AJP - Lung Journal of Applied Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 290: L307-L316, 2006. First published September 16, 2005; doi:10.1152/ajplung.00102.2005
1040-0605/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
290/2/L307    most recent
00102.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (7)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Portnoy, J.
Right arrow Articles by Mason, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Portnoy, J.
Right arrow Articles by Mason, R. J.

Alveolar type II cells inhibit fibroblast proliferation: role of IL-1{alpha}

Joshua Portnoy,1,4 Tianli Pan,1 Charles A. Dinarello,4 John M. Shannon,3 Jay Y. Westcott,1 Lening Zhang,2 and Robert J. Mason1,4

1Department of Medicine and 2Division of Biostatistics, National Jewish Medical and Research Center, Denver, Colorado; 3Pulmonary Cell Biology, Cincinnati Children's Hospital Medical Center, Cincinnati, Ohio; and 4Department of Medicine, University of Colorado Health Sciences Center, Denver, Colorado

Submitted 4 March 2005 ; accepted in final form 13 September 2005


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Alveolar type II (ATII) cells inhibit fibroblast proliferation in coculture by releasing or secreting a factor(s) that stimulates fibroblast production of prostaglandin E2 (PGE2). In the present study, we sought to determine the factors released from ATII cells that stimulate PGE2 production in fibroblasts. Exogenous addition of rat IL-1{alpha} to cultured lung fibroblasts induced PGE2 secretion in a dose-response manner. When fibroblasts were cocultured with rat ATII cells, IL-1{alpha} protein was detectable in ATII cells and in the coculture medium between days 8 and 12 of culture, correlating with the highest levels of PGE2. Furthermore, under coculture conditions, IL-1{alpha} gene expression increased in ATII cells (but not fibroblasts) compared with either cell cultured alone. In both mixed species (human fibroblasts-rat ATII cells) and same species cocultures (rat fibroblasts and ATII cells), PGE2 secretion was inhibited by the presence of IL-1 receptor antagonist (IL-1Ra) or selective neutralizing antibody directed against rat IL-1{alpha} (but not IL-1{beta}). Conditioned media from cocultures inhibited fibroblast proliferation, and this effect was abrogated by the addition of IL-1Ra. Addition of keratinocyte growth factor (KGF) resulted in an earlier increase in PGE2 secretion and fibroblast inhibition (day 8 of coculture). This effect was inhibited by indomethacin but was not altered by IL-1Ra. We conclude that in this coculture system, IL-1{alpha} secretion by ATII cells is one factor that stimulates PGE2 production by lung fibroblasts, thereby inhibiting fibroblast proliferation. In addition, these studies demonstrate that KGF enhances ATII cell PGE2 production through an IL-1{alpha}-independent pathway.

interleukin-1{beta}; interleukin-1{alpha}; keratinocyte growth factor; prostaglandin E2; cyclooxygenase-2


IT HAS LONG BEEN RECOGNIZED that a reciprocal interaction exists in the control of epithelial cell and fibroblast growth. In the normal lung, epithelial cells are thought to exert an inhibitory effect on fibroblasts, whereas fibroblasts can stimulate epithelial cell proliferation and differentiation. Lung injury disturbs this dynamic interaction, and injured alveolar epithelium loses both its capacity to proliferate and its ability to inhibit fibroblast proliferation (2). In fact, idiopathic pulmonary fibrosis (IPF) is thought to emanate from epithelial microinjury triggering dysregulated epithelial cell-fibroblast interactions in the absence of significant inflammation (42, 52).

The factors regulating the interaction between alveolar type II (ATII) cells and fibroblasts, however, are only partially understood. Young and Adamson (52) observed that secreted products of epithelial cells inhibit fibroblast growth in epithelial cell-fibroblast cocultures. Prostaglandin E2 (PGE2), a lipid mediator derived from cell membrane phospholipids, has since been identified as a critical inhibitor of fibroblast proliferation (15, 26), chemotaxis (27), and collagen production (16, 23, 26). Fibroblasts from fibrotic lungs synthesize less PGE2 both basally and in response to either interleukin (IL)-1{alpha} or transforming growth factor (TGF)-{beta}1 (25, 33, 49). Previous work in our laboratory (35) showed that alveolar epithelial inhibition of fibroblast proliferation involves the autocrine production of PGE2 by fibroblasts. PGE2 secretion was further enhanced by keratinocyte growth factor (KGF) and inhibited with indomethacin in these cocultures (35). However, the factors secreted by ATII cells that stimulate fibroblast secretion of PGE2 were not defined.

IL-1 has emerged as an important inducer of PGE2. IL-1 is a proinflammatory cytokine whose gene family consists of two major agonistic molecules, namely, IL-1-{alpha} and IL-1{beta}, and one antagonistic cytokine, the IL-1 receptor antagonist (IL-1Ra). All three IL-1 isoforms are encoded by different genes but bind to the same IL-1 receptor with different affinities (IL-1Ra > IL-1{alpha} > IL-1{beta}). Both IL-1{alpha} and IL-1{beta} possess similar cellular functions but signal in different subcellular compartments (45). IL-1{beta} demonstrates biological activity in its secreted form (17.5 kDa) but remains inactive in its precursor form. In contrast, IL-1{alpha} is mainly active as an intracellular precursor (31 kDa) or as a membrane-associated form (23 kDa). The active form of IL-1{alpha} (17.5 kDa) is not commonly secreted but may be released from dying cells or by proteolysis after calpain-mediated cleavage (46).

Sato et al. (41) demonstrated that IL-1{alpha} in conditioned medium of skin keratinocytes stimulated PGE2 production predominantly by dermal fibroblasts in keratinocyte-fibroblast cocultures. IL-1{alpha} secretion has not been reported previously in ATII cells. The present study was designed to identify the soluble factors released by ATII cells that modulate fibroblast production of PGE2. Specifically, we aimed to identify the effects of IL-1{alpha} and IL-1{beta} in epithelial fibroblast cocultures as it pertains to the regulation of PGE2 and fibroblast proliferation. Furthermore, we aimed to study whether KGF enhances PGE2 production in epithelial cell-fibroblast cocultures through IL-1{alpha}- or IL-1{beta}-dependent pathways. These studies indicate that fibroblast production of PGE2 is induced by ATII cell release of IL-1{alpha} in ATII-fibroblast (ATII-FB) cocultures. In contrast, KGF stimulates PGE2 production through an IL-1{alpha}-independent pathway in this coculture system.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Reagents

Recombinant rat IL-1{alpha} and rat IL-1{beta}, recombinant human IL-1{beta}, recombinant human KGF, anti-rat IL-1{alpha}, anti-rat IL-1{beta}, and recombinant TGF-{beta}1 were purchased from R&D Systems (Minneapolis, MN). IL-1Ra was provided by C. A. Dinarello. Indomethacin was purchased from Sigma Chemical (St. Louis, MO). Rat IL-1{alpha} and rat IL-1{beta} were used at concentrations of 0.01–10 ng/ml. Anti-IL-1{alpha} and anti-IL-1{beta} neutralizing antibodies were used at concentrations of 3 µg/ml, whereas IL-1Ra was used at a concentration of 10 µg/ml. KGF was obtained from R&D Systems.

Adult Rat ATII Cell Isolation and Culture

Rat ATII cells were isolated from lungs of 200-g adult male Sprague-Dawley rats (Bantin-Kingman, Fremont, CA) by tissue dissociation with porcine pancreatic elastase (Worthington Biochemicals, Freehold, NJ) followed by centrifugation over a discontinuous metrizamide gradient, as previously described (12). Cells were suspended in Dulbecco's modified Eagle's medium (DMEM; GIBCO-BRL, Grand Island, NY) supplemented with 10% fetal bovine serum (FBS; Irvine Scientific, Santa Ana, CA), 2 mM glutamine, 100 U/ml penicillin G, 100 µg/ml streptomycin, 2.5 µg/ml amphotericin B, and 10 µg/ml gentamicin (Sigma Chemical). The cells were plated at a density of 5 x 105 cells/cm2 per well onto six-well tissue culture plates (Costar, Cambridge, MA) that were coated with 1 ml of Matrigel (BD Biosciences, Bedford, MA) (44).

Adult Human Lung Fibroblasts

Adult human lung fibroblasts (HLF; no. AG02262) were obtained from the National Institute of Aging, Cell and Culture Repository, Coriell Institute for Medical Research (Camden, NJ). These fibroblasts have previously been shown to secrete at least two growth factors for rat ATII cells, namely, KGF and hepatocyte growth factor (HGF) (36). The cells were obtained at population doubling two. Cells from passage 4 or 5 were used in all experiments. The cells were grown in DMEM supplemented with 10% FBS.

Adult Rat Lung Fibroblasts

Rat adult lung fibroblasts were prepared by explanting minced rat adult lungs from 200-g adult male Sprague-Dawley rats into 100-mm tissue culture dishes. The medium consisted of DMEM supplemented with 10% FBS, 2 mM glutamine, 100 U/ml penicillin G, 100 µg/ml streptomycin, 2.5 µg/ml amphotericin B, and 10 µg/ml gentamicin. After ~3 days, fibroblasts grew out from the edge of the explant, the medium and remaining explant tissue fragments were removed, and the adherent cells were grown to 50% confluence. The fibroblasts were then passaged and grown to near confluence. These cells (passage 2) were used for all experiments.

Preparation of Fibroblast Type II Cell Cocultures

Adult rat ATII cells were isolated and plated on 1 ml of Matrigel per well in six-well plates as described. The day of ATII cell plating was considered day –1 of culture. Twenty-four hours later (day 0 of coculture), adult lung fibroblasts were mixed with rat-tail collagen at a density of 3.3 x 105 cells/ml collagen (44). Three hundred microliters of the fibroblast-collagen mixture was spread on a 25-mm polycarbonate filter (Corning, Cambridge, MA) and gelled at 37°C for 15 min in an incubator containing no supplemental CO2. The collagen gel remained attached to the polycarbonate filter for the remainder of the experiment. The medium in the type II cell cultures was changed to remove nonadherent cells and debris. The fibroblast rafts were then transferred into the well and floated above the ATII cells bound to Matrigel. No epithelial cell-fibroblast cell contact occurred in the cocultures. Culture purity was assessed in our original studies by using immunocytochemistry to identify any contaminating cell types (35). MAB-1435 was used to detect macrophages and dendritic cells, and vimentin was used to detect macrophages and fibroblasts (35). The use of differing species of ATII cells and fibroblasts in cocultures (rat ATII and human lung fibroblasts) allowed us to distinguish the secretion of epithelial cell IL-1{alpha} and IL-1{beta} from that of fibroblast IL-1{alpha} and IL-1{beta}, and to duplicate the conditions of our original experiments on epithelial cell-fibroblast interactions (35). Parallel experiments using both rat adult lung fibroblasts and rat ATII cells in coculture were performed to confirm the effects of IL-1 on PGE2 and fibroblast proliferation in cocultures of the same species. The ATII cells were cocultured with the fibroblast rafts for a total of 12 days. Our group (35) has previously shown that the ATII cell phenotype was maintained, as evidenced by the maintenance of the mRNAs of surfactant proteins A, B, C, and D. Culture medium was changed every 4 days after initiation of coculture.

Preparation of RNA

Fibroblasts embedded in collagen gel and ATII cell aggregates cultured on Matrigel were directly lysed into 4 M guanidinium isothiocyanate (GITC), 0.5% N-laurylsarcosine, and 0.1 M {beta}-mercaptoethanol in 25 mM sodium citrate buffer (GITC). Total cellular RNA was isolated by ultracentrifugation for 18 h at 150,000 g through a 5.7 M CsCl cushion as previously described (43). Isolated RNA samples were treated with 4 units of RNase-free DNase I (Promega, Madison, WI) for 30 min at 37°C to remove any genomic DNA contamination.

Real-Time PCR

Total RNA (2 µg) was used to synthesize cDNA with the TaqMan reverse transcription reagent kit (Applied Biosystems, Branchburg, NJ) in a final volume of 100 µl, according to the manufacturer's instructions. Random hexamers were used as primers in the reverse transcription reaction. Preparations were incubated at 25°C for 10 min, at 48°C for 30 min, and then at 95°C for 5 min and were then stored at –20°C until ready for use. The cDNA was diluted 1:100 with water, and 20 µl of the diluted cDNA were amplified in 50 µl of PCR mix (PE Biosystems, Branchburg, NJ).

Primers and probes for real-time PCR for rat IL-1{alpha}, rat IL-1{beta}, human IL-1{alpha}, human IL-1{beta}, and human cyclooxygenase (COX)-2 were designed using Primers Express 1.5a software (Applied Biosystems). cDNA of accession numbers E05489 (rat IL-1{alpha}), E05490 (rat IL-1{beta}), M15329 (human IL-1{alpha}), M15330 (human IL-1{beta}), S67722 (rat COX-2), and M90100 (human COX-2) were selected from GenBank (National Heart, Lung, and Blood Institute) and used as cDNA templates for primer and probe design. For rat IL-1{alpha}, the sequences AGGGCACAGAGGGAGTCAACT and TCAGGAACTTTGGCCATCTTG were selected for the forward and reverse primers, respectively; the intervening sequence TTTCTTTGCCGACTCAAGCGCCAAT was used for the probe. For rat IL-1{beta}, the sequences GATGGCTGCACTATTCCTAATGC and AGACTGCCCATTCTCGACAAG were used for forward and reverse primers, respectively. The intervening sequence CCCCAGGACATGCTAGGGAGCCC was used in constructing the IL-1{beta} probe. For human IL-1{alpha}, the sequences AGGCTGCATGGATCAATCTGT and CTACCACCATGCTCTCCTTGAAG were used for forward and reverse primers, respectively; the intervening sequence TCTCTGAGTATCTCTGAAACCTCTAAAACATCCAAGCT was used for the probe. For human IL-1{beta}, the sequences GCACGATGCACCTGTACGAT and AGACATCACCAAGCTTTTTTGCT were used for forward and reverse primers, respectively; the intervening sequence ACTGAACTGCACGCTCCGGGACTC was used for the probe. For human COX-2, sequences TGAAGCCAATTCAGTAGGTGCAT and ATGGCTAAAAGAAGAAAAGAAAAGGA were used for forward and reverse primers, respectively. The intervening sequence AATCAAGCCTGGCTACCTGCATGCTG was used in constructing the COX-2 probe. FAM fluorescent dye was used as a reporter for IL-1{alpha}, IL-1{beta}, and COX-2 gene expression, whereas VIC was used as a reporter for GAPDH.

Samples were run in triplicate. Each 50-µl PCR reaction contained 20 µl of the relevant cDNA, 100 nM of each primer, 200 nM of probe, 200 µM of each dATP, dCTP, and dGTP, 400 µM of dUTP, 0.5 unit of AmpErase UNG, 0.25 unit of AmpliTaq polymerase, 5.5 mM MgCl2, and 1x TaqMan buffer A. The thermal cycling program consisted of 50°C for 2 min (UNG digestion), 95°C for 10 min (AmpliTaq polymerase activation), 40 cycles of 95°C for 15 s (denaturation), and finally, 60°C for 1 min (annealing/extending). The reactions were quantitated by selecting the amplification cycle when the PCR product of interest was first detected [the threshold cycle, CT (1)]. Data were analyzed with the comparative CT method by using arithmetic formulas for relative quantitation. The relative amount of target, normalized to an endogenous reference (rodent GAPDH rRNA) and compared with the unstimulated state as a calibrator, is expressed as 2{Delta}{Delta}Ct [{Delta}{Delta}CT ={Delta}CT,q{Delta}CT,cb, where {Delta}CT,q is the sample of interest and {Delta}CT,cb is the unstimulated sample (calibrator) normalized to the endogenous GAPDH reference].

Cell Counts

Collagen gels were digested with 1 ml of collagenase I (1 mg/ml) diluted in DMEM containing 1% FBS at 37°C for 1 h. The cell suspension was collected and centrifuged at 1,500 rpm for 10 min. The cell pellet was treated with trypsin and EDTA for 15 min to produce single cells. The enzymatic reaction was then stopped by adding DMEM containing 10% FBS. Total fibroblast cell number was determined with a hemacytometer as previously described (35).

Immunoassays

PGE2 assay. PGE2 was quantified via an enzyme immunoassay using acetyl cholinesterase-conjugated tracers as previously described (40, 48). Reagents for this assay were purchased from Cayman Chemical (Ann Arbor, MI), and the samples were quantified without purification following the manufacturer's instructions.

Rat IL-1{alpha} and IL-1{beta} assays. The rat IL-1{alpha} ELISAs were performed using ELISA Tech (Aurora, CO), utilizing antibodies and standards purchased from R&D Systems. The rat IL-1{beta} ELISA kit was purchased from R&D Systems and used as described in the instructions. Under the recommended conditions for rat IL-1{alpha} direct ELISA assay, no cross-reactivity with human IL-1{alpha} was observed. Less than 0.5% cross-reactivity with recombinant human IL-1{beta} is reported in the rat IL-1{beta} ELISA kit as stated by R&D Systems.

TGF-{beta}1 assay. TGF-{beta}1 was assayed using reagents from ELISA Tech (Denver, CO). Samples were quantified after activation with acid and subsequent neutralization of pH. This assay detects activated TGF-{beta}1 of a wide variety of species but does not recognize TGF-{beta}2 or TGF-{beta}3.

Data analysis

The SAS statistical analysis package (version 8.2) was used for all analyses. Pearson's correlation coefficient was obtained when we accessed the association between IL-1{alpha} and PGE2. An ANOVA model was used to compare different experimental conditions. Different conditions were allowed to have their own variances when a significant difference was detected among conditions. Multiple comparisons were adjusted for with Dunnett's test (several conditions compared with a single control) or a false discovery rate procedure (other multiple comparisons on the same data set). Statistical significance was claimed when the P value for a test result was 0.05 or less.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Lung Fibroblasts Produce PGE2 in Response to Rat IL-1{alpha}

Several studies have established that PGE2 production increases in epithelial cell-fibroblast cocultures (4, 32, 35). We have previously demonstrated that fibroblasts constitute the predominant source of PGE2 in these ATII-FB cocultures (35). To study the effect of IL-1{alpha} or IL-1{beta} on fibroblast PGE2 production in this system, we embedded HLF in collagen and cultured them in DMEM containing 10% FBS. Culture medium was changed every 2 days. Rat IL-1{alpha} or rat IL-1{beta} was added at different concentrations between days 10 and 12 of culture. The medium was harvested on day 12, and PGE2 was measured. Analysis of the data using Pearson's correlation coefficient showed that rat IL-1{alpha} stimulated PGE2 production by HLF in a dose-dependent fashion (r = 0.484, P < 0.004) (Fig. 1). HLF PGE2 secretion was not induced by rat IL-1{beta}. These human fibroblasts, however, did secrete PGE2 in response to human IL-1{beta} (data not shown).



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 1. Human lung fibroblasts (HLF) produce prostaglandin E2 (PGE2) in response to interleukin (IL)-1{alpha}. Rat IL-1{alpha} or IL-1{beta} was added at various concentrations to HLF on day 10 of culture. The culture medium was harvested after 48 h, and PGE2 was measured by ELISA. Rat IL-1{alpha} stimulated PGE2 production by HLF in a dose-dependent manner (*P < 0.004). However, fibroblast PGE2 secretion was not affected by rat IL-1{beta}. Data are expressed as means ± SE and are the results of 4 independent experiments.

 
Inhibition of Rat IL-1{alpha} Blocks PGE2 Production

After establishing that rat IL-1{alpha} protein stimulated HLF production of PGE2 (Fig. 1), we next studied whether inhibition of IL-1 would block PGE2 secretion in the ATII-FB cocultures. Rat ATII cells were isolated and seeded on Matrigel at a density of 5 x 106 cells/well on day –1 of culture. On day 0 of culture, a fibroblast raft was added to each well and cocultured with the ATII cells. Culture medium was changed every 4 days. IL-1Ra (10 ng/ml) was added on days 8–12 of culture. The conditioned medium (CM) was harvested on day 12 for PGE2 assay. IL-1Ra (an inhibitor of both IL-1{alpha} and IL-1{beta}) significantly reduced PGE2 production in the cocultures (mean PGE2 decreased from 1.3 to 0.5 ng/ml, n = 3) (Fig. 2A). To verify that the IL-1{alpha} was in fact released into the coculture medium, CM harvested from ATII-FB cocultures (days 8–12) was added to fibroblasts embedded in collagen gels. The CM was diluted 1:1 with fresh DMEM containing 10% FBS and tested on separate fibroblasts that had been grown for 6 days. Fibroblast number in cultures treated with CM was determined on day 11. In the presence of CM, fibroblast proliferation was inhibited. This effect, however, was abrogated by the addition of IL-1Ra, which acts solely by blocking IL-1, but not by the placebo (n = 2, Fig. 2D).



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 2. IL-1 receptor antagonist (IL-1Ra) and IL-1{alpha} neutralizing antibody decrease PGE2 production in cocultures of rat alveolar type II (ATII) cells and HLF. A: ATII cells were cocultured with HLF (FB-ATII). IL-1Ra was added to the cocultures between days 8 and 12 at a concentration of 10 µg/ml. The medium was harvested on day 12, and PGE2 was measured using ELISA. IL-1Ra inhibited PGE2 levels in these cocultures by 60% (*different from fibroblasts alone, P < 0.05; **P < 0.007). Data are expressed as means ± SE and are the results of 3 independent experiments. Fb, fibroblasts; TII, type II cells. B: IL-1{alpha} selective neutralizing antibody (IL-1{alpha} NA), IL-1{beta} NA, or control IgG was administered to ATII-fibroblast (FB) cocultures on days 0, 4, and 8 of coculture. Fibroblasts were harvested from conditioned media (CM) and counted on day 12 of coculture. IL-1{alpha} NA significantly inhibited PGE2 secretion at all time points measured (days 4, 8, and 12 of coculture) compared with the IgG control condition (*P < 0.0004). In contrast, administration of IL-1{beta} NA had no significant effect on PGE2 secretion in these cocultures. Data are expressed as means ± SE and are the results of 4 independent experiments. C: addition of IL-1{alpha} NA at a concentration of 3 µg/ml in these cocultures stimulated fibroblast proliferation correlating with PGE2 levels (*P < 0.006). Data are expressed as mean (±SE) fibroblast number normalized to IgG control and are the results of 4 independent experiments. D: CM derived from FB-ATII cocultures (days 8–12) inhibited proliferation of fibroblasts that had been grown for 6 days in DMEM containing 10% FBS (D10FBS). This effect was abrogated by the addition of IL-1Ra (10 µg/ml). Data are expressed as means and are the results of 2 independent experiments.

 
To determine whether PGE2 inhibition by IL-1Ra was related to inhibition of IL-1{alpha} or IL-1{beta}, we repeated the IL-1Ra experiments outlined above using selective neutralizing antibodies to either rat IL-1{alpha} or IL-1{beta} (at a concentration of 3 µg/ml). These experiments were performed using a mixed species coculture (rat ATII with HLF) to isolate the respective cell types and define the source of IL-1{alpha} and IL-1{beta} (ATII vs. FB) in our system. The anti-rat IL-1{alpha} antibody used is associated with a 15% cross-reactivity with human IL-1{alpha} but does not cross-react with rat or human IL-1{beta}. The anti-rat IL-1{beta} antibody used does not neutralize the biological activity of human IL-1{beta}, human IL-1{alpha}, or rat IL-1{alpha}. Wells containing IgG (3 µg/ml) were used as the control condition. These antibodies (IgG, IL-1{alpha} neutralizing antibodies, or IL-1{beta} neutralizing antibodies) were added to cocultures on day 0 of culture and with each subsequent medium change. Culture medium was changed every 4 days, and PGE2 levels were measured using ELISA. Fibroblasts were harvested and counted on day 12 as described above. As shown in Fig. 2B, neutralizing antibody to rat IL-1{alpha} (but not IL-1{beta}) significantly inhibited PGE2 secretion measured on days 4, 8, and 12 in ATII-FB cocultures. The antibody to IL-1{alpha} also resulted in an increase in fibroblast number (Fig. 2C). A 50% increase in fibroblast proliferation was seen in cocultures exposed to neutralizing antibody directed against rat IL-1{alpha} (but not IL-1{beta}) (Fig. 2C). We next confirmed these results in same-species (rat-rat) cocultures by coculturing rat ATII cells with rat lung fibroblasts (Fig. 3). PGE2 levels inversely correlated with fibroblast number measurements on day 12 of coculture (Fig. 3, A and B). A 50–70% reduction in PGE2 was measured in cocultures exposed to neutralizing antibody directed against rat IL-1{alpha} (but not IL-1{beta}) (Fig. 3C).



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 3. IL-1{alpha} NA decreases PGE2 production in cocultures of rat ATII cells and rat lung fibroblasts. A and B: rat ATII cells were cocultured with rat adult lung fibroblasts. CM was harvested every 4 days, and fibroblasts were harvested on day 12 of culture. Fibroblast proliferation was inhibited when fibroblasts were cocultured with rat ATII cells (A), and changes in proliferation correlated inversely with PGE2 levels (B). C: IL-1{alpha} NA, IL-1{beta} NA, or control IgG was added to the cocultures on days 0, 4, and 8 of coculture at a concentration of 3 µg/ml. PGE2 levels were measured in the CM every 4 days, and fibroblasts were counted on day 12 of coculture. A 50–70% reduction in PGE2 was measured in cocultures exposed to IL-1{alpha} NA (*P < 0.05).

 
IL-1{alpha} Increases in Coculture of ATII Cells With Fibroblasts

In the design of our coculture system, ATII cells remained physically separated from fibroblasts throughout the culture period. Because the two cell types were not in direct contact, we assumed that any interaction between the two cell types would result only from secretion of soluble factors. To determine whether secreted IL-1{alpha} protein levels increased in cocultured medium, CM from cocultures of HLF and rat ATII cells was harvested for determination of rat IL-1{alpha} and IL-1{beta} protein levels from days 1 to 4 (CM1–4), days 4 to 8 (CM4–8), and days 8 to 12 (CM8–12). CM from the ATII-FB cocultures was compared with CM from ATII cells cultured alone. When cocultures were grown in the presence of 10% FBS, IL-1 {alpha} was below the level of detection in the CM at all time points. To improve the detection of one IL-1{alpha} assay, we repeated the experiments by modifying the culture conditions and removing FBS between days 8 and 12 of culture. This modification was made on the basis of a prior observation that PGE2 levels in the CM of these cocultures was highest when FBS was removed from the medium between days 8 and 12 of culture (35). We therefore hypothesized that IL-1{alpha} levels would likewise be highest under these conditions, as well. When cultured in the absence of serum, rat IL-1{alpha} protein remained undetectable in the CM of ATII cells cultured alone (days 8–12) but was detectable in the CM of ATII cells cocultured with HLF (IL-1{alpha}: 40.3 ± 12.4 pg/ml, mean ± SE, n = 4) correlating with the highest measured levels of PGE2 (70.6 ng/ml). In contrast, IL-1{beta} was measured in the CM of cocultures in the presence of FBS but did not significantly increase with time (CM1–4: 243 ± 94 pg/ml, CM4–8: 252 ± 37 pg/ml, CM8–12: 138 ± 5 pg/ml). Secreted levels of TGF-{beta}1 also were measured in coculture and were found to gradually increase over 12 days in coculture (CM1–4: 656 ± 23 pg/ml, CM4–8: 1,302 ± 69 pg/ml, CM8–12: 1,260 ± 26 pg/ml, CM8–12 without FBS, 786 ± 85 pg/ml; n = 4). When human TGF-{beta}1 (50–800 pg/ml), however, was added exogenously to human fibroblasts cultured in rat-tail collagen gel in DMEM containing 10% FBS on days 8–12 of culture, no significant change in PGE2 secretion or fibroblast proliferation was observed (data not shown).

Given the inherent limitations in measuring low levels of IL-1{alpha}, we next measured intracellular levels of rat ATII IL-1{alpha}. Rat ATII cells were cultured on Matrigel matrix as described above, either alone or in the presence of a fibroblast raft floated above. On day 12 of culture, the Matrigel was dissolved with Matrisperse, and the ATII cells were pelleted and lysed in RIPA buffer. IL-1{alpha} protein was then measured using ELISA. Intracellular IL-1{alpha} protein was only detectable in ATII cell lysates (both cultured alone or in coculture with fibroblasts) but not in fibroblast lysates on day 8 of culture, again correlating with the highest measured levels of PGE2 (n = 2) (data not shown).

ATII Cell IL-1{alpha} and FB COX-2 mRNA Expression is Increased in ATII-HLF Cocultures

To support the hypothesis that the source of IL-1{alpha} was derived from ATII cells rather than fibroblasts, we measured IL-1{alpha} gene expression in both the fibroblasts and ATII cells in these cocultures. COX-2 gene expression also was measured in fibroblasts cocultured with ATII cells and compared with that measured in fibroblasts cultured alone. Because previous studies by our group (35) had shown that fibroblasts are the predominant producers of PGE2 in this coculture system, we expected to find upregulated COX-2 gene expression in fibroblasts cocultured with ATII cells. Total RNA was extracted from fibroblasts and ATII cells on day 8 of culture. Rat and human IL-1{alpha} gene expression and human COX-2 gene expression were measured using real-time PCR. When fibroblasts were cocultured with rat ATII cells, a six- to eightfold increase in fibroblast COX-2 gene expression (normalized to GAPDH) was seen (Fig. 4). When IL-1{alpha} was added exogenously to cultured HLF under these same conditions, a fourfold increase in COX-2 gene expression was seen at doses of 0.1–10 ng/ml (data not shown). When ATII cells were cocultured with the fibroblasts for 8 days, a 2.5-fold increase in ATII cell (rat) IL-1{alpha} gene expression (normalized to GAPDH) also was seen in these cocultures (Fig. 5A). No change was seen in HLF IL-1{alpha} expression in these cocultures (Fig. 5B). These results confirm that when fibroblasts are cocultured with ATII cells, COX-2 is induced in fibroblasts, leading to increased levels of PGE2. These data further indicate that IL-1{alpha} derives from ATII cells (rather than fibroblasts) in these cocultures.



View larger version (11K):
[in this window]
[in a new window]
 
Fig. 4. Fibroblast cyclooxygenase (COX)-2 gene expression is upregulated in ATII and fibroblast cocultures. HLF were either cultured alone or cocultured with ATII cells in D10FBS. On day 8 of culture, fibroblasts were harvested and total RNA was extracted and purified. Real-time PCR was used to measure changes in HLF COX-2 gene expression compared with fibroblasts cultured alone, with changes normalized to GAPDH. Fibroblasts cocultured with ATII cells demonstrated a 6- to 8-fold increase in COX-2 gene expression compared with fibroblasts cultured alone (*P < 0.04). Data are expressed as means ± SE and are the results of 4 independent experiments.

 


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 5. IL-1{alpha} gene expression increases in ATII cells cocultured with HLF. Rat ATII cells were cocultured with HLF in the presence or absence of keratinocyte growth factor (KGF; 20 ng/ml). On day 8 of culture, fibroblasts and ATII cells were harvested in GITC. Total RNA was extracted and prepared as stated in MATERIALS AND METHODS. Changes in human or rat IL-1{alpha} gene expression in HLF or ATII cells were measured using real-time PCR. Gene expression of the cocultured cells was compared with gene expression of either ATII cells or HLF cultured alone. As shown in A, a 2.5-fold increase in IL-1{alpha} gene expression was observed in ATII cells cocultured with fibroblasts compared with ATII cells cultured alone. However, this effect was abrogated when the cells were cultured in the presence of KGF. In contrast, no change in fibroblast IL-1{alpha} gene expression was seen in cocultures compared with fibroblasts cultured alone (B). Data are expressed as means ± SE and are the results of 4 independent experiments. *P < 0.02.

 
KGF Stimulates Fibroblast Production of PGE2 in Epithelial Cell-Fibroblast Cocultures Independently of IL-1{alpha}

Previous observations indicated that PGE2 could be induced earlier in culture (day 8 of coculture) by the exogenous addition of KGF and that PGE2 secretion correlated with inhibition of fibroblast proliferation by day 8 (rather than day 12) of coculture (35). To define the mechanism by which KGF regulates fibroblast inhibition, we sought to define whether KGF augmented fibroblast production of PGE2 in ATII-FB coculture by enhancing ATII cell secretion of IL-1{alpha}. HLF (0.25 x 106 cells) were cocultured with rat ATII cells (5 x 106 cells/well) in the presence or absence of KGF (10 ng/ml), indomethacin (1 µM), and/or IL-1Ra (100 ng/ml). Culture medium was changed every 2 days. On day 8, the fibroblasts were counted and PGE2 was measured in the CM. Consistent with our group's previous report (35), no significant change was seen in PGE2 or fibroblast proliferation in the cocultures compared with fibroblasts cultured alone at this earlier time point (day 8 of coculture) in the absence of KGF (Figs. 6 and 7). As shown in Fig. 6, a significant increase in PGE2 secretion was induced by day 8 of coculture with exogenous administration of KGF. As expected, when exogenous KGF (10 ng/ml) was administered to fibroblasts cultured alone, no change in PGE2 secretion or fibroblast proliferation was observed (data not shown). The enhanced production of PGE2 in ATII-FB cocultures by KGF was abrogated by indomethacin (1 µM) (P = 0.0030) (Fig. 7). In contrast, IL-1Ra did not inhibit PGE2 secretion induced by KGF (Fig. 7). Concurrent with the rise in PGE2, significant inhibition of fibroblast proliferation also was observed in ATII-FB cocultures exposed to KGF (P = <0.03) (Fig. 8). The inhibitory effect of KGF on fibroblast proliferation was abrogated by indomethacin but not by IL-1Ra (Fig. 8). At the mRNA level, KGF reduced basal IL-1{alpha} gene expression in ATII cells (P < 0.0001) (Fig. 5A). Furthermore, KGF administration reversed the IL-1{alpha} expression induced by coculture with fibroblasts (P < 0.02) (Fig. 5A).



View larger version (12K):
[in this window]
[in a new window]
 
Fig. 6. KGF increases PGE2 production in ATII-FB cocultures. Rat ATII cells were cultured either alone or in coculture with HLF in the presence or absence of KGF (20 ng/ml). PGE2 levels are shown on day 8 of coculture. At this earlier time point (day 8 vs. day 12 of coculture), KGF significantly increased PGE2 production when ATII cells were cocultured with HLF (*P = 0.01). In the absence of KGF, however, no significant change in PGE2 was observed in ATII-HLF cocultures compared with ATII cells cultured alone (control condition).

 


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 7. KGF induces PGE2 in ATII-FB cocultures independently of IL-1. Rat ATII cells were cocultured with HLF in the presence or absence of KGF (10 ng/ml), indomethacin (Indo; 1 µM), and/or IL-1Ra (10 µg/ml) for a total of 8 days. Culture medium was changed every 2 days. On day 8 of coculture, PGE2 was measured in the CM. The KGF induction of PGE2 in ATII-FB cocultures was reversed by Indo (1 µM). In contrast, IL-1Ra had no effect on KGF stimulation of PGE2. Open bar represents fibroblasts cultured alone; shaded and solid bars refer to ATII-FB cocultures in the presence or absence of EtOH (D10FBS vehicle control), Indo, IL-1Ra, or KGF (K) as indicated. +Less than control ATII-FB cocultures (P < 0.01), *greater than control ATII-FB cocultures (P < 0.05).

 


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 8. KGF inhibits FB proliferation in ATII-FB cocultures independently of IL-1. HLF were cocultured with rat ATII cells in the presence or absence of KGF (10 ng/ml), Indo (1 µM), and/or IL-1Ra (10 µg/ml). On day 8 of coculture, the fibroblasts were counted and correlated with PGE2 levels in the CM. Concurrent with the increase in PGE2 levels (see Fig. 6), significant inhibition of fibroblast proliferation was observed in ATII-FB cocultures exposed to KGF (*P < 0.05). The suppressive effect of KGF on fibroblast proliferation was abrogated by Indo but not by IL-1Ra, suggesting that KGF acts to inhibit HLF proliferation independently of IL-1{alpha}.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The reciprocal interaction governing epithelial cell-fibroblast proliferation is well established (4, 26). Effective repair, following injury, mandates alveolar epithelial cell regeneration and a capacity to suppress fibroblast activation (2, 3). When epithelial cells and fibroblasts are cocultured together, epithelial cells release soluble factors(s) that impede fibroblast growth and function. However, these soluble factors have not been well defined. Conversely, fibroblasts stimulate epithelial cell proliferation by secreting KGF and HGF. Exogenous administration of KGF protects against lung injury when given prophylactically in various forms of lung injury (7, 50, 51) and is believed to confer this benefit by stimulating ATII cell proliferation and differentiation. Dysregulated interactions that result from disturbance of this alveolar epithelial cell-fibroblast relationship are thought to result in pulmonary fibrosis (42).

PGE2, an oxygenated metabolite of arachidonic acid, has been recognized as a critical "antifibrotic" mediator of alveolar epithelial cell-fibroblast interaction. PGE2 has been shown to suppress fibroblast proliferation (5, 13, 29), migration (27), and collagen synthesis (18). PGE2 also negatively regulates platelet-derived growth factor (PDGF)-R{alpha}, thereby suppressing PDGF stimulation of rat lung myofibroblasts in vitro (6). Furthermore, fibroblasts isolated from patients with IPF have a diminished capacity to secrete PGE2 compared with fibroblasts from the lungs of healthy individuals (25, 49). Moore et al. (32) demonstrated that when alveolar epithelial cells are cultured on fibronectin, thereby maintaining a type I-like cell phenotype, the alveolar epithelial cell is a major source of PGE2. In contrast, our group (35) previously reported that when alveolar epithelial cells are cultured on Matrigel to express a type II cell phenotype and then cocultured with fibroblasts, PGE2 is predominantly produced by fibroblasts in an autocrine fashion, establishing an autoregulatory feedback loop over fibroblast cell growth. The factors regulating PGE2 secretion by both fibroblasts and alveolar epithelial cells, however, are poorly understood.

The IL-1 family of cytokines consists of two agonists (IL-1{alpha} and IL-1{beta}) and one receptor antagonist (IL-1Ra). Both IL-1{alpha} and IL-1{beta} bind to the same receptor but are active in different subcellular compartments (8). IL-1{beta} is primarily secreted after proteolytic cleavage (10) and is thought to elicit systemic "proinflammatory" and "profibrotic" responses. The presence of IL-1{beta} has been demonstrated in tissues undergoing fibrogenesis (21, 34). Furthermore, fibrotic lung disease could be attenuated by inhibition of IL-1{beta} (and IL-1{alpha}) with IL-1Ra in animal models of pulmonary fibrosis (38). In addition, an adenovirus expressing IL-1{beta} induces pulmonary fibrosis (28). Conflicting evidence, however, suggests that IL-1{beta} may, in fact, inhibit fibrogenesis. IL-1{beta} is an established inducer of PGE2 production in HLF (14) and has been shown to inhibit collagen production and stimulate collagenase expression in other cell types (19). Recent data indicate that the balance of antifibrotic (PGE2) pathways activated by IL-1{beta} and competing profibrotic (PDGF) pathways may determine the outcome of pulmonary fibrosis (6, 28).

In contrast, precursor IL-1{alpha} is found in keratinocytes and epithelial cells of healthy subjects, where it is either membrane bound and functions in a juxtacrine manner as a cell-cell interaction molecule (22) or, alternatively, accumulates intracellularly where, once activated, it translocates to the nucleus and acts as an intracrine proinflammatory activator of transcription (39, 47). Only rarely is IL-1{alpha} released from cells under conditions associated with cell death (46). In contrast to IL-1{beta}, the role of IL-1{alpha} in fibrotic lung disease is less well defined. It is known that IL-1{alpha} increases phospholipase A2 and PGE2 in human and rat lung fibroblasts (30, 33). In the context of epithelial cell-fibroblast interaction, Sato et al. (41) have demonstrated that human epidermal keratinocytes stimulate fibroblast production of PGE2 by secreting IL-1{alpha}.

We therefore sought to define the role of IL-1{alpha} and IL-{beta} in regulating alveolar epithelial cell-fibroblast interaction. We hypothesized that ATII cells regulate fibroblast production of PGE2 through paracrine or intracrine signaling of IL-1. Because fibroblasts do not express the KGF receptor, and KGF acts almost exclusively on epithelial cells, we speculated that KGF further enhances PGE2 production by augmenting ATII cell secretion of IL-1.

Our data indicate that PGE2 production in rat ATII-FB cocultures is stimulated by IL-1{alpha} and not IL-1{beta}. We have confirmed previous reports that both human IL-1{alpha} and IL-1{beta} stimulate PGE2 secretion in HLF in a dose-response manner. We also have found that by using mixed species (rat IL-1) with HLF, we could distinguish the effects of IL-1{alpha} from IL-1{beta}, because HLF produce PGE2 in response to rat IL-1{alpha} but not rat IL-1{beta} or TGF-{beta}1 under the same culture conditions. Selective inhibition of IL-1{alpha} (but not IL-1{beta}) in these mixed species (rat-human) cocultures inhibited PGE2 secretion, inversely correlating with fibroblast proliferation. This mixed species system also allowed us to identify the source of IL-1{alpha} as emanating from the ATII cell rather than the fibroblast, because the IL-1 neutralizing antibodies selectively targeted IL-1{alpha} and IL-1{beta} derived from the rat ATII cells. Furthermore, we were able to demonstrate enhanced IL-1{alpha} gene expression in ATII cells cocultured with fibroblasts compared with ATII cells cultured alone. In contrast, no change in fibroblast IL-1{alpha} gene expression was seen in the cocultured conditions compared with fibroblasts cultured alone. The selective response to IL-1{alpha} (rather than IL-1{beta}) was corroborated in coculture studies in same-species (rat-rat) experiments. Specific NA to IL-1{alpha} but not IL-1{beta} suppressed PGE2 production and neutralized the suppressive effects of ATII cells on fibroblast proliferation.

We believe that the in vitro effects of IL-1{alpha} on fibroblast PGE2 production are important in understanding lung repair. Ordinarily, ATII cells are separated from fibroblasts and there is no contact between membrane-bound IL-1{alpha} on the ATII cells with the fibroblasts. In lung injury, it is possible that repair occurs via contact between membrane-bound IL-1{alpha} on ATII cells and migrating fibroblasts. Alternatively, cell fragments containing small amounts of potent membrane-bound IL-1{alpha} may be released in an injury state as they are in prolonged culture in vitro, which then triggers surrounding fibroblasts to produce PGE2 and inhibit fibroblast proliferation.

In our hands, IL-1{alpha} protein was detectable both intracellularly (in the ATII cells) as well as in the coculture medium (when cultured in the absence of serum) only at low levels between days 8 and 12 of coculture. Our limited ability to directly measure IL-1{alpha} in the culture medium and exclusively under serum-free conditions is not surprising. In fact, it has been reported that circulating IL-1{alpha} is not a reliable indicator of its activity (9). IL-1 is a highly active cytokine in humans and produces biological effects at levels in the subpicomolar range far below ELISA assay detection limits. For this reason, it is only specific blockade or neutralization of a cytokine that provides a convincing case for causation (9). This has been recently demonstrated in two disease conditions where there was no demonstration of elevated IL-1 (either IL-1{alpha} or IL-1{beta}), but with the administration of IL-1Ra, dramatic resolution of the disease was reported (17, 37).

Recent data indicate that IL-1{alpha} acts as an intracrine activator of various genes. Given that IL-1{alpha} generally remains membrane bound or intracellular and that ATII cells were physically separated from fibroblasts in these cocultures, we have considered the possibility that intracrine activation of unidentified genes in ATII cells in turn stimulate fibroblast production of PGE2. To exclude this possibility, we collected CM of ATII-FB cocultures and added it to rat lung fibroblasts. Fibroblast proliferation was inhibited in the presence of CM, but the effect was abrogated with the addition of IL-1Ra. We thus concluded that extracellular IL-1 found in the CM is responsible for inhibition of fibroblast proliferation and that IL-1Ra acted by neutralizing the IL-1 released by ATII cells, rather than by a direct effect on the fibroblasts. In addition, both IL-1Ra and IL-1 neutralizing antibodies act on the mature portion of the IL-1 protein, which remains extracellular in orientation. The neutralizing antibody would therefore be unable to access IL-1 intracellularly, excluding intracrine signaling as a mechanism of PGE2 signaling in our coculture system.

Contrary to our hypothesis, selective inhibition of IL-1{alpha} had no effect on KGF-induced PGE2 secretion or fibroblast inhibition in these cocultures. In fact, KGF inhibited IL-1{alpha} gene expression by ATII cells while concurrently increasing PGE2 in the coculture system. Although these studies indicate that KGF augments PGE2 through an IL-1{alpha}-independent mechanism, the signaling pathway through which KGF regulates PGE2 is not known. One possibility is that KGF directly induces ATII cell expression of COX-2 and thereby increases PGE2. In support of this hypothesis, KGF-2 (FGF-10), a homolog of KGF (FGF-7), has been shown to increase COX-2 expression and activity in cultured intestinal epithelial cells (20). Alternatively, KGF may act by stimulating the secretion of other soluble factors by ATII cells, which in turn augment PGE2 production by fibroblasts in vivo. Although TGF-{beta}1 has been reported to increase PGE2 in fibroblast cultures (31), this was not the case with HLF in the present study.

In summary, the present study demonstrates that ATII cells inhibit fibroblast proliferation in part through an IL-1{alpha}-mediated increase in fibroblast production of PGE2. Our findings also suggest that in the absence of inflammatory stimuli, epithelial cell-fibroblast interaction is governed by IL-1{alpha}- rather than IL-1{beta}-mediated pathways. Our studies confirm that KGF increases PGE2 in epithelial cell-fibroblast cocultures through an IL-1{alpha}-independent pathway; however, the precise mechanism whereby KGF increases PGE2 remains unknown. Although these data demonstrate that IL-1{alpha} inhibits fibroblast proliferation in vitro, we are mindful that IL-1 inhibition is an effective therapy in the treatment of rheumatoid arthritis (11, 24). The synovial fibroblasts produce abundant PGE2, and yet the pannus (proliferating fibroblasts) is reduced by blocking IL-1. This counters the concept that PGE2 is antiproliferative (unless the synovial fibroblast is different from the lung fibroblast). Additional studies are required to sort out this apparent paradox. Defining the mechanisms through which alveolar epithelial cells inhibit fibroblast proliferation would significantly enhance understanding of fibroproliferative diseases.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported in part by National Institutes of Health Grants HL-67671, HL-07085, and HL-29891. These studies also were supported by National Institutes of Health Grants AI-15614 (C. A. Dinarello) and AI-15614 (C. A. Dinarello).


    ACKNOWLEDGMENTS
 
We thank Teneke Warren for secretarial assistance, Jon Geske (ELISA Tech) for assistance in the PGE2 and IL-1 ELISA assays, and Boyd Jacobson for assistance with graphic imaging.


    FOOTNOTES
 

Address for reprint requests and other correspondence: R. J. Mason, Dept. of Medicine, National Jewish Medical and Research Center, 1400 Jackson St., Denver, CO 80206 (e-mail: masonb{at}njc.org)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Aaronson SA, Bottaro DP, Miki T, Ron D, Finch PW, Fleming TP, Ahn J, Taylor WG, and Rubin JS. Keratinocyte growth factor. A fibroblast growth factor family member with unusual target cell specificity. Ann NY Acad Sci: 62–77, 1991.
  2. Adamson IY, Young L, and Bowden DH. Relationship of alveolar epithelial injury and repair to the induction of pulmonary fibrosis. Am J Pathol 130: 377–383, 1988.[Abstract]
  3. Adamson IYR, Hedgecock C, and Bowden DH. Epithelial cell-fibroblast interactions in lung injury and repair. Am J Pathol 137: 385–392, 1990.[Abstract]
  4. Adamson IYR, Young L, and King GM. Reciprocal epithelial: fibroblast interactions in the control of fetal and adult rat lung cells in culture. Exp Lung Res 17: 821–835, 1991.[Web of Science][Medline]
  5. Bitterman PB, Wewers MD, Rennard SI, Adelberg S, and Crystal RG. Modulation of alveolar macrophage-driven fibroblast proliferation by alternative macrophage mediators. J Clin Invest 77: 700–708, 1986.[Web of Science][Medline]
  6. Boyle JE, Lindroos PM, Rice AB, Zhang L, Zeldin DC, and Bonner JC. Prostaglandin-E2 counteracts interleukin-1{beta}-stimulated upregulation of platelet-derived growth factor {alpha}-receptor on rat pulmonary myofibroblasts. Am J Respir Cell Mol Biol 20: 433–440, 1999.[Abstract/Free Full Text]
  7. Deterding RR, Havill AM, Yano T, Middleton SC, Jacoby CR, Shannon JM, Simonet WS, and Mason RJ. Prevention of bleomycin-induced lung injury in rats by keratinocyte growth factor. Proc Assoc Am Physicians 109: 254–268, 1997.[Web of Science][Medline]
  8. Dinarello CA. Biologic basis for interleukin-1 in disease. Blood 87: 2095–2147, 1996.[Abstract/Free Full Text]
  9. Dinarello CA. Blocking IL-1 in systemic inflammation. J Exp Med 201: 1355–1359, 2005.[Abstract/Free Full Text]
  10. Dinarello CA. Interleukin-1{beta}, interleukin-18, and the interleukin-1{beta} converting enzyme. Ann NY Acad Sci 856: 1–11, 1998.[CrossRef][Web of Science][Medline]
  11. Dinarello CA. Therapeutic strategies to reduce IL-1 activity in treating local and systemic inflammation. Curr Opin Pharmacol 4: 378–385, 2004.[CrossRef][Web of Science][Medline]
  12. Dobbs LG, Geppert EF, Williams MC, Greenleaf RD, and Mason RJ. Metabolic properties and ultrastructure of alveolar type II cells isolated with elastase. Biochim Biophys Acta 618: 510–523, 1980.[Medline]
  13. Elias JA. Tumor necrosis factor interacts with interleukin-1 and interferons to inhibit fibroblast proliferation via fibroblast prostaglandin-dependent and -independent mechanisms. Am Rev Respir Dis 138: 652–658, 1988.[Web of Science][Medline]
  14. Endo T, Ogushi F, Sone S, Ogura T, Taketani Y, Hayashi Y, Ueda N, and Yamamoto S. Induction of cyclooxygenase-2 is responsible for interleukin-{beta}-dependent prostaglandin E2 synthesis by human lung fibroblasts. Am J Respir Cell Mol Biol 12: 358–365, 1995.[Abstract]
  15. Fine A and Goldstein RH. The effect of PGE2 on the activation of quiescent lung fibroblasts. Prostaglandins 33: 903–913, 1987.[CrossRef][Web of Science][Medline]
  16. Fine A, Poliks CF, Donahue LP, Smith BD, and Goldstein RH. The differential effect of prostaglandin E2 on transforming growth factor-{beta} and insulin-induced collagen formation in lung fibroblasts. J Biol Chem 264: 16988–16991, 1989.[Abstract/Free Full Text]
  17. Fitzgerald AA, Leclercq SA, Yan A, Homik JE, and Dinarello CA. Rapid responses to anakinra in patients with refractory adult-onset Still's disease. Arthritis Rheum 52: 1794–1803, 2005.[CrossRef][Web of Science][Medline]
  18. Goldstein RH and Polgar P. The effect and interaction of bradykinin and prostaglandins on protein and collagen production by lung fibroblasts. J Biol Chem 257: 8630–8633, 1982.[Abstract/Free Full Text]
  19. Graham MF, Willey A, Adams J, Yager D, and Diegelmann RF. Interleukin 1{beta} down-regulates collagen and augments collagenase expression in human intestinal smooth muscle cells. Gastroenterology 110: 344–350, 1996.[CrossRef][Web of Science][Medline]
  20. Han DS, Li F, Holt L, Connolly K, Hubert M, Miceli R, Okoye Z, Santiago G, Windle K, Wong E, and Sartor RB. Keratinocyte growth factor-2 (FGF-10) promotes healing of experimental small intestinal ulceration in rats. Am J Physiol Gastrointest Liver Physiol 279: G1011–G1022, 2000.[Abstract/Free Full Text]
  21. Johnston CJ, Piedboeuf B, Rubin P, Williams JP, Baggs R, and Finkelstein JN. Early and persistent alterations in the expression of interleukin-1{alpha}, interleukin-1{beta} and tumor necrosis factor {alpha} mRNA levels in fibrosis-resistant and sensitive mice after thoracic irradiation. Radiat Res 145: 762–767, 1996.[Web of Science][Medline]
  22. Kaplanski G, Farnarier C, Kaplanski S, Porat R, Shapiro L, Bongrand P, and Dinarello CA. Interleukin-1 induces interleukin-8 secretion from endothelial cells by a juxtacrine mechanism. Blood 84: 4242–4248, 1994.[Abstract/Free Full Text]
  23. Kawamoto M, Romberger DJ, Nakamura Y, Adachi Y, Tate L, Ertl RF, Spurzem JR, and Rennard SI. Modulation of fibroblast type I collagen and fibronectin production by bovine bronchial epithelial cells. Am J Respir Cell Mol Biol 12: 425–433, 1995.[Abstract]
  24. Kay J and Calabrese L. The role of interleukin-1 in the pathogenesis of rheumatoid arthritis. Rheumatology (Oxford) 43, Suppl 3: iii2–iii9, 2004.
  25. Keerthisingam CB, Jenkins RG, Harrison NK, Hernandez-Rodriguez NA, Booth H, Laurent GJ, Hart SL, Foster ML, and McAnulty RJ. Cyclooxygenase-2 deficiency results in a loss of the anti-proliferative response to transforming growth factor-{beta} in human fibrotic lung fibroblasts and promotes bleomycin-induced pulmonary fibrosis in mice. Am J Pathol 158: 1411–1422, 2001.[Abstract/Free Full Text]
  26. Klien JH and Adamson IYR. Fibroblast inhibition and prostaglandin secretion by alveolar epithelial cells exposed to silica. Lab Invest 60: 808–813, 1989.[Web of Science][Medline]
  27. Kohyama T, Ertl RF, Valenti V, Spurzem J, Kawamoto M, Nakamura Y, Veys T, Allegra L, Romberger D, and Rennard SI. Prostaglandin E2 inhibits fibroblast chemotaxis. Am J Physiol Lung Cell Mol Physiol 281: L1257–L1263, 2001.[Abstract/Free Full Text]
  28. Kolb M, Margetts PJ, Anthony DC, Pitossi F, and Gauldie J. Transient expression of IL-1{beta} induces acute lung injury and chronic repair leading to pulmonary fibrosis. J Clin Invest 107: 1529–1536, 2001.[Web of Science][Medline]
  29. Lama V, Moore BB, Christensen P, Toews GB, and Peters-Golden M. Prostaglandin E2 synthesis and suppression of fibroblast proliferation by alveolar epithelial cells is cyclooxygenase-2-dependent. Am J Respir Cell Mol Biol 27: 752–758, 2002.[Abstract/Free Full Text]
  30. Lin LL, Lin AY, and DeWitt DL. Interleukin-1{alpha} induces the accumulation of cytosolic phospholipase A2 and the release of prostaglandin E2 in human fibroblasts. J Biol Chem 267: 23451–23454, 1992.[Abstract/Free Full Text]
  31. McAnulty RJ, Chambers RC, and Laurent GJ. Regulation of fibroblast procollagen production. Transforming growth factor-{beta}1 induces prostaglandin E2 but not procollagen synthesis via a pertussis toxin-sensitive G-protein. Biochem J 307: 63–68, 1995.[Web of Science][Medline]
  32. Moore BB, Peters-Golden M, Christensen PJ, Lama V, Kuziel WA, Paine R, 3rd, and Toews GB. Alveolar epithelial cell inhibition of fibroblast proliferation is regulated by MCP-1/CCR2 and mediated by PGE2. Am J Physiol Lung Cell Mol Physiol 284: L342–L349, 2003.[Abstract/Free Full Text]
  33. Ogushi F, Endo T, Tani K, Asada K, Kawano T, Tada H, Maniwa K, and Sone S. Decreased prostaglandin E2 synthesis by lung fibroblasts isolated from rats with bleomycin-induced lung fibrosis. Int J Exp Pathol 80: 41–49, 1999.[CrossRef][Web of Science][Medline]
  34. Pan LH, Ohtani H, Yamauchi K, and Nagura H. Co-expression of TNF{alpha} and IL-1{beta} in human acute pulmonary fibrotic diseases: an immunohistochemical analysis. Pathol Int 46: 91–99, 1996.[Web of Science][Medline]
  35. Pan T, Mason RJ, Westcott JY, and Shannon JM. Rat alveolar type II cells inhibit lung fibroblast proliferation in vitro. Am J Respir Cell Mol Biol 25: 353–361, 2001.[Abstract/Free Full Text]
  36. Panos RJ, Rubin JS, Csaky KG, Aaronson SA, and Mason RJ. Keratinocyte growth factor and hepatocyte growth factor/scatter factor are heparin-binding growth factors for alveolar type II cells in fibroblast-conditioned medium. J Clin Invest 92: 969–977, 1993.[Web of Science][Medline]
  37. Pascual V, Allantaz F, Arce E, Punaro M, and Banchereau J. Role of interleukin-1 (IL-1) in the pathogenesis of systemic onset juvenile idiopathic arthritis and clinical response to IL-1 blockade. J Exp Med 201: 1479–1486, 2005.[Abstract/Free Full Text]
  38. Piguet PF, Vesin C, Grau GE, and Thompson RC. Interleukin 1 receptor antagonist (IL-1ra) prevents or cures pulmonary fibrosis elicited in mice by bleomycin or silica. Cytokine 5: 57–61, 1993.[CrossRef][Web of Science][Medline]
  39. Pollock AS, Turck J, and Lovett DH. The prodomain of interleukin 1{alpha} interacts with elements of the RNA processing apparatus and induces apoptosis in malignant cells. FASEB J 17: 203–213, 2003.[Abstract/Free Full Text]
  40. Pradelles P, Grassi J, and Maclouf J. Enzyme immunoassays of eicosanoids using acetylcholinesterase. Methods Enzymol 187: 24–34, 1990.[Web of Science][Medline]
  41. Sato T, Kirimura Y, and Mori Y. The co-culture of dermal fibroblasts with human epidermal keratinocytes induces increased prostaglandin E2 production and cyclooxygenase 2 activity in fibroblasts. J Invest Dermatol 109: 334–339, 1997.[CrossRef][Web of Science][Medline]
  42. Selman M, King TE, and Pardo A. Idiopathic pulmonary fibrosis: prevailing and evolving hypotheses about its pathogenesis and implications for therapy. Ann Intern Med 134: 136–151, 2001.[Abstract/Free Full Text]
  43. Shannon JM, Emrie PA, Fisher JH, Kuroki Y, Jennings SD, and Mason RJ. Effect of a reconstituted basement membrane on expression of surfactant apoproteins in cultured adult rat alveolar type II cells. Am J Respir Cell Mol Biol 2: 183–192., 1990.[Web of Science][Medline]
  44. Shannon JM, Mason RJ, and Jennings SD. Functional differentiation of alveolar type II epithelial cells in vitro: effects of cell shape, cell-matrix interactions and cell-cell interactions. Biochim Biophys Acta 931: 143–156, 1987.[Medline]
  45. Song X, Voronov E, Dvorkin T, Fima E, Cagnano E, Benharroch D, Shendler Y, Bjorkdahl O, Segal S, Dinarello CA, and Apte RN. Differential effects of IL-1{alpha} and IL-1{beta} on tumorigenicity patterns and invasiveness. J Immunol 171: 6448–6456, 2003.[Abstract/Free Full Text]
  46. Watanabe N and Kobayashi Y. Selective release of a processed form of interleukin 1{alpha}. Cytokine 6: 597–601, 1994.[CrossRef][Web of Science][Medline]
  47. Werman A, Werman-Venkert R, White R, Lee JK, Werman B, Krelin Y, Voronov E, Dinarello CA, and Apte RN. The precursor form of IL-1{alpha} is an intracrine proinflammatory activator of transcription. Proc Natl Acad Sci USA 101: 2434–2439, 2004.[Abstract/Free Full Text]
  48. Westcott JY, Johnston K, Batt RA, Wenzel SE, and Voelkel NF. Measurement of peptidoleukotrienes in biological fluids. J Appl Physiol 68: 2640–2648, 1990.[Abstract/Free Full Text]
  49. Wilborn J, Crofford LJ, Burdick MD, Kunkel SL, Strieter RM, and Peters-Golden M. Cultured lung fibroblasts isolated from patients with idiopathic pulmonary fibrosis have a diminished capacity to synthesize prostaglandin E2 and to express cyclooxygenase-2. J Clin Invest 95: 1861–1868, 1995.[Web of Science][Medline]
  50. Yano T, Deterding RR, Simonet WS, Shannon JM, and Mason RJ. Keratinocyte growth factor reduces lung damage due to acid instillation in rats. Am J Respir Cell Mol Biol 15: 433–442, 1996.[Abstract]
  51. Yi ES, Williams ST, Lee H, Malicki DM, Chin EM, Yin S, Tarpley J, and Ulich TR. Keratinocyte growth factor ameliorates radiation- and bleomycin-induced lung injury and mortality. Am J Pathol 149: 1963–1970, 1996.[Abstract]
  52. Young L and Adamson IY. Epithelial-fibroblast interactions in bleomycin-induced lung injury and repair. Environ Health Perspect 101: 56–61, 1993.[Web of Science][Medline]



This article has been cited by other articles:


Home page
Am. J. Respir. Cell Mol. Bio.Home page
R. Manzer, C. A. Dinarello, G. McConville, and R. J. Mason
Ozone Exposure of Macrophages Induces an Alveolar Epithelial Chemokine Response through IL-1{alpha}
Am. J. Respir. Cell Mol. Biol., March 1, 2008; 38(3): 318 - 323.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
290/2/L307    most recent
00102.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (7)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Portnoy, J.
Right arrow Articles by Mason, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Portnoy, J.
Right arrow Articles by Mason, R. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2006 by the American Physiological Society.