Am J Physiol Lung Cell Mol Physiol 290: L144-L152, 2006.
First published August 5, 2005; doi:10.1152/ajplung.00131.2005
1040-0605/06 $8.00
Nitrogen dioxide enhances allergic airway inflammation and hyperresponsiveness in the mouse
Matthew E. Poynter,1
Rebecca L. Persinger,2
Charles G. Irvin,1
Kelly J. Butnor,2
Hans van Hirtum,2
Wendy Blay,2
Nicholas H. Heintz,2
Justin Robbins,3
David Hemenway,3
Douglas J. Taatjes,2 and
Yvonne Janssen-Heininger2
Departments of 1Medicine, 2Pathology, and 3Civil and Mechanical Engineering, University of Vermont, Burlington, Vermont
Submitted 23 March 2005
; accepted in final form 31 July 2005
 |
ABSTRACT
|
|---|
In addition to being an air pollutant, NO2 is a potent inflammatory oxidant generated endogenously by myeloperoxidase and eosinophil peroxidase. In these studies, we sought to determine the effects of NO2 exposure on mice with ongoing allergic airway disease pathology. Mice were sensitized and challenged with the antigen ovalbumin (OVA) to generate airway inflammation and subsequently exposed to 5 or 25 ppm NO2 for 3 days or 5 days followed by a 20-day recovery period. Whereas 5 ppm NO2 elicited no pathological changes, inhalation of 25 ppm NO2 alone induced acute lung injury, which peaked after 3 days and was characterized by increases in protein, LDH, and neutrophils recovered by BAL, as well as lesions within terminal bronchioles. Importantly, 25 ppm NO2 was also sufficient to cause AHR in mice, a cardinal feature of asthma. The inflammatory changes were ameliorated after 5 days of inhalation and completely resolved after 20 days of recovery after the 5-day inhalation. In contrast, in mice immunized and challenged with OVA, inhalation of 25 ppm NO2 caused a marked augmentation of eosinophilic inflammation and terminal bronchiolar lesions, which extended significantly into the alveoli. Moreover, 20 days postcessation of the 5-day 25 ppm NO2 inhalation regimen, eosinophilic and neutrophilic inflammation, pulmonary lesions, and AHR were still present in mice immunized and challenged with OVA. Collectively, these observations suggest an important role for NO2 in airway pathologies associated with asthma, both in modulation of degree and duration of inflammatory response, as well as in induction of AHR.
asthma; eosinophil; neutrophil; lung
THE TOXIC OXIDANT GAS, NO2, is formed by the combustion process and is a pollutant found in both indoor and outdoor air (3, 7, 19, 30, 35). Not well recognized are recent reports demonstrating that NO2 can also be formed within the lung during inflammation, as a result of the catalytic activity of eosinophil peroxidase and myeloperoxidase, or decomposition of peroxynitrite (ONOO) (5, 41, 55, 57). Consequently, nitrotyrosine formation, a stable end product of NO2 reactivity, is present in lungs from patients with asthma, chronic obstructive pulmonary disease, and many other inflammatory disorders (1, 9, 24, 26, 43, 44, 56) and may contribute to the pathophysiology of these diseases.
Epidemiological, clinical, and rodent studies have documented the adverse effects of NO2 on the lung. Exposure to NO2 is associated with increases in emergency room visits, hospital admissions, mortality, and acute respiratory complaints that include breathing difficulties, apnea, and exacerbation of asthma symptoms (3, 7), suggesting its role in augmenting respiratory illness. Epidemiologic studies performed in children have clearly documented an increased relative risk for adverse respiratory effects, including asthma exacerbations, which were associated with exposure to indoor or outdoor NO2 (7, 32). The inhalation of NO2 causes a number of biochemical, morphological, and functional changes in lungs of rodents (6, 1215, 20, 25, 29, 47, 48). NO2 is absorbed all along the respiratory tract and, depending on the concentration and dose, injury can occur in the trachea, bronchi, bronchioles, alveolar ducts, and the proximal airways (17, 34). The main site of NO2 deposition and injury is at the distal conducting airways at the level of the terminal bronchioles (7).
Studies that address the contribution of NO2 to pulmonary inflammation in mice are relevant because of the availability of genetically altered strains, which are instrumental to identify signaling pathways applicable to the pathophysiology of pulmonary diseases associated with the formation of reactive nitrogen species (RNS). To date, a limited number of studies using mice have demonstrated contradictory effects (22, 23, 40), possibly due to the use of different mouse strains, different doses of NO2, and different timing of the NO2 administration. The goal of the present study was to document the effects of NO2 exposure on the mouse lung and to determine whether 5 or 25 ppm NO2 exposure exacerbated allergic airways disease or promoted chronic alterations in the allergic inflamed lung.
 |
MATERIALS AND METHODS
|
|---|
Ovalbumin model of allergic airway inflammation and hyperresponsiveness.
Mice were subjected to ovalbumin (OVA) sensitization by administration of 100 µl of OVA (20 µg, grade V; Sigma, St. Louis, MO) with Alum (2.25 mg, Imject Alum; Pierce) via intraperitoneal injection on days 0 and 7. Mice were challenged using three doses of aerosolized 1% OVA in PBS for 30 min on days 1416, as previously described (8, 38, 52).
Exposure to NO2.
C57BL/6 mice, obtained from The Jackson Laboratory (Bar Harbor, ME), were used for whole body inhalation studies conducted within our Association for Assessment and Accreditation of Laboratory Animal Care-accredited inhalation facility. All animal studies were reviewed and approved by the institutional animal care and use committee at the University of Vermont. The methodology has been completely described elsewhere (25). In brief, a 50-l Teflon bag was filled with 1 part pure NO2 to 3 parts dry N2 gas, thus diluting the NO2. This mixture was then pumped through a regulating valve using a stainless steel/Teflon diaphragm pump into a mixing chamber and then into the inhalation chamber where the animals were exposed. A nitric oxide analyzer equipped with an NO2 thermal converter was used to continuously measure chamber NO2 in the gas phase according to the manufacturers instructions (Eco Physics, Ann Arbor, MI). The instrument was routinely calibrated through the use of NO2 permeation tubes and was shown to adequately monitor concentrations from 0.05 to 50 ppm. The exhaust from the exposure chamber was passed through a stainless steel duct to release the gases through a negative pressure line to the top of the building. Mice were exposed to 5 or 25 ppm NO2 for 1, 3, or 5 days, using daily exposure regimens of 6 h in duration. Selected groups of mice exposed to a 5- or 25-ppm NO2 dose for 6 h/day for 5 days were allowed to recover for 20 days.
