AJP - Lung Columbus Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Lung Cell Mol Physiol 289: L419-L428, 2005. First published May 20, 2005; doi:10.1152/ajplung.00002.2005
1040-0605/05 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
289/3/L419    most recent
00002.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Han, S.
Right arrow Articles by Roman, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Han, S.
Right arrow Articles by Roman, J.

Peroxisome proliferator-activated receptor-{gamma} ligands suppress fibronectin gene expression in human lung carcinoma cells: involvement of both CRE and Sp1

ShouWei Han,1 Jeffrey D. Ritzenthaler,1 Hilda N. Rivera,2 and Jesse Roman1,2

1Division of Pulmonary, Allergy, and Critical Care Medicine, Department of Medicine, Emory University School of Medicine, and 2Atlanta Veterans Affairs Medical Center, Atlanta, Georgia

Submitted 1 January 2005 ; accepted in final form 5 May 2005


   ABSTRACT
TOP
 ABSTRACT
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Lung carcinoma often occurs in patients with chronic lung disease such as tobacco-related emphysema and asbestos-related pulmonary fibrosis. These diseases are characterized by dramatic alterations in the content and composition of the lung extracellular matrix, and we believe this "altered" matrix has the ability to promote lung carcinoma cell growth. One extracellular matrix molecule shown to be altered in these lung diseases is fibronectin (Fn). We previously reported increased growth and survival of non-small cell lung carcinoma (NSCLC) cells exposed to Fn. Thus Fn may serve as a mitogen/survival factor for NSCLC and therefore represents a novel target for anti-cancer strategies. To this end, we studied the effects of the PPAR{gamma} ligands 15d-PGJ2, rosiglitazone (BRL49653, and troglitazone on Fn expression in NSCLC cells and found that they were able to inhibit Fn gene transcription. Inhibition of Fn expression by BRL49653and troglitazone, but not by 15d-PGJ2, was prevented by the specific PPAR{gamma} antagonist GW-9662 and by PPAR{gamma} small interfering RNA. Working with Fn deletion and mutated promoter constructs, we found that the region between –170 and –50 bp downstream from the transcriptional start site of the promoter was involved in PPAR{gamma} ligand inhibition. PPAR{gamma} ligands also diminished the phosphorylation of CREB, diminished Sp1 nuclear protein expression, and prevented the binding of these transcription factors to CRE and Sp1 sites, respectively, within the Fn promoter. In summary, our results demonstrate that PPAR{gamma} ligands inhibit Fn gene expression in NSCLC cells through PPAR{gamma}-dependent and -independent pathways that affect both CREB and Sp1.

cyclic adenosine 5'; '-monophosphate response element; small interfering ribonucleic acid

TUMOR GROWTH AND INVASION are not only the result of malignant transformation but are also dependent on environmental influences from the surrounding stroma, local growth factors, and systemic hormones (37). In particular, the composition of the extracellular matrix is believed to affect malignant cell behavior, which may depend on the differentiation state of the tumor cells (19). One matrix molecule capable of affecting many cellular functions is fibronectin (Fn), a 250-kDa heterodimeric extracellular matrix glycoprotein that has been implicated in various kinds of physiological events during embryogenesis, angiogenesis, thrombosis, and inflammation (28). Fn expression and deposition are increased in acute and chronic forms of lung injury; this is true for the tobacco-related lung diseases (e.g., emphysema) and the fibrotic lung diseases (e.g., asbestos-related pulmonary fibrosis, idiopathic pulmonary fibrosis), among others (34, 36).

Fn is thought to play a role in tumor cell invasion since it is expressed in carcinoma cells, and its expression has been associated with carcinoma development (18, 20, 46). In lung carcinoma, Fn expression is also increased, especially in non-small cell lung carcinoma (NSCLC) (12, 21). Of note, the adhesion of lung carcinoma cells to Fn enhances tumorigenicity and confers resistance to apoptosis induced by standard chemotherapeutic agents (32). Furthermore, we have previously demonstrated that Fn stimulates lung carcinoma cell growth by inducing the expression of the prooncogene cyclooxygenase-2 (COX-2) with subsequent PGE2 secretion (15). Together, these studies point to Fn as an autocrine/paracrine factor that might promote NSCLC progression in vivo. Therefore, we have focused our attention on the search for agents that inhibit Fn expression and/or function in lung carcinoma cells. Our search led us to the peroxisome proliferator-activated receptor-{gamma} (PPAR{gamma}) ligands.

PPARs are members of the steroid hormone superfamily of ligand-activated transcription factors (6). PPARs, like hormone nuclear receptors, heterodimerize with the retinoid X receptor and bind to specific DNA response elements termed DR-1, which consist of a direct repeat of two AGGTCA half sites separated by a single intervening nucleotide (6). Of the three PPAR isoforms identified, PPAR{alpha}, -{beta} (previously referred to as {delta}), and -{gamma}, PPAR{gamma} has been the most intensively investigated. This receptor participates in biological pathways of fundamental basic and clinical interest, such as cellular differentiation, insulin sensitivity, and type 2 diabetes and carcinoma (6). Recent studies have demonstrated that PPAR{gamma} is expressed in several carcinoma cells, including lung carcinoma (7, 9, 22), and that it is involved in growth inhibition and differentiation in a number of lung carcinoma cell types (3).

The relationship between PPAR{gamma} activation and Fn expression is supported by rat studies in vivo showing that oral administration of the PPAR{gamma} ligand thiazolidinediones (TZD) reduced extracellular matrix deposition, and TZD-induced PPAR{gamma} activation inhibited Fn synthesis induced by transforming growth factor (TGF)-{beta}1 in rat hepatic stellate cells (9). Also, a recent study showed that the PPAR{gamma} ligands pioglitazone and 15d-PGJ2 inhibited TGF-{beta}1-induced Fn expression through a dual mechanism that was both independent and dependent on PPAR{gamma} activation in mouse mesangial cells (11). However, the exact mechanisms by which PPAR{gamma} ligands affect Fn gene expression in lung carcinoma cells remain unclear. Here, we report that PPAR{gamma} ligands inhibit Fn gene expression in NSCLC by reduction of the binding activities of the transcription factors cAMP response element (CRE) and Sp1 through PPAR{gamma}-dependent and -independent pathways.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Cell culture and chemicals. The NSCLC cell lines H1838 and H2106 were obtained from American Type Culture Collection (Manassas, VA) and were grown in RPMI-1640 medium supplemented with 10% heat-inactivated FBS, 50 IU/ml penicillin/streptomycin, and 1 µg amphotericin (complete medium) as previously described (14). The PPAR{gamma} ligands 15d-PGJ2, rosiglitazone (BRL49653, and troglitazone, and the PPAR{gamma} antagonist GW-9662 (24) were obtained from Cayman Chemical (Ann Arbor, MI) (see Table 1 for description). The [{gamma}-32P]dATP and the RT-PCR kit components were obtained from Perkin Elmer Life Sciences (Boston, MA). [Methyl-3H]thymidine was purchased from Amersham Biosciences (Piscataway, NJ). Polyclonal antibodies specific for Sp1, CRE binding protein (CREB), and phosphor-CREB antibodies were purchased from Cell Signaling (Beverly, MA). The anti-Fn polyclonal antibody was purchased from Abcam (Cambridge, MA). EMSA system and the Dual-Luciferase Report Assay kit were obtained from Promega (Madison, WI). LightCycler-FastStart DNA Master SYBR Green I kit and the 5' DNA Terminus Labeling System were purchased from Roche Molecular Biochemicals (Indianapolis, IN). All other chemicals were purchased from Sigma (St. Louis, MO) unless otherwise indicated.


