|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
, and endotoxin increase expression of DMT1 in bronchial epithelial cells
1Center for Environmental Medicine and Lung Biology, University of North Carolina, Chapel Hill, North Carolina; 2Department of Biochemistry, State University of New York at Buffalo, Buffalo, New York; 3Department of Cellular and Structural Biology, University of Texas Health Science Center, San Antonio, Texas; 4National Health and Environmental Effects Research Laboratory, Environmental Protection Agency, Research Triangle Park, North Carolina; and 5Department of Internal Medicine, Duke University Medical Center, Durham, North Carolina
Submitted 4 December 2003 ; accepted in final form 2 March 2005
| ABSTRACT |
|---|
|
|
|---|
, interferon (IFN)-
, and LPS increase DMT1 expression in airway epithelial cells. We used RT-PCR to detect mRNA for both IRE DMT1 and +IRE DMT1 in BEAS-2B cells. Treatment with TNF-
, IFN-
, or LPS increased both forms. Western blot analysis also demonstrated an increase in the expression of both isoforms of DMT1 after these treatments. Twenty-four hours after exposure of an animal model to TNF-
, IFN-
, or LPS, a significant increase in pulmonary expression of IRE DMT1 was seen by immunohistochemistry; the level of +IRE DMT1 was too low in the lung to be visualized using this methodology. Finally, iron transport into BEAS-2B cells was increased after inclusion of TNF-
, IFN-
, or LPS in the media. We conclude that proinflammatory cytokines and LPS increase mRNA and protein expression of DMT1 in airway cells in vitro and in vivo. Furthermore, both IRE and +IRE isoforms are elevated after exposures. Increased expression of this protein appears to be included in a coordinated response of the cell and tissue where the function might be to diminish availability of metal. membrane transporters; tumor necrosis factor; interferon; divalent metal transporter-1; lipopolysaccharide
In the proximal duodenum, Fe3+ is reduced to Fe2+, which is then transported into the epithelial cell by DMT1 (50). Both microcytic anemia (mk) mice and Belgrade rats carry the same missense mutation in DMT1 (7, 8). This mutation, in which Gly185 is changed to arginine (G185R), occurs within predicted transmembrane domain 4 of the protein (43). Consequently, both the mk mouse and the Belgrade rat demonstrate diminished intestinal iron absorption. The inherited defect of iron uptake in these naturally occurring animal mutants corroborated that DMT1 is the transferrin-independent system responsible for dietary iron absorption in the intestine and carries out a similar function in many other cells (9).
DMT1 generates two alternatively spliced mRNAs that differ at their 3'-untranslated region by either the presence or absence of an iron-response element (IRE) (+IRE and IRE isoforms, respectively). The two protein isoforms also differ in the last 18 or 25 amino acids of the COOH termini. IRE are found in noncoding portions of mRNA for specific proteins that can be posttranscriptionally regulated in response to cellular iron levels (24). The presence of an IRE suggested that DMT1 levels can be modulated by iron via an IRE-dependent pathway. In addition, there appears to be an IRE-independent iron regulatory pathway for control of DMT1 expression with exposure of respiratory epithelial cells to iron increasing the expression of IRE DMT1 (48). There appeared, however, to be little effect of this metal on the +IRE isoform on these same cells (48).
Regulation of DMT1 may contribute to the uptake and detoxification of iron by cells resident in the respiratory tract. Elevated concentrations of this metal will disrupt normal homeostasis. An initial event in diminishing the metal-catalyzed oxidant generation could be an increased cellular uptake by DMT1 with storage within ferritin. Inflammation has been associated with a disequilibrium of iron, an increased availability of this metal, and oxidative stress (11). Proinflammatory cytokines have been demonstrated to affect an elevated expression of DMT1 in a macrophage cell line (25, 49). LPS has similarly been used to produce an integrated response in terms of these mediators (49). We tested the hypothesis that tumor necrosis factor (TNF)-
, interferon (IFN)-
, and LPS increase the expression of DMT1 in airway epithelial cells.
| MATERIALS AND METHODS |
|---|
|
|
|---|
, IFN-
, and LPS were selected as a result of both synergism among them in inducing genes involved in the inflammatory response (34) and because these are agents to which respiratory epithelial cells can be exposed. Human TNF-
, human IFN-
, rat TNF-
, and rat IFN-
were from R&D Systems (Minneapolis, MN). LPS was Escherichia coli O55:B5 from Sigma (St. Louis, MO). All other reagents were from Sigma unless otherwise specified.