Pulmonary function assessment.
After anesthesia and tracheostomy, mice were mechanically ventilated for the assessment of pulmonary function using the forced oscillation technique, as previously described (54). Mice were ventilated at a rate of 2.5 Hz, with a tidal volume of 0.2 ml and 3 cmH2O positive end-expiratory pressure (flexiVent; SCIREQ, Montreal, PQ, Canada). Data from regular ventilation were collected to establish the baseline for each animal, and inhaled doses of aerosolized methacholine (Sigma-Aldrich) in saline were then administered in successive increasing concentrations (0, 3.125, 12.5, and 50 mg/ml) as an aerosol. Multiple linear regression was used to fit impedance spectra derived from measured pressure and volume to the constant phase model of the lung (18)
where Z is input impedence of the respiratory system, Rn is a Newtonian resistance composed mostly of the flow resistance of the conducting pulmonary airways, I is the inertence of the gas in the central airways, G reflects viscous dissipation of energy in the respiratory tissues, Hti reflects elastic energy storage in the tissues, f is frequency, i =
,
is 2
f, and
couples G and Hti. Using this model, the peak response for the physiological property of elastance (Hti, a measure of parenchymal events) was determined, and the percentage change from baseline, as measured at the beginning of the protocol, was calculated.
Bronchoalveolar lavage.
Mice were killed by a lethal dose of pentobarbital via intraperitoneal injection. Bronchoalveolar lavage fluid (BALF) was immediately collected from euthanized mice for the assessment of total and differential cell counts (39). Supernatants were collected for protein (Bio-Rad, Hercules, CA), and lactate dehydrogenase (LDH) was quantitated according to the manufacturers instructions (Promega, Madison, WI).
Histopathology and transmission electron microscopy.
After the mice were killed and bronchoalveolar lavage was performed, the left lung lobe was instilled with 4% paraformaldehyde in PBS (4% PFA) for 10 min at a pressure of 25 cmH2O and placed into 4% PFA at 4°C overnight for further fixation of the tissue before being embedded in paraffin. Seven-micrometer sections were cut, affixed to glass microscope slides, deparaffinized with xylene, rehydrated through a series of ethanols (39), stained with hematoxylin and eosin or with periodic acid-Schiff stains, coverslipped, and examined by light microscopy. For transmission electron microscopy, the PFA-infused lungs were immersed in Karnovskys fixative (2.5% glutaraldehyde, 1.0% PFA in Millonigs phosphate buffer) and fixed overnight at 4°C. After three 5-min rinses in buffer, the tissue pieces were postfixed for 45 min at 4°C in 1% osmium tetroxide. Finally, the tissue pieces were rinsed in buffer, dehydrated in a graded series of ethanol (finishing with propylene oxide), and embedded in Spurrs resin. Ultrathin sections (6080 nm thick) were cut with a diamond knife, retrieved onto copper grids, contrasted with uranyl acetate and lead citrate, and examined with a JEOL 1210 transmission electron microscope operating at 60 kV.
Quantitative RT-PCR.
Lungs were removed from the mice immediately after bronchoalveolar lavage, snap frozen in liquid nitrogen, and pulverized using chilled mortars and pestles. RNA was extracted using TRIzol, DNase treated using RNeasy columns (Qiagen), and reverse transcribed into cDNA using Superscript II according to instructions by the manufacturer (GIBCO-BRL). Real-time semiquantitative RT-PCR was performed using the Taqman Universal PCR Master Mix and the ABI PRISM 7700 Sequence Detection System. The probes and primer sets used for mouse hypoxanthine guanine phosphoribosyltransferase (HPRT), forward: 5'-TTTGCCGCGAGCCG-3', reverse: 5'-TAACCTGGTTCATCATCGCTAATC-3', probe: 5' FAM-(CGACCCGCAGTCCCAGCGTC)-BHQ-1 3', and eotaxin-1, forward: 5'-AGAGCTCCACAGCTTCTATT-3', reverse: 5'-CTTACTGGTCATGATAAAGCAGCAG-3', probe: 5' FAM-(ACGGTCACTTCCTTCACCTCCCAGG)-BHQ-1 3', were purchased from Biosearch Technologies (Novato, CA), and the mouse Assay-On-Demand primers and probes Gob-5, Mm00489959_m1, Muc5ac, Mm0276725_g1, and Ccl20 Mm00444228_m1 were purchased from Applied Biosystems (Foster City, CA). Gob-5, eotaxin-1, and Ccl20 levels were normalized to HPRT, and the data are presented as average expression relative to the housekeeping gene.
Statistical analysis.
Data were analyzed by two-way ANOVA, and Bonferroni correction was used for multiple comparisons.
 |
RESULTS
|
|---|
Because elevated ambient levels of NO2 are associated with bronchitic symptoms in asthmatics (32), and recent observations demonstrate that NO2 can be generated endogenously through eosinophil peroxidase or myeloperoxidase catalyzed reactions (4), we sought to characterize the patterns of lung injury and repair following exposure to NO2 in the mouse. Exposure to 5 ppm NO2 for 6 h/day for 1, 3, or 5 days resulted in no remarkable lung inflammation or injury (data not shown). In contrast, exposure to 25 ppm NO2 resulted in acute and reversible lung injury. Indicative of the reversible lung injury induced, mice exposed to 25 ppm NO2 demonstrated increased LDH activity and protein levels in the BALF after 1 or 3 days of NO2 exposure, which largely resolved after 2 additional days of exposure (Fig. 1). Interestingly, increased protein in the lavage was detected before LDH levels were elevated, suggesting that protein leak, possibly via plasma exudation, occurred before lung cellular damage.

