AJP - Lung Watch the video to see how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 290: L351-L358, 2006. First published September 23, 2005; doi:10.1152/ajplung.00275.2005
1040-0605/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
290/2/L351    most recent
00275.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sparkman, L.
Right arrow Articles by Boggaram, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sparkman, L.
Right arrow Articles by Boggaram, V.

Ceramide decreases surfactant protein B gene expression via downregulation of TTF-1 DNA binding activity

Loretta Sparkman, Hemakumar Chandru, and Vijayakumar Boggaram

Department of Molecular Biology, University of Texas Health Center at Tyler, Tyler, Texas

Submitted 27 June 2005 ; accepted in final form 17 September 2005


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Ceramide, a sphingolipid, is an important signaling molecule in the inflammatory response. Mediators of acute lung injury such as TNF-{alpha}, platelet-activating factor, and Fas/Apo ligand stimulate sphingomyelin hydrolysis to increase intracellular ceramide levels. Surfactant protein B (SP-B), a hydrophobic protein of pulmonary surfactant, is essential for surfactant function and lung stability. In this study we investigated the effects of ceramide on SP-B gene expression in H441 lung epithelial cells. Ceramide decreased SP-B mRNA levels in control and dexamethasone-treated cells after 24-h incubation and inhibition of SP-B mRNA was associated with inhibition of immunoreactive SP-B. In transient transfections assays, ceramide inhibited SP-B promoter activity, indicating that the inhibitory effects are exerted at the transcriptional level. Deletion mapping experiments showed that the ceramide-responsive region is located within the –233/–80-bp region of human SP-B promoter. Electrophoretic mobility shift and reporter assays showed that ceramide reduced the DNA binding activity and transactivation capability of thyroid transcription factor 1 (TTF-1/Nkx2.1), a key factor for SP-B promoter activity. Collectively these data showed that ceramide inhibits SP-B gene expression by reducing the DNA biding activity of TTF-1/Nkx2.1 transcription factor. Protein kinase C inhibitor bisindolylmaleimide and the protein tyrosine kinase inhibitor genistein partially reversed ceramide inhibition, indicating that protein kinases play important roles in the ceramide inhibition of SP-B gene expression. Chemical inhibitors of de novo ceramide synthesis and sphingomyelin hydrolysis had no effect on TNF-{alpha} inhibition of SP-B promoter activity and mRNA levels, suggesting that ceramide does not play a role in the inhibition.

sphingolipids; lung injury; inflammation; transcription; thyroid transcription factor 1


SURFACTANT, A PROTEOLIPID COMPLEX, is essential for lung stability. Surfactant protein B (SP-B) is an 8-kDa hydrophobic protein of surfactant that promotes the formation and stability of the surfactant monolayer on the alveolar surface through its interactions with dipalmitoyl phosphatidylcholine, the principal surface-active phospholipid of surfactant (10). SP-B gene expression is subject to developmental and multifactorial regulation by cytokines, growth factors, and hormones (5). SP-B mRNA is expressed in a cell/tissue-restricted manner by the alveolar type II and Clara cells of the lung.

SP-B is essential for lung function. A complete lack of SP-B as in the case of frame-shift mutation in codon 121 (121ins2) in humans (25) and in genetically engineered SP-B null mice (9) results in death due to respiratory failure. Partial deficiency of SP-B is associated with susceptibility to lung injury, suggesting that optimal SP-B levels are necessary for maintenance of lung function (8). Apart from newborn respiratory distress syndrome (RDS) and congenital alveolar proteinosis, SP-B levels are also reduced in a variety of lung diseases such as acute respiratory distress syndrome (ARDS) (13), respiratory syncytial virus infection in infants (15), familial interstitial lung disease (2), and others. Inflammatory mediators such as TNF-{alpha} (4, 26) and nitric oxide (30) inhibit SP-B gene expression.

The sphingolipid ceramide serves as an important signaling molecule in the inflammatory response triggered by a host of stress factors including cytokines, ionizing radiation, and others (22). Ceramide can be produced via de novo synthesis or hydrolysis of membrane sphingomyelin by sphingomyelinases. Lung cells express high levels of sphingomyelinases (29, 35), and the levels of lactosylceramide, a ceramide derivative, and ceramide are markedly elevated in the bronchoalveolar lavage fluid of ARDS patients (27) and in plasma of sepsis patients, respectively (11). In sepsis, plasma ceramide levels are correlated with mortality (11). A role for ceramide in the development of lung injury is indicated by increased lung permeability and surfactant dysfunction in rats exposed to TNF-{alpha} and ceramide (29) and suppression of platelet activating factor (PAF)-induced lung edema in acid sphingomyelinase-deficient rats (12). These data strongly suggest a role for ceramide in the development of acute lung injury. A potential mechanism for ceramide-induced lung injury is by inhibiting surfactant protein gene expression. In particular inhibition of SP-B can result in lung injury as reduced SP-B levels are correlated with surfactant dysfunction and susceptibility to lung injury. In this study we tested the proposal that high concentrations of ceramide decrease SP-B mRNA levels in lung epithelial cells. To date no information is available on the sphingolipid regulation of surfactant protein gene expression.

We found that ceramide inhibited basal and dexamethasone induced SP-B mRNA levels in H441 lung epithelial cells. Ceramide inhibition of SP-B mRNA was associated with inhibition of SP-B promoter activity and ceramide response region was mapped between –233 and –80 bp of SP-B promoter. Ceramide inhibition of SP-B mRNA was associated with inhibition of DNA binding activity of thyroid transcription factor (TTF)-1. Pharmacological inhibition of protein kinase C partly reversed ceramide inhibition indicating a role for the protein kinase C signaling pathway.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Cell culture. NCI-H441 cells (American Type Culture Collection HTB-174), a human lung adenocarcinoma cell line with characteristics of bronchiolar (Clara) epithelial cells were grown on plastic tissue culture dishes in RPMI 1640 medium containing 10% fetal bovine serum, penicillin (100 U/ml), streptomycin (100 µg/ml), and amphotericin B (0.25 µg/ml). In all experiments the medium was changed to RPMI 1640 without serum for 24 h before the start of the experiment.

