Am J Physiol Lung Cell Mol Physiol 288: L975-L987, 2005.
First published January 14, 2005; doi:10.1152/ajplung.00003.2004
1040-0605/05 $8.00
Ethanol stimulates the expression of fibronectin in lung fibroblasts via kinase-dependent signals that activate CREB
Jesse Roman,1,2
Jeffrey D. Ritzenthaler,1
Rabih Bechara,1,2
Lou Ann Brown,3 and
David Guidot1,2
Division of Pulmonary, Allergy, and Critical Care Medicine, Departments of 1Medicine and 3Pediatrics, Emory University School of Medicine, and 2Atlanta Veterans Affairs Medical Center, Atlanta, Georgia
Submitted 7 January 2004
; accepted in final form 6 January 2005
 |
ABSTRACT
|
|---|
Ethanol renders the lung susceptible to acute lung injury in the setting of insults such as sepsis. The mechanisms mediating this effect are unknown, but activation of tissue remodeling is considered key to this process. We found that chronic ethanol ingestion in rats increased the expression of fibronectin, a matrix glycoprotein implicated in acute lung injury. In cultured NIH/3T3 cells and in primary rat and mouse lung fibroblasts, ethanol induced fibronectin mRNA and protein expression in a dose- and time-dependent fashion. The effect of ethanol was prevented by inhibitors of protein kinase C and mitogen-activated protein kinases and was associated with the phosphorylation and increased DNA binding of the transcription factor cAMP response element binding protein, followed by increased transcription of the fibronectin gene. Fibroblasts were found to express
7 nicotinic acetylcholine receptor (nAChR), and ethanol induction of fibronectin was abolished by
-bungarotoxin and methyllcaconitine, inhibitors of
7 nAChRs. However, ethanol was able to induce fibronectin mRNA and protein in primary lung fibroblasts isolated from
7 nAChR knockout mice. The ethanol-induced fibronectin response was dependent on ethanol metabolism since 4-methylpyrazole, an inhibitor of alcohol dehydrogenase, abolished the effect and acetaldehyde induced it. These observations suggest that ethanol or ethanol metabolites stimulate lung fibroblasts to produce fibronectin by inducing specific signals transmitted via nAChRs independent of the
7-subunit, and this might represent a mechanism by which ethanol renders the lung susceptible to acute lung injury.
extracellular matrix; tissue remodeling; signal transduction; gene transcription; nicotinic acetylcholine receptors; lung injury; cAMP response element binding protein
THE ACUTE RESPIRATORY DISTRESS SYNDROME (ARDS) is a devastating disease that afflicts
75,000150,000 individuals per year in the United States (1). The most common at-risk diagnoses associated with the development of ARDS are sepsis, trauma, and the aspiration of gastric contents. The mechanisms that lead to the development of this syndrome in some patients and not others are unknown, but a recent discovery points to alcohol abuse as an important predisposing factor. This association was first identified by the work of Moss and colleagues (33) who demonstrated that chronic alcohol abuse in humans independently increases the incidence of ARDS in at-risk patients and is associated with increased mortality related to multiorgan failure.
Ethanol also predisposes rats to edematous lung injury elicited by endotoxemia or sepsis, thereby mimicking the human condition (25). The use of this model has greatly improved our understanding of the cellular mechanisms responsible for the effects of ethanol in the lung. The data available to date indicate that chronic (68 wk) ingestion of ethanol in these animals results in decreased levels of glutathione, an important antioxidant in the lung (25, 52). This defect is associated with alterations in epithelial cell permeability (21), decreased alveolar liquid clearance (21), decreased cell viability (9), and decreased surfactant production (22). Alterations in glutathione metabolism have also been confirmed in humans that abuse alcohol (34).
Studies performed in rats chronically fed with ethanol also revealed activation of tissue remodeling in the lung. In particular, ethanol induced activation of matrix-degrading enzymes of the matrix metalloproteinase family (29) and increased the production of the profibrotic factor transforming growth factor-
1 (4). These studies suggest that activation of tissue remodeling, with subsequent alterations in extracellular matrix expression, deposition, and degradation, might represent another mechanism by which ethanol can affect the lung and render it susceptible to acute lung injury (42).
More recently, we found that chronic ethanol ingestion also increases the expression of fibronectin in the lung. This multidomain cell-adhesive glycoprotein is increased in acute lung injury, and its production is elicited experimentally by agents associated with this illness (e.g., paraquat) (27, 43). Although the exact role of fibronectin in lung is unknown, its ability to promote matrix deposition and coagulation, and to induce the migration and activation of inflammatory cells in vitro, among other functions, suggests that fibronectin is not only a sensitive marker of injury but that it is a key player in the pathogenesis of acute lung injury (44). Accordingly, this report explores the intracellular mechanisms that mediate ethanol-induced fibronectin expression in fibroblasts in order to gain insight into the pathways involved in activation of tissue remodeling in the lungs of experimental animals exposed to ethanol chronically.
 |
MATERIALS AND METHODS
|
|---|
Experimental reagents.
-Bungarotoxin was purchased from Amersham Biosciences (Piscataway, NJ). The anti-cAMP response element binding protein (CREB) antibody, anti-phospho-CREB antibody, and mitogen enhanced kinase-1 (MEK-1) inhibitor PD-98059 were purchased from Cell Signaling Technology (Beverly, MA). Ethanol, N6, 2'-O-dibutryl adenosine 3',5'-cyclic monophosphate, calphostin C, 4-methylpyrazole, and methyllcaconitine (MLA) were purchased from Sigma Chemical (St. Louis, MO). All other reagents were purchased from Fisher Scientific (Pittsburgh, PA) or Sigma unless otherwise specified.
Cell culture and treatment.
Murine NIH/3T3 fibroblasts from American Type Culture Collection (no. 1658; Manassas, VA) were maintained in DMEM with 4.5 g/l of glucose supplemented with 10% heat-inactivated FBS and 1% antibiotic-antimycotic solution (100 U/ml penicillin G sodium, 100 U/ml streptomycin, 0.25 µg/ml amphotericin B) and incubated in a humidified 5% CO2 incubator at 37°C. The cells were harvested by trypsinization with 2.5x trypsin and 5.3 mM EDTA, washed with PBS, counted, and plated at 1.5 x 105 cells/ml in 12-well tissue culture dishes in 10% FBS. Concurrently, cells were treated with calphostin C (1 x 107 M) or MAPK inhibitor (50 µM). The doses of experimental agents were chosen based on results from preliminary studies or doses reported in the literature.
Primary lung fibroblasts were harvested from rat lungs obtained from wild-type mice, transgenic mice containing the full-length human fibronectin promoter connected to the luciferase reporter vector (51), and knockout mice deficient in
7 nicotinic acetylcholine receptors (nAChRs; no. 003232; Jackson Laboratories, Bar Harbor, ME) by discarding the outer 3 mm of lung periphery and cutting the remaining lung parenchyma tissue into 1-mm sections. Animal studies were approved and conducted in accordance with the rules and regulations of the Animal Care Committee of Emory University and the Atlanta VA Medical Center. Tissue sections were washed twice in sterile PBS, resuspended in DMEM with 4.5 g/l glucose supplemented with 10% FBS and 1% antibiotic-antimycotic solution (100 U/ml penicillin G sodium, 100 U/ml streptomycin, 0.25 µg/ml amphotericin B), transferred to a tissue culture dish, and incubated in a humidified 5% CO2 incubator at 37°C for 13 wk to allow fibroblasts to migrate out of tissue sections. Primary lung fibroblasts were between three and five passages when used in experiments.