View this table:
[in this window]
[in a new window]
  		Table 1. PPAR{gamma} agonists and antagonists

 
PPAR{gamma} small interfering RNA treatment. PPAR{gamma} small interfering RNA (siRNA) duplexes were synthesized by Sigma Genosys (The Woodlands, Texas) according to published data (31): siPPAR{gamma} RNA duplex (5'-CAGAUCCAGUGGUUGCAGAAT); (5'-UCUGCAACCACUGGAUCUGTT). For the transfection procedure, cells were grown to 60% confluence, and PPAR{gamma} siRNA or control siRNA (Santa Cruz Biotechnology, Santa Cruz, CA) were transfected using the siRNA Transfection Reagent (Santa Cruz Biotechnology). The final concentration of siRNA in each well was 100 nM. After being cultured for 30 h, cells were washed, resuspended in new culture media, and treated with troglitazone, BRL49653(both are synthetic PPAR{gamma} ligands), or 15d-PGJ2 (a natural PPAR{gamma} ligand) for an additional 24 h.

RT-PCR. Total RNA was prepared from cells using TRI Reagent (Sigma) according to the manufacturer's instructions. The Fn (422 bp) and GAPDH (200 bp) cDNA fragments were amplified using primers synthesized by Sigma Genosys: Fn sense (5'-CCGTGGGCAACTCTGTC); Fn antisense (5'-'TGCGGCAGTTGTCACAG); GAPDH sense (5'-CCATGGAGAAGGCTGGGG-3'); and GAPDH antisense (5'-CAAAGTTGTCATGGAT GACC-3') according to published data (1, 14). RT-PCR was carried out as previously described (11). Briefly, samples were denatured at 95°C for 30 s, followed by 32 PCR cycles with temperatures as follows: 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s. PCR products were subject to a final extension incubation of 7 min at 72°C. PCR products were analyzed on a 1% agarose gel containing 0.2 µg/µl ethidium bromide and visualized under UV light.

Real-time RT-PCR. This procedure was described previously (17). The primers for Fn and GAPDH were the same as those used for RT-PCR. Final results were expressed as the % of Fn mRNA in treated cells compared with untreated control cells. Fn mRNA expression was normalized to endogenous GAPDH mRNA. All PCR reactions were performed using the LightCycler-FastStart DNA Master SYBR Green I kit in the Cepheid Smart-Cycler real-time PCR cycler (Sunnyvale, CA) (17). Experiments were performed in triplicate for each data point.

Western blot analysis. Western blot analysis was performed as previously described (16). Briefly, protein concentrations were determined by the Bio-Rad protein assay. Equal amounts of protein from whole cell lysates (50 µg) or nuclear fractions (20 µg) were solubilized in 2x SDS-sample buffer (16) and separated on SDS-10% polyacrylamide gels. Blots were incubated with polyclonal antibodies raised against rabbit Fn (1:4,000), Sp1, CREB, or phosphor-CREB (1:2,000) for 2 h at room temperature. Afterward, blots were incubated with a secondary goat antibody raised against rabbit IgG conjugated to horseradish peroxidase (1:2,000, Cell Signaling) for 1 h at room temperature. The blots were then washed, transferred to freshly made ECL solution (Amersham, Arlington, IL), and exposed to X-ray film. Protein bands were quantified by densitometric scanning using a Bio-Rad GS-800 calibrated densitometer. In controls, the anti-Fn, anti-Sp1 antibodies were omitted or replaced by a control rabbit IgG.

[Methyl-3H]thymidine incorporation assay. Human NSCLC cells were incubated with 1 µCi/ml [methyl-3H]thymidine (Amersham, specific activity 250 Ci/mmol) in the presence or absence of indicated reagents for up to 24 h. The medium was removed, and the attached cells were washed with 1x PBS. Afterward, the attached cells were treated with ice-cold 6% trichloroacetic acid (TCA) at 4°C for 20 min and washed once with 6% TCA. The cells were then solubilized with 0.1 N NaOH and counted in a liquid scintillation counter in 4 ml of scintillation fluid.

Plasmids. The full-length Fn promoter plasmid construct connected to the luciferase reporter gene was a generous gift from Dr. Thomas Birkenmeier (Washington Univ., School of Medicine, St. Louis, MO). The Fn promoter construct contains ~1,200 bp of the 5'-flanking region of the human Fn gene (–1180/+69) isolated from the human fibrosarcoma cell line HT-1080 (5). The construct includes 69 bp of exon 1, a CAAT site located at –150 bp, and the sequence ATATAA at –25 bp from the transcription start site. The Fn promoter also contains several previously identified regulatory elements, such as three CREs located at –415, –260, and –170 bp, respectively. Also, several Sp1 sites, beginning at –119 bp from the transcription start site and one NF-{kappa}B site located at –41 bp, are within the Fn promoter. The Fn promoter was subcloned into the SmaI site of the pGL3 basic luciferase reporter vector (Promega). Several deletion Fn promoter constructs were previously prepared in our laboratory (25). pFnLUC(–510/+69) contains all three CREs; pFnLUC(–165/+69) contains no CRE and three Sp1 binding sites; pFnLUC(–50/+69) contains no Sp1 binding sites and one NF-{kappa}B site. The Fn plasmid constructs containing site-directed mutations of CRE cis-acting elements were generated by oligonucleotide-directed mutation using the GeneEditor in vitro site-directed mutagenesis system (Promega). Briefly, double-stranded Fn promoter plasmid was alkaline denatured, precipitated, washed, and resuspended in Tris-EDTA. Mutated CRE oligonucleotides (mCRE –415 bp, 5' CGAAGAGAGGTGtgGCAATGTCCTCAAAC; mCRE –260 bp, 5' CTAAAAAGTTTGATGtgCGCAAAGGAAACC; mCRE –170 bp, 5' CAGTCCCCCGTGtgGTCACCCGGGAG) and selection oligonucleotide (5' GATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGC 3') were annealed; mutant strand was synthesized, ligated, and transformed into BMH 71–18 mutS competent cells. The mutated CRE Fn plasmid was isolated and transformed into JM109 competent cells. Ten colonies were selected and screened for mutants by sequencing using an Applied Biosystems ABI Prism 377 DNA sequencer. The phRL-TK synthetic Renilla luciferase reporter vector was obtained from Promega.

Transient transfection assays. H1838 cells (1 x 105 cells/well in 6-well dishes) were seeded and grown to 50–60% confluence. Plasmid DNA (2 µg) with or without 0.2 µM phosphorothioate single-stranded palindromic oligonucleotide CRE (5'-TGACGTCATGACGTCATGACGTCA-3'), CRE control oligonucleotide (5'-CTAGCTAGCTAGCTAGCTAGCTAG-3') (23), 2 µg/µl Sp1 oligodeoxynucleotide (ODN) (5'-ATTCGATCGGGCCGCGAG-3'), or mutated Sp1 ODN (5'-ATTCGATCGGTTCGGGGCGAG-3'), which were annealed to become double-stranded Sp1 ODNs, and internal control phRL-TK synthetic Renilla luciferase reporter vector (0.2 µg) were cotransfected into cells using the FUGENE 6 transfection reagent (Roche Molecular Biochemicals, Indianapolis, IN) as described previously (13). Afterward, the cells were treated with 15d-PGJ2 (10 µM), BRL49653(10 µM), or troglitazone (15 µM) for an additional 24 h, and cell extracts were prepared. Luciferase activity was quantified using the Dual-Luciferase Reporter Kit according to recommendations by the manufacturer (Promega). Changes in firefly luciferase activity were calculated and plotted after normalization using Renilla luciferase activity within the same sample. All experiments were performed in triplicate, and data represent three independent experiments.

