AJP - Lung Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 290: L385-L395, 2006. First published September 30, 2005; doi:10.1152/ajplung.00098.2005
1040-0605/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
290/2/L385    most recent
00098.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (11)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Matsushima, R.
Right arrow Articles by Yasuoka, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Matsushima, R.
Right arrow Articles by Yasuoka, S.

Human airway trypsin-like protease stimulates human bronchial fibroblast proliferation in a protease-activated receptor-2-dependent pathway

Rie Matsushima,1 Akira Takahashi,1 Yutaka Nakaya,1 Hiroshi Maezawa,2 Mari Miki,3 Yoichi Nakamura,3 Fumitaka Ohgushi,3 and Susumu Yasuoka1

1Department of Nutrition and Metabolism, Graduate School of Nutrition and Bioscience, and 2Department of Medical Sciences, School of Medicine, University of Tokushima, Tokushima; and 3Department of Clinical Investigation, National Hospital Organization, Kochi National Hospital, Kochi City, Japan

Submitted 2 March 2005 ; accepted in final form 21 September 2005


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Human airway trypsin-like protease (HAT) was isolated from airway secretions and localized to bronchial epithelial cells by immunohistochemistry. In the present study, we examined whether HAT could stimulate DNA synthesis and proliferation of primary human bronchial fibroblasts (HBF). HAT significantly stimulated the proliferation of HBF by 20–55%, a level similar to that of the mitogenic activity of lung mast cell tryptase (MCT). HAT also stimulated the incorporation of [3H]thymidine in HBF, and this HAT-induced DNA synthesis was abolished by leupeptin. Protease-activated receptor-2 (PAR-2) mRNA was expressed and localized to the cell surface in HBF. PAR-2 activating peptide (AP) also enhanced DNA synthesis, and both HAT and PAR-2 AP induced receptor internalization, similar to the response to trypsin. Pretreatment of HBF with anti-PAR-2 antibody significantly suppressed both HAT and PAR-2 AP-induced DNA synthesis. In addition, HAT and PAR-2 AP induced intracellular Ca2+ mobilization in HBF. The HAT-induced increase in Ca2+ was desensitized by pretreatment with trypsin or PAR-2 AP. U0126, a specific MAPK inhibitor, completely inhibited HAT-induced DNA synthesis as well as HAT-induced phosphorylation of MAPK. The effect of HAT and MCT together was additive, whereas the effect of HAT and insulin together on HBF DNA synthesis was synergistic. These results indicate that HAT stimulates fibroblast proliferation in bronchial airways through a PAR-2-dependent MEK-MAPK mediated pathway and that HAT is linked to airway processes involving fibroblasts.

mast cell tryptase; mitogen-activated protein kinase


HUMAN AIRWAY TRYPSIN-LIKE PROTEASE (HAT) is a novel monomeric serine protease with a molecular size of 27 kDa (36). Analysis of the nucleotide sequence of cloned HAT cDNA suggests that HAT is originally translated as a precursor with a molecular size of 48 kDa, whose NH2-terminal proximal region contains a hydrophobic putative transmembrane domain (35). On the basis of the predicted structure, the HAT precursor is thought to be a member of the type II transmembrane serine protease family, which includes corin, enteropeptidase, MT-SP1 (also known as matriptase), and hepsin (16). An immunohistochemical analysis of human airway tissues using a HAT-specific monoclonal antibody showed that the HAT protein was found specifically in ciliated epithelial cells, but not in goblet cell and submucosal gland (31). These observations suggest that HAT might be responsible for regulating some biological processes in airway epithelial layers.

Fibroblast proliferation is involved not only in regeneration and repair of injured or damaged tissues, but also in tissue fibrosis and remodeling (28). Previous studies showed that fibroblasts are involved in fibrosis and remodeling in chronic airway diseases and that fibrogenic mediators released from airway epithelial cells regulate fibroblast proliferation (9, 17, 24, 26, 30). Serine proteases such as thrombin and mast cell tryptase (MCT) have been reported to stimulate fibroblast proliferation, suggesting that they may mediate lung fibrosis and remodeling (1, 6, 15, 27, 28, 33). HAT is a trypsin-like serine protease localized to airway epithelial cells. Therefore, we hypothesized that HAT mediates not only regeneration of airway walls but also remodels airways by stimulating fibroblast proliferation.

Recently, serine proteases such as thrombin, trypsin, and MCT have been shown to regulate biological functions in various kinds of cells via a new class of cell surface receptor, the protease-activated receptor (PAR). Four PARs, PAR-1, PAR-2, PAR-3, and PAR-4 have been identified. These receptors are G protein-coupled receptors that are activated by cleavage of their NH2-terminal domains by serine proteases (13). PAR-2 is activated by trypsin family proteases such as trypsin and MCT (11, 13, 23). Miki et al. (22) have shown that HAT increased the intracellular Ca2+ concentration by activating PAR-2 in primary human bronchial epithelial cells. Recently, we have shown that HAT cleaves a synthetic peptide corresponding to the NH2 terminus of PAR-2 at the receptor activating site in vitro, as does trypsin (unpublished observations). This result is consistent with HAT activation of PAR-2.