Culture of BEAS-2B cells.
BEAS-2B cells were used in all studies. This is an immortalized line of normal human bronchial epithelium derived by transfection of normal primary cells with SV40 early-region genes. Cells were grown on uncoated plastic 12-well plates (Costar, Cambridge, MA) in keratinocyte growth medium (KGM; Clonetics, San Diego, CA), which is essentially MCDB 153 medium supplemented with 5 ng/ml human epidermal growth factor, 5 mg/ml insulin, 0.5 mg/ml hydrocortisone, 0.15 mM calcium, bovine pituitary extract, 0.1 mM ethanolamine, and 0.1 mM phosphoethanolamine. The responses of BEAS-2B cells to iron are similar to those of normal human bronchial epithelial cells (10). BEAS-2B cells were grown to 90100% confluence and then exposed to TNF-
, IFN-
, and LPS.
RT-PCR on cell specimens. Cells were lysed with 4 M guanidine thiocyanate (Boehringer Mannheim, Indianapolis, IN), 50 mM sodium citrate, 0.5% Sarkosyl, and 0.01 M dithiothreitol. After dislodging the cells from wells with scrapers (Costar), we sheared lysates with four passes through a 22-gauge syringe. One hundred nanograms of total RNA were reverse transcribed (Moloney murine leukemia virus reverse transcriptase reverse transcriptase, Life Technologies). Quantitative PCR was performed using Taqman polymerase with detection of SYBR Green fluorescence on an ABI Prism 7700 Sequence detector (PE Biosystems, Foster City, CA). DMT1 mRNA levels were normalized using the expression of GAPDH as a housekeeping gene. Relative quantitation of both DMT1 and GAPDH mRNA was based on standard curves prepared from serially diluted mouse mast cell cDNA. The following sense and antisense sequences were employed:
DMT1 (+IRE): 5' TGGCAATGTTTGATTGC 3' and 5' AGAAACACACTGGCTCTGAT 3'; DMT1 (IRE): 5' TTTGTCGTCACTTTTCTTGAATTGTT 3' and 5' GGTTTCTGGATCTTGTTACTGGATATT 3'; GAPDH: 5' GAAGGTGAAGGTCGGAGTC 3' and 5' GAAGATGGTGATGGGATTTC 3'.
DMT1 oligonucleotides were isoform specific. The data represent the means of triplicates (3 wells), and all studies were repeated at least once.
Western blot analysis on cell specimens. BEAS-2B cells were lysed with buffer containing 1% Nonidet P-40, 0.5% deoxycholate, 0.1% SDS, and protease inhibitors (Cocktail Set III; Calbiochem, La Jolla, CA) and then sheared through a 22-gauge needle. Protein content was determined using the Bradford assay (Bio-Rad, Hercules, CA). The remainder of the sample was mixed with an equal volume of 4x sample loading buffer (0.5 M Tris·HCl, pH 6.8, 10% glycerol, 2% SDS, 0.7 mM 2-mercaptoethanol, and 0.05% bromphenol blue).
Protein samples (50 µg) were separated by electrophoresis on a 415% SDS acrylamide gel and transferred to a nitrocellulose membrane (Bio-Rad). The membrane was blocked with 3% nonfat milk in PBS and incubated with an antibody directed against the ±DMT1. Preparation of isoform-specific antibodies has been previously described (36). The membrane was stained with a horseradish peroxidase-conjugated goat anti-rabbit IgG antibody (1:1,000; Santa Cruz Biotechnology, Santa Cruz, CA) and developed using enhanced chemiluminescence (ECL kit; Amersham Pharmacia Biotech).
Immunohistochemistry and RT-PCR on animal lungs.
The United States Environmental Protection Agency reviewed and approved all procedures on animals. Efforts were made to limit discomfort in the animals and to reduce the number of animals used in the experiments. Sixty-day-old (250300 g) male Sprague-Dawley rats were divided into four groups of four rats each. After being given anesthesia with 25% halothane (Aldrich Chemicals, Milwaukee, WI), the first group was intratracheally instilled with 0.5 ml of normal saline, the second with 5 µg of TNF-
in 0.5 ml of normal saline, the third with 10 µg of IFN-
in 0.5 ml of normal saline, and the fourth with 100 µg of LPS in 0.5 ml of normal saline. Twenty-four hours after instillation, rats were again anesthetized with halothane and killed by exsanguination. The lungs were resected and either fixed at inflation with 10% formalin (for immunohistochemistry) or frozen (for RT-PCR).