Materials. C2-ceramide, sphingosine, and sphingosine-1-phosphate were obtained from Avanti (Alabaster, AL). Dihydroceramide C2 was from Sigma. C2-ceramide, dihydroceramide C2, and sphingosine were dissolved in anhydrous ethanol. Sphingosine-1-phosphate was dissolved in a mixture of methanol-water (95:5) at a concentration of 0.5 mg/ml by heating at 45°C for 10–15 min followed by sonication for 10 s each time for three times. Solubilized sphingosine-1-phosphate was dried under nitrogen and reconstituted in cell culture medium containing 0.4% bovine serum albumin. TNF-{alpha} was purchased from R & D Systems (Minneapolis, MN). Bisindolylmaleimide, genistein, and 4-amino-5-(4-chlorophenyl)-7-(t-butyl)pyrazolol[3,4-d]pyrimidine (PP2) were from Calbiochem (La Jolla, CA). Dimethylaminopurine was from Acros Organics. TRI reagent was from Molecular Research Center (Cincinnati, OH).

RNA isolation and Northern blot analysis. Experimental procedures for RNA isolation and Northern blot analysis are as described previously (21). Total RNA was isolated by the acid-guanidinium thiocyanate-phenol method with TRI reagent (Molecular Research Center, Cincinnati, OH). We quantified RNA by measuring absorbance at 260 nm, and equal amounts of RNA were separated by electrophoresis on agarose gels (1%) containing 20 mM MOPS and 1.1% formaldehyde. Separated RNAs were transferred to HybondN+ membrane by capillary action with saline sodium citrate (SSC, 20x) as the transfer solution. The membranes were UV cross-linked, hybridized to 32P-labeled human SP-B and GAPDH cDNAs, and washed. The final wash was routinely done with 1x SSC containing 0.1% SDS at 65°C. The washed blots were scanned with a PhosphorImager, and RNA bands corresponding to SP-B and GAPDH were quantified. SP-B mRNA levels were normalized to 18S rRNA levels to correct for variations in the quantification, loading, and transfer of RNA. The expression of GAPDH mRNA was assessed as an internal control.

Immunohistochemical detection of SP-B. Immunoreactive SP-B was detected with a staining kit from Lab Vision (Fremont, CA) according to the manufacturer's protocol. H441 cells grown on cell culture slide chambers were fixed in Excell PLUS for 1 h, and endogenous peroxidase activity was blocked by incubation with Peroxide Block for 30 min. Afterward, cells were incubated with rabbit polyclonal human SP-B antibodies (1:200 dilution; Chemicon International, Temecula, CA) followed by horseradish peroxidase-conjugated secondary antibody. Cells were then incubated with aminoethylcarbazole to visualize the antigen-antibody complex and counterstained with contrast blue solution.

Transient transfection and reporter gene assay. Amplification of human SP-B 5'-flanking DNA containing –911/+41 bp and construction of luciferase reporter plasmid have been reported previously (30). 5'-Truncated DNA fragments containing –517/+41, –233/+41, and –80/+41 bp SP-B promoter were amplified by PCR with a plasmid containing –911/+41 bp of SP-B 5'-flanking DNA as the template and the following SP-B primers containing introduced SacI and HindIII sites (underlined), 5'-CGAGCTCCATGTGTCCATAGAACCAGA-3' (–517/–498) (sense), 5'-CGAGCTCAGCCACAAGTCCAGGAACAT-3' (–233/–214) (sense), 5'-CGAGCTCACTGAGGTCGCTGCCACTCC-3' (–80/–61) (sense), 5'-CCCAAGCTTCCACTGCAGCAGGTGTGACTCAGCCAGGGCACCTCT-3' (+9/+41) (antisense).

Amplified DNAs were ligated upstream of the luciferase reporter gene in the plasmid pGL3luc(basic) (Promega, Madison, WI). SP-B promoter plasmids were sequenced to ensure that they are free of nucleotide changes. TTF-1 and hepatocyte nuclear factor (HNF)-3 reporter plasmids containing multiple copies of SP-B TTF-1 and HNF-3 binding sites linked upstream of basal SP-B promoter (–59/+41 bp) were constructed by PCR. A plasmid containing –236/+41 bp of SP-B 5' flanking DNA served as the template, and the following SP-B primers were used: TTF-1, 5'-CGAGCTCAGCACCTGGAGGGCTCTTCAGAGCAAGCACCTGGAGGG CTCTTCAGAGCACTACAGAGCCCCCACGCCCCGCCCAGCT-3' (–59/–32) (sense); HNF-3, 5'-CGAGCTCAAGACAAACACTGAAAGACAAACACTGAAAG ACAAACACTGAAAGACAAACACTGACTACAGAGCCCCCACG CCCCGCCCAGCT-3' (–59/–32) (sense) and 5'-CCCAAGCTTCCACTGCAGCAGGTGTGACTCAGCCAGGGCACCTCT-3' (+9/+41) (antisense).

SacI and HindIII sites introduced into the primers are underlined. Introduced TTF-1 and HNF-3 sequences are shown in italics, and core TTF-1 and HNF-3 binding sites are underlined. Amplified DNA was inserted upstream of luciferase reporter gene in the vector pGL3basic and sequenced to ensure that it did not contain any mutations. Plasmid DNAs were amplified in Escherichia coli Top10 strain (Invitrogen) and purified by anion exchange chromatography (Qiagen). DNAs were transiently transfected into cells by liposome-mediated DNA transfer with Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. Cells were cotransfected with a {beta}-galactosidase expression plasmid, pcDNA3.1 (Invitrogen) for the assessment of transfection efficiency. After transfection, cells were first incubated overnight in serum-containing medium and then in serum-free medium for 24 h, after which they were subjected to treatments. {beta}-Galactosidase and luciferase reporter activities in cell extracts were measured by chemiluminescent assays (Tropix, Bedford, MA and Promega).

Preparation of nuclear extracts and electrophoretic mobility shift analysis. Nuclear extracts were prepared according to the methods described previously (31, 32). We determined protein concentrations of nuclear extracts by Bradford's method using Bio-Rad protein assay reagent.

We annealed synthetic oligonucleotides by heating equimolar concentrations of sense and antisense oligonucleotides in 10 mM Tris·HCl, pH 7.5 containing 10 mM MgCl2, and 50 mM NaCl at 95°C for 5 min; they were then allowed to cool to room temperature over a period of 1 h. We determined the concentration of annealed oligonucleotides by measuring absorbance at 260 nm (50 ng/ml = 1.0 A260 unit). The sense strand sequences of SP-B promoter oligonucleotides are as follows: TTF-1/Nkx2.1, 5'-GCACCTGGAGGGCTCTTCAGAGCAA-3' (–111/–87); HNF-3, 5'-GCAAAGACAAACACTGAG-3' (–90/–73).