EMSA. Nuclear protein extracts were prepared for EMSA as described by others (8). The protein content of the nuclear extract was determined using the Bradford method. EMSA experiments were performed as described before (14). The ODN for Sp1 and CRE were synthesized by Sigma Genosys based on Fn promoter sequences (42, 30, 48): wild-type Sp1 (5'-GGTGGGGCGGGGCGGGGACA), mutant Sp1 (5'-GGTGGGGCtaGcCGGGGACA); wild-type CRE (5'-TCCCCCGTGACGTCACCCGG), mutant CRE (5'-TCCCCCaTGgCtTC ACCCGG). The small letters indicate mutations. Complementary double-stranded ODNs were annealed and purified following the manufacturer's protocol (Sigma). The Sp1 and CRE ODNs or mutated ODNs were radiolabeled with [{gamma}-32P]ATP using T4 polynucleotide kinase as recommended by the manufacturer. Nuclear proteins (5 µg) were first incubated under binding conditions [10 mM HEPES, Tris·HCl (pH 7.9), 50 mM KCl, 0.1 mM EDTA, 1 mM DTT, 12% (vol/vol) glycerol, and 2 µg poly(dI-dC)] for 10 min, followed by addition of radiolabeled ODN (1 x 106 cpm) for 20 min at room temperature in a final volume of 20 µl. For cold competition, a 100-fold excess of the respective nonradiolabeled wild-type ODN was added to the reaction. When applicable, 2 µg of anti-CREB or anti-Sp1 antibodies were added to each binding reaction for the supershift assay. After binding, protein-DNA complexes were electrophoresed on a native 4.5% polyacrylamide gel using 1x Tris-glycine buffer. The gels were dried and subjected to autoradiography at –80°C.

Statistical analysis. All experiments were repeated a minimum of three times. All data collected were expressed as means ± SD. The data in some figures are from a representative experiment, which was qualitatively similar in the replicate experiments. Statistical significance was determined with a Student's t-test (two-tailed) comparison between two groups of data sets. Asterisks shown in the figures indicate significant differences of experimental groups compared with the corresponding control condition (P < 0.05, see figure legends).


   RESULTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 GRANTS
 REFERENCES
 
Dose- and time-dependent inhibition of Fn protein expression by PPAR{gamma} ligands in human lung carcinoma cells. Previously, we and others have demonstrated that several human lung carcinoma cell lines express Fn mRNA as determined by RT-PCR (12, 15). Here, we show that treatment of H1838 cells with the PPAR{gamma} ligands BRL49653and 15d-PGJ2 significantly inhibits (P < 0.05) Fn protein expression by Western blot analysis in a dose- and time-dependent manner. These PPAR{gamma} ligands were most effective at reducing Fn protein expression at a concentration of 10 µM for 24 h (Fig. 1, A–D). A third PPAR{gamma} ligand, troglitazone, was also tested, and the results were similar to those observed for both BRL49653and 15d-PGJ2 (not shown).



View larger version (41K):
[in this window]
[in a new window]
  		Fig. 1. Dose-and time-dependent inhibition of fibronectin (Fn) expression by peroxisome proliferator-activated receptor-{gamma} (PPAR{gamma}) ligands in human lung carcinoma cells. A and B: BRL49653stimulates Fn expression in a dose- and time-dependent manner. Cellular protein (50 µg) was isolated from H1838 cells treated with increasing concentrations of BRL49653for the indicated periods of time followed by Western blot analysis for Fn protein using an anti-Fn antibody. Blots were also incubated with an anti-actin antibody to control for gel loading. Right: densitometric analysis of Western blots for Fn protein. Results are expressed as the optical density of Fn and normalized to actin levels. *Significant difference from control untreated cells (P < 0.05). C and D: 15d-PGJ2 stimulates Fn expression in a dose- and time-dependent manner. Cellular protein (50 µg) was isolated from H1838 cells treated with increasing concentrations of 15d-PGJ2 for the indicated periods of time followed by Western blot analysis for Fn protein using an anti-Fn antibody. Blots were also incubated with an anti-actin antibody to control for gel loading. Right: densitometric analysis of Western blots for Fn protein. Results are expressed as the optical density of Fn and normalized to actin levels. *Significant difference from control untreated cells (P < 0.05).

 
PPAR{gamma} ligands inhibit Fn mRNA expression in human lung carcinoma cells. Next, we examined the effects of PPAR{gamma} ligands on Fn mRNA expression. As shown by RT-PCR analysis in Fig. 2A, treatment of H1838 cells with 15d-PGJ2 or BRL49653(10 µM each), or troglitazone (15 µM) for 24 h, significantly reduced Fn mRNA levels compared with the untreated control cells. These findings were confirmed by real-time RT-PCR analysis (Fig. 2B). It should be highlighted that the effects of PPAR{gamma} ligands on Fn expression are not related to their growth inhibitory activity. In time-course experiments, we demonstrated that PPAR{gamma} ligands reduced the expression of Fn before 24 h of exposure, whereas growth inhibition was not observed until after 48 h of treatment (not shown). These finding are important because, as we previously reported, Fn stimulates NSCLC cell proliferation. Here, we provide further evidence for this by showing that inhibition of endogenous Fn expression with Fn siRNA results in inhibition of NSCLC proliferation. The addition of exogenous Fn increased proliferation, thereby restoring NSCLC proliferation back to baseline levels (Fig. 2C). This suggests that inhibition of endogenous Fn expression does not block the ability of the tumor cells to respond to other sources of Fn.



View larger version (19K):
[in this window]
[in a new window]
  		Fig. 2. PPAR{gamma} ligands inhibit Fn mRNA expression and the role of Fn on non-small cell lung carcinoma cell growth. A: RT-PCR analysis of Fn from H1838 total RNA extracts. Total RNA was isolated from H1838 cells treated with 15d-PGJ2 (10 µM), BRL49653(10 µM), or troglitazone (15 µM) for 24 h, and mRNA levels for Fn and GAPDH were tested by RT-PCR. B: real-time RT-PCR analysis of Fn total RNA extracts. Real-time RT-PCR results are expressed as the % of Fn mRNA in treated cells compared with nontreated control cells. C: [3H]thymidine incorporation assay for H1838 cell proliferation. H1838 Cells (5 x 104 cells/well in a 24-well dish) were treated with or without Fn small interfering RNA (siRNA) or control siRNA (100 nM each) for 30 h and then incubated with 1 µCi/ml of [3H]thymidine for 24 h in the presence or absence of Fn (20 µg/ml). *Significant difference from control untreated cells (Con) (P < 0.05). **Significance of combined treatments compared with Fn siRNA or Fn treatment alone. Results represent means ± SD.

 
Inhibition of Fn expression by PPAR{gamma} ligands through PPAR{gamma}-dependent and -independent mechanisms. Previous studies have shown that the regulation of various genes by PPAR{gamma} ligands occurs via both PPAR{gamma}-dependent and -independent signals (10, 27, 45). We tested whether these signaling mechanisms were also activated in our system. We found that the inhibitory effect of BRL49653and troglitazone on Fn protein expression was prevented in the presence of GW-9662, a specific antagonist of PPAR{gamma} (Fig. 3A). However, the inhibitory effect of 15d-PGJ2 was not affected by GW-9662. In parallel studies, siRNA interference assays were used to eliminate the endogenous PPAR{gamma} mRNA and subsequently any PPAR{gamma} protein expressed in the H1838 cells. Western blot analysis in Fig. 3B demonstrates that cells transfected with the PPAR{gamma} siRNA almost completely eliminated PPAR{gamma} protein expression (96% of control). Cells transfected with PPAR{gamma} siRNA had similar amounts of Fn protein compared with nontreated control cells, whereas PPAR{gamma} siRNA reversed the inhibitory effects of the PPAR{gamma} ligands BRL49653and troglitazone on Fn protein expression. However, PPAR{gamma} siRNA treatment had no effect on the inhibition of Fn by 15d-PGJ2 (Fig. 3C). In cells transfected with control siRNA, treatment with the PPAR{gamma} ligands showed a decrease in Fn expression similar to nontransfected control cells (Fig. 3D). These findings suggest that the inhibitory effects of 15d-PGE2 are not dependent on PPAR{gamma} activation.