Thus in the present study, we found that HAT stimulates human bronchial and lung fibroblast proliferation in vitro. Our results also indicate that HAT stimulates fibroblast proliferation via PAR-2.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Reagents and antibodies. For recombinant HAT (rHAT), 60 U/mg of protein and two kinds of rabbit polyclonal antibody against rHAT and PAR-2 were supplied from Teijin Institute for Bio-Medical Research, Tokyo, Japan. rHAT in PBS containing 0.01% BSA was sterilized by filtration through a Millipore polyvinylidene difluoride membrane (0.22 µm, low-protein binding). Human MCT was purified from human lung tissues by a modification of the method of Smith et al. (29), as previously reported (36). [Methyl-3H]thymidine (sp act 2.9 Ci/mmol) was purchased from Perkin Elmer Life Science (Boston, MA). Bovine insulin and human holotransferrin were purchased from Sigma (St. Louis, MO). PAR-1 activating peptide (PAR-1 AP, TFLLR-NH2) and PAR-2 activating peptide (PAR-2 AP, SLIGKV-NH2) were purchased from Bachem (Bubendorf, Switzerland). Human pancreas trypsin was purchased from Athens Research & Technology (Athens, GA). Human thrombin was purchased from MP Biomedicals (Aurora, OH). U0126, a specific inhibitor of MEK, was obtained from Promega (Madison, WI). Anti-phospho-p44/42 MAPK (Thr202/Tyr204) antibody and anti-p44/42 MAPK antibody were purchased from Cell Signaling Technology (Beverly, MA). Alexa Fluor 488-labeled goat anti-rabbit IgG was purchased from Molecular Probes (Eugene, OR). Streptavidin-horseradish peroxidase conjugate was purchased from Biosource (Camarillo, CA).

Gel filtration of mucoid sputum extract and measurement of HAT. Gel filtration of mucoid sputum extract on Sephadex G-200 was carried out as previously described (37), using elution buffer (0.05 M Tris, 0.30 M NaCl, pH 7.4). HAT content was measured by ELISA using a rHAt primary antibody, secondary anti-rabbit biotinylated antibody, and streptavidin-peroxidase. Purified rHAT was used as a standard.

Collection of mucoid sputum. Mucoid sputum samples were obtained from 86 patients, 40–70 yr old, who had chronic airway diseases, including bronchial asthma. Samples were collected in a plastic container in an ice bath and kept at –80°C until use.

Cells and cell cultures. The human lung fibroblasts (HLF) were obtained from lung tissues of patients that had undergone resection of localized lung tumors. Before the operation, written informed consent was obtained from patients after a full explanation of the procedures involved. The experimental procedure was approved by the Ethics Committee at the University of Tokushima. For parenchymal lung fibroblasts, tissue was carefully cut into 3- to 5-mm pieces. The pieces were placed into a 6-cm diameter dish (Falcon BD Labware, Lincoln Park, NJ) with 2 ml of DMEM (Sigma) supplemented with 10% FBS and gentamicin (100 mg/ml) and incubated at 37°C in a humidified atmosphere of 5% CO2 and 95% air. When the tissue had firmly attached to the plastic surface, a further 4 ml of culture medium were slowly added to the dish and incubated, as described above. The medium was changed every 2 days.

For human bronchial fibroblasts (HBF), the bronchial tissues were carefully dissected free of parenchymal connective tissue, and a 4- to 5-mm piece of tissue was cultured, as described for the lung fibroblasts. After 3 wk in culture, fibroblasts had grown out from the explanted tissues. These cells were cultured for at least a further 2 wk until confluent islands of cells were observed. The cultures were then passaged with a split ratio of 1:2 into 75-cm2 dishes containing culture medium. Thereafter, confluent cells were passaged with a split ratio of 1:4. Experiments were performed with cells between passages 2 and 6.

Measurement of DNA synthesis. The trypsinized fibroblasts were washed with DMEM twice, suspended in DMEM/10% FBS at a density of 40,000 cells/ml, and cultured in 100 µl of DMEM with 10% FBS in a 96-well plate (Falcon BD Labware) at 37°C in a 5% CO2 incubator for 48–72 h until 50–70% confluent. Unless otherwise stated, the cells were then rendered quiescent by incubating them in serum-free DMEM containing holotransferrin (1 µg/ml) and BSA (100 µg/ml; DMEM/0.01% BSA) for a further 24 h. The quiescent fibroblasts were incubated for 48 h with a test protease in 100 µl of the same medium in the presence of [3H]thymidine (0.5 µCi/ml). After incubation, 50 µl of 1 N NaOH were added to each well. The lysed cell plates were transferred to a specific glass fiber filter using a harvester (Filtermate 196/micromate 196; Packard, Meriden, CT). Incorporation of [3H]thymidine into the cells was measured using a Matrix 9600 direct beta counter (Packard) and expressed as counts per minute. Six replicate wells were used to test the effects of each growth factor on the fibroblasts and another six-well replicate well without growth factors served as controls.