After 24 h of fixation in formalin, lung tissue sections were cut, floated on a protein-free water bath, mounted on silane-treated slides (Fisher, Raleigh, NC), and air-dried overnight. The slides were heat-fixed at 60°C in a slide dryer (Shandon Lipshaw, Pittsburgh, PA) for 10 min and cooled to room temperature. Sections were then deparaffinized and hydrated to 95% alcohol (xylene for 10 min, absolute alcohol for 5 min, and 95% alcohol for 5 min). Endogenous peroxidase activity was blocked with 0.6% H2O2 in absolute methanol for 8 min. Slides were rinsed in 95% alcohol for 2 min, placed in deionized H2O, and washed in PBS. After being treated with Cyto Q Background Buster (Innovex Biosciences) for 10 min, slides were incubated with the primary antibody diluted in 1% bovine serum albumin for 45 min at 37°C in PBS at a dilution of 1:200. Slides were incubated with biotinylated linking antibody from Stat-Q Staining System (Innovex Biosciences) for 10 min at room temperature and washed with PBS, and peroxidase enzyme label from Stat-Q Staining System (Innovex Biosciences) was applied. After incubation for 10 min at room temperature and washes with PBS, tissue sections were developed with 3,3'-diaminobenzidine tetrahydrochloride for 3 min at room temperature. Sections were counterstained with hematoxylin, dehydrated through alcohols, cleared in xylene, and coverslipped using a permanent mounting media. Immunohistochemical findings were confirmed in a second group of 16 animals.
Total RNA was extracted from the lung tissue homogenates using TRIzol reagent (Life Technologies). Lysates were sheared with four passes through a 22-gauge syringe. First-strand cDNAs were synthesized from 0.4 µg of total RNA in 100 µl of a buffer containing 5 µM random hexaoligonucleotide primers, 10 U/µl Moloney murine leukemia virus reverse transcriptase, 1 U/µl RNasin, 0.5 mM dNTP, 50 mM KCl, 3 mM MgCl2, and 10 mM Tris·HCl (pH 9.3). After a 1-h incubation at 39°C, the reverse transcriptase was heat inactivated at 94°C for 4 min. Quantitative PCR was performed using Taqman polymerase on an ABI Prism 7700 Sequence detector (PE Biosystems). DMT1 mRNA levels were normalized using the expression of GAPDH as a housekeeping gene. Relative quantitation of both DMT1 and GAPDH mRNA was based on standard curves prepared from serially diluted mouse mast cell cDNA. The following sense and antisense sequences were employed (sense, then antisense):
IRE DMT1: 5' TTTGTCGTCACTTTTCTTGAATTGTT 3' and 5' GGTTTCTGGATCTTGTTACTGGATATT 3'; GAPDH: 5' GAAGGTGAAGGTCGGAGTC 3' and 5' GAAGATGGTGATGGGATTTC 3'.
mRNA for macrophage inflammatory protein-2 (MIP-2) was also quantified. Values were compared with those for IRE DMT1 in an effort to control for the incursion of inflammatory cells following exposures of the animals to cytokines and LPS. The following sense and antisense sequences were employed (sense, then antisense):
MIP-2: 5' CAGAGCTTGAGTGTGACG 3' and 5' TCGTACCTGATGTGCCTC 3'.
Measurement of ferritin concentrations. Cells were dislodged from wells with scrapers (Costar) into the exposure media (a volume of 1.0 ml), and the cell suspension was disrupted by sonication for 15 s. Ferritin protein concentrations in these cell lysates were analyzed using a commercially available enzyme immunoassay kit, controls, and standards from Microgenics (Concord, CA). These assays were modified for use in the Cobas Fara II centrifugal spectrophotometer (Hoffman-LaRoche, Branchburg, NJ). The data represent the means of triplicates (3 wells), and all studies were repeated at least once.
Measurement of iron concentrations. Media were removed from cells, and Hanks' balanced salt solution (HBSS) with 100 µM ferric ammonium citrate (FAC) was added. At 1 and 4 h, the supernatant was removed. The cells were washed twice with HBSS, and 1.0 ml of 3 N HCl containing 10% trichloroacetic acid was added to each well. After the cells were scraped into the acid, they were hydrolyzed at 70°C for 18 h. The concentration of iron in the supernatant and cell hydrolysis was determined using inductively coupled plasma atomic emission spectroscopy at a wavelength of 238.204 (model P30; Perkin Elmer, Norwalk, CT). A single element standard was used to calibrate the instrument (Fisher). The limit of detection approximated 10 ppb.