View larger version (38K):
[in this window]
[in a new window]
  		Fig. 3. Role of PPAR{gamma} activation in PPAR{gamma} ligand inhibition of Fn expression. A: effects of PPAR{gamma} ligands on Fn protein levels in the presence of PPAR{gamma} antagonist. Cellular protein was isolated from H1838 cells cultured for 1 h in the presence or absence of GW-9662 (20 µM) before exposure to BRL49653(10 µM), troglitazone (15 µM), or 15d-PGJ2 (10 µM) for an additional 24 h, followed by Western blot analysis for Fn protein. A, bottom: densitometric analysis of Western blots for Fn protein. Results are expressed as the optical density of Fn and normalized to actin levels. B: PPAR{gamma} siRNA blocks the production of PPAR{gamma} protein. Cellular protein was isolated from H1838 cells transfected with PPAR{gamma} siRNA or control siRNA (100 nM each) for 30 h, followed by Western blot analysis for PPAR{gamma} protein. C and D: effects of PPAR{gamma} ligands on Fn protein level in the presence of PPAR{gamma} siRNA. Cellular protein was isolated from H1838 cells transfected with PPAR{gamma} siRNA or control siRNA as described above, followed by Western blot analysis for Fn protein in the presence or absence of BRL49653(10 µM), troglitazone (15 µM), or 15d-PGJ2 (10 µM). Right: densitometric analysis of Western blots for Fn protein. Results are expressed as the optical density of Fn and normalized to actin levels. *Significant difference from control untreated cells (Con) (P < 0.05). **Significance of combined treatments compared with the BRL49653 troglitazone, or 15d-PGJ2 treatment alone (P < 0.05). Trog, troglitazone.

 
PPAR{gamma} ligands inhibit Fn promoter activity. We next examined the effects of PPAR{gamma} ligands on the transcriptional regulation of the Fn gene. The Fn promoter contains multiple transcription factor binding sites including several CRE and Sp1 sites as well as one NF-{kappa}B site (Fig. 4A). These sites have been shown to be differentially responsive to various stimuli (25, 30, 42, 48). To elucidate the cis-acting elements in the Fn promoter that mediate the inhibitory effects of PPAR{gamma} ligands, transient transfection assays were performed with the full-length as well as several promoter deletion constructs connected to a luciferase reporter gene. In transfected H1838 cells treated with 15d-PGJ2, BRL49653 or troglitazone, the full-length Fn promoter –1249/+69 activity decreased significantly compared with untreated control cells (Fig. 4B). To confirm the role of PPAR{gamma} in the inhibition of the Fn promoter, H1838 cells were transfected with the Fn promoter –1249/+69 along with control or PPAR{gamma} siRNA and treated with 15d-PGJ2, BRL49653 or troglitazone. As depicted in Fig. 4C, PPAR{gamma} siRNA prevented the inhibitory effect of both BRL49653and troglitazone, but not that of 15d-PGJ2, on the Fn promoter activity. The control siRNA had no effect.



View larger version (37K):
[in this window]
[in a new window]
  		Fig. 4. Regulation of Fn gene transcription by PPAR{gamma} ligands. A: schematic diagram of Fn promoter. A schematic diagram of the human Fn promoter is presented. Three copies of cAMP response element (CRE) binding sites (solid rectangles), 3 copies of Sp1 binding sites (open circles), 1 copy of the NF-{kappa}B (solid triangle), and 1 TATA box (open square) are indicated. B: effects of PPAR{gamma} ligands on Fn promoter activity. H1838 cells (1 x 105 cells/well in 6-well dish) were cotransfected with wild-type Fn promoter construct connected to a luciferase reporter gene along with 0.1 µg of phRL-TK synthetic Renilla luciferase reporter vector for 24 h. Afterward, cells were cultured in the presence or absence of 15d-PGJ2, BRL49653(10 µM each), or troglitazone (15 µM) for an additional 24 h followed by measurement of luciferase activity. C: effects of PPAR{gamma} ligands on Fn promoter activity in the presence of PPAR{gamma} siRNA. H1838 cells (1 x 105 cells/well in 6-well dish) were cotransfected with control or PPAR{gamma} siRNA (100 nM each) and wild-type Fn promoter construct connected to luciferase report gene (2µg/µl) as described above for 30 h. Afterward, cells were cultured in the presence or absence of 15d-PGJ2, BRL49653(10 µM each), or troglitazone (15 µM) for an additional 24 h followed by measurement of luciferase activity. D: effects of PPAR{gamma} ligands on Fn promoter activity in the presence of CRE decoy and cold Sp1 oligonucleotides. H1838 cells (1 x 105 cells/well in 6-well dish) were cotransfected with the human Fn deletion construct –510/+69 bp or –165/+69 bp connected to luciferase reporter gene, 0.2 µM phosphorthioate synthetic single-stranded oligonucleotide composed of the CRE sequence or nonsense control oligonucleotide, or 2 µg/µl consensus or mutated Sp1 oligodeoxynucleotide (ODN) along with 0.1 µg of phRL-TK synthetic Renilla luciferase reporter vector for 24 h. Afterward, the cells were cultured in the presence or absence of 15d-PGJ2 (10 µM), BRL49653(10 µM), or troglitazone (15 µM) for an additional 24 h followed by measuring luciferase activity. mSp1, mutant Sp1. E: effects of PPAR{gamma} ligands on Fn promoter activity with mutated CRE Fn constructs. H1838 cells (1 x 105 cells/well in 6-well dish) were cotransfected with the human Fn deletion construct –510/+69 bp or human Fn mutated constructs (M1, mutated CRE at –415 bp; M2, mutated CRE at –270 bp; M3, mutated CRE at –170 bp) connected to luciferase reporter gene along with 0.1 µg of phRL-TK synthetic Renilla luciferase reporter vector for 24 h. Afterward, cells were cultured in the presence or absence of 15d-PGJ2 (10 µM), BRL49653(10 µM), or troglitazone (15 µM) for an additional 24 h. H1838 cells were harvested and washed, and luciferase activity was determined using a dual-luciferase kit. Results of 1 representative experiment out of at least 3 were performed are shown. *Significant difference from control untreated cells (Con) (P < 0.05). **Significance of combined treatments compared with 15d-PGJ2 or BRL49653or troglitazone treatment alone (P < 0.05).

 
To determine which cis-acting elements within the Fn promoter mediate the inhibitory effects of PPAR{gamma} ligands, Fn promoter deletion constructs –510/+69 and –165/+69 were tested for their ability to respond to treatment with 15d-PGJ2, BRL49653 or troglitazone. The Fn promoter activity in H1838 cells transfected with the Fn promoter –510/+69, which contains three CRE binding sites, three Sp1 binding sites, and one NF-{kappa}B binding site, was inhibited with PPAR{gamma} ligand treatment. Cells cotransfected with a CRE decoy oligonucleotide were less responsive to the inhibitory effects of the 15d-PGJ2, BRL49653 or troglitazone, whereas cotransfection with a CRE control oligonucleotide had no effect (Fig. 4D). This suggested that CRE was involved in the inhibitory effect of the PPAR{gamma} ligands. By using site-directed mutated Fn promoter constructs (among these, –415, –270, and –170 CRE sites were mutated separately), we found that only the mutation of one site (–170) was involved in mediating the suppressive effect by PPAR{gamma} ligands (Fig. 4E). However, the remaining activity suggested the involvement of other elements. It is for this reason that we tested the shorter promoter –165/+69 and focused on Sp1. The Fn promoter activity in H1838 cells transfected with the Fn promoter –165/+69 was also inhibited with PPAR{gamma} ligand treatment; however, cotransfection of cells with an Sp1-competing double-stranded ODN completely abrogated the inhibitory effects of 15d-PGJ2, BRL49653 or troglitazone. Cotransfection with a Sp1 control ODN had no effect (Fig. 4D). The Fn promoter construct –165/+69 contains three Sp1 binding sites and one NF-{kappa}B binding site; the CRE binding sites at –415, –270, and –170 bp were deleted. Transfection studies using the Fn promoter construct –50/+69 showed only minimal promoter activity and no response to the PPAR{gamma} ligands (data not shown). Together, these data suggest the CRE and the Sp1 cis-acting elements in the region between –170 and –50 bp were mainly responsible for mediating the suppressive effect of PPAR{gamma} ligands on the Fn gene.