Cell proliferation assay. HBF were seeded at 4,000 cells/well into a 96-well plate containing 100 µl of DMEM/10% FBS until 70–80% confluent. Then they were cultured in serum-free DMEM/0.1% BSA for 24 h, stimulated with HAT for 48 h in the same medium, harvested from the plate by trypsinization, and counted in a hemocytometer, as described by Tani et al. (33).

RT-PCR analysis of mRNA for PAR-2 in HBF. HBF were seeded into 6-cm cell culture dishes and incubated until confluent. Total cellular RNA was extracted from the cells using Isogen (Nippon Gene, Tokyo, Japan) according to the manufacturer's instructions. RT-PCR procedures were carried out as described previously (22). Sense (CAGTTGGGTCTGAATTGTGTCG) and antisense (TGCACGAGCTTATGCTGCTGAC) primers for PCR of PAR-2 RNA were supplied by the Teijin Institute for Bio-Medical Research. The expected PCR product was a 491-bp fragment for PAR-2. GAPDH was used as an internal control. The PCR products were electrophoresed on 1.5% agarose gels and stained with ethidium bromide. Semiquantitative measurement of each mRNA was done using VersaDoc (Bio-Rad). The PAR-2 mRNA was normalized to GAPDH mRNA.

Immunofluorescent localization of PAR-2. After activation of PAR-2 on cell surfaces by trypsin, PAR-2 is internalized into early endosomes and lysosomes, indicating that activated PAR-2 was endocytosed and degraded (12–14). To clarify whether intracellular mobilization of the PAR-2 receptor occurs after HAT stimulation, we carried out the following morphological examinations. HBFs were cultured in chambered glass slides (Nalge Nunc, Rochester, NY) in DMEM/10% FBS for 2–3 days until 60–70% confluent. After incubation for 24 h in DMEM/0.01% BSA, the cells were stimulated with test protease or agonist (HAT, trypsin, thrombin, PAR-1 AP, or PAR-2 AP). Cells at 5 min after stimulation were fixed with acetone at –20°C for 20 min. The intracellular mobilization of PAR-2 was observed by indirect immunofluorescence using an anti-PAR-2 antibody according to the method of Iwakiri et al. (18). Briefly, the acetone-fixed cells were pretreated with 10% normal goat serum for 20 min and then incubated overnight at 4°C with a 1:400 dilution of rabbit polyclonal anti-PAR-2. After being washed several times with PBS, the cells were incubated with a 1:200 dilution of Alexa Fluor 488-labeled goat anti-rabbit IgG for 60 min at room temperature in the dark. Nuclear counterstaining was performed using 20 µg/ml ethidium bromide for 30 min at room temperature. Fluorescent images of cell sections excited at 488 and 560 nm were captured using a confocal laser scanning microscope (Leica TCS NT, Heidelberg, Germany) equipped with an argon-krypton laser source. In Fig. 6, PAR-2 is shown in green, and nuclei are shown in red. As a control, the immunostaining procedure was performed with normal rabbit IgG instead of PAR-2 antibody.



View larger version (146K):
[in this window]
[in a new window]
 
Fig. 6. Immunofluorescent localization of PAR-2 in HAT-treated HBF cells. HBF were cultured in chambered slides in DMEM/10% FBS for 2–3 days to 60–70% confluence. After incubation for 24 h in DMEM/0.01% BSA, they were incubated with 10 nM HAT, 10 nM trypsin, 200 µM PAR-2 AP, 10 nM thrombin, or 200 µM PAR-1 AP for 5 min at 37°C. Cells were then fixed with cold acetone and immunostained for PAR-2 as described in MATERIALS AND METHODS. A: control (no stimulation). PAR-2 was expressed on the cell surface of HBF. B: cells treated with 10 nM HAT for 5 min show PAR-2 internalization. Both 10 nM trypsin (C) and 200 µM PAR-2 AP (D) treatment for 5 min induced mobilization of PAR-2 in HBF. In contrast, significant mobilization of PAR-2 in HBF was not seen with either 10 nM thrombin (E) or 200 µM PAR-1 AP (F) treatment for 5 min induced. Arrows show PAR-2 localization.

 
To estimate the degree of internalization of PAR-2 after stimulation by the agonist, the fluorescent images of PAR-2 on the cell surface were enclosed and analyzed by Image-Pro Plus version 4.5 (Media Cybernetics, Silver Spring, MD) and expressed as percentages of the control value.