Statistics. Statistical software employed was Abstat (Anderson-Bell, Arvada, CO). Data are expressed as mean values ± SE. Unless specified otherwise, the data represent the means of triplicates, and all studies were repeated at least once. Differences between multiple groups were compared using one-way analysis of variance. The post hoc test employed was Scheffé's test. Two-tailed tests of significance were employed. Significance was assumed at P < 0.05.
| RESULTS |
|---|
|
|
|---|
20 times as abundant as the +IRE isoform in BEAS-2B cells (Fig. 1, A and B). Previous investigation demonstrated that the response of BEAS-2B cells to iron is similar to that of normal human bronchial epithelial cells (10), and any effect of proinflammatory mediators and LPS on metal transport proteins was likely to be evident at 24 h of exposure (48). FAC (500 µM) increased levels of mRNA for IRE DMT1 more than eightfold (Fig. 1A); however, change in the +IRE mRNA was insignificant with this same exposure (Fig. 1B). TNF-
significantly increased mRNA for both isoforms of DMT1, but elevations for the IRE isoform were small, and a dose response was absent. IFN-
clearly elevated the amount of mRNA for both isoforms, exhibiting a dose dependency with 20 ng/ml having no effect, whereas 100 ng/ml elevated mRNA levels. Similarly, LPS augmented the amount of mRNA for both isoforms of DMT1 in the BEAS-2B cells, also exhibiting a dose dependency. Finally, there was no synergistic interaction between IFN-
and LPS in increasing the amount of +IRE or IRE DMT mRNA in BEAS-2B cells, consistent with the two agents affecting the same inflammatory pathway.
|
did not appear to affect expression of either isoform by Western analysis. Comparable to its mRNA, the expression of IRE DMT was elevated following inclusion of IFN-
and LPS in the media of the BEAS-2B cells (Fig. 2, A and B). Changes in the expression of +IRE DMT1 were also similar to those of its mRNA as expression increased with IFN-
and LPS (Fig. 3, A and B).
|
|
, IFN-
, or LPS, rats did not demonstrate detectable expression of +IRE DMT1 in the lower respiratory tract using immunohistochemistry. At this same time, IRE DMT1 was evident in the airways of rats exposed to saline (Fig. 4A). Expression of this same protein either was minimal or could not be detected in alveolar epithelium and endothelium. After instillation of TNF-
, IFN-
, and LPS, there was a significant increase in the binding of the antibody by airway and alveolar epithelium and alveolar macrophages (Fig. 4, BD). The staining pattern did not allow the protein to be localized to a specific membrane. RT-PCR verified significant increases in mRNA for IRE DMT1 following exposures to TNF-
, IFN-
, and LPS (Fig. 5A). mRNA for MIP-2 (a protein associated with inflammatory cells) was similarly elevated but at relatively lower-level values (Fig. 5B).
|
|
, IFN-
, and LPS all increased the ferritin concentrations associated with the BEAS-2B cells (Fig. 6). The concentration of ferritin in the cells with LPS in the media was almost fourfold greater than without exposure.
|
, IFN-
, and LPS did not change metal uptake at incubation times of 12 h or less. BEAS-2B cells were then exposed to TNF-
, IFN-
, and LPS for 24 h, and iron transport was quantified. Addition of proinflammatory cytokines and LPS had no obvious effect on cell number and appearance. After exposure to 100 µM FAC in HBSS only (no transferrin available), measurement of the metal in the cell supernatant revealed there was increased uptake by those cells incubated with the cytokines and LPS at both 1 and 4 h (Fig. 7A). The disappearance of iron appeared to be greatest in those cells treated with IFN-
and LPS. Nonheme concentrations of cellular iron confirmed increases consistent with elevated transport of the metal by BEAS-2B cells after treatment with TNF-
, IFN-
, and LPS (Fig. 7B).
|
| DISCUSSION |
|---|
|
|
|---|
80% of all the DMT1. However, in the BEAS-2B cells, there is an even greater proportion of this isoform with a ratio of IRE to +IRE DMT1 approaching 20:1. In contrast to the response of DMT1 in airway epithelial cells to iron, which includes elevation of both the mRNA and expression of the IRE isoform and little change in the +IRE isoform (48), both IRE and +IRE DMT increase following exposure to proinflammatory cytokines and LPS. Contrasting results were obtained for the association of TNF-
and DMT1; mRNA and immunohistochemistry suggested an increase in the protein after cytokine exposure, which Western blotting did not verify. The elevation in IRE and +IRE DMT1 mRNA and protein was greater following inclusion of IFN-
in the media relative to those with TNF. LPS similarly increased cDNA and protein for both isoforms rather than specifically affecting the IRE species. Even after stimulation by TNF-
, IFN-
, and LPS, however, a vast majority of DMT1 in the lung would be the IRE species.