Detection of fibronectin and CREB phosphorylation by Western blot.
Fibroblasts were treated with 60 mM ethanol for 048 h, washed with ice-cold PBS, and lysed in 1 ml of homogenization buffer (50 mM NaCl, 50 mM NaF, 50 mM NaP2O7-10 H2O, 5 mM EDTA, 5 mM EGTA, 2 mM Na3V04, 0.5 mM PMSF, 0.01% Triton X-100, 10 µg/ml leupeptin, and 10 mM HEPES, pH 7.4) by repeated passages through a 26-gauge needle. The resulting homogenate was centrifuged at 14,000 rpm for 5 min at 4°C. Protein concentration was determined by the Bradford method. The protein (100 µg) was mixed with an equal volume of 2x sample buffer (125 mM Tris·HCl, pH 6.8, 4% SDS, 20% glycerol, 510% 2-mercaptoethanol, 0.004% bromphenol blue), boiled for 5 min, loaded onto a 10% SDS-polyacrylamide gel (5% SDS-polyacrylamide gel for fibronectin detection) with a 3.9% stacking gel, and electrophoresed for 1 h at 60 mA. The separated proteins were transferred onto nitrocellulose using a Bio-Rad Trans Blot semidry transfer apparatus for 30 min at 25 mA, blocked with Blotto [1x TBS (10 mM Tris·HCl, pH 8.0, 150 mM NaCl), 5% nonfat dry milk, 0.05% Tween 20] for 1 h at room temperature, and washed twice for 5 min with wash buffer (1x TBS, 0.05% Tween 20). Blots were incubated with a polyclonal antibody raised against human fibronectin (antibody F3648, 1:1,000 dilution; Sigma) for 24 h at 4°C, washed three times for 5 min with wash buffer, and incubated with a secondary goat antibody raised against rabbit IgG conjugated to horseradish peroxidase (antibody A9169, 1:10,000 dilution) for 1 h at room temperature. Endogenous levels of CREB activated by phosphorylation at Ser133 were detected using an antibody specific for phosphor-CREB (1:1,000 dilution) for 2 h at 4°C, washed three times for 5 min with wash buffer, and incubated with a secondary goat antibody raised against rabbit IgG conjugated to horseradish peroxidase (1:5,000 dilution) for 1 h at room temperature. The blots were washed four times in wash buffer, transferred to freshly made ECL solution (Amersham, Arlington, IL) for 1 min, and exposed to X-ray film. Protein bands were quantified by densitometric scanning using a GS-800 calibrated laser densitometer (Bio-Rad).
Detection of mRNAs by RT-PCR.
Fibroblasts were exposed to ethanol (0100 mM) and tested at 2, 6, 8, and 24 h for various mRNAs using an RT-PCR bioluminescence assay. The procedure for bioluminescent detection of mRNA was performed as previously described (38, 41). Amplification of PCR products was achieved using 5'-biotinylated (forward) primers; the 3' primers were not modified, and the PCR products ranged in size from 300 to 350 bp. Cycled curve studies were performed to ensure that for the amounts of cDNA being amplified, the reaction had not reached plateau of the amplification curve at a constant number of cycles for any primer pair. Negative controls consisted of deionized H2O and RNA without RT-PCR products, and standardization was made to the housekeeping gene
-actin or hypoxanthine phosphoribosyltransferase (HPRT). The biotinylated primer-PCR product was captured on streptavidin-coated plates (Boehringer Mannheim) and probed with digoxigenin (DIG)-labeled probes. The oligos were DIG labeled using DIG Oligonucleotide Tailing kit plates (Boehringer Mannheim). Anti-digoxigenin antibody labeled with the bioluminescent molecule aequorin (AquaLite; SeaLite Sciences, Bogart, GA) was added, and luminescence was measured on a LabSystems Luminoskan Ascent Plate Luminometer after triggering with calcium. Because of its semiquantitative nature, the relative amounts of a specific mRNA were compared with one another within the same experiment. All products were verified by agarose gel electrophoresis to ensure that the predicted mRNA species was being examined.
Primers and probes for RT-PCR reactions were based on GenBank published sequences and are as follows: rat fibronectin forward primer (AGAGCATACCTCTCAGAG), rat fibronectin reverse primer (CTGCTCATCAGTTGGGAA), rat fibronectin probe (TCTATCACCCTC ACCAAC); rat HPRT forward primer (GTCATGAAGGAGATGGGA), rat HPRT reverse primer (CAGCAA GCTTGCACCCTT), rat HPRT probe (GCTTGACCAAGG AAAGCA); mouse fibronectin forward primer (CTGTGACAACTGCCGTAG), mouse fibronectin reverse primer (CAGCTTCTCCAAGCATCG), mouse fibronectin probe (ACCAAGGTCAATC CACAC); mouse
-actin forward primer (ATGGATGACGATATCGCT), mouse
-actin reverse primer (ATGAGGTAGTCTGTCAGG T), mouse
-actin probe (GGATGGCTACGTACATGG CT); mouse nAChR
7 forward primer (GTAACCATGCGCCGTAGG), mouse nAChR
7 reverse primer (CCGAGGCTTGTGCTGAC), mouse nAChR
7 probe (GGTGCTGGCGAAGT ACTG).
125I-
-bungarotoxin-binding and competition assay.
The
-bungarotoxin (
-BGT) binding assay was performed using the method of Breese et al. (7, 8) to detect nAChRs on the surface of fibroblasts. Fibroblasts (1 x 106) were incubated with 5 nM [125I]Tyr54
-BGT (specific activity 2,000 Ci/mM) alone or with 60 mM ethanol for 16 h at 37°C/5% CO2. Control cells were incubated with binding buffer (TBS + 0.2% BSA). The cells were rinsed twice in binding buffer at 37°C for 5 min, followed by three washes in TBS for 15 min and one wash in PBS for 5 min. Afterward, 125I radioactivity bound to the functional nAChRs contained in the samples was quantified by a gamma counter.
The
-BGT competition assay was performed on primary mouse lung fibroblasts (1 x 106) incubated with or without ethanol (60 mM) in the presence or absence
-BGT (0.52.5 nM) or a second specific
7 nAChR inhibitor, MLA (0.51.0 nM), for 8 h at 37°C and 5% CO2. Afterwards, cells were harvested and mRNA levels for fibronectin and
-actin were determined as described above.
Examination of fibronectin gene transcription.
To evaluate for fibronectin gene transcription, the pFN(1.2kb)LUC promoter construct was introduced into murine NIH/3T3 fibroblasts via electroporation to create stable transfectants (32). pFN(1.2kb)LUC contains
1,200 bp of the 5' flanking region of the human fibronectin gene isolated from the human fibrosarcoma cell line HT-1080. This construct includes 69 bp of exon 1, a CAAT site located at 150 bp, and the sequence ATATAA at 25 bp from the transcription start site. It also contains several previously identified regulatory elements such as three cAMP response elements (CREs) located at 415, 270, and 170 bp, and an SP-1 site at 102 bp from the transcription start site. The promoter was subcloned into the SmaI site of pGL3 Basic Luciferase Reporter Vector (Promega, Madison, WI) (32).