Measurement of intracellular calcium concentration. The concentration of intracellular free Ca2+ ([Ca2+]i) was evaluated by microfluorometry using fura-2 AM (Dojindo, Kumamoto, Japan) at excitation wavelengths of 340 and 380 nm and an emission wavelength of 510 nm with a specially designed chamber and an ARGUS-50/CA system (Hamamatsu Photonics, Tokyo, Japan). In each experiment, the ratio of fluorescence at 340 nm to that at 380 nm was determined in 10–15 cells selected by the system.

HBF in DMEM/10% FBS were grown to 60–70% confluence on glass coverslips in a 12-well plate. The culture medium was changed to DMEM/0.1% BSA, and the cells were cultured for 24 h. The cells were then washed with HEPES-buffered solution (HBS; 10 mM HEPES, 145 mM NaCl, 5 mM KCl, 1 mM CaCl2, 1 mM MnCl2, and 10 mM glucose, pH 7.4) containing 0.1% BSA, incubated in HBS with 2 µM fura-2 AM and 0.2% Pluronic (Dojindo) for 20 min at 37°C, and washed twice with dye-free HBS. The coverslips were inserted into the chamber kept at 37°C and perfused with the same solution containing test samples for 15–30 min.

Immunoblotting. HBFs were seeded into 6- or 10-cm dishes and cultured in DMEM/10% FBS until 70–80% confluent. The culture medium was changed to DMEM/0.01% BSA, and the cells were cultured for an additional 24 h. The fibroblasts were stimulated with HAT for 5–120 min. To examine the effects of the agonists on phosphorylation of MAPK, fibroblasts were stimulated with the agonists in 6-cm dishes. After stimulation, cells were washed with ice-cold PBS and incubated in 1 ml of ice-cold cell lysis buffer consisting of 20 mM Tris·HCl (pH 7.5), 150 mM NaCl, 1 mM Na2EDTA, 1 mM EGTA, 1% Triton, 2.5 mM sodium pyrophosphate, 1 mM {beta}-glycerophosphate, 1 mM Na3VO4, and 1 µg/ml leupeptin for 5 min. The cells were then scraped off the dishes and transferred to microcentrifuge tubes, sonicated in an ice-bath for 30 s, and microcentrifuged at 14,000 rpm for 5 min at 4°C. Clear supernatants were collected, and protein content was determined using a bicinchoninic acid protein assay reagent kit (Pierce, Rockford, IL). Aliquots of cell lysates containing the same amount of protein were adjusted to a volume of 100 µl, mixed with 100 µl of 2x SDS sample buffer, and boiled for 5 min, and 10 µl of the sample were separated by SDS-PAGE on a 7–15% gradient gel (Dai-ichi-Kagaku, Tokyo, Japan). Prestained broad-range protein standards (Promega) were used to estimate molecular mass. The proteins were transferred to a polyvinylidene difluoride membrane (Immobilon, Dai-ichi-Kagaku). For detection of phospho-p44/42 MAPK and p44/42 MAPK, rabbit polyclonal antibodies that detect only phosphorylated MAPK or detect MAPK regardless of its phosphorylation status, respectively, were used. A peroxidase-conjugated anti-rabbit antibody was used as the secondary antibody. Positive reactivity was detected using the ECL chemiluminescence kit (Amersham Biosciences, Piscataway, NJ). Signals were detected on X-ray film.

Assay of trypsin-like activity. Trypsin-like activity was measured by the method of Yasuoka et al. (36).

Statistical analysis. Data are represented as means ± SE. P values were determined by Bonferroni-Duncan multiple-comparison test, and a P < 0.05 value was considered to be statistically significant.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Gel filtration of mucoid sputum extract. Figure 1 shows the elution pattern of trypsin-like activity during gel filtration on a Sephadex G-200 column loaded with a mucoid sputum extract. Trypsin-like activity was detected only in tubes 44–54 with a peak of activity in tube 48. The peak of purified rHAT was located in tube 48, and the peak of purified lung MCT was located in tube 34 (data not shown). The elution profile of HAT (ng/ml), as measured by the ELISA, was almost identical to that of trypsin-like activity. Similar results were obtained using 15 different mucoid sputum extracts. The HAT concentration in the mucoid sputum samples varied from 50 to 2,700 ng/ml, with a mean value of 408 (±SE of ±54, n = 86).



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 1. Sephadex G-200 filtration of mucoid sputum extract from a patient with chronic bronchitis is depicted. Two milliliters of mucoid sputum extract were subjected to gel filtration on Sephadex G-200 (column 2.2 x 65 cm). Elution was carried out at a flow rate of 15 ml/h at 4°C, and 4-ml fractions were collected. Trypsin-like activity was measured by using t-butyloxycarbonyl-L-phenylalanyl-L-seryl-L-arginine-4-methyl-coumaryl-7-amide as a substrate. HAT, human airway trypsin-like protease.