The transcriptional control of DMT1 expression could be affected by cytokines and LPS through multiple pathways. The 5'-regulatory region of human DMT1 that precedes exon 1B (16) contains a potential IFN regulatory element, three potential Sp1 binding sites, two potential hypoxia-inducible factor (HIF)-1 binding sites, and five potential metal response elements (MRE) (24). These motifs are comparable to Nramp1, which also contains IFN-
and LPS responsive elements at the 5'-regulatory region (13). Binding of interferon to an IFN-
responsive element will contribute to increased transcription and subsequent DMT1 protein expression. TNF-
and LPS have been previously demonstrated to increase IFN-
in specific cell types (31). Alternatively, the influence of both TNF-
and LPS on DMT1 mRNA and protein levels could be mediated by Sp1 transcription factors (35, 38, 52), as LPS does alone (2, 17, 33). Indeed, an involvement of Sp transcription factors (and Sp1) has been previously demonstrated in the expression of other iron-related proteins (37, 45). However, interaction with other transcription factors is not excluded since proinflammatory cytokines can activate HIF-1 pathway (40), and LPS may increase expression of proteins with a MRE (18), which are present on DMT1.
The concentration of the iron storage protein, ferritin, increases in airway epithelial cells exposed to LPS, and both proinflammatory cytokines can elevate ferritin. TNF increases ferritin in myoblasts, monocytic, THP-1, A549, and HepG2 cells (5, 23, 28, 39, 41). Similarly, IFN-
affects ferritin expression in monocytic cells (5). Ferritin levels also correlate with cytokine concentrations in patients with both cancer (6) and Still's disease (42). Proinflammatory cytokines can stimulate both transcription and translation of ferritin (25), modulate binding affinity of the iron regulatory proteins to IREs, and influence the posttranscriptional control of ferritin. Ferritin expression following cytokine stimulation may also be independent of iron (5, 15, 23, 28). LPS also affects expression of ferritin in monocytic cells (25), and after intravenous injection, increases ferritin in animals (22).
Iron transport by BEAS-2B cells paralleled mRNA levels and expression of DMT1. After upregulation of the protein by TNF, IFN-
, and LPS, uptake of the metal from the media was increased. Similarly, nonheme iron concentrations in the cell were elevated. Cytokines including TNF (1, 6, 20, 41), IL-1 (12, 29), and IFN-
(6) have previously been demonstrated to affect a hypoferremic response. LPS also leads to a hypoferremia in a living system (29, 44). Decrements in iron are not associated with changes in total iron binding capacity, suggesting that transferrin may not be affected (1). The decrease in circulating iron may reflect increased storage of iron within intracellular ferritin. Although iron uptake does not have to be affected by either cytokines or LPS in the hypoferremia that develops following exposure (20, 47), it can be increased (41). The induction of apoferritin by these same cytokines has been postulated to result in a shift of iron into the storage protein (21). It is also possible that an increased transport of iron results from an elevated expression of DMT1 such as that described in a monocytic line (25, 49) and epithelial cells in this investigation. There was no attempt to define the biological effects of LPS on iron transport in terms of the two cytokines used as such study resided outside the focus of this investigation.
The anemia of chronic diseases, also called the anemia of inflammation, anemia of chronic disorders, and hypoferremic anemia with reticuloendothelial siderosis, is considered to result from prolonged exposure to proinflammatory cytokines and LPS. The diagnostic feature of an anemia of chronic disease is hypoferremia in the setting of adequate increased iron stores (27). Cytokines have been implicated as a responsible mechanism (1, 26). The focus of previous investigation has been a decrement in the release of iron from cells of the reticuloendothelial system (19). An inhibition of iron release from monocytic cells following LPS exposure has been described (4, 30). A decreased expression of metal transporter protein-1 is also postulated to contribute to a decreased release of the metal from cells (51). An increased uptake of iron by DMT1 is also likely to contribute to this anemia (25). Some portion of this response appears to be an effort by the host to decrease iron availability to microbial invaders that require iron to replicate (32). The cytokines are pivotal in coordinating changes in iron homeostasis in a manner to diminish availability. This should include 1) an increased cellular uptake of the metal, 2) its increased storage in ferritin, and 3) a diminished release. The molecular response to cytokines may not be unique to monocytic cells of the reticuloendothelial system but may be shared among numerous cell types, including respiratory epithelial cells. Finally, this response provides some understanding as to why prior exposures to these agents increase resistance to infection and inflammation (2).