The stably transfected NIH/3T3 fibroblasts were maintained in DMEM with 4.5 g/l of glucose supplemented with 10% heat-inactivated FBS and 1% antibiotic-antimycotic solution (100 U/ml penicillin G sodium, 100 U/ml streptomycin, 0.25 µg/ml amphotericin B) and incubated in a humidified 5% CO2 incubator at 37°C. The cells were harvested by trypsinization with 2.5x trypsin and 5.3 mM EDTA (Sigma), washed with PBS, counted, and plated at 1.5 x 105 cells/ml in 12-well tissue culture dishes in 10% FBS. Concurrently, cells were treated with ethanol (0160 mM) for various periods of time. Afterwards, the cells were tested for luciferase activity. For this, the cells were harvested by cell scraper, washed with PBS, resuspended in 100 µl of cell lysis buffer (Promega), and sonicated, and a 10-µl aliquot was tested by adding 50 µl of Luciferase Assay Reagent (Promega). Light intensity was measured using a Labsystems Luminoskan Ascent Plate Luminometer. Results were recorded as normalized luciferase units and adjusted for total protein content that was measured using the Bradford method (6).
Electrophoretic DNA mobility shift assay.
Fibroblasts (3 x 106) were seeded onto 150-mm2 tissue culture flasks and incubated in 10% FBS for 24 h with and without concurrent treatment with ethanol at the doses described above. Cells were washed with ice-cold PBS, and nuclear binding proteins were extracted by a published method (18). Protein concentration was determined by the Bradford method using Bio-Rad protein assay reagent (6). Double-stranded CREB consensus oligonucleotide (5' AGAGATTGCCTGACGTCAGAGAGCTAG) was labeled with biotin-N4-CTP using terminal deoxynucleotidyl transferase enzyme. Nuclear protein (5 µg) was incubated with biotin-labeled double-stranded CREB for 20 min at room temperature as described previously (32). For competition reactions, non-biotin-labeled consensus and mutated CREB double-stranded oligonucleotides (5' AGAGATTGCCTGTGGTCAGAGAGCTAG) were added to the reaction mixture at 50x molar concentration. DNA-protein complexes were separated on 6% native polyacrylamide gel (20:1 acrylamide/bis ratio) in low ionic strength buffer (22.25 mM Tris borate, 22.25 mM boric acid, 500 mM EDTA) for 23 h at 4°C at 10 V/cm2. DNA and DNA-protein complexes were transferred to nylon membrane using a Bio-Rad Trans Blot semidry transfer apparatus for 1 h at 25 V and cross-linked using the Fb-UVXL-1000 UV Crosslinker (Fisher Scientific, Pittsburgh, PA). DNA and DNA-protein complexes were detected using Streptavidin-Horseradish Peroxidase Conjugate and Lightshift Chemiluminescent Substrate according the manufacturer's instructions (Pierce Biotechnology, Rockford, IL). The membrane was exposed to X-ray film for 1 min.
Screening for LPS.
Experimental reagents were reconstituted in LPS-free water (Sigma). All treatment materials and culture media were screened with a limulus-based endotoxin assay with a sensitivity of 0.06 ng/ml (Endotect-Schwarz/Mann Biotech, Cleveland, OH) as described (39, 40). Reagents were found to remain endotoxin free throughout all experiments.
Animal model of chronic ethanol ingestion and lung immunohistochemistry.
The animal model of chronic ethanol ingestion has been described previously (9, 21, 22, 25, 29, 52). Briefly, young adult male Sprague-Dawley rats (200250 g) were fed the Lieber-DeCarli liquid diet (Research Diets, New Brunswick, NH) containing either ethanol (36% total calories) or the isocaloric carbohydrate substitution with Maltin-Destrin (control diet). The diets are otherwise identical in protein, lipid, and essential nutrient composition. This is a standard experimental diet in ethanol ingestion models, and we have used it extensively. During the first 2 wk of the dietary regimen, the ethanol-fed rats were gradually acclimated to the ethanol, receiving 12% of their total calories as ethanol (1/3 strength) for 1 wk, then 24% of their total calories as ethanol (2/3 strength) for 1 wk, and then full-strength diet (36% of total calories as ethanol) for 4 wk, for a total of 6 wk of ethanol ingestion. Afterwards, the animals were killed, followed by isolation of the lungs for RNA isolation (see above) and immunohistochemistry. Control and experimental lungs were processed and submitted to immunohistochemistry with an anti-fibronectin antibody as previously described (39).
Statistical evaluation.
Means + SD of the mean were calculated for all experimental values. Significance was assessed by ANOVA followed by Student's t-test. All experiments were repeated four to eight times.
 |
RESULTS
|
|---|
Ethanol increases fibronectin expression and deposition in rat lungs.
To examine the effects of ethanol on fibronectin expression in lung, rats were fed the Lieber-DeCarli isocaloric liquid diet that contains 36% of total calories provided as ethanol. This diet was previously shown to increase endotoxin-mediated acute edematous injury in rat lungs isolated and perfused ex vivo (25). After 6 wk, the lungs of control rats and rats fed with ethanol diets were harvested and processed for the detection of fibronectin mRNA (by RT-PCR) and protein (by immunohistochemistry). The lungs of rats fed with ethanol showed increased fibronectin mRNA content compared with pair-fed control animals (Fig. 1A). As expected, immunohistochemical analysis of control lungs showed fibronectin deposition in vascular airway structures and within alveolar septae (Fig. 1B). However, experimental lungs showed increased fibronectin deposition as demonstrated by intense staining of lung structures including the alveolar septae; both epithelial cells and interstitial fibroblasts appeared stained (Fig. 1C). These observations demonstrate that chronic ethanol ingestion in rats is associated with increased expression and deposition of the matrix glycoprotein fibronectin in vivo.

View larger version (76K):
[in this window]
[in a new window]
|
Fig. 1. Increased fibronectin mRNA (A) and protein (B) in the lungs of ethanol-treated rats. A: induction of fibronectin mRNA in lung. Sprague-Dawley rats were fed for 6 wk with the Lieber-DeCarli liquid diet with ethanol (n = 5; 36% total calories) or with an isocaloric substitution with Maltin-Dextrin (n = 5; control diet). Afterwards, the lungs were processed for mRNA isolation and RT-PCR analysis to evaluate message for endogenous fibronectin. Data are shown as means ± SD from a representative experiment. Note that lungs from ethanol-fed rats contained higher levels of fibronectin mRNA. *Significant difference from control diet-fed rats, P < 0.01. B: distribution of fibronectin protein in control lungs. The lungs from control animals were stained with an anti-fibronectin polyclonal antibody (FN-1). Note that staining for fibronectin was detected around vascular and airway structures. Fibronectin staining was also detected within the alveolar epithelium and within the alveolar septae (inset). C: distribution of fibronectin protein in ethanol-treated animals. The lungs from ethanol-fed rats were stained with an anti-fibronectin polyclonal antibody (FN-1) as described above. As in the control, fibronectin staining was detected around vascular and airway structures. It was also detected in the alveolar epithelium and within alveolar septae (inset).
|
|
Ethanol induces the expression of fibronectin in fibroblasts by stimulating the transcription of its gene.