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 1. Assessment of the injury markers lactate dehydrogenase (LDH; A) and protein (B) in bronchoalveolar lavage from C57BL/6 mice exposed to air or NO2. Mice were exposed to 25 ppm for 6 h/day for 1, 3, or 5 days. In addition, 1 group of animals was maintained for 20 days postcessation of the 5-day exposure period. Data are means ± SE of 5 mice/group. **P < 0.01 for NO2 vs. air.
|
|
We next examined the lung tissues of NO2-exposed mice by histopathology (Fig. 2). Lung sections harvested from mice after 1 day of exposure to 25 ppm NO2 showed rare foci of periterminal bronchiole inflammatory cells composed predominantly of neutrophils with rare mononuclear cells and reactive pneumocytes within small airways. After 3 days of exposure, diffuse alterations involving primarily the terminal bronchioles were apparent and consisted of increased numbers of periterminal bronchiole macrophages, with intermixed neutrophils, lymphocytes, and plasma cells, and markedly reactive pneumocytes lining alveoli and sloughed into alveolar spaces. The terminal bronchioles displayed respiratory epithelial cell injury characterized by flattening and focal loss of cilia with focal squamous metaplasia and hyperplastic changes extending into the first order of respiratory bronchioles. Collectively, these changes involved >75% of the terminal bronchioles. Additional assessment of the terminal bronchioles from mice exposed to 25 ppm NO2 for 3 days by transmission electron microscopy confirmed hypertrophy and hyperplasia of type II cells, peribronchiolar hyperplasia, influx of macrophages and neutrophils, and occasional apoptotic bodies, compared with sections from control mice (Fig. 3). Consistent with these inflammatory changes, elevated numbers of macrophages and neutrophils were observed in the BALF of mice exposed to 25 ppm NO2 for 3 days (Fig. 4).

View larger version (85K):
[in this window]
[in a new window]
|
Fig. 2. Assessment of lung histopathology from mice exposed to 25 ppm NO2 for 6 h/day for 1, 3, or 5 days. In addition, 1 group of 25 ppm NO2-exposed animals was kept 20 days postcessation of the 5-day exposure period. Control mice (air) were exposed to high-efficiency particulate air-filtered room air for 6 h/day for 5 days. Lung sections were stained with hematoxylin and eosin. Original magnification, x200. Data are representative of 5 mice/group.
|
|

View larger version (117K):
[in this window]
[in a new window]
|
Fig. 3. Transmission electron micrographs of mouse lungs exposed to 25 ppm NO2 for 6 h/day for 3 days or to air alone. Lung sections were prepared as described in MATERIALS AND METHODS. al, alveoli; br, bronchiolar epithelial cell; arrows, site of peribronchiolar hyperplasia and cytosolic alterations. Magnification, x2,000 (air) and x1,200 (NO2). Data are representative of 3 mice/group.
|
|

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 4. Assessment of cells recovered by bronchoalveolar lavage from mice exposed to air or 25 ppm NO2 for 6 h/day for 3 days. Data are means ± SE of 5 mice/group. **P < 0.01 for NO2 vs. air.
|
|
In parallel with the resolution of injury markers in the bronchoalveolar lavage (Fig. 1), lungs harvested from mice after 5 days of exposure to 25 ppm NO2 displayed a dampened inflammatory infiltrate within terminal bronchioles (Fig. 2), consisting mainly of macrophages. After 20 days of recovery in room air following 5 days of exposure to 25 ppm NO2, the lung sections showed a near complete resolution of these changes (Fig. 2), demonstrating that this exposure regimen in the mouse causes a pattern of acute lung injury that resolves.
After having established that exposure to 25 ppm NO2 is itself sufficient to induce lung inflammation and injury, whereas 5 ppm NO2 is not, we next addressed what the consequences of exposure to these NO2 doses are to mice with preexisting allergic airway inflammation. Mice were either sensitized via intraperitoneal injection with the antigen OVA plus the adjuvant aluminum hydroxide or mock sensitized with adjuvant alone (Alum) and then challenged with aerosolized OVA for 30 min/day for 3 days. This protocol induces airway inflammation and hyperresponsiveness with many of the cardinal features of asthma (38, 39). Forty-eight hours after the last aerosolized OVA challenge, mice were exposed to air, 5 ppm NO2, or 25 ppm NO2 for 6 h/day for 3 days and analyzed the following day. Alternatively, 48 h after the last aerosolized OVA challenge, mice were exposed to air, 5 ppm NO2, or 25 ppm NO2 for 6 h/day for 5 days and analyzed after a 20-day recovery period in room air. Whereas exposure to 25 ppm NO2 alone led to an accumulation of macrophages and neutrophils in the BALF (Fig. 4), the BALF of mice exposed to the OVA sensitization and challenge regimen (OVA/OVA) demonstrated a predominance of inflammatory eosinophils in addition to resident alveolar macrophages (Fig. 5, A and B). In mice that were subjected to OVA/OVA, before exposure to 3 days of 5 ppm NO2, no changes in the inflammatory response were observed relative to the OVA/OVA group exposed to room air (Fig. 5A). In contrast, mice subjected to OVA/OVA before exposure to 3 days of 25 ppm NO2 demonstrated a markedly elevated inflammatory response, reflected by increased numbers of neutrophils and eosinophils in the bronchoalveolar lavage. In fact, the number of eosinophils recovered in these mice was nearly 10-fold the number recovered in the bronchoalveolar lavage from OVA/OVA mice that were exposed to air and analyzed at the same time point, reflecting a larger than additive effect (Fig. 5B). Histological examination of the lungs confirmed the enhanced response in mice exposed to the combined OVA/OVA and 3 days 25 ppm NO2 exposure regimens, over individual exposures (Fig. 5C). Although 25 ppm NO2 itself was capable of inducing distal bronchiolar inflammatory lesions, described above, and the mice subjected to OVA/OVA regimen showed perivascular and peribronchiolar inflammation, the lungs from OVA/OVA plus 25 ppm NO2- exposed mice showed a greater magnitude of the distal bronchiolar inflammatory lesions, which were composed primarily of eosinophils and lymphocytes and appeared to involve coalescing of alveoli into the inflammatory lesions as well (Fig. 5C). Lungs from mice exposed to 5 ppm NO2 demonstrated no histological changes relative to the air-exposed controls or to the OVA/OVA groups (data not shown). These results demonstrate that exposure to 25 ppm NO2 exacerbates the inflammatory response elicited by OVA/OVA.

View larger version (72K):
[in this window]
[in a new window]
|
Fig. 5. Assessment of the inflammatory response in mice subjected to individual or combined ovalbumin (OVA)/OVA and NO2 exposure regimens. Mice were either mock sensitized or OVA sensitized followed by challenge with OVA (Alum/OVA and OVA/OVA, respectively) on 3 sequential days (see MATERIALS AND METHODS). Forty-eight hours after the last OVA challenge, mice were either exposed to air or 5 or 25 ppm NO2 for 6 h/day for 3 days. A: assessment of the inflammatory response via analysis of bronchoalveolar lavage fluid (BALF) from mice exposed to air or 5 ppm NO2. Data are means ± SE of 56 mice/group. B: assessment of the inflammatory response via analysis of BALF from mice exposed to air or 25 ppm NO2. Data are means ± SE of 56 mice/group and are representative of studies performed 3 times. C: assessment of lung histopathology from mice exposed to air or 25 ppm NO2 by staining of lung sections with hematoxylin and eosin. Original magnification, x200. Data are representative of 56 mice/group of studies performed 3 times. D and E: assessment of mRNA expression of Gob-5, Muc5AC, CCL20, and eotaxin-1 in lung tissues from mice exposed to air or 25 ppm NO2. Lungs were harvested immediately after cessation of the 3-day NO2 exposure regimen (left), whereas some mice were allowed to recover for 20 days after cessation of the 5-day NO2 exposure regimen (right). Total lung cDNA was examined by quantitative PCR analysis, and data were normalized to the housekeeping gene, hypoxanthine guanine phosphoribosyltransferase. All data are expressed as the level of expression relative to the group of mice that were mock sensitized, challenged, and exposed to air (Alum/OVA; air) for 3 days. Data are means ± SE of 5 mice/group. *P < 0.05, **P < 0.01 vs. Alum/OVA + air exposure group; * or **over brackets indicate P < 0.05 or P < 0.01 between indicated groups, respectively.
|
|
Evaluation of the mRNA levels of the mucus cell-associated gene products Gob5 (36) and Muc5AC (58), the Th2 and dendritic cell chemokine CCL20 (42), and the eosinophil chemokine eotaxin-1 (53) in lung tissue demonstrates marked increases in mice subjected to OVA/OVA (Fig. 5, D and E). No additional increases were apparent in mice subjected to OVA/OVA plus 25 ppm NO2 exposure for 3 days compared with OVA/OVA exposure alone, despite the marked enhancement of the inflammatory response seen in mice subjected to combined exposures (Fig. 5, B and C). Furthermore, NO2 exposure alone was not sufficient to increase expression of any of these genes.
We next determined whether inflammation was prolonged in mice subjected to the combined OVA/OVA plus NO2 exposure regimens by examining lungs 20 days after recovery from 5 days of 5 or 25 ppm NO2 exposure. Whereas the overt inflammatory lesions were resolved in mice subjected to OVA/OVA or NO2 alone, or the combined exposure groups of OVA/OVA plus 5 ppm NO2 (Fig. 6A) in mice exposed to OVA/OVA plus 25 ppm NO2, residual inflammation was apparent based on the continued presence of neutrophils and eosinophils in the bronchoalveolar lavage (Fig. 6B) as well as the persistently elevated mRNA levels of CCL20 and eotaxin (Fig. 5E). The apparent elevations in bronchoalveolar lavage eosinophils from the OVA/OVA plus 5 ppm NO2 group were due to a single mouse and therefore did not reach statistical significance.

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 6. Assessment of the persistence of the inflammatory response via BALF analysis from antigen-challenged mice that were either mock sensitized (Alum/OVA) or antigen sensitized (OVA/OVA) and subsequently exposed to air, 5 ppm NO2 (A), or 25 ppm NO2 (B) for 5 days and allowed to recover for an additional 20 days. **P < 0.01 for OVA/OVA + NO2 exposure vs. Alum/OVA + air exposure; *over brackets indicates P < 0.05 between indicated groups.
|
|
Finally, we determined respiratory mechanics in the mice using impedance measurements obtained through the forced oscillations technique, as previously described (38). We have reported using this technique that the majority of pulmonary responsiveness to methacholine in the mouse model of allergic airway disease is manifest in parenchymal events, which are assessed as the tissue elastance parameter Hti (38). Whereas 48 h after three challenges airway hyperresponsiveness (AHR) was maximal in mice subjected to OVA/OVA, 3 days later, AHR was still apparent (Fig. 7, A and C). Whereas 5 ppm NO2 exposure did not cause AHR, 25 ppm NO2 exposure alone was sufficient to elicit AHR in the mouse (Fig. 7, A and C). A 25-ppm NO2 exposure did not further elevate OVA/OVA-induced AHR at this acute time point (Fig. 7C). However, 20 days after cessation of individual or combined exposures demonstrated that AHR in mice only exposed to NO2 was resolved, AHR was retained in OVA/OVA plus 25 ppm NO2-exposed mice (Fig. 7D). Mice exposed to OVA plus 5 ppm NO2 demonstrated no long-term alterations in AHR (Fig. 5B). Collectively, these data demonstrate that, in the absence of eosinophilic inflammation, NO2 inhalation is sufficient to acutely induce AHR to methacholine, and in the presence of preexisting allergic airway disease, NO2 exposure augments and prolongs the inflammatory response and causes sustained increases in AHR.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 7. Assessment of airway hyperresponsiveness in antigen-challenged mice that were either mock sensitized (Alum/OVA) or antigen sensitized (OVA/OVA) and exposed to air or 5 ppm NO2 for 6 h/day for 3 days (A), or for 5 days and allowed to recover for an additional 20 days (B), or exposed to air or 25 ppm NO2 for 6 h/day for 3 days (C), or for 5 days and allowed to recover for an additional 20 days (D). Data are means (n = 46/group) of changes in tissue elastance ( Hti) over baseline measurements taken before administration of increasing doses of methacholine. *P < 0.05 vs. Alum/OVA + air exposure, **P < 0.01 for OVA/OVA + NO2 exposure vs. Alum/OVA + air exposure. Stacked * are indicative of the significance of the respective overlapping groups below.
|
|
 |
DISCUSSION
|
|---|
Nitrogen dioxide represents a significant air pollutant for many populations, notably for individuals living in heavily polluted urban settings (32) and those exposed to indoor combustion byproducts generated during heating and cooking (7). In addition, its formation can also be triggered in the lung via peroxidase-catalyzed consumption of nitrite, providing an additional route of exposure (4). Recent studies also suggest that gaseous air pollutants can enhance the effects of allergens (10, 11), providing a putative mechanism whereby this reactive oxidant can exacerbate inflammatory lung disease. A number of various scenarios exist in which exposure to NO2, either from exogenous or endogenous sources, could contribute to the causation or aggravation in inflammatory lung diseases including asthma (2, 4951). A number of fundamental insights have previously been made in rats, including ultrastructural and morphological alterations (6, 13, 14, 47, 48), bronchoalveolar lavage protein, neutrophils (15), and LDH (20), as well as the reversibility of the phenotype (12). However, understanding the events elicited by NO2 exposure in a genetically defined model organism, such as the inbred mouse, are important to further our understanding of the potential of NO2 to cause lung pathophysiology.
Our findings described herein demonstrate that inhalation of 25 ppm NO2 by C57BL/6 mice induces acute damage associated with inflammation and lesions in the alveolar duct region and an influx of macrophages and neutrophils into the lavageable air spaces. In addition, we also demonstrate that this exposure regimen of 25 ppm NO2 augments allergic airway disease, evidenced from the enhanced and prolonged eosinophilic and neutrophilic inflammation, and prolonged AHR. The acute effect of 25 ppm NO2 alone causing AHR could have been due, at least in part, to pulmonary edema. The molecular events responsible for the NO2-induced aggravation of allergic airways disease were initially assessed by measuring eotaxin-1 and CCL20, yet remain to be further elucidated. Evaluation of eotaxin-1 mRNA, a chemokine important in eosinophil chemotaxis that is enhanced during allergic airways disease in the mouse, revealed no synergistic increases in mice subjected to combined antigen plus NO2 exposures, which would have explained the markedly enhanced eosinophilia in the combined exposure groups. However, it is possible that at earlier time points, which were not examined in the present study, mRNA levels for this chemokine might have been elevated in the combined exposure groups. Alternatively, it is also possible that eosinophil chemokine gradients are not enhanced, but that eosinophil retention or survival are enhanced in NO2-exposed mice via other mechanisms. Similarly, evaluation of Gob5, Muc5AC, and CCL20 mRNAs also failed to elucidate clear increases in OVA/OVA plus 25 ppm NO2 exposure groups compared with mice subjected to antigen alone after 3 days of NO2 exposure. In addition, these chemotactic signals are unlikely to cause the sustained inflammation observed in the OVA/OVA plus NO2 group, as they are at or near baseline levels 20 days after exposure, at a time of sustained inflammation and AHR.
Although the precise mechanism of action through which NO2 injures lungs and promotes inflammation remains to be determined, we have recently described in vitro that alveolar type 2 epithelial cells undergo cell death with characteristics of both apoptosis and necrosis following exposure to NO2 (37). RNS, NO2, or ONOO caused death of rat lung epithelial cells that were dividing or migrating, whereas confluent cultures were completely resistant. We also reported that RNS-induced death was induced via the activation of JNK, which occurred in a Fas-dependent manner (46). It will be of great interest to determine whether Fas and JNK activation also play a role in the genesis of NO2-induced acute lung injury and inflammation and whether these molecules are also important in the sustained inflammatory response observed in mice with allergic inflammation exposed to NO2.
The phenotype of JNK-dependent cell death triggered by NO2, which consists of mixed features of apoptosis and necrosis, may be important in the propagation of inflammation, based on recent studies demonstrating that necrotic cell constituents are potent activators of the transcription factor NF-
B (31). NO2-induced damage could result in the release of intracellular components, some of which are known to be sufficient to activate NF-
B in neighboring healthy cells, which in turn could elicit an inflammatory response and perpetuate damage to the lung. A further elucidation of the constituents of the cell debris that is elaborated into the air spaces of NO2-exposed mice, and their mechanism of activation of inflammatory signals, will be essential to address this hypothesis.
Toll-like receptors (TLRs) are a class of receptors that represents potential candidates to transduce NO2-induced necrotic inflammatory signaling, given the recent studies demonstrating that the intracellular protein, heat shock protein 70, induces NF-
B activation and inflammatory cytokine production through TLR2 (31). In addition, many other endogenous molecules may be capable of stimulating responses via TLR stimulation when released from necrotic cells or after their oxidative modification (45), the latter representing a plausible scenario after NO2 exposure. Intriguingly, a critical role for TLR4 in the genesis of acute lung injury by NO2 (21, 29) has emerged, based on observations that C3H/HeJ mice, which contain a mutation in the TLR4 gene that renders it nonfunctional, are particularly resistant to NO2, although at least another candidate gene is likely to be involved. TLR4 signaling has also been implicated in the pulmonary response to ozone exposure (27, 28). However, due to the lack of concordance of mouse strain responsiveness to NO2 and ozone in nine tested strains, the genetic mechanisms controlling susceptibility to lung damage induced by these agents are unlikely to be the same (29). Whether TLRs and downstream intracellular signaling events are indeed important in NO2-induced exacerbation of allergic airway disease remain to be formally tested.
Intriguingly, our present findings are not in complete agreement with recent reports on the effects of NO2 exposure in a mouse model of allergic airways disease, which either describe a lack of effect of NO2 on eosinophilia or a decrease in eosinophilic inflammation. These discrepancies can be explained by differences in the time frame of exposure to NO2 relative to the OVA challenge, the concentration and/or the duration of NO2 inhalation, and the genetic backgrounds of mice investigated. For example, using allergen-sensitized BALB/c mice exposed to 20 ppm NO2 immediately before an intranasal challenge with allergen, Proust et al. (40) reported enhanced AHR and lung permeability 24 h after exposure, despite a lack of alterations in eosinophil numbers in the BALF at 24 or 72 h after challenge and a reduction of late mucosal metaplasia compared with mice sensitized and challenged with allergen (OVA) alone. This group also reported that 5 ppm NO2 caused a reduction in many of the measured features of allergic airway disease (40). Using allergen-sensitized C57BL/6 mice exposed to 0.7 or 5 ppm NO2, Hubbard et al. (22) also demonstrated reductions in eosinophil numbers in the BALF compared with air-exposed mice in response to subsequent challenge with allergen. Using BALB/c mice sensitized and challenged in a manner similar to our methodologies, Hussain et al. (23) reported that exposure to 2 ppm NO2 24 h before allergen challenge induced airway neutrophilia and epithelial damage but did not alter AHR (as assessed by enhanced pause measurements) despite increasing baseline smooth muscle tone. Finally, using Brown Norway rats sensitized and challenged with house dust mite allergen, Gilmour et al. (16) reported that exposure to 5 ppm NO2 for 3 h after both allergen sensitization and challenge induced higher antigen-specific immunoglobulin levels in the circulation, inflammatory cells in the lungs, and lymphocyte responsiveness to antigen. From these different reports, it is apparent that NO2 exposure has distinct effects on pulmonary response to antigen in rodent models.
Although the dose of NO2 administered to our mice was higher than those used in a number of previous studies (16, 22, 23, 40) and are higher than the concentrations seen in ambient air, the actual concentrations of NO2 that reach the lung tissue are likely to be far lower than 25 ppm, given the high reactivity of NO2 toward airway surface lining components. Consequently, the patterns of tyrosine nitration observed within the lung tissue in situ using the current NO2 exposure regimen were not substantially different from air controls (data not shown). Additionally, in the allergic, inflamed lung, NO2 concentrations in the tissue locally could be very high, due to the catalytic activity of eosinophil peroxidase, which can generate up to 5 ppm NO2 (4) using concentrations of its substrates, H2O2 and nitrite, within the physiological range, leading to marked tyrosine nitration (4, 33). Therefore, although the levels of NO2 present in the exposure chamber are higher than NO2 concentrations found in association with air pollution, local concentrations of NO2 generated endogenously during allergic inflammation may effectively be even higher than those in the present study.
It is generally appreciated that oxidative stress accompanies inflammatory diseases of the lung and that the extent of oxidative stress appears to correlate with disease severity. For example, the degree of nitrotyrosine reactivity correlates directly with functional abnormalities in patients with asthma (44). Because NO2 is the ultimate oxidant responsible for tyrosine nitration, these findings suggest a role for NO2 in the pathophysiology of asthma. Indeed, our present study demonstrates that NO2 is sufficient to induce AHR, a hallmark feature of allergic airways disease. More significantly, we demonstrate that NO2 augments and prolongs OVA-induced inflammation and AHR. These findings provide "proof of concept" toward the notion that NO2 is an important mediator that can contribute to the pathological effects seen in the allergic inflamed lung.
 |
GRANTS
|
|---|
This work was funded by National Institutes of Health (NIH) Grant R01-HL-60014, the Vermont Genetics Network through NIH Grant 1-P20-RR-16462 from the Biomedical Research Infrastructure Network (BRIN) program of the National Center for Research Resources (NCRR), and NIH/NCRR Center of Biomedical Research Excellence (CoBRE) P20-RR-15557.
 |
ACKNOWLEDGMENTS
|
|---|
The authors thank Dr. Albert van der Vliet and Dr. Tara Sabo-Atwood for helpful comments and Mieke Bevelander and Ilse de Vrije for technical assistance.
 |
FOOTNOTES
|
|---|
Address for reprint requests and other correspondence: Y. Janssen-Heininger, Dept. of Pathology, Univ. of Vermont, HRSF Bldg., Rm. 216, Burlington, VT 05405 (e-mail: yvonne.janssen{at}uvm.edu)
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
 |
REFERENCES
|
|---|
- Andreadis AA, Hazen SL, Comhair SA, and Erzurum SC. Oxidative and nitrosative events in asthma. Free Radic Biol Med 35: 213225, 2003.[CrossRef][Web of Science][Medline]
- Barck C, Lundahl J, Hallden G, and Bylin G. Brief exposures to NO2 augment the allergic inflammation in asthmatics. Environ Res 97: 5866, 2005.[Medline]
- Bascom R. Health effects of outdoor air pollution. Part 2. Committee of the Environmental and Occupational Health Assembly of the American Thoracic Society. Am J Respir Crit Care Med 153: 477498, 1996.[Abstract]
- Brennan ML, Wu W, Fu X, Shen Z, Song W, Frost H, Vadseth C, Narine L, Lenkiewicz E, Borchers MT, Lusis AJ, Lee JJ, Lee NA, Abu-Soud HM, Ischiropoulos H, and Hazen SL. A tale of two controversies: defining both the role of peroxidases in nitrotyrosine formation in vivo using eosinophil peroxidase and myeloperoxidase-deficient mice, and the nature of peroxidase-generated reactive nitrogen species. J Biol Chem 277: 1741517427, 2002.[Abstract/Free Full Text]
- Byun J, Mueller DM, Fabjan JS, and Heinecke JW. Nitrogen dioxide radical generated by the myeloperoxidase-hydrogen peroxide-nitrite system promotes lipid peroxidation of low density lipoprotein. FEBS Lett 455: 243246, 1999.[CrossRef][Web of Science][Medline]
- Cabral-Anderson LJ, Evans MJ, and Freeman G. Effects of NO2 on the lungs of rats. I. Morphology. Exp Mol Pathol 27: 353365, 1977.[CrossRef][Web of Science][Medline]
- Chauhan AJ, Krishna MT, Frew AJ, and Holgate ST. Exposure to nitrogen dioxide (NO2) and respiratory disease risk. Rev Environ Health 13: 7390, 1998.[Medline]
- Cieslewicz G, Tomkinson A, Adler A, Duez C, Schwarze J, Takeda K, Larson KA, Lee JJ, Irvin CG, and Gelfand EW. The late, but not early, asthmatic response is dependent on IL-5 and correlates with eosinophil infiltration. J Clin Invest 104: 301308, 1999.[Web of Science][Medline]
- Dweik RA, Comhair SA, Gaston B, Thunnissen FB, Farver C, Thomassen MJ, Kavuru M, Hammel J, Abu-Soud HM, and Erzurum SC. NO chemical events in the human airway during the immediate and late antigen-induced asthmatic response. Proc Natl Acad Sci USA 98: 26222627, 2001.[Abstract/Free Full Text]
- Franze T, Weller MG, Niessner R, and Poschl U. Enzyme immunoassays for the investigation of protein nitration by air pollutants. Analyst 128: 824831, 2003.[CrossRef][Medline]
- Franze T, Weller MG, Niessner R, and Poschl U. Protein nitration by polluted air. Environ Sci Technol 39: 16731678, 2005.[Medline]
- Freeman G, Crane SC, and Furiosi NJ. Healing in rat lung after subacute exposure to nitrogen dioxide. Am Rev Respir Dis 100: 662676, 1969.[Web of Science][Medline]
- Freeman G, Crane SC, Stephens RJ, and Furiosi NJ. Pathogenesis of the nitrogen dioxide-induced lesion in the rat lung: a review and presentation of new observations. Am Rev Respir Dis 98: 429443, 1968.[Web of Science][Medline]
- Freeman G, Crane SC, Stephens RJ, and Furiosi NJ. The subacute nitrogen dioxide-induced lesion of the rat lung. Arch Environ Health 18: 609612, 1969.[Web of Science][Medline]
- Gelzleichter TR, Witschi H, and Last JA. Concentration-response relationships of rat lungs to exposure to oxidant air pollutants: a critical test of Habers Law for ozone and nitrogen dioxide. Toxicol Appl Pharmacol 112: 7380, 1992.[CrossRef][Web of Science][Medline]
- Gilmour MI. Interaction of air pollutants and pulmonary allergic responses in experimental animals. Toxicology 105: 335342, 1995.[CrossRef][Web of Science][Medline]
- Goldstein E, Peek NF, Parks NJ, Hines HH, Steffey EP, and Tarkington B. Fate and distribution of inhaled nitrogen dioxide in rhesus monkeys. Am Rev Respir Dis 115: 403412, 1977.[Web of Science][Medline]
- Hantos Z, Daroczy B, Suki B, Nagy S, and Fredberg JJ. Input impedance and peripheral inhomogeneity of dog lungs. J Appl Physiol 72: 168178, 1992.[Abstract/Free Full Text]
- Hedberg K, Hedberg CW, Iber C, White KE, Osterholm MT, Jones DB, Flink JR, and MacDonald KL. An outbreak of nitrogen dioxide-induced respiratory illness among ice hockey players. JAMA 262: 30143017, 1989.[Abstract/Free Full Text]
- Henderson RF, Benson JM, Hahn FF, Hobbs CH, Jones RK, Mauderly JL, McClellan RO, and Pickrell JA. New approaches for the evaluation of pulmonary toxicity: bronchoalveolar lavage fluid analysis. Fundam Appl Toxicol 5: 451458, 1985.[CrossRef][Web of Science][Medline]
- Holroyd KJ, Eleff SM, Zhang LY, Jakab GJ, and Kleeberger SR. Genetic modeling of susceptibility to nitrogen dioxide-induced lung injury in mice. Am J Physiol Lung Cell Mol Physiol 273: L595L602, 1997.[Abstract/Free Full Text]
- Hubbard AK, Symanowicz PT, Thibodeau M, Thrall RS, Schramm CM, Cloutier MM, and Morris JB. Effect of nitrogen dioxide on ovalbumin-induced allergic airway disease in a murine model. J Toxicol Environ Health A 65: 19992005, 2002.[CrossRef][Web of Science][Medline]
- Hussain I, Jain VV, OShaughnessy P, Businga TR, and Kline J. Effect of nitrogen dioxide exposure on allergic asthma in a murine model. Chest 126: 198204, 2004.[Abstract/Free Full Text]
- Ichinose M, Sugiura H, Yamagata S, Koarai A, and Shirato K. Increase in reactive nitrogen species production in chronic obstructive pulmonary disease airways. Am J Respir Crit Care Med 162: 701706, 2000.[Abstract/Free Full Text]
- Jakab GJ. Modulation of pulmonary defense mechanisms by acute exposures to nitrogen dioxide. Environ Res 42: 215228, 1987.[Medline]
- Kaminsky DA, Mitchell J, Carroll N, James A, Soultanakis R, and Janssen Y. Nitrotyrosine formation in the airways and lung parenchyma of patients with asthma. J Allergy Clin Immunol 104: 747754, 1999.[CrossRef][Web of Science][Medline]
- Kleeberger SR, Reddy S, Zhang LY, and Jedlicka AE. Genetic susceptibility to ozone-induced lung hyperpermeability: role of toll-like receptor 4. Am J Respir Cell Mol Biol 22: 620627, 2000.[Abstract/Free Full Text]
- Kleeberger SR, Reddy SP, Zhang LY, Cho HY, and Jedlicka AE. Toll-like receptor 4 mediates ozone-induced murine lung hyperpermeability via inducible nitric oxide synthase. Am J Physiol Lung Cell Mol Physiol 280: L326L333, 2001.[Abstract/Free Full Text]
- Kleeberger SR, Zhang LY, and Jakab GJ. Differential susceptibility to oxidant exposure in inbred strains of mice: nitrogen dioxide versus ozone. Inhal Toxicol 9: 601621, 1997.[CrossRef][Web of Science]
- Krishna MT, Chauhan AJ, Frew AJ, and Holgate ST. Toxicological mechanisms underlying oxidant pollutant-induced airway injury. Rev Environ Health 13: 5971, 1998.[Medline]
- Li M, Carpio DF, Zheng Y, Bruzzo P, Singh V, Ouaaz F, Medzhitov RM, and Beg AA. An essential role of the NF-
B/Toll-like receptor pathway in induction of inflammatory and tissue-repair gene expression by necrotic cells. J Immunol 166: 71287135, 2001.[Abstract/Free Full Text] - McConnell R, Berhane K, Gilliland F, London SJ, Vora H, Avol E, Gauderman WJ, Margolis HG, Lurmann F, Thomas DC, and Peters JM. Air pollution and bronchitic symptoms in Southern California children with asthma. Environ Health Perspect 107: 757760, 1999.[Web of Science][Medline]
- McElhinney B, Poynter ME, Shrivastava P, Hazen SL, and Janssen-Heininger YM. Eosinophil peroxidase catalyzes JNK-mediated membrane blebbing in a Rho kinase-dependent manner. J Leukoc Biol 74: 897907, 2003.[Abstract/Free Full Text]
- Moldeus P. Toxicity induced by nitrogen dioxide in experimental animals and isolated cell systems. Scand J Work Environ Health 19: 2836, 1993.
- Mustafa MG. Health effects and toxicology of ozone and nitrogen dioxide. In: Environmental Oxidants, edited by Nrigau JO and Simmons MS. New York: Wiley & Sons, 1994, p. 351404.
- Nakanishi A, Morita S, Iwashita H, Sagiya Y, Ashida Y, Shirafuji H, Fujisawa Y, Nishimura O, and Fujino M. Role of gob-5 in mucus overproduction and airway hyperresponsiveness in asthma. Proc Natl Acad Sci USA 98: 51755180, 2001.[Abstract/Free Full Text]
- Persinger RL, Blay WM, Heintz NH, Hemenway DR, and Janssen-Heininger YM. Nitrogen dioxide induces death in lung epithelial cells in a density-dependent manner. Am J Respir Cell Mol Biol 24: 18, 2001.[Abstract/Free Full Text]
- Poynter M, Cloots R, van Woerkom T, Butnor K, Vacek P, Taatjes D, Irvin C, and Janssen-Heininger Y. NF-
B activation in airways modulates allergic inflammation but not hyperresponsiveness. J Immunol 173: 70037009, 2004.[Abstract/Free Full Text] - Poynter M, Irvin C, and Janssen-Heininger Y. Rapid activation of nuclear factor-
B in airway epithelium in a murine model of allergic airway inflammation. Am J Pathol 160: 13251334, 2002.[Abstract/Free Full Text] - Proust B, Lacroix G, Robidel F, Marliere M, Lecomte A, and Vargaftig BB. Interference of a short-term exposure to nitrogen dioxide with allergic airways responses to allergenic challenges in BALB/c mice. Mediators Inflamm 11: 251260, 2002.[CrossRef][Web of Science][Medline]
- Pryor WA and Squadrito GL. The chemistry of peroxynitrite: a product from the reaction of nitric oxide with superoxide. Am J Physiol Lung Cell Mol Physiol 268: L699L722, 1995.[Abstract/Free Full Text]
- Reibman J, Hsu Y, Chen LC, Bleck B, and Gordon T. Airway epithelial cells release MIP-3
/CCL20 in response to cytokines and ambient particulate matter. Am J Respir Cell Mol Biol 28: 648654, 2003.[Abstract/Free Full Text] - Saleh D, Barnes PJ, and Giaid A. Increased production of the potent oxidant peroxynitrite in the lungs of patients with idiopathic pulmonary fibrosis. Am J Respir Crit Care Med 155: 17631769, 1997.[Abstract]
- Saleh D, Ernst P, Lim S, Barnes PJ, and Giaid A. Increased formation of the potent oxidant peroxynitrite in the airways of asthmatic patients is associated with induction of nitric oxide synthase: effect of inhaled glucocorticoid. FASEB J 12: 929937, 1998.[Abstract/Free Full Text]
- Seong SY and Matzinger P. Hydrophobicity: an ancient damage-associated molecular pattern that initiates innate immune responses. Nat Rev Immunol 4: 469478, 2004.[CrossRef][Web of Science][Medline]
- Shrivastava P, Pantano C, Watkin R, McElhinney B, Guala A, Poynter ML, Persinger RL, Budd R, and Janssen-Heininger Y. Reactive nitrogen species-induced cell death requires Fas-dependent activation of c-Jun N-terminal kinase. Mol Cell Biol 24: 67636772, 2004.[Abstract/Free Full Text]
- Stephens RJ, Freeman G, and Evans MJ. Early response of lungs to low levels of nitrogen dioxide. Light and electron microscopy. Arch Environ Health 24: 160179, 1972.[Web of Science][Medline]
- Stephens RJ, Freeman G, and Evans MJ. Ultrastructural changes in connective tissue in lungs of rats exposed to NO2. Arch Intern Med 127: 873883, 1971.[Abstract/Free Full Text]
- Strand V, Rak S, Svartengren M, and Bylin G. Nitrogen dioxide exposure enhances asthmatic reaction to inhaled allergen in subjects with asthma. Am J Respir Crit Care Med 155: 881887, 1997.[Abstract]
- Strand V, Svartengren M, Rak S, Barck C, and Bylin G. Repeated exposure to an ambient level of NO2 enhances asthmatic response to a nonsymptomatic allergen dose. Eur Respir J 12: 612, 1998.[Abstract]
- Sunyer J, Basagana X, Belmonte J, and Anto JM. Effect of nitrogen dioxide and ozone on the risk of dying in patients with severe asthma. Thorax 57: 687693, 2002.[Abstract/Free Full Text]
- Takeda K, Hamelmann E, Joetham A, Shultz LD, Larsen GL, Irvin CG, and Gelfand EW. Development of eosinophilic airway inflammation and airway hyperresponsiveness in mast cell-deficient mice. J Exp Med 186: 449454, 1997.[Abstract/Free Full Text]
- Teixeira MM, Wells TN, Lukacs NW, Proudfoot AE, Kunkel SL, Williams TJ, and Hellewell PG. Chemokine-induced eosinophil recruitment. Evidence of a role for endogenous eotaxin in an in vivo allergy model in mouse skin. J Clin Invest 100: 16571666, 1997.[Web of Science][Medline]
- Tomioka S, Bates JH, and Irvin CG. Airway and tissue mechanics in a murine model of asthma: alveolar capsule vs. forced oscillations. J Appl Physiol 93: 263270, 2002.[Abstract/Free Full Text]
- Van der Vliet A, Eiserich JP, Shigenaga MK, and Cross CE. Reactive nitrogen species and tyrosine nitration in the respiratory tract: epiphenomena or a pathobiologic mechanism of disease? Am J Respir Crit Care Med 160: 19, 1999.[Free Full Text]
- Van Der Vliet A, Nguyen MN, Shigenaga MK, Eiserich JP, Marelich GP, and Cross CE. Myeloperoxidase and protein oxidation in cystic fibrosis. Am J Physiol Lung Cell Mol Physiol 279: L537L546, 2000.[Abstract/Free Full Text]
- Wu W, Chen Y, and Hazen SL. Eosinophil peroxidase nitrates protein tyrosyl residues. Implications for oxidative damage by nitrating intermediates in eosinophilic inflammatory disorders. J Biol Chem 274: 2593325944, 1999.[Abstract/Free Full Text]
- Zuhdi Alimam M, Piazza FM, Selby DM, Letwin N, Huang L, and Rose MC. Muc-5/5ac mucin messenger RNA and protein expression is a marker of goblet cell metaplasia in murine airways. Am J Respir Cell Mol Biol 22: 253260, 2000.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
S. W. Aesif, V. Anathy, M. Havermans, A. S. Guala, K. Ckless, D. J. Taatjes, and Y. M.W. Janssen-Heininger
In Situ Analysis of Protein S-Glutathionylation in Lung Tissue Using Glutaredoxin-1-Catalyzed Cysteine Derivatization
Am. J. Pathol.,
July 1, 2009;
175(1):
36 - 45.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2006 by the American Physiological Society.