We conclude that both proinflammatory cytokines and LPS increase RNA and protein expression of DMT1 in respiratory epithelial cells in vitro and in vivo. Furthermore, both IRE and +IRE isoforms are elevated following exposures. Increased expression of this protein appears to be included in a coordinated response of the cell and tissue that diminishes availability of metal. It is also possible that elevation of DMT1 expression by cytokines is but one of several mechanisms for increasing cell iron concentrations; iron may also be transported by an as yet unknown alternative pathway that could affect upregulation of this protein.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
and tumour necrosis factor
induce hypoferraemia, ferritin production and a decrease in circulating transferrin receptors in cancer patients. Eur J Clin Invest 28: 520527, 1998.[CrossRef][Web of Science][Medline]
B in the regulation of ferritin H by tumor necrosis factor-
. J Biol Chem 270: 1528515293, 1995.
(TNF-
) in fever and the acute phase reaction in rabbits. Pflügers Arch 438: 218223, 1999.[CrossRef][Web of Science][Medline]
alters red blood cell kinetics and induces anemia in vivo. FASEB J 3: 16371643, 1989.[Abstract]
interferon and lipopolysaccharide. Blood 94: 23832389, 1999.
B/Rel, and Sp1 proteins in uninduced and lipopolysaccharide-induced expression. Arterioscler Thromb Vasc Biol 17: 365374, 1997.
1(I) gene expression. DNA Cell Biol 19: 167178, 2000.[CrossRef][Web of Science][Medline]
and tumor necrosis factor-
in monocytic cells involves cooperation between interferon regulatory factor-1, NF-
B, and Sp1 transcription factors. J Biol Chem 270: 2792027931, 1995.
and iron metabolism in differentiating human monocytic THP-1 cells. Br J Haematol 110: 978984, 2000.[CrossRef][Web of Science][Medline]
and IL-1
on iron metabolism by A549 cells and influence on cytotoxicity. Am J Physiol Lung Cell Mol Physiol 277: L257L263, 1999.
(IFN-
)? The acute phase response in patients treated with IFN-
-2b. Eur J Clin Invest 32, Suppl 1: 7983, 2002.
and lipopolysaccharide regulate the expression of DMT1 and increase the uptake of iron from low relative molecular mass complexes by macrophages. Eur J Biochem 267: 65866593, 2000.[Web of Science][Medline]
This article has been cited by other articles:
![]() |
D. W. Reid, G. J. Anderson, and I. L. Lamont Role of lung iron in determining the bacterial and host struggle in cystic fibrosis Am J Physiol Lung Cell Mol Physiol, November 1, 2009; 297(5): L795 - L802. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Li and B. Frei Prolonged Exposure to LPS Increases Iron, Heme, and p22phox Levels and NADPH Oxidase Activity in Human Aortic Endothelial Cells: Inhibition by Desferrioxamine Arterioscler Thromb Vasc Biol, May 1, 2009; 29(5): 732 - 738. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Lichten, J. P. Liuzzi, and R. J. Cousins Interleukin-1{beta} contributes via nitric oxide to the upregulation and functional activity of the zinc transporter Zip14 (Slc39a14) in murine hepatocytes Am J Physiol Gastrointest Liver Physiol, April 1, 2009; 296(4): G860 - G867. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. C. Sihler and L. M. Napolitano Anemia of Inflammation in Critically Ill Patients J Intensive Care Med, September 1, 2008; 23(5): 295 - 302. [Abstract] [PDF] |
||||
![]() |
L. Li and B. Frei Iron Chelation Inhibits NF-{kappa}B-Mediated Adhesion Molecule Expression by Inhibiting p22phox Protein Expression and NADPH Oxidase Activity Arterioscler Thromb Vasc Biol, December 1, 2006; 26(12): 2638 - 2643. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |