA motifs. J Biol Chem 276: 47632–47641, 2001.[Abstract/Free Full Text]
  21. Neish AS, Williams AJ, Palmer HJ, Whitley MZ, and Collins T. Functional analysis of the human vascular cell adhesion molecule 1 promoter. J Exp Med 176: 1583–1593, 1992.[Abstract/Free Full Text]
  22. Newton AC. Regulation of protein kinase C. Curr Opin Cell Biol 9: 161–167, 1997.[CrossRef][Web of Science][Medline]
  23. Nick JA, Young SL, Brown KK, Avdi NJ, Arndt PG, Suratt BT, Janes MS, Henson PM, and Worthen GS. Role of p38 mitogen-activated protein kinase in a murine model of pulmonary inflammation. J Immunol 164: 2151–2159, 2000.[Abstract/Free Full Text]
  24. Papi A and Johnston SL. Respiratory epithelial cell expression of vascular cell adhesion molecule-1 and its up-regulation by rhinovirus infection via NF-kappaB and GATA transcription factors. J Biol Chem 274: 30041–30051, 1999.[Abstract/Free Full Text]
  25. Pettersen CA and Alder KB. Airways inflammation and COPD: epithelial-neutrophil interactions. Chest 121: 142S–150S, 2002.[CrossRef][Web of Science][Medline]
  26. Pietersma A, Tilly BC, Gaestel M, de Jong N, Lee JC, Koster JF, and Sluiter W. p38 mitogen activated protein kinase regulates endothelial VCAM-1 expression at the post-transcriptional level. Biochem Biophys Res Commun 230: 44–48, 1997.[CrossRef][Web of Science][Medline]
  27. Rahman A, Anwar KN, and Malik AB. Protein kinase C-{zeta} mediates TNF-{alpha}-induced ICAM-1 gene transcription in endothelial cells. Am J Physiol Cell Physiol 279: C906–C914, 2000.[Abstract/Free Full Text]
  28. Rahman A, Anwar KN, Uddin S, Xu N, Ye RD, Platanias LC, and Malik AB. Protein kinase C-delta regulates thrombin-induced ICAM-1 gene expression in endothelial cells via activation of p38 mitogen-activated protein kinase. Mol Cell Biol 21: 5554–65, 2001.[Abstract/Free Full Text]
  29. Rahman A, Bando M, Kefer J, Anwar KN, and Malik AB. Protein kinase C-activated oxidant generation in endothelial cells signals intercellular adhesion molecule-1 gene transcription. Mol Pharmacol 55: 575–583, 1999.[Abstract/Free Full Text]
  30. Reinhardt PH, Elliott JF, and Kubes P. Neutrophils can adhere via alpha4beta1-integrin under flow conditions. Blood 89: 3837–3846, 1997.[Abstract/Free Full Text]
  31. Ridger VC, Wagner BE, Wallace WAH, and Hellewell PG. Differential effects of CD18, CD29, and CD49 integrin subunit inhibition on neutrophil migration in pulmonary inflammation. J Immunol 166: 3484–3490, 2001.[Abstract/Free Full Text]
  32. Rosseau S, Selhorst J, Wiechmann K, Leissner K, Maus U, Mayer K, Grimminger F, Seeger W, and Lohmeyer J. Monocyte migration through the alveolar epithelial barrier: adhesion molecule mechanisms and impact of chemokines. J Immunol 164: 427–435, 2000.[Abstract/Free Full Text]
  33. Scholz D, Devaux B, Hirche A, Potzsch B, Kropp B, Schaper W, and Schape J. Expression of adhesion molecules is specific and time-dependent in cytokine-stimulated endothelial cells in culture. Cell Tissue Res 284: 415–423, 1996.[CrossRef][Web of Science][Medline]
  34. Umetani M, Mataki C, Minegichi N, Yamamoto M, Hamakubo T, and Kodama T. Function of GATA transcription factors in induction of endothelial vascular cell adhesion molecule-1 by tumor necrosis factor-alpha. Arterioscler Thromb Vasc Biol 21: 917–922, 2001.[Abstract/Free Full Text]
  35. Van Assche G and Rutgeerts P. Antiadhesion molecule therapy in inflammatory bowel disease. Inflamm Bowel Dis 8: 291–300, 2002.[CrossRef][Web of Science][Medline]
  36. Vanden Berghe W, Plaisance S, Boone E, De Bosscher K, Schmitz ML, Fiers W, and Haegeman G. p38 and extracellular signal-regulated kinase mitogen-activated protein kinase pathways are required for nuclear factor-kappaB p65 transactivation mediated by tumor necrosis factor. J Biol Chem 273: 3285–3290, 1998.[Abstract/Free Full Text]
  37. Wagner JG and Roth RA. Neutrophil migration mechanisms, with an emphasis on the pulmonary vasculature. Pharmacol Rev 52: 349–374, 2000.[Abstract/Free Full Text]