Double-stranded oligonucleotides were 5'-end labeled with [{gamma}-32P] and T4 polynucleotide kinase. We performed electrophoretic mobility shift analyses (EMSAs) essentially as described previously (19) by incubating 0.5–1.0 ng (100,000 cpm) of the labeled oligonucleotide with 5 µg of nuclear protein in 20 µl of binding buffer [13 mM HEPES, pH 7.9 containing 13% glycerol, 80 mM KCl, 5 mM MgCl2, 1 mM DTT, 1 mM EDTA, and 1 µg of poly(dI-dC) as nonspecific competitor DNA] at 30°C for 20 min. For antibody supershift assay, protein-DNA complex was first formed and then incubated with thyroid-specific enhancer-binding protein (T/EBP) antiserum or antibody for 20 min at room temperature. Polyclonal antisera to the NH2-terminal portion of rat T/EBP (TTF-1/Nkx2.1) was kindly supplied by Dr. Shioko Kimura (National Cancer Institute, Bethesda, MD). After electrophoresis, the gel was dried and exposed to an X-ray film.

Statistics. Data are shown as means ± SD/SE. In experiments where SP-B mRNA levels in control cells were arbitrarily set at 100%, statistical significance was analyzed by one-sample t-test. For other samples, unpaired t-test was used to analyze statistical significance. One-tailed P values of <0.05 were considered significant.


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Ceramide inhibits SP-B mRNA and promoter activity. No information is available about sphingolipid regulation of surfactant protein gene expression. To begin to ascertain the role of sphingolipid metabolites in the regulation of surfactant protein gene expression, we first determined the effects of ceramide on the expression of SP-B mRNA. We studied the effects of ceramide on the basal and dexamethasone induction of SP-B mRNA levels to determine whether ceramide has similar effects on SP-B levels in the absence and presence of dexamethasone. Also, as SP-B mRNA levels are significantly increased in dexamethasone-treated cells the effects of dexamethasone and other agents on SP-B mRNA can be readily assessed. H441 cells were incubated with a cell-permeable C2-ceramide analog with or without dexamethasone, and its effects on SP-B mRNA levels were determined by Northern blotting. We found that ceramide inhibited basal (control = 100, ceramide = 58 ± 8.7, n = 4) and dexamethasone induction (control = 100, dexamethasone = 1,409 ± 372, n = 4, dexamethasone + ceramide = 430 ± 104, n = 4) of SP-B mRNA levels after 24 h of incubation without significant effects on GAPDH mRNA levels (Fig. 1). The inhibitory effects of ceramide were time dependent, and significant effects were observed after 24 h of incubation (Fig. 2). Consistent with its inhibitory effects on SP-B mRNA levels, ceramide reduced SP-B promoter activity by similar extent (control = 100, ceramide = 48 ± 3.1, n = 3), indicating that the inhibitory effects are exerted at the transcriptional level (Fig. 2). Ceramide at a concentration of 10 µM did not have significant toxic effects on H441 cells as judged by light microscopy, total RNA yield, and GAPDH mRNA expression levels. Ceramide at a concentration of 10 µM was used in all the experiments.



View larger version (49K):
[in this window]
[in a new window]
 
Fig. 1. Ceramide inhibits surfactant protein (SP)-B mRNA levels in H441 lung epithelial cells. H441 cells were incubated in control medium or medium containing dexamethasone (10–7 M) (Dex) ± ceramide (Cer) at indicated concentrations for 24 h, and SP-B and GAPDH mRNAs were analyzed by Northern blotting. A: representative Northern blot showing the effects of treatments on SP-B and GAPDH mRNA levels. 18S rRNA levels detected by ethidium bromide staining are also shown. B: SP-B levels in control cells were arbitrarily set at 100, and the levels in treated cells were determined relative to control levels. Data represent means ± SE of 4 independent experiments. **P < 0.01 for Cer (10 and 20 µM)-treated cells vs. control cells; *P < 0.05 for Dex-treated cells vs. control cells; {dagger}P < 0.01 for Dex + Cer (10 µM)- and Dex + Cer (20 µM)-treated cells vs. Dex alone-treated cells. C, control medium.

 


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 2. Ceramide inhibits SP-B mRNA levels and SP-B promoter activity in a time-dependent manner in H441 cells. A: cells were incubated in control medium or medium containing Cer (10 µM) for the indicated periods of time, and SP-B mRNA levels were determined. Data shown are means ± SE of 3 independent experiments. #P < 0.0001 for Cer-treated cells vs. control at 24 h. B: cells transfected with a plasmid containing –911/+41 bp of human SP-B 5'-flanking DNA linked to luciferase reporter gene in the vector pGL3luc (basic) were incubated in control medium or medium containing Cer (10 µM) for the indicated periods of time. Luciferase activity in cell lysates was determined and normalized to cotransfected {beta}-galactosidase activity. Data represent means ± SE of 3 independent experiments. *P < 0.05 for ceramide-treated cells vs. control at 12 h; **P < 0.01 for ceramide-treated cells vs. control at 24 h.

 
Ceramide decreases SP-B protein levels. We analyzed SP-B protein levels by immunohistochemical detection to determine whether ceramide inhibition of SP-B mRNA levels is associated with inhibition of SP-B protein. H441 cells grown on cell culture slide chambers were incubated in control medium or dexamethasone (10–7 M)-containing medium with or without ceramide (10 µM) for 24 h and SP-B levels were visualized by immunohistochemical detection. Results (Fig. 3) showed that SP-B levels were induced by treatment with dexamethasone and incubation with ceramide reduced SP-B levels to control levels. Although immunohistochemical detection does not provide quantitative data, these results showed that ceramide inhibited SP-B protein levels.



View larger version (67K):
[in this window]
[in a new window]
 
Fig. 3. Ceramide inhibits immunoreactive SP-B protein levels in H441 cells. Cells were incubated in control medium, medium plus Dex (10–7 M), or medium containing Dex (10–7 M) plus Cer (10 µM) for 24 h and then processed for immunohistochemical detection of SP-B as described in METHODS. Arrows indicate staining for SP-B immunoreactive protein. Results shown are representative of 2 independent experiments.