 
Effect of HAT on HBF and HLF proliferation. To examine whether HAT induces proliferation of HBF, HBF at 70–80% confluence were stimulated with HAT in DMEM/0.1% BSA for 48 h. As shown in Table 1, HAT at 12.5–100 nM significantly increased HBF cell number in a dose-dependent manner by up to 53%. The effect of HAT was reproducible in five separate experiments. MCT at 50 nM and thrombin at 10 nM increased cell numbers by 60 and 77%, respectively (Table 1). These results indicate that HAT induces proliferation of HBF, and that, at equimolar concentrations, HAT has similar activity to that of MCT, but lower activity than that of thrombin.


View this table:
[in this window]
[in a new window]
 
Table 1. Effect of HAT on proliferation of primary human bronchial fibroblasts

 
In the following experiments, the stimulatory effect of HAT on fibroblast proliferation was estimated by measuring the incorporation of [3H]thymidine. As shown in Fig. 2, A and B, HAT at 10–100 nM significantly increased [3H]thymidine incorporation in HBF and HLF at 70–80% confluence in a dose-dependent manner. The stimulatory effect of HAT on [3H]thymidine incorporation (percent relative to control) was similar in HBF and HLF and ~3.5 ± 1.5-fold higher than control levels at 100 nM HAT.



View larger version (11K):
[in this window]
[in a new window]
 
Fig. 2. Effect of HAT on DNA synthesis in human bronchial fibroblasts (HBF; A) and human lung fibroblasts (HLF; B). Serum-starved cells were stimulated with increasing concentrations of HAT (0.4–400 mU/ml, 0.1–100 nM) for 48 h in 96-well microplates. DNA synthesis was estimated by [3H]thymidine incorporation as described in MATERIALS AND METHODS. Data are presented as means ± SE from 6 wells. *P < 0.05 compared with control. cpm, Counts per minute.

 
The absolute value of HAT-induced [3H]thymidine incorporation in both HBF and HLF was greater in confluent cells than in the cells at 70–80% confluence. However, the percent increase relative to the control was more marked in cells at 70–80% confluence mainly because the control level in confluent cells was higher than in subconfluent cells. Therefore, in the following experiments, the effect of HAT on [3H]thymidine incorporation (DNA synthesis in fibroblasts) was tested with cells at 70–80% confluence.

Effect of protease inhibitor on HAT-induced DNA synthesis in HBF. Leupeptin, a serine protease inhibitor, is known to inhibit the peptidolytic activity of HAT (36). Leupeptin at 50 µM almost completely abolished DNA synthesis induced by 50 nM HAT in HBF (Fig. 3). The addition of the inhibitor alone showed no significant effect on the basal level of [3H]thymidine incorporation. Moreover, the inactivation of HAT enzymatic activity by heating at 95°C also abolished its ability to stimulate DNA synthesis (data not shown). These results indicate that the DNA synthesis-stimulating activity of HAT is due to its proteolytic activity.



View larger version (11K):
[in this window]
[in a new window]
 
Fig. 3. Effect of the protease inhibitor leupeptin on HAT-induced DNA synthesis in HBF. Serum-starved HBF were stimulated with 50 nM HAT for 24 h in the presence or absence of 50 µM leupeptin. Data are presented as means ± SE from 6 wells. *P < 0.05 compared with control.

 
Expression of PAR-2 mRNA in HBF. Recent investigations have shown that serine proteases such as trypsin and MCT regulate cellular functions of various cells via PAR-2 (1, 35, 8, 12, 14). Thus we postulated that HAT stimulated DNA synthesis in HBF via activation of PAR-2. First, we estimated the expression of PAR-2 mRNA in HBF. Total RNA obtained from the HBF cultures was subjected to RT-PCR analysis for detection of PAR-2 mRNA. As shown in Fig. 4, A and B, expression of PAR-2 mRNA was observed in HBF as well as in HLF.



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 4. Analysis of expression of protease-activated receptor (PAR)-2 mRNA in HBF by RT-PCR. HBF were grown in DMEM/10% FBS in a 60-mm dish. Total RNA was extracted from the cells and subjected to RT-PCR for PAR-2 as described in MATERIALS AND METHODS. Some of the products (cDNA) were amplified for 30 cycles with specific primer (denaturation at 85°C for 45 s, annealing at 58°C for 45 s, and elongation at 72°C for 2 min). GAPDH mRNA was used as a control of PAR-2 mRNA. PCR was performed for 30 cycles (denaturation at 85°C for 45 s, annealing at 50°C for 45 s, and elongation at 72°C for 1 min). A: electrophoresis on a 1.5% agarose gel of the PCR products. Molecular markers (100-bp step ladder, Promega) were used to verify the sizes of the RT-PCR products. B: relative levels of mRNA PAR-2/GAPDH.