CRE and Sp1, but not NF-{kappa}B, sites in the Fn promoter are involved in the PPAR{gamma} ligand effect. To further identify the transcription factors that mediated the inhibitory effects of PPAR{gamma} ligands on Fn expression, EMSAs were performed. As shown in Fig. 5A, the treatment of H1838 cells with 15d-PGJ2, troglitazone, or BRL49653caused a reduction in binding to CRE sites within the promoter compared with nontreated control cells. Competition with 100-fold molar excess of nonradiolabeled CRE ODN or binding to the mutated CRE radiolabeled ODN demonstrated the specificity of the protein-DNA complex. Treatment of H1838 cells with 15d-PGJ2, troglitazone, or BRL49653also caused a reduction in binding to Sp1 sites compared with nontreated control cells (Fig. 5B). Again, competition with 100-fold molar excess of nonradiolabeled Sp1 ODN or binding to the mutated Sp1 radiolabeled ODN demonstrated the specificity of the protein-DNA complex. Treatment of H1838 cells with 15d-PGJ2 or troglitazone had no effect on NF-{kappa}B DNA binding activity (not shown). Similar results were obtained using H2106 cells (not shown). The addition of CREB (Fig. 5C) and Sp1 (Fig. 5D) antibodies to the binding reaction resulted in at least one supershift band demonstrating the specificity of the protein-DNA binding. Nuclear extract from HeLa cells (Promega) was used as a positive control for Sp1 protein.



View larger version (63K):
[in this window]
[in a new window]
  		Fig. 5. PPAR{gamma} ligands inhibit DNA binding by CRE binding protein (CREB) and Sp1 in human lung carcinoma cells. A: EMSA analysis of CREB binding from H1838 nuclear protein extracts. H1838 cells were treated with or without 15d-PGJ2 (10 µM), troglitazone (15 µM), or BRL49653(10 µM) for 24 h. For competition assays, CRE (cold) or mutant CRE (mCRE) oligonucleotides were added to the reactions (first 2 lanes). Afterward, nuclear protein was processed for EMSA as described in MATERIALS AND METHODS to detect CREB binding. Con refers to untreated cells. B: EMSA analysis of Sp1 binding activity from H1838 nuclear protein extracts. The cells were treated with PPAR{gamma} ligands as described above. For competition assays, Sp1 (cold) or mSp1 oligonucleotides were added to the reactions. Afterward, nuclear protein was processed for EMSA as described in MATERIALS AND METHODS to detect Sp1 binding. Con refers to untreated cells. C: EMSA supershift analysis of CREB binding activities. Nuclear extracts from H1838 cells were incubated with CREB-specific antibody and then subjected to EMSA analysis. For competition assays, CRE (cold) or mCRE oligonucleotides were added to the reactions (first 2 lanes). Con refers to untreated cells. D: EMSA supershift analysis of Sp1 binding activities. Nuclear extracts from H1838 cells were incubated with Sp1-specific antibody and then subjected to EMSA analysis. For competition assays, Sp1 (cold) or mSp1 oligonucleotides were added to the reactions (first 2 lanes). Nuclear protein extracted from HeLa cells was used as control. Con refers to untreated cells. Ab, antibody.

 
PPAR ligands inhibit the phosphorylation of CREB and expression of the Sp1 nuclear protein. Western blot analysis was used to determine whether PPAR{gamma} ligand treatment reduced the amount of CREB or Sp1 protein located in the nucleus. As shown in Fig. 6A, H1838 cells treated with 15d-PGJ2, troglitazone, or BRL49653(not shown) demonstrated a reduction in the amount of phosphorylated CREB protein, but not total CREB protein. Also, as shown in Fig. 6B, H1838 cells treated with 15d-PGJ2, troglitazone, or BRL49653demonstrated a reduction in the amount of Sp1 protein found in the nucleus.



View larger version (29K):
[in this window]
[in a new window]
  		Fig. 6. PPAR{gamma} ligands inhibit CREB phosphorylation and Sp1 expression. A: Western blot analysis of CREB protein from H1838 cellular extracts. H1838 cells were treated with or without the PPAR{gamma} ligands 15d-PGJ2 (10 µM), BRL49653(10 µM), or troglitazone (15 µM) for 24 h. Cells were harvested, and nuclear proteins (20 µg) were isolated and subjected to Western blot analysis. Blots were incubated with anti-CREB or anti-phosphorylated CREB antibodies. Right: densitometric analysis of Western blot for phosphorylated CREB (p-CREB) and total CREB protein. Results (optical density units) are expressed as the amount of phosphorylated CREB protein over the total CREB protein. The levels of p-ATF-1 (phosphor-activating transcription factor 1) were not affected. B: Western blot analysis of Sp1 protein from H1838 cellular extracts. H1838 cells were treated with or without PPAR{gamma} ligands as described above. Cells were harvested, and nuclear proteins (20 µg) were isolated and subjected to Western blot analysis. Blots were incubated with anti-Sp1 antibody. Right: densitometric analysis of Western blot for Sp1 protein. Results (optical density units) are expressed as the amount of Sp1 protein compared with control nontreated cells (Con). *Significant difference from control cells (P < 0.05).

 

   DISCUSSION
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
GRANTS
 REFERENCES
 
In the current study, we focus on the link between Fn expression and the PPAR{gamma} signaling pathway in lung carcinoma cells. Previous studies have demonstrated that extracellular matrixes, including Fn, affect cell growth and differentiation (43, 47). Cell adhesion to the extracellular matrix has been reported to control cell cycle genes such as p21 and cyclin D1 (2, 35), and the overexpression of Fn in certain carcinoma cells, including lung carcinoma cells, has also been reported (12, 18, 21, 46). Although the exact consequences of Fn expression by lung carcinoma cells remain unclear, we have reported that Fn stimulates the proliferation and survival of NSCLC (15). Thus both host cell- and tumor cell-derived Fn may serve as a mitogen/autocrine factor for lung carcinoma cells and, as such, represents a potential target for developing anti-cancer therapies.

The expression of PPAR{gamma} and the effects of PPAR{gamma} ligands on cell growth and apoptosis have also been extensively studied in many carcinoma cell types, including lung (7, 22). However, the exact mechanisms mediating the effects of PPAR{gamma} ligands on cell growth inhibition are not fully understood. Here, we report that treatment of H1838 lung carcinoma cells with the PPAR{gamma} ligands 15d-PGJ2, BRL49653 or troglitazone significantly decreased Fn mRNA and protein levels compared with nontreated control cells; other studies are also consistent with these results (9, 41, 49). One study showed that the adhesion of colon carcinoma cells, which express high levels of PPAR{gamma}, to Fn significantly decreased collagen expression when exposed to the PPAR{gamma} ligand troglitazone (41). Another recent report indicated that the PPAR{gamma} ligand pioglitazone inhibited human cortical fibroblast cell growth and Fn secretion, and this was mediated through a PPAR{gamma}-dependent mechanism (49). Our results demonstrating that PPAR{gamma} ligands inhibit Fn gene expression in human lung carcinoma cells are highly relevant to these studies. In previous studies, we showed that Fn enhanced NSCLC cell proliferation and that this effect was associated with stimulation of COX-2 expression and production of PGE2 (15). More recently, we showed that the effects of PPAR{gamma} ligands on Fn expression were associated with inhibition of COX-2 expression and PGE2 production (not shown).