Because of the increased deposition of fibronectin around fibroblasts in the lungs of ethanol-exposed rats, we explored the effects of ethanol in cultured lung fibroblasts with the intention of developing an in vitro model of ethanol-induced fibronectin expression. Using RT-PCR, we found that ethanol induced the expression of endogenous fibronectin mRNA in primary rat lung fibroblasts (Fig. 2A). This coincided with an increase in fibronectin protein production as determined by Western blotting (Fig. 2B). These observations identify the lung fibroblast as a potential target for ethanol in the lung.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 2. Ethanol induces the synthesis of fibronectin in rat lung fibroblasts. A: induction of fibronectin mRNA. Rat lung fibroblasts were cultured in the presence of physiological concentrations of ethanol (60 mM) for 24 h and harvested, and the cell extracts were processed for RT-PCR analysis of fibronectin mRNA. Relative fibronectin mRNA values are shown as means ± SD. Note that ethanol induced fibronectin mRNA accumulation compared with nontreated control cells. *Significant difference from control cells (n = 6; P < 0.05). B: induction of fibronectin protein. Fibroblasts were cultured as described above for up to 48 h. Afterwards, the cell extracts were tested for fibronectin protein by Western blotting. The data are depicted as densitometric units obtained from analysis of a representative Western blot. Ethanol induced fibronectin production at both 24 and 48 h (n = 5).
|
|
The data presented above also suggested that the effects of ethanol on fibronectin expression occur at the level of gene transcription. To test this, we used NIH/3T3 fibroblasts that were considered a suitable model for our studies because they respond to ethanol in a similar fashion as primary lung fibroblasts. This is demonstrated in Fig. 3A where NIH/3T3 cells treated with ethanol (60 mM) show increased accumulation of endogenous fibronectin mRNA as determined by RT-PCR. The increase in fibronectin mRNA was detectable as early as 8 h after ethanol stimulation. As expected, the ethanol-induced response was associated with a subsequent increase in fibronectin protein production as determined by Western blotting that was highest at 48 h (Fig. 3B).

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 3. Ethanol induces the synthesis of fibronectin in NIH/3T3 fibroblasts. A: induction of fibronectin mRNA. NIH/3T3 fibroblasts were cultured in the presence of ethanol (60 mM) for up to 24 h, harvested, and processed for RT-PCR to detect fibronectin mRNA. Note that ethanol induced the accumulation of fibronectin mRNA by 8 h, and this persisted at 24 h. Data are presented as means ± SD. *Significant difference from time 0 control fibroblasts (n = 5; P < 0.001). B: induction of fibronectin protein. Fibroblasts were treated with ethanol (60 mM) as described above and harvested for Western blotting, and fibronectin was detected using an anti-fibronectin antibody (n = 5). The data are depicted as mean densitometric units ± SD obtained from analysis of a representative Western blot. Note that ethanol induced the production of fibronectin protein by 24 h.
|
|
When the transcription of the gene was tested in NIH/3T3 cells stably transfected with a construct containing the human fibronectin promoter fused to the luciferase reporter gene pFN(1.2kb)LUC, as previously reported (32), we found that ethanol increased the transcription of pFN(1.2kb)LUC compared with nontreated control fibroblasts (Fig. 4, AC). As before, the effects of ethanol were both time dependent (peaking around 8 h) and dose dependent (optimal at 60 mM). At the concentrations used, ethanol had no effect on cell viability (not shown).

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 4. Ethanol stimulates fibronectin gene transcription in NIH/3T3 fibroblasts. A: stimulation of fibronectin gene transcription. NIH/3T3 fibroblasts stably transfected with the fibronectin-luciferase promoter construct were treated with ethanol (60 mM) for 24 h, harvested, and processed to assess fibronectin gene transcription by measuring luminescence. Data are presented as means ± SD (n = 6). Note that ethanol doubled the transcription of the fibronectin gene over control. *Significant difference from control fibroblasts, P < 0.001. B: dose-dependent stimulation of fibronectin gene transcription. Stably transfected fibroblasts were treated with ethanol for 24 h and harvested, and fibronectin gene transcription was quantified as described above. Data are presented as means ± SD. Note that 60 mM ethanol was optimal (n = 6). *Significant difference from time 0 control fibroblasts, P < 0.001. C: time-dependent stimulation of fibronectin gene transcription. Stably transfected fibroblasts were treated with 60 mM ethanol from 2 to 48 h and harvested, and fibronectin gene transcription was quantified as described above. Data are presented as means ± SD (n = 6). Note that ethanol significantly stimulated transcription of the fibronectin gene between 8 and 48 h. P < 0.01.
|
|
Ethanol induction of fibronectin gene transcription is dependent on protein kinase activity and the induction of CREB.
The stimulation of fibronectin by serum and other agents has been shown to be preceded by protein kinase activation and phosphorylation of the transcription factor CREB, followed by CREB binding to CREs in the fibronectin promoter (32). To test whether this pathway also mediates the ethanol-induced fibronectin response, we performed the following experiments. First, we tested the effects of protein kinase inhibitors on the ethanol-induced response. As depicted in Fig. 5A, a protein kinase C inhibitor, calphostin C (24), abolished the constitutive expression of fibronectin as well as expression induced by ethanol. PD-98059, an inhibitor of MEK-1 (2), which is upstream of Erk-1 and Erk-2 in the mitogen-activated protein kinase pathway, also inhibited the ethanol-induced fibronectin response (Fig. 5B). The inhibitory effects of these agents at the concentrations used were not associated with increased cell death (not shown).

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 5. Ethanol induces fibronectin production via protein kinases. A: protein kinase C-dependent production of fibronectin. Transfected fibroblasts were cultured with ethanol (60 mM) for 16 h in the presence and absence of the protein kinase C inhibitor calphostin C. Data are presented as means ± SD. Note that activated calphostin C (ACC) inhibited the ethanol-stimulated expression of the gene (n = 6). The inactive reagent had no effect (not shown). *Significant difference from ethanol-treated fibroblasts, P < 0.001. B: mitogen-activated protein kinase-dependent production of fibronectin. Transfected fibroblasts were cultured as before in the presence of ethanol (60 mM) with or without the mitogen-enhanced kinase-1 (MEK-1) inhibitor PD-98059, and fibronectin gene transcription was measured. Data are presented as means ± SD. Note that the MEK-1 inhibitor prevented the stimulatory effect of ethanol, but it did not block the constitutive expression of the gene (n = 6). *Significant difference from ethanol-treated fibroblasts, P < 0.001.
|
|
Second, we tested the effects of ethanol on CREB. The exposure of fibroblasts to 60 mM ethanol induced the phosphorylation of CREB in a time-dependent fashion (Fig. 6A). This event was associated with increased binding of CREB to DNA as determined by EMSA (Fig. 6B). Note that a competing oligonucleotide abolished the binding of CREB, whereas the mutated oligonucleotide did not affect CREB binding.

View larger version (47K):
[in this window]
[in a new window]
|
Fig. 6. Ethanol stimulates cAMP response element binding protein (CREB) phosphorylation and DNA binding. A: induction of CREB phosphorylation. NIH/3T3 fibroblasts treated with ethanol (60 mM) were processed for Western blotting with an antibody to phosphorylated CREB (n = 5). In this representative Western blot, note that ethanol induced the phosphorylation of CREB and activating transcription factor (ATF-1), most noticeably by 24 h. B: induction of CREB DNA binding. Fibroblasts were left untreated or were treated with ethanol (60 mM) and processed for EMSA to detect CREB. In this representative EMSA (n = 6), note that ethanol induced DNA binding by CREB (lane 3) compared with nontreated control cells (lane 2). This induction was inhibited with a nonlabeled consensus CREB oligonucleotide (lane 4) but not by a mutated CREB (mCREB) oligonucleotide (lane 5). Bound, DNA-protein complex.
|
|
Ethanol induction of fibronectin gene transcription is dependent on specific promoter elements.