 
Effect of anti-PAR-2 antibody on HAT-induced DNA synthesis in HBF. We evaluated the effect of an anti-PAR-2 antibody on HAT-induced DNA synthesis in HBF. The anti-PAR-2 antibody at 1–10 µg/ml significantly suppressed HAT-induced DNA synthesis by 30–35% compared with that of the control incubated in the absence of antibody (Fig. 5). PAR-2 AP-stimulated DNA synthesis in HBF was also suppressed by 30–40% by antibody treatment (Fig. 5). Both thrombin (10 nM) and PAR-1 AP (200 µM) stimulated DNA synthesis in HBF, to levels similar to those observed at 50 nM HAT. However, thrombin and PAR-1 AP-induced DNA synthesis were not significantly suppressed by the anti-PAR-2 antibody.



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 5. Effect of anti-PAR-2 antibody (Ab) on HAT-induced DNA synthesis in HBF. Experimental procedures were essentially the same as those for Fig. 2. Serum-starved cells were stimulated with HAT (50 nM), PAR-2 activating peptide (AP; 200 µM), thrombin (10 nM), or PAR-1 AP (200 µM) after they had been preincubated in the presence or absence of various concentrations of an anti-PAR-2 antibody (0.1–10 µg/ml) for 1 h. Data are presented as means ± SE from 6 wells. *P < 0.05 compared with response in the absence of antibody. Bars indicate treatment groups being compared.

 
Immunofluorescence examination of the effect of HAT on PAR-2 in HBF. Before HAT exposure (0 min), the PAR-2 protein was clearly localized along the cell surface and at the perinuclear envelope in HBF cells (Fig. 6A), in addition to a small number of reactive granules in the cytoplasm. The intensity of PAR-2 expression on the cell surface almost completely disappeared by 5 min after stimulation with 50 nM HAT (Fig. 6B). HAT concentrations ranging from 10 to 100 nM induced internalization of PAR-2 (data not shown). Both trypsin (10 nM) and PAR-2 AP (200 µM), known to stimulate PAR-2, induced internalization of PAR-2 to the same extent as HAT treatment (Fig. 6, C and D). In contrast, human thrombin (10 nM) and PAR-1 AP (200 µM) treatment showed no significant effect on localization of PAR-2 in HBF (Fig. 6, E and F) but did stimulate DNA synthesis (Fig. 5).

To estimate the degree of PAR-2 internalization, the change in surface PAR-2 fluorescence intensity after PAR-2 AP stimulation for 0–30 min was analyzed by using Image-Pro software. After stimulation with 50 nM HAT, the fluorescence intensity decreased to ~10% of that of the control at 5 min, and the decrease continued for 30 min (Fig. 7). Trypsin at 10 nM and PAR-2 AP at 200 µM also decreased the fluorescence intensity almost to the same extent as 50 nM HAT, whereas 10 nM thrombin and 200 µM PAR-1 AP caused no significant decrease (Fig. 7).



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 7. Internalization of PAR-2 in HBF after stimulation with HAT and other substances. Experimental procedures were essentially the same as those described in the Fig. 6. The change in surface PAR-2 fluorescence intensity after agonist stimulation was analyzed by Image-Pro software as described in MATERIALS AND METHODS. Results are expressed as a percentage of the surface PAR-2 immunoreactivity of unstimulated cells, and means ± SE of the fluorescence of 6 cells were expressed as a % of the control.

 
Effect of HAT on [Ca2+]i in HBF. An increase in [Ca2+]i occurs after activation of PARs by their agonists (5, 32). Therefore, we can use the increase in [Ca2+]i as a measure of the activation of PARs by different agonists. Figure 8 shows the [Ca2+]i in HBF in response to HAT, trypsin, and PAR-2 AP. When HBF were stimulated with 10 or 50 nM trypsin, a rapid initial elevation of [Ca2+]i, which declined over 3–6 min, was found. When HBF were stimulated with 100 nM HAT, a peak of elevation of [Ca2+]i was found within 3–6 min after onset of stimulation. The peak Ca2+ response to 100 nM HAT was similar to that elicited by 10 nM trypsin. Only a minor increase in [Ca2+]i was detectable when HBF were stimulated with 20 nM HAT. PAR-2 AP also elevated [Ca2+]i, and the peaks of Ca2+ release elicited by 100 and 500 µM PAR-2 AP were similar to that seen in response to 10 and 100 nM HAT, respectively. HBF cells also responded to 1 µM bradykinin with elevated [Ca2+]i. The peak Ca2+ response to 1 µM bradykinin was similar to that of 50 nM trypsin (data not shown).



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 8. Effect of HAT on intracellular free Ca2+ concentration ([Ca2+]i) in HBF. HBF grown on 13 x 13 coverslips in a 12-well plate in DMEM/10% FBS to 60–70% confluence were cultured in DMEM/0.1% BSA for 24 h. Cells were loaded with 2 µM fura-2 AM in the presence of 0.2% Pluronic for 20 min in HEPES-buffered solution (HBS) at 37°C. [Ca2+]i was evaluated by microfluorometry as described in MATERIALS AND METHODS and expressed as the ratio of fluorescence intensity at 340 nm to that in 380 nm. The coverslips were inserted into a temperature-controlled chamber kept at 37°C and perfused with the same buffer containing the indicated agonists, trypsin, HAT, or PAR-2 AP, for 15–30 min.

 
Next, we examined desensitization of PAR-2 in HBF by sequential exposure to agonists at 3-min intervals without an intervening washout. As shown in Fig. 9A, 50 nM trypsin treatment almost completely abolished or markedly reduced the Ca2+ response to a second exposure of 50 nM trypsin or 500 µM PAR-2 AP, but did not affect the Ca2+ response to 1 µM bradykinin. Similarly, 500 µM PAR-2 AP treatment markedly reduced the Ca2+ response after a second exposure to 500 µM PAR-2 AP or 50 nM trypsin but did not affect the Ca2+ response to 1 µM bradykinin (Fig. 9B). Consistent with these results, 100 nM HAT reduced or abolished the Ca2+ response to a second exposure to 100 nM HAT, 50 nM trypsin, or 500 µM PAR-2 AP but did not affect the Ca2+ response to a second exposure to 1 µM bradykinin (Fig. 9C). These results indicate that HAT, trypsin, and PAR-2 AP cause intracellular Ca2+ mobilization in HBF via a common receptor, PAR-2.



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 9. Desensitization of the Ca2+ response to trypsin, PAR-2 AP, or HAT in HBF. The experimental procedures were essentially the same as those for Fig. 8. HBF were exposed to the first agonist in HBS. Then they were exposed to a second agonist 5 min after application of the first agonist, without an intervening wash. The agonists and concentrations were: 50 nM trypsin, 500 µM PAR-2 AP, 100 nM HAT, and 1 µM bradykinin. The first agonists are trypsin (A), PAR-2 AP (B), or HAT (C), and the second agonists are indicated on each graph.

 
Involvement of the MEK-MAPK cascade in HAT-induced stimulation of DNA synthesis. Previous work has shown that the p44/42 MAPK (ERK1/2), a key component for mitogenic signal transduction, is phosphorylated as a result of PAR-2 activation (12, 34). U0126, a specific inhibitor of MEK, was used to examine whether MAPK mediates DNA synthesis in HAT-treated HBF cultures. As shown in Fig. 10, 50 nM HAT induced DNA synthesis in HBF, and this response was almost completely inhibited in the presence of 20 nM U0126.



View larger version (11K):
[in this window]
[in a new window]
 
Fig. 10. Effect of U0126, an MEK inhibitor, on HAT-induced DNA synthesis in HBF. Unless otherwise stated, experimental procedures were essentially the same as those for Fig. 2. HBF were stimulated with 50 nM HAT in the presence or absence of 10 or 20 nM U0126 for 48 h, and [3H]thymidine incorporation was measured, as described in MATERIALS AND METHODS. Data are presented as means ± SE from 6 wells. *P < 0.05 compared with response in the absence of antibody.

 
When HBF were stimulated with 1–100 nM HAT for 15 min, MAPK was phosphorylated, as shown by Western blotting with a phospho-MAPK-specific antibody. MAPK phosphorylation was most pronounced at 100 nM HAT (Fig. 11A). Moreover, HAT treatment induced p44/42 MAPK phosphorylation in a time-dependent manner, and the strongest phosphorylation was obtained at 5–15 min. Phosphorylation of MAPK was almost completely suppressed by 20 nM U0126 (data not shown).



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 11. Effect of HAT on phosphorylation of MAPK (p42/44, ERK1/2) in HBF. After HBF were grown to 70–80% confluence in 6-cm dishes in DMEM/10% FBS, they were starved in DMEM/0.01% BSA for 24 h. The cells were then stimulated with HAT for 15 min at 37°C. Phosphorylation of MAPK was analyzed by Western blotting as described in MATERIALS AND METHODS. Phosphorylated MAPK (top) and total MAPK (bottom) were measured using an anti-phosphorylated-MAPK antibody and an anti-MAPK antibody, respectively. A: effect of HAT concentration. Cells incubated with increasing concentrations of HAT showed increased phosphorylation of MAPK (top). The total amounts of MAPK present in the cell lysates are the same (bottom). B: time course of MAPK phosphorylation. Serum-starved HBF were exposed to 50 nM HAT for the indicated time periods, and cell lysates were analyzed as in A. MW, molecular weight.