We also found that the reduction in Fn expression induced by BRL49653and troglitazone was prevented in the presence of the selective PPAR{gamma} antagonist GW-9662 (24), whereas the effect of 15d-PGJ2 on Fn expression was not affected. This suggests that both PPAR{gamma}-dependent and -independent signaling pathways are involved in regulation of Fn expression. The PPAR{gamma}-dependent and -independent signaling induced by PPAR{gamma} ligands has been reported in several other studies (10, 27, 45). For example, Straus et al. (38) studied the PPAR{gamma}-dependent inhibition of inducible nitric oxide synthase expression and found that 15d-PGJ2 was significantly more effective than synthetic PPAR{gamma} ligands, despite binding to PPAR{gamma} with lower affinity. Chen et al. (4) reported that 15d-PGJ2 inhibited cytokine-stimulated Janus kinase 2-STAT signaling through a PPAR{gamma}-independent, reactive oxygen species-dependent mechanism. This PPAR{gamma}-independent action of 15d-PGJ2 has shed new light on the mechanism of action of this endogenous anti-cancer agent. Consistent with the above observations, we found that lung carcinoma cells transfected with PPAR{gamma} siRNA prevented both BRL49653 and troglitazone-mediated inhibition of Fn expression, but not that induced by 15d-PGJ2.

To determine the mechanism(s) responsible for the PPAR{gamma}-induced inhibition of Fn gene expression, EMSAs were performed to identify specific nuclear transcription factors binding to the Fn promoter. The human Fn promoter contains multiple transcription factor binding sites including several CRE, Sp1, and NF-{kappa}B sites, and recent studies demonstrate that similar sites play important roles in the regulation of several genes, including that of Fn (5, 25, 30, 42, 48). Our results demonstrate that PPAR{gamma} ligands resulted in reduced binding of CREB to the –170 bp site within the Fn promoter. The CREB transcription factor is one gene activator that has the ability to induce a wide range of both cellular and viral genes (23). PPAR{gamma} ligands have also been shown to suppress other genes by regulating the nuclear binding activity to the CRE (39). Synthetic single-stranded palindromic CRE decoy oligonucleotides transfected into cells have been shown to be very specific in their ability to compete with target transcription factors and act as competitor cis-acting elements (23). CRE decoy oligonucleotides produced selective growth inhibition in a variety of carcinoma cells, including lung carcinoma, without adversely affecting the normal cell growth (29). Park et al. (29) demonstrated that the CRE-palindromic oligonucleotides effectively competed with the native CRE enhancer for binding transcription factors and inhibited basal CRE gene transcription in a wide variety of cell types. We found that transfection of lung carcinoma cells with CRE decoy oligonucleotides reduced the ability of PPAR{gamma} ligands to inhibit Fn promoter activity, confirming the involvement of CRE sites. Among the three Fn promoter CRE sites, only one (–170 bp) was found to be important in PPAR{gamma} ligand regulation of Fn expression. This is consistent with other reports showing the importance of the –170-bp CRE site in the regulation of Fn in other cell systems (30, 44). Working with several Fn-deleted constructs connected to the luciferase reporter gene demonstrated that downregulation of Fn by PPAR{gamma} was, at least, mediated by antagonizing the transactivating activity of CREB binding to one CRE site in the Fn promoter. The results showing that PPAR{gamma} ligands inhibit the phosphorylation of CREB further support a role for CREB/DNA binding in Fn expression in NSCLC.

We also found that there was a detectable response to PPAR{gamma} ligands in Fn promoter deletion constructs where the CRE sites were absent; this suggested that other transcription factor binding sites in the Fn promoter might be involved in the PPAR{gamma} regulation of Fn. One of these possible targets is Sp1. Using Sp1 competitor ODN in cells transfected with the Fn promoter deletion construct –165/+69 lacking all three CRE sites, we found that wild-type, but not mutated, Sp1 ODN completely prevented the inhibitory effects of PPAR{gamma} ligands on Fn expression. Sp1 is known to play an important role in the activation of the Fn promoter from studies using human embryonic carcinoma cells (42). The connection between PPAR{gamma} and Sp1 has also been reported in other cell studies (40). Sugawara et al. (40) reported that PPAR{gamma} ligands inhibited Sp1 binding to DNA and inhibited transcriptional activity in vascular smooth muscle cells, suggesting that PPAR{gamma} functionally antagonizes Sp1 by inhibiting the formation of the Sp1-DNA complex.

Together, our results demonstrate that PPAR{gamma} ligands reduce CREB- and Sp1-DNA binding activities as well as Sp1 protein expression, which results in the inhibition of Fn gene expression in human lung carcinoma cells. The inhibition of Fn by PPAR{gamma} ligands appears to be mediated through PPAR{gamma}-dependent and -independent pathways. These observations suggest a novel role for PPAR{gamma} ligands in the development of therapeutic interventions able to prevent or inhibit lung carcinoma progression. Also, they unveil a potential new mechanism by which the effects of the stroma on NSCLC growth can be investigated.


   GRANTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
REFERENCES
 
This work was supported by American Cancer Society Institutional Research Grant 6-47083 (S. W. Han), the Aerodigestive and Lung Cancer Program of the Winship Cancer Institute at Emory University, a Merit Review Grant from the Department of Veterans Affairs (J. Roman), and by grants from the National Institutes of Health (J. Roman).


   FOOTNOTES
 

Address for reprint requests and other correspondence: S. Han, Division of Pulmonary, Allergy, and Critical Care Medicine, Emory Univ. School of Medicine, Whitehead Biomedical Research Bldg., 615 Michael St., 205-M, Atlanta, GA 30322 (e-mail: shan2{at}emory.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   REFERENCES
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Bernard MP, Kolbe M, Weil D, and Chu ML. Human cellular Fn: comparison of the carboxyl-terminal portion with rat identifies primary structural domains separated by hypervariable regions. Biochemistry 24: 2698–2704, 1985.[CrossRef][Medline]
  2. Bottazzi ME, Zhu X, Bohmer RM, and Assoian RK. Regulation of p21 (cip1) expression by growth factors and the extracellular matrix reveals a role for transient ERK activity in G1 phase. J Cell Biol 146: 1255–1264, 1999.[Abstract/Free Full Text]
  3. Chang TH and Szabo E. Induction of differentiation and apoptosis by ligands of peroxisome proliferator-activated receptor {gamma} in non-small cell lung carcinoma. Cancer Res 60: 1129–1138, 2000.[Abstract/Free Full Text]
  4. Chen CW, Chang YH, Tsi CJ, and Lin WW. Inhibition of IFN-{gamma}-mediated inducible nitric oxide synthase induction by the peroxisome proliferator-activated receptor {gamma} agonist, 15-deoxy-delta12,14-prostaglandin J2, involves inhibition of the upstream Janus kinase/STAT1 signaling pathway. J Immunol 171: 979–988, 2003.[Abstract/Free Full Text]
  5. Dean DC, Bowlus CL, and Bourgeois S. Cloning and analysis of the promoter region of the human Fn gene. Proc Natl Acad Sci USA 84: 1876–1880, 1987.[Abstract/Free Full Text]
  6. Debril MB, Renaud JP, Fajas L, and Auwerx J. The pleiotropic functions of peroxisome proliferator-activated receptor {gamma}. J Mol Med 79: 30–47, 2001.[CrossRef][Web of Science][Medline]
  7. DeCicco KL, Tanaka T, Andreola F, and De Luca LM. The effect of thalidomide on non-small cell lung cancer (NSCLC) cell lines: possible involvement in the PPAR{gamma} pathway. Carcinogenesis 25: 1805–1812, 2004.[Abstract/Free Full Text]
  8. Dignam JD, Lebovitz RM, and Roeder RG. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11: 1475–1489 1983.[Abstract/Free Full Text]
  9. Galli A, Crabb DW, Ceni E, Salzano R, Mello T, Svegliati-Baroni G, Ridolfi F, Trozzi L, Surrenti C, and Casini A. Antidiabetic thiazolidinediones inhibit collagen synthesis and hepatic stellate cell activation in vivo and in vitro. Gastroenterology 122: 1924–1940, 2002.[CrossRef][Web of Science][Medline]
  10. Grau R, Iniguez MA, and Fresno M. Inhibition of activator protein 1 activation, vascular endothelial growth factor, and cyclooxygenase-2 expression by 15-deoxy-delta12,14-prostaglandin J2 in colon carcinoma cells: evidence for a redox-sensitive peroxisome proliferator-activated receptor-{gamma}-independent mechanism. Cancer Res 64: 5162–5171, 2004.[Abstract/Free Full Text]
  11. Guo B, Koya D, Isono M, Sugimoto T, Kashiwagi A, and Haneda M. Peroxisome proliferator-activated receptor-{gamma} ligands inhibit TGF-{beta}1-induced fibronectin expression in glomerular mesangial cells. Diabetes 53: 200–208, 2004.[Abstract/Free Full Text]
  12. Han JY, Kim HS, Lee SH, Park WS, Lee JY, and Yoo NJ. Immunohistochemical expression of integrins and extracellular matrix proteins in non-small cell lung cancer: correlation with lymph node metastasis. Lung Cancer 41: 65–70, 2003.[CrossRef][Web of Science][Medline]
  13. Han S, Wada RK, and Sidell N. Differentiation of human neuroblastoma by phenylacetate is mediated by peroxisome proliferator-activated receptor {gamma}. Cancer Res 61: 3998–4002, 2001.[Abstract/Free Full Text]
  14. Han S and Sidell N. RU486-induced growth inhibition of human endometrial cells involves the nuclear factor-{kappa}B signaling pathway. J Clin Endocrinol Metab 88: 713–719, 2003.[Abstract/Free Full Text]
  15. Han S, Sidell N, Susan Roser-Pager S, and Roman J. Fibronectin stimulates human lung cancer cell growth by inducing cyclooxygenase-2 (COX-2) gene expression. Int J Cancer 111: 322–331, 2004.[CrossRef][Web of Science][Medline]
  16. Han SW, Lei ZM, and Rao CV. Up-regulation of cyclooxygenase-2 gene expression by chorionic gonadotropin during the differentiation of human endometrial stromal cells into decidua. Endocrinology 137: 1791–1797, 1996.[Abstract]
  17. Han SW, Inoue H, Flowers L, and Sidell N. Control of COX-2 gene expression through peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) in human cervical cancer cells. Clin Cancer Res 9: 4627–4635, 2003.[Abstract/Free Full Text]
  18. Hegele A, Heidenreich A, Kropf J, von Knobloch R, Varga Z, Hofmann R, and Olbert P. Plasma levels of cellular fibronectin in patients with localized and metastatic renal cell carcinoma. Tumour Biol 25: 111–116, 2004.[CrossRef][Medline]
  19. Hirtenlehne K, Pec M, Cubista E, and Singer CF. Extracellular matrix proteins influence phenotype and cytokine expression in human breast carcinoma cell lines. Eur Cytokine Netw 13: 234–240, 2002.[Web of Science][Medline]
  20. Hu M, Carles-Kinch KL, Zelinski DP, and Kinch MS. EphA2 induction of fibronectin creates a permissive microenvironment for malignant cells. Mol Cancer Res 2: 533–540, 2004.[Abstract/Free Full Text]
  21. Jakowlew SB, Mariano JM, You L, and Mathias A. Differential regulation of protease and extracellular matrix protein expression by transforming growth factor-{beta}1 in non-small cell lung carcinoma cells and normal human bronchial epithelial cells. Biochim Biophys Acta 1353: 157–170, 1997.[Medline]
  22. Keshamouni VG, Reddy RC, Arenberg DA, Joel B, Thannickal VJ, Kalemkerian GP, and Standiford TJ. Peroxisome proliferator-activated receptor-{gamma} activation inhibits tumor progression in non-small-cell lung cancer. Oncogene 23: 100–108, 2004.[CrossRef][Web of Science][Medline]
  23. Lee YN, Park YG, Choi YH, Cho YS, and Cho-Chung YS. CRE-transcription factor decoy oligonucleotide inhibition of MCF-7 breast cancer cells: cross-talk with p53 signaling pathway. Biochemistry 39: 4863–4868, 2000.[CrossRef][Medline]
  24. Leesnitzer LM, Parks DJ, Bledsoe RK, Cobb JE, Collins JL, Consler TG, Davis RG, Hull-Ryde EA, Lenhard JM, Patel L, Plunket KD, Shenk JL, Stimmel JB, Therapontos C, Willson TM, and Blanchard SG. Functional consequences of cysteine modification in the ligand binding sites of peroxisome proliferator activated receptors by GW9662. Biochemistry 41: 6640–6650, 2002.[CrossRef][Medline]
  25. Michaelson JE, Ritzenthaler JD, and Roman J. Regulation of serum-induced Fn expression by protein kinases, cytoskeletal integrity, and CREB. Am J Physiol Lung Cell Mol Physiol 282: L291–L301, 2002.[Abstract/Free Full Text]
  26. Morishita R, Gibbons GH, Horiuchi M, Ellison KE, Nakama M, Zhang L, Kaneda Y, Ogihara T, and Dzau VJ. A gene therapy strategy using a transcription factor decoy of the E2F binding site inhibits smooth muscle proliferation in vivo. Proc Natl Acad Sci USA 92: 5855–5859, 1995.[Abstract/Free Full Text]
  27. Nencioni A, Wesselborg S, and Brossart P. Role of peroxisome proliferator-activated receptor {gamma} and its ligands in the control of immune responses. Crit Rev Immunol 23: 1–13, 2003.[CrossRef][Web of Science][Medline]
  28. Oyama F, Hirohashi S, Shimasato Y, Titani K, and Sekiguchi K. Qualitative and quantitative changes of human tenascin expression in transformed lung fibroblast and lung tumor tissues: comparison with Fn. Cancer Res 51: 4876–4881, 1991.[Abstract/Free Full Text]
  29. Park YG, Nesterova M, Agrawal S, and Cho-Chung YS. Dual blockade of cyclic AMP response element (CRE) and AP-1-directed transcription by CRE-transcription factor decoy oligonucleotide gene-specific inhibition of tumor growth. J Biol Chem 274: 1573–1580, 1999.[Abstract/Free Full Text]
  30. Pesce CG, Nogues G, Alonso CR, Baralle FE, and Kornblihtt AR. Interaction between the (–170) CRE and the (–150) CCAAT box is necessary for efficient activation of the Fn gene promoter by cAMP and ATF-2. FEBS Lett 457: 445–451, 1999.[CrossRef][Medline]
  31. Qin C, Morrow D, Stewart J, Spencer K, Porter W, Smith R III, Phillips T, Abdelrahim M, Samudio I, and Safe S. A new class of peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) agonists that inhibit growth of breast cancer cells: 1,1-bis(3'-indolyl)-1-(p-substituted phenyl) methanes. Mol Cancer Ther 3: 247–260, 2004.[Abstract/Free Full Text]
  32. Rintoul RC and Sethi T. Extracellular matrix regulation of drug resistance in small-cell lung carcinoma. Clin Sci 102: 417–424, 2002.[CrossRef][Web of Science][Medline]
  33. Roesler WJ, Vandenbark GR, and Hanson RW. Cyclic AMP and the induction of eukaryotic gene transcription. J Biol Chem 263: 9063–9066, 1988.[Free Full Text]
  34. Roman J and McDonald JA. Fibronectin and fibronectin receptors in lung development, injury and repair. In: The Lung: Scientific Foundations (2nd ed.), edited by Crystal RG, West JB, Barnes PJ, Cherniak NS, and Weibel ER. New York: Raven, 1997, p. 737–756.
  35. Roy J, Tran PK, Religa P, Kazi M, Henderson B, Lundmark K, and Hedin U. Fn promotes cell cycle entry in smooth muscle cells in primary culture. Exp Cell Res 273: 169–177, 2002.[CrossRef][Web of Science][Medline]
  36. Sinkin RA, Roberts M, LoMonaco MB, Sanders RJ, and Metlay LA. Fibronectin expression in bronchopulmonary dysplasia. Pediatr Dev Pathol 1: 494–502, 1998.[CrossRef][Web of Science][Medline]
  37. Sozen I and Arica A. Interactions of cytokines, growth factors, and the extracellular matrix in the cellular biology of uterine leiomyomata. Fertil Steril 78: 1–12, 2002.[CrossRef][Web of Science][Medline]
  38. Straus DS, Pascual G, Li M, Welch JS, Ricote M, Hsiang CH, Sengchanthalangsy LL, Ghosh G, and Glass CK. 15-deoxy-delta 12,14-prostaglandin J2 inhibits multiple steps in the NF-{kappa}B signaling pathway. Proc Natl Acad Sci USA 97: 4844–4849, 2000.[Abstract/Free Full Text]
  39. Subbaramaiah K, Lin DT, Hart JC, and Dannenberg AJ. Peroxisome proliferator-activated receptor {gamma} ligands suppress the transcriptional activation of cyclooxygenase-2. Evidence for involvement of activator protein-1 and CREB-binding protein/p300. J Biol Chem 276: 12440–12448, 2001.[Abstract/Free Full Text]
  40. Sugawara A, Uruno A, Kudo M, Ikeda Y, Sato K, Taniyama Y, Ito S, and Takeuchi K. Transcription suppression of thromboxane receptor gene by peroxisome proliferator-activated receptor-{gamma} via an interaction with Sp1 in vascular smooth muscle cells. J Biol Chem 277: 9676–9683, 2002.[Abstract/Free Full Text]
  41. Sunami E, Tsuno NH, Kitayama J, Saito S, Osada T, Yamaguchi H, Tomozawa S, Tsuruo T, Shibata Y, and Nagawa H. Decreased synthesis of matrix metalloproteinase-7 and adhesion to the extracellular matrix proteins of human colon carcinoma cells treated with troglitazone. Surg Today 32: 343–350, 2002.[CrossRef][Web of Science][Medline]
  42. Suzuki M, Oda E, Nakajima T, Sekiya S, and Oda K. Induction of Sp1 in differentiating human embryonal carcinoma cells triggers transcription of the Fn gene. Mol Cell Biol 18: 3010–3020, 1998.[Abstract/Free Full Text]
  43. Takano N, Kawakami T, Kawa Y, Asano M, Watabe H, Ito M, Soma Y, Kubota Y, and Mizoguchi M. Fn combined with stem cell factor plays an important role in melanocyte proliferation, differentiation and migration in cultured mouse neural crest cells. Pigment Cell Res 15: 192–200, 2002.[CrossRef][Web of Science][Medline]
  44. Tseng L, Tang M, Wang Z, and Mazella J. Progesterone receptor (hPR) upregulates the fibronectin promoter activity in human decidual fibroblasts. DNA Cell Biol 22: 633–640, 2003.[CrossRef][Web of Science][Medline]
  45. Vernochet C, Milstone DS, Iehle C, Belmonte N, Phillips B, Wdziekonski B, Villageois P, Amri EZ, O'Donnell PE, Mortensen RM, Ailhaud G, and Dani C. PPAR{gamma}-dependent and PPAR{gamma}-independent effects on the development of adipose cells from embryonic stem cells. FEBS Lett 510: 94–98, 2002.[CrossRef][Medline]
  46. Wasenius VM, Hemmer S, Kettunen E, Knuutila S, Franssila K, and Joensuu H. Hepatocyte growth factor receptor, matrix metalloproteinase-11, tissue inhibitor of metalloproteinase-1, and Fn are up-regulated in papillary thyroid carcinoma: a cDNA and tissue microarray study. Clin Cancer Res 9: 68–75, 2003.[Abstract/Free Full Text]
  47. Wilson SH, Ljubimov AV, Morla AO, Caballero S, Shaw LC, Spoerri PE, Tarnuzzer RW, and Grant MB. Fibronectin fragments promote human retinal endothelial cell adhesion and proliferation and ERK activation through {alpha}5{beta}1 integrin and PI 3-kinase. Invest Ophthalmol Vis Sci 44: 1704–1715, 2003.[Abstract/Free Full Text]
  48. Yi T, Lee BH, Park RW, and Kim IS. Transactivation of Fn promoter by HTLV-I Tax through NF-{kappa}B pathway. Biochem Biophys Res Commun 276: 579–586, 2000.[CrossRef][Web of Science][Medline]
  49. Zafiriou S, Stanners SR, Saad S, Polhill TS, Poronnik P, and Pollock CA. Pioglitazone inhibits cell growth and reduces matrix production in human kidney fibroblasts. J Am Soc Nephrol 16: 638–645, 2005.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Infect. Immun.Home page
J. Baumert, K.-H. Schmidt, A. Eitner, E. Straube, and J. Rodel
Host Cell Cytokines Induced by Chlamydia pneumoniae Decrease the Expression of Interstitial Collagens and Fibronectin in Fibroblasts
Infect. Immun., February 1, 2009; 77(2): 867 - 876.
[Abstract] [Full Text] [PDF]