 
Sphingosine and sphingosine-1-phosphate do not inhibit SP-B mRNA levels. Ceramide once produced via hydrolysis of membrane sphingomyelin or de novo synthesis is further metabolized into sphingosine and sphingosine-1-phosphate by ceramidase and sphingosine kinase enzymes, respectively. Sphingosine and sphingosine-1-phosphate have diverse effects on cells, including effects on gene expression (33). We assessed the effects of these sphingomyelin metabolites on SP-B mRNA levels. As SP-B mRNA levels are rather low in H441 cells, in the following experiments we determined the effects of different agents and inhibitors on dexamethasone induction of SP-B mRNA levels. Our earlier data showed that ceramide had similar inhibitory effects on SP-B mRNA levels in control and dexamethasone-treated cells. We found that sphingosine (10 µM) and sphingosine-1-phosphate (1 µM) did not inhibit SP-B mRNA levels, indicating that the inhibitory effects of ceramide are selective (Fig. 4). Higher concentrations of sphingosine-1-phosphate (up to 5 µM) had no effect on SP-B mRNA levels (data not shown). Furthermore, dihydroceramide, an inactive analog of ceramide, was significantly less effective than ceramide in inhibiting SP-B mRNA levels. Consistent with the lack of effects on SP-B mRNA levels, dihydroceramide, sphingosine, and sphingosine-1-phosphate did not inhibit SP-B promoter activity (data not shown).



View larger version (41K):
[in this window]
[in a new window]
 
Fig. 4. Sphingolipid inhibition of SP-B mRNA levels in H441 cells is specific for Ceramide. Cells were incubated in control medium or medium containing Dex (10–7 M) ± Cer (10 µM), dihydroceramide (10 µM), sphingosine (10 µM), or sphingosine-1-phosphate (S-1-P, 1 µM) for 24 h, and SP-B and GAPDH mRNA levels were analyzed by Northern blotting. S-1-P was reconstituted in medium containing 0.4% BSA. A: representative Northern blot showing the effects of treatments on SP-B and GAPDH mRNA levels. 18S rRNA levels visualized by ethidium bromide staining are also shown. B: data shown are means ± SE of 5 independent experiments. #P < 0.0001 for Dex-treated cells vs. control and for Dex + Cer-treated cells vs. Dex alone-treated cells. *P < 0.05 for Dex + dihydroceramide-treated cells vs. Dex alone-treated cells.

 
Ceramide response region is located between –236 and –80 bp of SP-B promoter. Our experiments showed that ceramide inhibited SP-B mRNA levels by inhibiting SP-B promoter activity. We mapped SP-B promoter region responsible for ceramide inhibition by deletion analysis. We found that deletion of SP-B 5'-flanking DNA from –991 to –233 bp had no effect on ceramide inhibition of SP-B promoter activity; however, further deletion to –80 bp rendered the promoter insensitive to inhibition, indicating that the SP-B promoter region between –236 and –80 bp contains DNA elements necessary for inhibition (Fig. 5). Deletion of the 5'-region of SP-B flanking DNA resulted in a gradual loss of the promoter activity with the –80/+41-bp fragment retaining 1–5% of the activity of the –911/+41-bp fragment.



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 5. Deletion mapping identifies SP-B promoter region –233/–80 bp to contain Ceramide response DNA elements. SP-B-luciferase promoter plasmids containing 5' deletions were transiently transfected into H441 cells, and transfected cells were incubated in control medium or medium containing Cer (10 µM) for 24 h. Luciferase activity in cell lysates was determined and normalized to cotransfected {beta}-galactosidase activity. A: schematic diagram of SP-B 5'-flanking DNA showing the locations of functionally important DNA elements and the transcription start site. B: data shown are means ± SE of 4 independent experiments. **P < 0.01 for Cer-treated cells vs. control for the –911/+41 and –233/+41 bp constructs. #P < 0.0001 for Cer-treated cells vs. control for the –517/+41 bp construct. TTF, thyroid transcription factor; HNF, hepatocyte nuclear factor; Luc, luciferase.

 
Ceramide decreases TTF-1/Nkx2.1 DNA binding activity. Deletion mapping analysis of SP-B 5'-flanking DNA showed that the ceramide response region is located within –233/–80 bp of promoter region. This region that is part of the SP-B promoter contains functionally important binding sites for HNF-3 and TTF-1 transcription factors (6) (20). As this region contains HNF-3 and TTF-1 DNA binding sites it is possible that ceramide inhibition of SP-B promoter activity is mediated via downregulation of DNA binding activities of these transcription factors. We determined the effect of ceramide on the DNA binding activities of TTF-1 and HNF-3 elements by EMSA. HNF-3 DNA binding activity in H441 cells is mainly due to HNF-3{alpha} as there is no detectable expression of HNF-3{beta} and HNF-3{gamma} (7). Treatment of cells with ceramide (10 µM) resulted in decreased TTF-1 DNA binding activity in a time-dependent manner with significant effects after 24 h of incubation (Fig. 6). In contrast the DNA binding activity of HNF-3 was not affected (Fig. 6). The inactive ceramide analog, dihydroceramide, did not reduce TTF-1 DNA binding activity (data not shown), indicating that the inhibitory effects of ceramide are specific. In separate experiments we found that the nonimmune IgG/serum did not produce supershifted bands with TTF-1 probe, and the TTF-1 antiserum/antibodies produced supershift bands only in A549 cells transfected with a TTF-1 expression plasmid but not in untransfected cells, showing the specificity of the TTF-1 antibody. A549 cells have either very low or undetectable levels of TTF-1. We further assessed the role of TTF-1 and HNF-3 transcription factors in the ceramide inhibition of SP-B promoter activity by determining the effects of ceramide on the transcriptional activities of TTF-1 and HNF-3 reporter plasmids. Reporter constructs containing multiple TTF-1 and HNF-3 binding elements placed upstream of basal SP-B promoter were transfected into H441 cells, and the effect of ceramide on reporter activity was determined. Results (Fig. 7) showed that ceramide inhibited TTF-1 but not HNF-3 reporter expression, indicating that ceramide negatively regulates TTF-1 binding activity resulting in reduced transactivation capability. The significance of an increase in HNF-3 reporter activity in ceramide-treated cells is not clear. Together these data strongly indicate that ceramide downregulates TTF-1 DNA binding to inhibit SP-B promoter activity.



View larger version (121K):
[in this window]
[in a new window]
 
Fig. 6. Ceramide reduces TTF-1 DNA binding activity in H441 cells. H441 cells were incubated in control medium or medium containing Cer (10 µM) for the indicated periods of time, and nuclear extracts were prepared. TTF-1 and HNF-3 DNA binding activities were analyzed by antibody-supershift EMSA and EMSA, respectively. Dotted and solid arrows indicate the mobilities of antibody-protein-DNA and protein-DNA complexes. Similar results were obtained in 3 other independent experiments.

 


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 7. Ceramide reduces TTF-1 reporter activity in H441 cells. A: schematic diagram of the TTF-1 and HNF-3 reporter plasmids. The reporter plasmids contain 4 copies of TTF-1 or HNF-3 binding sequences inserted upstream of –59/+41 bp fragment of human SP-B gene in the pGL3luc(basic) vector. B: H441 cells were transiently transfected with TTF-1 and HNF-3 reporter plasmids along with pcDNA3.1, a {beta}-galactosidase expression plasmid, and then incubated in control medium or medium containing Cer (10 µM) for 24 h. Luciferase activities in cell lysates were determined and normalized to cotransfected {beta}-galactosidase activity. Data shown are means ± SE of 5 independent experiments. ***P < 0.001 for Cer-treated cells vs. control for TTF-1 reporter plasmid; **P < 0.01 for Cer-treated cells vs. control for HNF-3 reporter plasmid.

 
Role of protein kinase signaling pathways in the ceramide inhibition of SP-B mRNA. Many of the effects of cytokines, growth factors, and bioactive lipids on cell growth, differentiation, and gene expression are mediated via protein kinase signaling pathways. To gain insights into signaling pathways and underlying mechanisms that mediate ceramide inhibition of SP-B mRNA, we investigated the effects of chemical inhibitors of various protein kinases on the ceramide inhibition of SP-B mRNA. Our preliminary results showed that ceramide did not activate ERK, p38, and JNK MAPK signaling pathways (Chandru H and Boggaram V, unpublished observations), indicating that these pathways may not be necessary for ceramide inhibition. Inhibition by ceramide was unaffected by the nitric oxide synthase inhibitor nitro-L-arginine methyl ester, indicating that nitric oxide does not mediate inhibition of SP-B mRNA levels (Sparkman L and Boggaram V, unpublished observations). We determined the effects of pretreatment with bisindolylmaleimide I (protein kinase C inhibitor), PP2 (Src kinase inhibitor), genistein (protein tyrosine kinase inhibitor), and dimethylaminopurine (ceramide activated protein kinase inhibitor) on ceramide inhibition of dexamethasone induction of SP-B mRNA. Results (Fig. 8) showed that bisindolylmaleimide I and genistein significantly blocked the inhibitory effects of ceramide. Another protein kinase C inhibitor, Go-6983, also partly reversed ceramide inhibition of SP-B mRNA levels (data not shown), indicating that protein kinase C signaling may be involved in ceramide inhibition. Src kinase inhibitor PP2 synergized dexamethasone induction of SP-B mRNA and appeared to block ceramide inhibition. Analysis of the effect of ceramide on the activation of Src kinase by Western blotting produced negative results, suggesting that the Src kinase signaling pathway may not be involved (data not shown). Further studies are necessary to clarify the role of PP2 and the Src kinase pathway in the ceramide inhibition of SP-B mRNA. The inability of dimethylaminopurine to block ceramide inhibition indicates that ceramide-activated protein kinase signaling pathway may not be necessary for ceramide inhibition.



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 8. Effects of protein kinase inhibitors on Ceramide inhibition of SP-B mRNA levels. H441 cells were first incubated for 2 h in medium containing inhibitors, and then incubation continued with Dex (10–7 M) ± Cer (10 µM) for 24 h. SP-B mRNA levels were analyzed by Northern blotting and normalized to 18S rRNA levels. BIM, bisindolylmaleimide I (5 µM); PP2, 4-amino-5-(4-chlorophenyl)-7-(t-butyl)pyrazolol[3,4-d]pyrimidine (10 µM); Gen, genistein (50 µM); DMAP, dimethylaminopurine (1 mM). Data are means ± SE of 4 independent experiments. **P < 0.01 for Dex vs. control, *P < 0.05 for Dex + PP2 vs. Dex alone, **P < 0.01 for Dex + Cer vs. Dex alone, {dagger}P < 0.05 for BIM + Dex + Cer vs. Dex + Cer, P = 0.052 for Gen + Dex + Cer vs. Dex + Cer.

 
TNF-{alpha} inhibition of SP-B promoter activity and mRNA levels is not mediated via changes in ceramide levels. TNF-{alpha} is a proinflammatory cytokine whose levels are elevated in a number of inflammatory diseases of the lung including ARDS. Activation of sphingomyelinases is an important pathway leading to intracellular increases in ceramide levels, and TNF-{alpha} is a known activator of sphingomyelinases in rat lung (29) and H441 cells (35). TNF-{alpha} inhibits SP-B mRNA levels in mouse lung (26) and H441 cells (4) by posttranscriptional (mRNA stability) and transcriptional mechanisms, respectively. Considering that TNF-{alpha} activates sphingomyelinases to increase ceramide levels in the lung, we sought to understand the role of ceramide in the TNF-{alpha} inhibition of SP-B promoter activity and mRNA levels. De novo ceramide synthesis was blocked with myriocin (14), a specific inhibitor of serine palmitoyl transferase, and sphingomyelin hydrolysis was blocked with imipramine (18) and 3-O-methylsphingomyelin (17), inhibitors of acid and neutral sphingomyelinases, respectively, and the effects of TNF-{alpha} on the inhibition of SP-B promoter activity and SP-B mRNA levels were determined. Results (Fig. 9) showed, consistent with previous findings, that TNF-{alpha} inhibited SP-B promoter activity and SP-B mRNA levels and that inhibition of ceramide synthesis and sphingomyelin hydrolysis had no effect on TNF-{alpha} inhibition. Imipramine and 3-O-methyl sphingomyelin showed modest inhibitory effects on SP-B promoter activity and mRNA levels, whereas myriocin had modest stimulatory effects. These data indicate that TNF-{alpha} inhibition of SP-B promoter activity and mRNA levels is not mediated via changes in the intracellular ceramide levels.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 9. Effects of sphingomyelinase and ceramide synthesis inhibitors on TNF-{alpha} inhibition of SP-B promoter activity and SP-B mRNA levels. A: H441 cells were transiently transfected with a plasmid containing –911/+41 bp of human SP-B 5'-flanking DNA linked to luciferase reporter gene in the vector pGL3luc(basic). Transfected cells were first incubated ± imipramine (25 µM), 3-O-methylsphingomyelin (MSM, 10 µM), or myriocin (1 µM) for 2 h, and then incubation continued ± TNF-{alpha} (25 ng/ml) for an additional 24 h. Luciferase activity in cell lysates was determined and normalized to cotransfected {beta}-galactosidase activity. Data shown are means ± SD of 2 independent experiments. **P < 0.01 for TNF-{alpha} vs. control; P = 0.3 for imipramine + TNF-{alpha} vs. TNF-{alpha} alone; P = 0.29 for 3-O-methylsphingomyelin + TNF-{alpha} vs. TNF-{alpha} alone; P = 0.22 for myriocin + TNF-{alpha} vs. TNF-{alpha} alone. B: H441 cells were first incubated ± imipramine (25 µM), MSM (10 µM), or myriocin (1 µM) for 2 h, and then incubation continued ± TNF-{alpha} for an additional 24 h. SP-B mRNA levels were analyzed by Northern blotting and normalized to 18 S rRNA levels. Data shown are means ± SD of 2 independent experiments. *P < 0.05 for TNF-{alpha} vs. control; P = 0.15 for imipramine + TNF-{alpha} vs. TNF-{alpha} alone; P = 0.14 for MSM + TNF-{alpha} vs. TNF-{alpha} alone; P = 0.22 for myriocin + TNF-{alpha} vs. TNF-{alpha} alone.

 

    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Mediators of acute lung injury such as TNF-{alpha}, PAF, and lipopolysaccharide (LPS) activate sphingomyelinases to increase intracellular ceramide levels. Ceramide has long been recognized as a signaling molecule in the inflammatory response. As surfactant serves important roles in lung stability any alterations in surfactant composition/or function can lead to surfactant dysfunction and susceptibility to lung injury. Recently it was shown that TNF-{alpha}, acting via ceramide (29), and sphingosine (28) decreased surfactant function and the activity of CTP-phosphocholine cytidyltransferase (35), a rate-limiting enzyme in surfactant phospholipid synthesis, respectively, suggesting that surfactant is a key target for the development of inflammation-induced lung injury.

Our data showed that ceramide reduced basal and dexamethasone-induced SP-B mRNA and protein levels in H441 cells. The inhibition was specific for ceramide as the inactive analog dihydroceramide was significantly less effective to repress SP-B mRNA. Metabolites of ceramide such as sphingosine and sphingosine-1-phosphate did not inhibit SP-B mRNA levels, indicating the specificity of ceramide inhibition. Our studies used the semisynthetic and cell-permeable C2-ceramide analog. It is not clear if the inhibitory effects are due to ceramide itself or are mediated by metabolites of ceramide such as ceramide-1-phosphate. Ceramide reduced SP-B promoter activity, indicating that transcriptional mechanisms play important roles in the repression of SP-B gene expression. To our knowledge repression of SP-B gene expression by a bioactive lipid has not been reported previously. The effect of ceramide on the expression of other surfactant protein genes has not yet been investigated. Our preliminary findings showed that ceramide at 10 and 20 µM inhibited SP-A mRNA levels after 24 h of incubation in H441 cells. Our data showing inhibitory effects of ceramide on SP-B gene expression provides a molecular basis for ceramide-mediated lung injury as in the case of ARDS, wherein elevated ceramide levels are detected in the bronchoalveolar lavage fluid (27). There is limited information on ceramide regulation of gene expression in the lung. Ceramide induces cyclooxygenase-2 expression in A549 lung epithelial cells independently of NF-{kappa}B activation (24). Ceramide inhibition of CTP-phosphocholine cytidyltransferase synthesis was attributed to multiple signaling pathways including protein kinase C, p38 MAPK, and cytosolic phospholipase A2 (3). Molecular mechanisms of ceramide regulation of gene expression and associated signaling pathways in the lung remain to be elucidated.

Deletion mapping analysis identified SP-B promoter region between –233 and –80 bp to contain cis-DNA elements necessary for ceramide inhibition. This promoter region contains HNF-3 and TTF-1 sites that are necessary for promoter activity. Ceramide treatment of H441 cells resulted in decreased DNA binding activity of TTF-1/Nkx2.1 and decreased reporter activity from TTF-1 reporter plasmid, whereas the DNA binding and reporter activity of HNF-3 were not affected. Collectively these data suggested that ceramide inhibition of TTF/Nkx2.1 DNA binding activity leads to inhibition of SP-B mRNA levels. SP-B promoter function is sensitive to changes in the helical phasing and orientation of cis-DNA elements (1) and is dependent on the combinatorial interactions between TTF-1, HNF-3, and Sp1/Sp3 transcription factors (20). It is likely that ceramide inhibition of TTF-1/Nkx2.1 DNA binding activity interferes with the assembly of the transcriptional complex resulting in the inhibition of SP-B transcription. Our data showed that ceramide inhibited basal and dexamethasone-induced SP-B mRNA levels. Our data also show that ceramide inhibited SP-B promoter activity, indicating that transcription plays important roles in the inhibition. The inductive effects of dexamethasone are primarily due to enhanced stabilization of SP-B mRNA (21), suggesting that ceramide reduces SP-B mRNA levels in dexamethasone-treated cells by inhibiting transcription. Whether ceramide has any effect on the stability of SP-B mRNA in dexamethasone-treated cells remains to be determined.

TTF-1/Nkx2.1 is a lung- and thyroid-restricted homeodomain-containing transcription factor that is a key activator of surfactant protein gene expression (23). Molecular mechanisms of ceramide inhibition of TTF-1/Nkx2.1 DNA binding activity remain to be determined. TTF-1/Nkx2.1 DNA binding activity is sensitive to changes in the phosphorylation (37) (36) and redox (34) status. As such, ceramide-induced changes in the phosphorylation and/or redox status of TTF-1 could contribute to reduced DNA binding activity. It is unlikely that ceramide-induced changes in TTF-1 redox status are responsible for the reduced TTF-1 DNA binding activity as a number of antioxidants, such as N-acetyl cysteine, reduced glutathione, mannitol, dimethyl sulfoxide, and dimethylthiourea, failed to reverse inhibition of SP-B mRNA (data not shown). Whether ceramide causes changes in the phosphorylation status of TTF-1 to inhibit its DNA binding activity remains to be investigated. Alternatively ceramide could decrease TTF-1 expression to reduce its DNA binding activity. TNF-{alpha} inhibition of SP-B mRNA levels in H441 lung cells has been attributed to reduced TTF-1 binding activity (4).

Our preliminary experiments showed that ceramide did not activate ERK, p38, and JNK MAPK and Src-kinase signaling pathways in H441 cells (data not shown), indicating that ceramide inhibition of SP-B gene expression may be dependent on other signaling pathways. Partial reversal of ceramide inhibition by protein kinase C inhibitors suggests a possible role for protein kinase C signaling in the ceramide inhibition of SP-B gene expression.

TNF-{alpha}, a proinflammatory cytokine, is a key mediator of acute lung injury, and TNF-{alpha} inhibition of surfactant synthesis is a contributing factor for lung injury (16). Our data showed that chemical inhibitors of de novo ceramide synthesis and sphingomyelin hydrolysis did not block TNF-{alpha} inhibition of SP-B promoter activity and mRNA levels, indicating that ceramide does not mediate TNF-{alpha} inhibition. Other mediators of acute lung injury such as PAF and LPS also activate sphingomyelinases to elevate intracellular ceramide levels. It remains to be determined whether PAF and LPS inhibit SP-B gene expression via increases in the intracellular ceramide levels. Ceramide repression of SP-B gene expression provides a molecular basis for surfactant dysfunction in inflammatory diseases such as ARDS.


    GRANTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work has been supported by the National Heart, Lung, and Blood Institute Grant HL-48048.


    ACKNOWLEDGMENTS
 
We thank James B. McKnight for technical assistance and Dr. Barry Starcher and G. Koteswara Rao for help with immunohistochemical detection of SP-B.


    FOOTNOTES
 

Address for reprint requests and other correspondence: V. Boggaram, Dept. of Molecular Biology, 11937 US Highway 271, Tyler, TX 75708-3154 (e-mail: vijay.boggaram{at}uthct.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Alam MN, Berhane K, and Boggaram V. Lung surfactant protein B promoter function is dependent on the helical phasing, orientation and combinatorial actions of cis-DNA elements. Gene 282: 103–111, 2002.[CrossRef][Web of Science][Medline]
  2. Amin RS, Wert SE, Baughman RP, Tomashefski JF Jr, Nogee LM, Brody AS, Hull WM, and Whitsett JA. Surfactant protein deficiency in familial interstitial lung disease. J Pediatr 139: 85–92, 2001.[CrossRef][Web of Science][Medline]
  3. Awasthi S, Vivekananda J, Awasthi V, Smith D, and King RJ. CTP:phosphocholine cytidylyltransferase inhibition by ceramide via PKC-{alpha}, p38 MAPK, cPLA2, and 5-lipoxygenase. Am J Physiol Lung Cell Mol Physiol 281: L108–L118, 2001.[Abstract/Free Full Text]
  4. Berhane K, Margana RK, and Boggaram V. Characterization of rabbit SP-B promoter region responsive to downregulation by tumor necrosis factor-{alpha}. Am J Physiol Lung Cell Mol Physiol 279: L806–L814, 2000.[Abstract/Free Full Text]
  5. Boggaram V. Regulation of lung surfactant protein gene expression. Front Biosci 8: d751–d764, 2003.[Web of Science][Medline]
  6. Bohinski RJ, Di Lauro R, and Whitsett JA. The lung-specific surfactant protein B gene promoter is a target for thyroid transcription factor 1 and hepatocyte nuclear factor 3, indicating common factors for organ-specific gene expression along the foregut axis. Mol Cell Biol 14: 5671–5681, 1994.[Abstract/Free Full Text]
  7. Braun H and Suske G. Combinatorial action of HNF3 and Sp family transcription factors in the activation of the rabbit uteroglobin/CC10 promoter. J Biol Chem 273: 9821–9828, 1998.[Abstract/Free Full Text]
  8. Clark JC, Weaver TE, Iwamoto HS, Ikegami M, Jobe AH, Hull WM, and Whitsett JA. Decreased lung compliance and air trapping in heterozygous SP-B-deficient mice. Am J Respir Cell Mol Biol 16: 46–52, 1997.[Abstract]
  9. Clark JC, Wert SE, Bachurski CJ, Stahlman MT, Stripp BR, Weaver TE, and Whitsett JA. Targeted disruption of the surfactant protein B gene disrupts surfactant homeostasis, causing respiratory failure in newborn mice. Proc Natl Acad Sci USA 92: 7794–7798, 1995.[Abstract/Free Full Text]
  10. Cochrane CG and Revak SD. Pulmonary surfactant protein B (SP-B): structure-function relationships. Science 254: 566–568, 1991.[Abstract/Free Full Text]
  11. Drobnik W, Liebisch G, Audebert FX, Frohlich D, Gluck T, Vogel P, Rothe G, and Schmitz G. Plasma ceramide and lysophosphatidylcholine inversely correlate with mortality in sepsis patients. J Lipid Res 44: 754–761, 2003.[Abstract/Free Full Text]
  12. Goggel R, Winoto-Morbach S, Vielhaber G, Imai Y, Lindner K, Brade L, Brade H, Ehlers S, Slutsky AS, Schutze S, Gulbins E, and Uhlig S. PAF-mediated pulmonary edema: a new role for acid sphingomyelinase and ceramide. Nat Med 10: 155–160, 2004.[CrossRef][Web of Science][Medline]
  13. Gregory TJ, Longmore WJ, Moxley MA, Whitsett JA, Reed CR, Fowler AA III, Hudson LD, Maunder RJ, Crim C, and Hyers TM. Surfactant chemical composition and biophysical activity in acute respiratory distress syndrome. J Clin Invest 88: 1976–1981, 1991.[Web of Science][Medline]
  14. Hanada K, Nishijima M, Fujita T, and Kobayashi S. Specificity of inhibitors of serine palmitoyltransferase (SPT), a key enzyme in sphingolipid biosynthesis, in intact cells. A novel evaluation system using an SPT-defective mammalian cell mutant. Biochem Pharmacol 59: 1211–1216, 2000.[CrossRef][Web of Science][Medline]
  15. Kerr MH and Paton JY. Surfactant protein levels in severe respiratory syncytial virus infection. Am J Respir Crit Care Med 159: 1115–1118, 1999.[Abstract/Free Full Text]
  16. Lewis JF and Jobe AH. Surfactant and the adult respiratory distress syndrome. Am Rev Respir Dis 147: 218–233, 1993.[Web of Science][Medline]
  17. Lister MD, Ruan ZS, and Bittman R. Interaction of sphingomyelinase with sphingomyelin analogs modified at the C-1 and C-3 positions of the sphingosine backbone. Biochim Biophys Acta 1256: 25–30, 1995.[Medline]
  18. Marchesini N and Hannun YA. Acid and neutral sphingomyelinases: roles and mechanisms of regulation. Biochem Cell Biol 82: 27–44, 2004.[CrossRef][Web of Science][Medline]
  19. Margana R, Berhane K, Alam MN, and Boggaram V. Identification of functional TTF-1 and Sp1/Sp3 sites in the upstream promoter region of rabbit SP-B gene. Am J Physiol Lung Cell Mol Physiol 278: L477–L484, 2000.[Abstract/Free Full Text]
  20. Margana RK and Boggaram V. Functional analysis of surfactant protein B (SP-B) promoter. Sp1, Sp3, TTF-1, and HNF-3alpha transcription factors are necessary for lung cell-specific activation of SP-B gene transcription. J Biol Chem 272: 3083–3090, 1997.[Abstract/Free Full Text]
  21. Margana RK and Boggaram V. Transcription and mRNA stability regulate developmental and hormonal expression of rabbit surfactant protein B gene. Am J Physiol Lung Cell Mol Physiol 268: L481–L490, 1995.[Abstract/Free Full Text]
  22. Mathias S, Pena LA, and Kolesnick RN. Signal transduction of stress via ceramide. Biochem J 335: 465–480, 1998.
  23. Mendelson CR. Role of transcription factors in fetal lung development and surfactant protein gene expression. Annu Rev Physiol 62: 875–915, 2000.[CrossRef][Web of Science][Medline]
  24. Newton R, Hart L, Chung KF, and Barnes PJ. Ceramide induction of COX-2 and PGE(2) in pulmonary A549 cells does not involve activation of NF-kappaB. Biochem Biophys Res Commun 277: 675–679, 2000.[CrossRef][Web of Science][Medline]
  25. Nogee LM, de Mello DE, Dehner LP, and Colten HR. Brief report: deficiency of pulmonary surfactant protein B in congenital alveolar proteinosis. N Engl J Med 328: 406–410, 1993.[Free Full Text]
  26. Pryhuber GS, Bachurski C, Hirsch R, Bacon A, and Whitsett JA. Tumor necrosis factor-{alpha} decreases surfactant protein B mRNA in murine lung. Am J Physiol Lung Cell Mol Physiol 270: L714–L721, 1996.[Abstract/Free Full Text]
  27. Rauvala H and Hallman M. Glycolipid accumulation in bronchoalveolar space in adult respiratory distress syndrome. J Lipid Res 25: 1257–1262, 1984.[Abstract]
  28. Ryan AJ, Fisher K, Thomas CP, and Mallampalli RK. Transcriptional repression of the CTP:phosphocholine cytidylyltransferase gene by sphingosine. Biochem J 382: 741–750, 2004.[CrossRef][Web of Science][Medline]
  29. Ryan AJ, McCoy DM, McGowan SE, Salome RG, and Mallampalli RK. Alveolar sphingolipids generated in response to TNF-{alpha} modifies surfactant biophysical activity. J Appl Physiol 94: 253–258, 2003.[Abstract/Free Full Text]
  30. Salinas D, Sparkman L, Berhane K, and Boggaram V. Nitric oxide inhibits surfactant protein B gene expression in lung epithelial cells. Am J Physiol Lung Cell Mol Physiol 285: L1153–L1165, 2003.[Abstract/Free Full Text]
  31. Schreiber E, Matthias P, Muller MM, and Schaffner W. Rapid detection of octamer binding proteins with 'mini-extracts', prepared from a small number of cells. Nucleic Acids Res 17: 6419, 1989.[Free Full Text]
  32. Singh S and Aggarwal BB. Activation of transcription factor NF-kappa B is suppressed by curcumin (diferuloylmethane). J Biol Chem 270: 24995–25000, 1995.[Abstract/Free Full Text]
  33. Spiegel S and Milstien S. Sphingosine-1-phosphate: an enigmatic signalling lipid. Nat Rev Mol Cell Biol 4: 397–407, 2003.[CrossRef][Web of Science][Medline]
  34. Tell G, Pines A, Paron I, D'Elia A, Bisca A, Kelley MR, Manzini G, and Damante G. Redox effector factor-1 regulates the activity of thyroid transcription factor 1 by controlling the redox state of the N transcriptional activation domain. J Biol Chem 277: 14564–14574, 2002.[Abstract/Free Full Text]
  35. Vivekananda J, Smith D, and King RJ. Sphingomyelin metabolites inhibit sphingomyelin synthase and CTP:phosphocholine cytidylyltransferase. Am J Physiol Lung Cell Mol Physiol 281: L98–L107, 2001.[Abstract/Free Full Text]
  36. Yan C and Whitsett JA. Protein kinase A activation of the surfactant protein B gene is mediated by phosphorylation of thyroid transcription factor 1. J Biol Chem 272: 17327–17332, 1997.[Abstract/Free Full Text]
  37. Zannini M, Acebron A, De Felice M, Arnone MI, Martin-Perez J, Santisteban P, and Di Lauro R. Mapping and functional role of phosphorylation sites in the thyroid transcription factor-1 (TTF-1). J Biol Chem 271: 2249–2254, 1996.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
A. Das and V. Boggaram
Proteasome dysfunction inhibits surfactant protein gene expression in lung epithelial cells: mechanism of inhibition of SP-B gene expression
Am J Physiol Lung Cell Mol Physiol, January 1, 2007; 292(1): L74 - L84.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
290/2/L351    most recent
00275.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sparkman, L.
Right arrow Articles by Boggaram, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sparkman, L.
Right arrow Articles by Boggaram, V.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2006 by the American Physiological Society.