The above studies suggested a role for specific promoter elements within the fibronectin gene, namely the CREs, in the ethanol-induced effect. To confirm this role, we tested fibroblasts transfected with deletion constructs of the fibronectin gene promoter. All previous experiments were performed using pFN(1.2kb)LUC. In the experiments described in Fig. 7A, we tested cells transfected with pFN(0.5kb)LUC that lack most of the 5' sequences present in pFN(1.2kb) LUC but contain the three CREs, or we tested cells transfected with pFN(0.2kb)LUC that lack all three CREs. Ethanol stimulated the transcription of pFN(1.2kb)LUC over control as before. The stimulatory effect of ethanol was unaffected when the deletion construct pFN(0.5kb)LUC was tested, indicating that 5' sequences proximal to the CREs are not needed for optimal stimulation. In contrast, little stimulation was noted for ethanol when all CREs were lacking.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 7. Promoter elements involved in ethanol-induced fibronectin expression. A: experiments with deletion mutants. Fibroblasts were treated with ethanol (60 mM) as described above after transfection with the full-length construct, pFN(1.2kb)LUC, or one of the two deletion constructs, pFN(0.5kb)LUC or pFN(0.2kb)LUC. Data are presented as means ± SD (n = 6). Note that the pFN(0.2kb)LUC construct did not respond optimally. B: inhibition by cotransfection with CREB oligonucleotide. Stably transfected fibroblasts were cotransfected with a competing consensus CREB oligonucleotide or mCREB by electroporation followed by exposure to ethanol (60 mM) for 16 h. Afterwards, the cells were harvested and processed to assess fibronectin gene transcription. Data are presented as means ± SD (n = 6). Note that the competing CREB oligonucleotide significantly inhibited the stimulatory effect of ethanol. The mCREB had no effect. *Significant difference from ethanol-stimulated fibroblasts, P < 0.001.
|
|
These data suggest, but do not prove, a role for CREs in the ethanol-induced response. To strengthen the association between CREs and the response tested, we measured fibronectin expression in cells exposed to 60 mM ethanol after transfection with a competing consensus CRE oligonucleotide (Fig. 7B). The consensus CRE oligonucleotide greatly diminished the ethanol-induced fibronectin response, whereas the control-mutated CRE oligonucleotide had no effect.
Ethanol stimulates fibronectin gene transcription via nAChR-dependent signals.
Ethanol has been shown to act on nAChRs in neuronal cells (16). Because nAChRs have been detected in NIH/3T3 fibroblasts and monkey lung fibroblasts (49), among other nonneuronal cells, we examined the role of these receptors in our system. First, we demonstrated that NIH/3T3 cells express mRNA coding for
7 nAChRs (data not shown). Further evidence for the presence of nAChRs was derived from
-BGT binding assays.
-BGT is a competitive ligand for
7 nAChRs (16). Consistent with the expression of nAChRs, we found binding sites for
-BGT on the surface of fibroblasts (Fig. 8A). Of note, the binding of
-BGT was increased after the exposure of the cells to ethanol for 24 h (P < 0.001). This ethanol-induced change in
-BGT binding was significantly decreased by excess unlabeled
-BGT and ethanol (P < 0.001).
Together, these observations indicated that fibroblasts express
7 mRNA and have nAChR protein on their surface. To confirm a role for nAChRs in the ethanol-induced fibronectin response, we pretreated transfected fibroblasts with
-BGT before exposing them to ethanol. As shown in Fig. 8B,
-BGT completely prevented the expression of the fibronectin in response to ethanol (P < 0.001).
To further define the specificity of the nAChR binding, studies with both
-BGT and MLA, two separate
7 nAChR competitors, were tested on primary lung fibroblasts. As shown in Fig. 8C, pretreatment of fibroblasts with unlabeled
-BGT (0.52.5 nM) or with MLA (0.251 µM) resulted in inhibition of fibronectin mRNA expression in response to ethanol.
Ethanol-induced fibronectin response is dependent on ethanol metabolism.
In hepatic cells, ethanol induction of procollagen can be inhibited by 4-methylpyrazole, a blocker of alcohol dehydrogenase (17). This suggests that the ability of ethanol to stimulate matrix gene expression is dependent on its metabolism and conversion into aldehyde. To test this possibility in our system, NIH/3T3 transfected fibroblasts were pretreated with 4-methylpyrazole before stimulation with ethanol. As depicted in Fig. 9A, this treatment inhibited the induction of fibronectin by ethanol. In contrast, 4-methylpyrazole did not affect the induction of fibronectin by nicotine, another ligand for
7 nAChRs (Fig. 9B). Consistent with the need for ethanol metabolism, we found that acetaldehyde mimicked its ability to induce fibronectin expression (Fig. 9A, inset).

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 9. Ethanol stimulation of fibronectin is inhibited by 4-methylpyrazole (4-MP). A: effects on ethanol-induced fibronectin expression. Stably transfected fibroblasts were treated with ethanol (60 mM) in the presence or absence of 4-MP and harvested for the detection of fibronectin gene transcription. Data are presented as means ± SD (n = 6). Note that 4-MP inhibited the ethanol-induced response. *Significant difference from control fibroblasts, P < 0.001. **Significant difference from ethanol-stimulated fibroblasts, P < 0.001. Inset: stably transfected fibroblasts were treated with ethanol, nicotine, or acetaldehyde and harvested for the detection of fibronectin gene transcription. Data are presented as means ± SD (n = 6). Note that acetaldehyde induced fibronectin expression with doses between 10 and 100 µM (P < 0.03). B: effects on nicotine-induced fibronectin expression. Stably transfected fibroblasts were treated with nicotine in the presence or absence of 4-MP and harvested for the detection of fibronectin gene transcription as described above. Data are presented as means ± SD (n = 6). Note that 4-MP had no effect on the nicotine-induced response. *Significant difference from control fibroblasts, P < 0.001.
|
|
Ethanol induction of fibronectin expression in primary mouse lung fibroblasts.
To determine whether similar results could be obtained in fibroblasts that are more relevant to lung and the in vivo model of ethanol ingestion, primary lung fibroblasts were isolated from transgenic mice that contain the fibronectin promoter connected to the luciferase reporter gene. Previous experiments were repeated, and the results were depicted in Fig. 10. In primary lung fibroblasts, ethanol was able to induce fibronectin mRNA (Fig. 10A). Ethanol increased the amount of fibronectin protein secreted by primary lung fibroblasts after 24 h and continued to stimulate it up to 48 h (Fig. 10B). Ethanol increased fibronectin gene transcription as well, with a maximum dose
60 mM and peaking by 8 h (Fig. 10, C and D). The inhibitor of protein kinase C, calphostin C (Fig. 10E), and that of MEK-1, PD-98059 (Fig. 10F), blocked the ethanol-induced increase in fibronectin gene expression. Finally, as demonstrated in Fig. 10G, the phosphorylation of CREB by ethanol increased as soon as 2 h after treatment and remained slightly elevated as long as 24 h.

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 10. Ethanol stimulation of fibronectin in primary lung fibroblasts. A: induction of fibronectin mRNA. Primary lung fibroblasts were treated with ethanol (60 mM) for 24 h, and the cell extracts were processed for RT-PCR analysis of fibronectin mRNA. Relative fibronectin mRNA values are shown as means ± SD. Note that ethanol induced fibronectin mRNA accumulation by 16 h compared with nontreated control cells. *Significant difference from time 0 control fibroblasts, P < 0.05. B: induction of fibronectin protein. Primary lung fibroblasts were cultured as described above for up to 48 h. Afterwards, the cell extracts were tested for fibronectin protein by Western blotting. The data are depicted as densitometric units obtained from analysis of a representative Western blot gel. C: dose-dependent stimulation of fibronectin gene transcription. Primary lung fibroblasts were treated with ethanol, and cells were harvested for the detection of fibronectin gene transcription. Data are presented as means ± SD (n = 6). Note that ethanol significantly induced the transcription of the fibronectin gene at a dose of 60 mM. *Significant difference from time 0 control fibroblasts, P < 0.001. D: ethanol stimulates fibronectin expression in a time-dependent manner. Primary lung fibroblasts were treated with ethanol (60 mM) for 048 h, and cells were harvested and processed to assess fibronectin gene transcription as described above. Data are presented as means ± SD (n = 6). Note that ethanol doubled the transcription of the fibronectin gene at 8 h compared with time 0 control cells (P < 0.001). E: protein kinase C-dependent production of fibronectin. Primary lung fibroblasts were cultured with ethanol (60 mM) for 16 h in the presence and absence of the protein kinase C inhibitor calphostin C. Data are presented as means ± SD. Note that ACC inhibited the ethanol-stimulated expression of the gene (n = 6). The inactive reagent had no effect (not shown). *Significant difference from ethanol-treated fibroblasts, P < 0.001. F: mitogen-activated protein kinase-dependent production of fibronectin. Primary lung fibroblasts were cultured as before in the presence of ethanol (60 mM) with or without the MEK-1 inhibitor PD-98059 (50 µM) for 16 h, and fibronectin gene transcription was measured. Data are presented as means ± SD. Note that the MEK-1 inhibitor prevented the stimulatory effect of ethanol, but it did not block the constitutive expression of the gene (n = 6). *Significant difference from ethanol-treated fibroblasts, P < 0.001. G: induction of CREB phosphorylation. Primary lung fibroblasts were treated with ethanol (60 mM) and processed for Western blotting with an antibody to phosphorylated CREB (n = 5). In this representative Western blot, note that ethanol induced the phosphorylation of CREB and ATF-1, most noticeably by 24 h.
|
|
To determine the role of the
7 nAChR in ethanol induction of the fibronectin gene, primary lung fibroblasts were isolated and tested for their ability to produce fibronectin after ethanol stimulation. As shown in Fig. 11A, fibroblasts deficient in
7 nAChR were still able to produce more fibronectin mRNA when treated with ethanol for 1248 h as determined by RT-PCR. Western blot data demonstrated that ethanol was also able to increase the secretion of fibronectin protein after 48 h of stimulation (Fig. 11B). Together, these data generated in fibroblasts deficient in
7 nAChRs show that
7 nAChRs are not required for induction of fibronectin expression in the setting of ethanol stimulation.
 |
DISCUSSION
|
|---|
Mechanisms of ethanol induction of fibronectin in fibroblasts.
This report demonstrates for the first time that chronic ethanol ingestion in animals results in increased expression of fibronectin mRNA and deposition of its protein in the lung. In addition, it identifies the lung fibroblast, among other cells, as a target for ethanol. Studies performed with cultured fibroblasts suggest that ethanol induces fibronectin gene transcription by acting on
-BGT-sensitive nAChRs and by inducing the phosphorylation and nuclear translocation of CREB, a key transcription factor capable of initiating fibronectin gene expression (32). Finally, the report demonstrates that ethanol induction of fibronectin is dependent on ethanol metabolism, protein kinase activity, and specific transcriptional elements within the fibronectin gene promoter. Together, these studies suggest that ethanol can directly affect lung fibroblasts and induce their expression of fibronectin. We speculate that this may result in alterations in the composition of the lung matrix and that this represents yet another potential mechanism by which ethanol renders the host susceptible to acute lung injury.
For years, it has been known that ethanol induces tissue remodeling in the liver where it can cause fibrosis and cirrhosis (48), but its effects on the lung have been poorly recognized until recently. In the liver, both ethanol and its metabolite acetaldehyde are considered to be fibrogenic and have been shown to induce the expression of collagen (10). Ethanol induces the production of collagen and the expression of
1(I) procollagen mRNA in fibroblasts and in primary cultures of liver stellate cells (19, 20, 50). Similar to our observations with fibronectin, the ethanol-induced collagen response in liver cells was found to be maximal with doses of ethanol between 50 and 100 mM, optimal after 24-h exposure, dependent on protein synthesis, and appeared to occur at the level of gene transcription (19). In that system, as in ours, the response was abolished by an inhibitor of ethanol metabolism to acetaldehyde, 4-methylpyrazole, suggesting that ethanol metabolism was needed to observe its effects on collagen expression. Of interest, the induction of collagen by ethanol was detected in liver stellate cells, but not in primary cultures of hepatocytes, suggesting that not all cells of an organ respond to ethanol equally. Consistent with a role for ethanol metabolism, we found that acetaldehyde mimics the stimulatory effect of ethanol in our system.
Ethanol-induced fibronectin expression has also been demonstrated in the liver. Increased total and cellular fibronectin protein production was detected in the liver of rats exposed to ethanol in their diet for 812 wk (20). However, the intracellular pathways responsible for its induction and how they relate to fibronectin induction in pulmonary cells are unclear. Our studies show that ethanol induction of fibronectin is dependent on the activity of protein kinases such as protein kinase C and MEK-1/Erks. This is reminiscent of the work of Svegliati-Baroni and colleagues (50) who demonstrated that the stimulation of fibronectin expression in human hepatic stellate cells is associated with a time-dependent phosphorylation of pp70(S6K) and Erk-1 and -2. In their system, the stimulatory effect of ethanol was also inhibited by calphostin C and PD-98059.
Our work also shows that ethanol induction of fibronectin is dependent on the activation and DNA binding by CREB, an important modulator of fibronectin gene transcription (14, 15, 32). Fibronectin gene expression occurs rapidly in response to a variety of cytokines and growth factors (e.g., transforming growth factor-
1) as well as changes in cell shape and attachment (15). The 5' sequences containing regulatory elements of the fibronectin gene have been cloned and characterized. In addition to a TATA box and several other transcriptional elements (i.e., NF-1, SP-1), the promoters of the human and murine fibronectin genes contain three CREs that appear to be the dominant regulators of fibronectin gene transcription (14, 15). In our system, these CREs appear to be critical in mediating the effects of ethanol.
Role of nAChRs in ethanol-induced fibronectin expression.
This study demonstrates the presence of
7 nAChRs in primary lung fibroblasts and that
-BGT-sensitive nAChRs play a role in the ethanol induction of fibronectin via specific intracellular signals. These observations are consistent with most other studies available to date in neuronal cells showing that ethanol acts mainly via nAChRs (23, 35). nAChRs are a family of multimeric acetylcholine-triggered cation channel proteins that form the predominant excitatory neurotransmitter receptors on muscles and nerves in the peripheral nervous system. They are also expressed in lower amounts throughout the central nervous system. At least 13 genes that code for nAChRs have been identified to date, four
-subunits and nine
-subunits. In each of these receptors, the various subunits assemble into pentamers in a homomeric or heteromeric fashion (28). The most abundant homomeric form is (
7)5. This is the receptor that our data with
-BGT pointed to as a mediator of the effects of ethanol in the lung. Little is known about nAChR expression and function outside of the central and peripheral nervous systems. nAChRs have been demonstrated in immune cells (47), keratinocytes (3), and, consistent with our data, in NIH/3T3 fibroblasts (3). Evidence for the expression of functional nAChRs in lung cells is also available.
7 nAChR subunits have been detected in both human and mouse bronchial epithelial cells and in submucosal glands (30).
7 has also been reported in small cell lung cancer (SCLC) and SCLC cell lines, and the growth of these cells can be inhibited by
-BGT, an antagonist of
7 receptors (11). Others have demonstrated in primates that nicotine, by binding to specific nAChRs, can affect lung development (49). When Sekhon et al. (49) examined for nAChRs in control animals, they detected
7 predominantly in fibroblasts surrounding the walls of airways and vessels, among other cell types. The expression of this receptor increased dramatically in animals exposed to nicotine. This was associated with increased collagen deposition surrounding the cartilaginous large airways and vessels. Overall, our observations and those described above suggest that lung cells (in particular fibroblasts) express functional nAChRs and that, by binding to these receptors, ethanol (and other ligands such as nicotine) can affect tissue remodeling in lung. Fibroblasts are not the only cells that recognize ethanol, and this explains the diffuse nature of the staining for fibronectin in the lungs of ethanol-treated rats.
In view of the above, we focused our attention on the possibility that
7 nAChRs mediated the stimulatory effect of ethanol. Unexpectedly, we found that in primary lung fibroblasts harvested from mice lacking
7 nAChRs, ethanol still stimulated the expression of the fibronectin gene. This suggests that
7 nAChRs are not required for ethanol to stimulate fibronectin expression in lung fibroblasts and that other
-BGT-sensitive nAChRs (perhaps
3
2,
4
2,
8, or
9/10 nAChRs) might play a role. In addition, this finding also raises the possibility of parallel pathways that are both nAChR dependent and independent.
Another interesting observation relates to the ability of 4-methylpyrazole to inhibit the effect of ethanol on fibronectin expression but not that of nicotine. In the case of ethanol, it appears that signal transduction requires alcohol metabolism and acetaldehyde production. This and other observations suggest that even though both ethanol and nicotine can stimulate nAChRs, they trigger different intracellular signals. This, together with differences in cell recognition and metabolism, might explain why nicotine and ethanol abuse are associated with the development of different clinical entities.
Implications for our understanding of acute lung injury.
We have shown that ethanol stimulates fibronectin expression in lung fibroblasts both in vitro and in vivo. It is important to point out that the level of ethanol used in the in vitro studies, 60 mM, is physiologically relevant because it translates to a blood alcohol level of
0.1 g/dl, which is within the range one might find in a moderate to heavy drinker (24). In the rats fed with the Lieber-DeCarli liquid diet containing ethanol (36% total calories), the blood alcohol concentrations averaged
117 ± 7.9 mg/dl (37). Despite the above, one should be careful when extrapolating our findings to the situation in vivo because the mechanisms involved in the effects observed might differ in view of the differences in time of exposure, metabolism, etc. Independent of the mechanisms involved, the observation that ethanol can induce fibronectin expression in the lung is an important one because fibronectin deposition is increased in many, if not all, forms of clinical and experimental acute lung injury, and it has been implicated in the pathogenesis of this illness (27, 43, 44). Its exaggerated deposition under these circumstances has considerable effects on lung structure. For example, fibronectin promotes collagen deposition in connective tissue (31). In doing so, the newly deposited fibronectin-containing matrices provide a scaffold for the migration of epithelial cells across denuded basement membranes and the organization of immune cells and fibroblasts in extravascular spaces (13). Fibronectin also affects many cellular functions. It has been shown to promote the adhesion, migration, proliferation, and differentiation of many lung cell types including epithelial and endothelial cells and fibroblasts (27, 43). With regard to immune cells, fibronectin has been shown to be chemotactic to monocytes and endothelial cells, among other cells (44), and to stimulate their expression of proinflammatory cytokines that, in turn, could amplify the inflammatory and repair responses of the lung after injury (5, 37, 45, 46).
The biological effects of fibronectin are possible because of its ability to interact with specific cell surface integrin receptors capable of signal transduction (12). The activation of the integrin fibronectin receptor
5
1 elicits the activation of intracellular signals including increased cAMP levels, calcium fluxes, and the activation of protein kinases. These events lead to the induction of potent transcription factors including activator protein-1 and nuclear factor-
B (37, 45, 46) that control the transcription of many genes including the proinflammatory cytokines interleukin-1
and tumor necrosis factor-
and vascular cell adhesion molecule-1.
In view of the above, it is postulated that the exaggerated deposition of fibronectin in the lungs of ethanol-treated animals alters the composition of the lung extracellular matrix. In turn, the newly deposited fibronectin-containing matrix primes lung resident and incoming cells to respond to injurious agents in an exaggerated manner. In doing so, fibronectin promotes the development of an aggressive uncontrolled tissue remodeling and inflammatory response that leads to tissue destruction rather than repair after injury. Further delineation of the factors and conditions that regulate ethanol-induced fibronectin expression, and the receptor and signaling events involved, is required before a full understanding of the true consequences this process has in the lung is possible.
 |
GRANTS
|
|---|
This work was supported by Department of Defense Grant DAMD17-02-1-0179 (to J. Roman) and grants from National Institutes of Health (to J. Roman, D. Guidot, and L. A. Brown).
 |
ACKNOWLEDGMENTS
|
|---|
The authors thank Susanne Roser-Page, Robert Raynor, and Nikiva Bernard for expert technical assistance and Dr. Elliot Spindel for insightful discussions.