  38. Wang Q and Doerschuk CM. The signaling pathways induced by neutrophil-endothelial cell adhesion. Antioxid Redox Signal 4: 39–47, 2002.[CrossRef][Web of Science][Medline]
  39. Woo CH, Eom YW, Yoo MH, You HJ, Han HJ, Song WK, Yoo YJ, Chun CS, and Kim JH. Tumor necrosis factor-alpha generates reactive oxygen species via a cytosolic phospholipase A2-linked cascade. J Biol Chem 275: 32357–32362, 2000.[Abstract/Free Full Text]
  40. Yang L, Cohn L, Zhang DH, Homer R, Ray A, and Ray P. Essential role of nuclear factor kappaB in the induction of eosinophilia in allergic airway inflammation. J Exp Med 188: 1739–1750, 1998.[Abstract/Free Full Text]
  41. Yoo MH, Woo CH, You HJ, Cho SH, Kim BC, Yee JE, Jhun BH, Kim TS, and Kim JH. Role of the cytosolic phospholipase A2-linked cascade in signaling by an oncogenic, constitutively active Ha-Ras isoform. J Biol Chem 276: 24645–24653, 2001.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Eur Respir JHome page
K. Vardarova, S. Scharf, F. Lang, B. Schmeck, B. Opitz, J. Eitel, A. C. Hocke, H. Slevogt, A. Flieger, S. Hippenstiel, et al.
PKC{alpha} and PKC{epsilon} differentially regulate Legionella pneumophila-induced GM-CSF
Eur. Respir. J., November 1, 2009; 34(5): 1171 - 1179.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
C. J. Clarke, J. M. Guthrie, and Y. A. Hannun
Regulation of Neutral Sphingomyelinase-2 (nSMase2) by Tumor Necrosis Factor-{alpha} Involves Protein Kinase C-{delta} in Lung Epithelial Cells
Mol. Pharmacol., October 1, 2008; 74(4): 1022 - 1032.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
Y. Jing, J. A. Dowdy, M. R. Van Scott, and J. S. Fedan
Hyperosmolarity-Induced Dilation and Epithelial Bioelectric Responses of Guinea Pig Trachea in Vitro: Role of Kinase Signaling
J. Pharmacol. Exp. Ther., July 1, 2008; 326(1): 186 - 195.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
H. Slevogt, L. Maqami, K. Vardarowa, W. Beermann, A. C. Hocke, J. Eitel, B. Schmeck, A. Weimann, B. Opitz, S. Hippenstiel, et al.
Differential regulation of Moraxella catarrhalis-induced interleukin-8 response by protein kinase C isoforms
Eur. Respir. J., April 1, 2008; 31(4): 725 - 735.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
Q. Tong, L. Zheng, L. Lin, B. Li, D. Wang, and D. Li
Hypoxia-Induced Mitogenic Factor Promotes Vascular Adhesion Molecule-1 Expression via the PI-3K/Akt-NF-{kappa}B Signaling Pathway
Am. J. Respir. Cell Mol. Biol., October 1, 2006; 35(4): 444 - 456.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
I. Kuwahara, E. P. Lillehoj, W. Lu, I. S. Singh, Y. Isohama, T. Miyata, and K. C. Kim
Neutrophil elastase induces IL-8 gene transcription and protein release through p38/NF-{kappa}B activation via EGFR transactivation in a lung epithelial cell line
Am J Physiol Lung Cell Mol Physiol, September 1, 2006; 291(3): L407 - L416.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
E. N. Ogawa, A. Ishizaka, S. Tasaka, H. Koh, H. Ueno, F. Amaya, M. Ebina, S. Yamada, Y. Funakoshi, J. Soejima, et al.
Contribution of High-Mobility Group Box-1 to the Development of Ventilator-induced Lung Injury
Am. J. Respir. Crit. Care Med., August 15, 2006; 174(4): 400 - 407.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
J. Menne, J.-K. Park, R. Agrawal, C. Lindschau, J. T. Kielstein, T. Kirsch, A. Marx, D. Muller, F. H. Bahlmann, M. Meier, et al.
Cellular and molecular mechanisms of tissue protection by lipophilic calcium channel blockers
FASEB J, May 1, 2006; 20(7): 994 - 996.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
288/2/L307    most recent
00105.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (22)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Woo, C.-H.
Right arrow Articles by Kim, J.-H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Woo, C.-H.
Right arrow Articles by Kim, J.-H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2005 by the American Physiological Society.