Home page
 ReproductionHome page
D. Gunnarsson, P. Leffler, E. Ekwurtzel, G. Martinsson, K. Liu, and G. Selstam
Mono-(2-ethylhexyl) phthalate stimulates basal steroidogenesis by a cAMP-independent mechanism in mouse gonadal cells of both sexes
Reproduction, May 1, 2008; 135(5): 693 - 703.
[Abstract] [Full Text] [PDF]

Home page
 Endocr Relat CancerHome page
V Costa, D Foti, F Paonessa, E Chiefari, L Palaia, G Brunetti, E Gulletta, A Fusco, and A Brunetti
The insulin receptor: a new anticancer target for peroxisome proliferator-activated receptor-{gamma} (PPAR{gamma}) and thiazolidinedione-PPAR{gamma} agonists
Endocr. Relat. Cancer, March 1, 2008; 15(1): 325 - 335.
[Abstract] [Full Text] [PDF]

Home page
 Toxicol SciHome page
M. A. Peraza, A. D. Burdick, H. E. Marin, F. J. Gonzalez, and J. M. Peters
The Toxicology of Ligands for Peroxisome Proliferator-Activated Receptors (PPAR)
Toxicol. Sci., April 1, 2006; 90(2): 269 - 295.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
289/3/L419    most recent
00002.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Han, S.
Right arrow Articles by Roman, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Han, S.
Right arrow Articles by Roman, J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2005 by the American Physiological Society.