 |
FOOTNOTES
|
|---|
Address for reprint requests and other correspondence: J. Roman, Emory Univ., Whitehead Biomedical Research Bldg., 615 Michael St., Ste. 205-M, Atlanta, GA 30322 (E-mail: jroman{at}emory.edu)
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
 |
REFERENCES
|
|---|
- Abraham E, Matthay MA, Dinarello CA, Vincent JL, Cohen J, Opal SM, Glauser M, Parsons P, Fisher CJ Jr, and Repine JE. Consensus conference definitions for sepsis, septic shock, acute lung injury, and acute respiratory distress syndrome: time for a reevaluation. Crit Care Med 28: 232235, 2000.[CrossRef][ISI][Medline]
- Alessi DR, Cuenda A, Cohen P, Dudley DT, and Saltiel AR. PD098059 is a specific inhibitor of the activation of mitogen-activated protein kinase in vitro and in vivo. J Biol Chem 270: 2748927494, 1995.[Abstract/Free Full Text]
- Aztiria EM, Sogayar MC, and Barrantes FJ. Expression of a neuronal nicotinic acetylcholine receptor in insect and mammalian host cell systems. Neurochem Res 25: 171180, 2000.[CrossRef][ISI][Medline]
- Bechara RI, Brown LA, Roman J, Joshi PC, and Guidot DM. Transforming growth factor
1 expression and activation is increased in the alcoholic rat lung. Am J Respir Crit Care Med 170: 188194, 2004.[Abstract/Free Full Text]
- Bowersox JC and Sorgente N. Chemotaxis of aortic endothelial cells in response to fibronectin. Cancer Res 42: 25472551, 1982.[Abstract/Free Full Text]
- Bradford MM. A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248254, 1976.[CrossRef][ISI][Medline]
- Breese CR, Adams C, Logel J, Drebing C, Rollins Y, Barnhart M, Sullivan B, Demasters BK, Freedman R, and Leonard S. Comparison of the regional expression of nicotinic acetylcholine receptor
7 mRNA and [125I]-
-bungarotoxin binding in human postmortem brain. J Comp Neurol 387: 385398, 1997.[CrossRef][ISI][Medline]
- Breese CR, Marks MJ, Logel J, Adams CE, Sullivan B, Collins AC, and Leonard S. Effect of smoking history on [3H] nicotine binding in human postmortem brain. J Pharmacol Exp Ther 282: 713, 1997.[Abstract/Free Full Text]
- Brown LAS, Harris FL, and Guidot DM. Chronic ethanol ingestion potentiates TNF-mediated oxidative stress and apoptosis in rat alveolar type II cells. Am J Physiol Lung Cell Mol Physiol 281: L377L386, 2001.[Abstract/Free Full Text]
- Casini A, Galli G, Salzano R, Rotella CM, and Surrenti C. Acetaldehyde-protein adducts, but not lactate and pyruvate, stimulate gene transcription of collagen and fibronectin in hepatic fat-storing cells. J Hepatol 19: 385392, 1993.[CrossRef][ISI][Medline]
- Cattaneo MG, D'atri F, and Vicentini LM. Mechanisms of mitogen-activated protein kinase activation by nicotine in small-cell lung carcinoma cells. Biochem J 328: 499503, 1997.[Medline]
- Clark EA and Brugge JS. Integrins and signal transduction: the road taken. Science 268: 233239, 1995.[Abstract/Free Full Text]
- Clark RAF, Lanigan JM, DellaPelle P, Manseau E, Dvorak HF, and Colvin RB. Fibronectin and fibrin provide a provisional matrix for epidermal cell migration during wound reepithelialization. J Invest Dermatol 79: 264269, 1982.[CrossRef][ISI][Medline]
- Dean DC, Bowlus CL, and Bourgeois S. Cloning and analysis of the promoter region of the human fibronectin gene. Proc Natl Acad Sci USA 84: 18761880, 1987.[Abstract/Free Full Text]
- Dean DC, Birkenmeier TM, Rosen GD, and Weintraub SJ. Glycoprotein synthesis and secretion. Expression of fibronectin and its cell surface receptors. Am Rev Respir Dis 144: S25S28, 1991.[ISI][Medline]
- De Fiebre NC and de Fiebre CM.
7 Nicotinic acetylcholine receptor knockout selectively enhances ethanol-, but not
-amyloid-induced neurotoxicity. Neurosci Lett 373: 4247, 2005.[CrossRef][ISI][Medline]
- Delmas C, de Saint Blanquat G, Freudenreich C, and Biellmann JF. New inhibitors of alcohol dehydrogenase: studies in vivo and in vitro in the rat. Alcohol Clin Exp Res 7: 264270, 1983.[ISI][Medline]
- Dignam JD, Lebovitz RM, and Roeder RG. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11: 14751489, 1983.[Abstract/Free Full Text]
- Fontana L, Jerez D, Rojas-Valencia L, Solis-Herruzo JA, Greenwel P, and Rojkind M. Ethanol induces the expression of
1 (I) procollagen mRNA in a co-culture system containing a liver stellate cell line and freshly isolated hepatocytes. Biochim Biophys Acta 362: 135144, 1997.
- Gillis SE and Nagy LE. Deposition of cellular fibronectin increases before stellate cell activation in rat liver during ethanol feeding. Alcohol Clin Exp Res 21: 857861, 1997.[CrossRef][ISI][Medline]
- Guidot DM, Modelska K, Lois M, Jain L, Moss M, and Pittet JF. Ethanol ingestion via glutathione depletion impairs alveolar epithelial barrier function in rats. Am J Physiol Lung Cell Mol Physiol 279: L127L135, 2000.[Abstract/Free Full Text]
- Guidot DM and Brown LAS. Mitochondrial glutathione replacement restores surfactant synthesis and secretion in alveolar epithelial cells of ethanol-fed rats. Alcohol Clin Exp Res 24: 10701076, 2000.[CrossRef][ISI][Medline]
- Harris RA. Ethanol actions on multiple ion channels: which are important? Alcohol Clin Exp Res 23: 15631570, 1999.[CrossRef][ISI][Medline]
- Henzel K, Thorborg C, Hofmann M, Zimmer G, and Leuschner U. Toxicity of ethanol and acetaldehyde in hepatocytes treated with ursodeoxycholic or taurosoudeoxycholic acid. Biochim Biophys Acta 1644: 3745, 2004.[Medline]
- Holguin F, Moss IM, Brown LS, and Guidot DM. Ethanol ingestion impairs alveolar type II cell glutathione homeostasis and function, and predisposes to endotoxin-mediated acute edematous lung injury in rats. J Clin Invest 101: 761768, 1998.[ISI][Medline]
- Kobayashi E, Nakano H, Morimoto M, and Tamaoki T. Calphostin C (UCN-1028C), a novel microbial compound, is a highly potent and specific inhibitor of protein kinase C. Biochem Biophys Res Commun 159: 548553, 1989.[CrossRef][ISI][Medline]
- Limper AH and Roman J. Fibronectin: a versatile matrix protein with roles in thoracic development, repair, and infection. Chest 101: 16631673, 1992.[CrossRef][ISI][Medline]
- Lindstrom J. Nicotinic acetylcholine receptors in health and disease. Mol Neurobiol 15: 193222, 1997.[ISI][Medline]
- Lois M, Brown LA, Moss M, Roman J, and Guidot DM. Ethanol induces the expression of matrix metalloproteinases in rat lungs. Am J Respir Crit Care Med 160: 13541360, 1999.[Abstract/Free Full Text]
- Maus AD, Pereira EF, Karachunski PI, Horton RM, Navaneetham D, Macklin K, Cortes WS, Albuquerque EX, and Conti-Fine BM. Human and rodent bronchial epithelial cells express functional nicotinic acetylcholine receptors. Mol Pharmacol 54: 779788, 1998.[Abstract/Free Full Text]
- McDonald JA, Kelley DG, and Broekelmann TJ. Role of fibronectin in collagen deposition: Fab' to the gelatin-binding domain of fibronectin inhibits both fibronectin and collagen organization in fibroblast extracellular matrix. J Cell Biol 92: 485492, 1982.[Abstract/Free Full Text]
- Michaelson J, Ritzenthaler J, Roser S, and Roman J. Protein kinases and cytoskeletal integrity modulate the expression of fibronectin in fibroblasts exposed to serum by inducing CREB. Am J Physiol Lung Cell Mol Physiol 282: L291L301, 2002.[Abstract/Free Full Text]
- Moss M, Bucher B, Moore FA, Moore EE, and Parsons PE. The role of chronic alcohol abuse in the development of acute respiratory distress syndrome in adults. JAMA 275: 5054, 1996.