 
Effect of HAT on DNA synthesis in HBF in the presence of MCT. It has been reported that MCT stimulates the proliferation of human lung fibroblasts and airway smooth muscle cells via PAR-2 (1, 4). Therefore, we examined the relationship between the stimulatory effect of HAT and MCT on DNA synthesis in HBF. MCT caused a dose-dependent increase in [3H]thymidine incorporation within the same range of concentrations as those of HAT (Fig. 12A). On the other hand, trypsin at 50 nM was only weakly stimulatory and at >100 nM damaged the cells (data not shown). When HBFs were stimulated with MCT at 0–120 nM with HAT at a concentration (15 nM) that only slightly increased [3H]thymidine incorporation over that of the control, [3H]thymidine incorporation was higher than that with MCT alone. However, no synergistic effect of HAT and MCT was observed (Fig. 12B). In contrast, a prominent synergistic effect between 15 nM HAT and insulin was observed when HBFs were stimulated with insulin at 1–100 µg/ml in the presence of HAT at 15 nM (Fig. 12C). These results show that the stimulation of [3H]thymidine incorporation by HAT in the presence of MCT was additive. The result in Fig. 12B supports the idea that both HAT and MCT stimulate DNA synthesis mainly via PAR-2 and that HAT acts synergistically with other substances, such as insulin, that stimulate fibroblast proliferation via receptors other than PAR-2.



View larger version (11K):
[in this window]
[in a new window]
 
Fig. 12. Effect of mast cell tryptase (MCT) on DNA synthesis in HBF in the presence of HAT. Unless otherwise stated, experimental procedures were essentially the same as those described in Fig. 2. A: HBF were stimulated with various concentrations of MCT. B: HBF were stimulated with MCT in presence of 16 nM HAT. C: HBF were stimulated with insulin in the presence of 16 nM HAT. *P < 0.05 compared with control.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
MCT (2, 30) and HAT (37) are thought to be the main trypsin-like enzymes released into human bronchial airways. Our previous study revealed that trypsin-like activity was detectable only in the fractions where HAT was eluted and not in fractions containing MCT. In the present study, ELISA and gel filtration assays confirmed that HAT is the predominant trypsin-like protease in mucoid sputum samples. In addition, the immunohistochemical study showed that HAT is localized to airway epithelial cells (31), suggesting that HAT is released into the airway wall during airway disease where it acts as a paracrine factor on cells adjacent to epithelial cells.

In the present study, direct cell counting showed that HAT at 10–100 nM stimulated by 53% the proliferation of subconfluent HBF, whereas MCT is known to be a potent mitogen for fibroblasts (1, 8, 15, 27). Our data show that the stimulatory effect of HAT on proliferation of HBF is similar to that of lung MCT but lower than that of thrombin.

The concentration of HAT, as measured by ELISA, in the mucoid sputum samples from patients with chronic airway diseases varies widely from 50 to 2,700 ng/ml, corresponding to a concentration of 2–100 nM. The HAT concentrations on the surfaces of the fibroblasts in bronchial airways are likely to be higher than those measured in airway secretions because HAT released into the airway lumen is diluted by airway secretions. Moreover, HAT seems to act in concert with other fibroblast growth factors. These results strongly suggest that in airway diseases, HAT is released into the airways at concentrations high enough to stimulate fibroblast proliferation.

In the present study, leupeptin almost completely inhibited HAT-induced DNA synthesis in HBF, suggesting that the peptidolytic activity of HAT is markedly inhibited by this serine protease inhibitor (36). The inactivation of HAT enzymatic activity by heating also abolished DNA synthesis. These results indicate that HAT enzymatic activity is required to stimulate DNA synthesis in fibroblasts and suggest that HAT activates some cell surface receptors by limited proteolysis.

It is well known that PARs are localized on the cell surface of various kinds of cells and activated by serine proteases such as thrombin and trypsin family proteases. In the present study, expression of PAR-2 mRNA in HBF as well as HLF was clearly shown by RT-PCR. Akers et al. (1) have also demonstrated expression of PAR-2 mRNA in primary HLF by RT-PCR. Indirect immunofluorescence showed localization of PAR-2 on the cell surface of HBF. PAR-2 is activated by trypsin and MCT, whereas PAR-1, PAR-3, and PAR-4 are activated by thrombin (3, 11, 13, 20, 23). We postulated that HAT might stimulate DNA synthesis via activation of PAR-2 because HAT belongs to the trypsin family of proteases (35, 36).

When PAR-2 on the cell surface is activated by agonists such as trypsin, it is internalized into early endosomes and then lysosomes, and endocytosis is {beta}-arrestin dependent (12, 14). Additionally, Iwakiri at el. (18) have reported that HAT induced PAR-2 internalization in a human keratinocyte cell line (HaCat). Therefore, the internalization of PAR-2 is thought to be an important measure of PAR-2 activation by an agonist. In the present immunofluorescence study, we demonstrated that in HBF, internalization of PAR-2 occurs within 5 min after stimulation with 10–100 nM HAT, 10 nM trypsin, or 200 µM PAR-2 AP. No internalization was observed after stimulation with 10 nM thrombin or 200 µM PAR-1 AP. These results support the hypothesis that HAT stimulates DNA synthesis in HBF via activation of PAR-2. Moreover, 10–100 nM HAT rapidly increased intracellular Ca2+ in HBF. This HAT-induced increase of intracellular Ca2+ was desensitized by pretreatment with trypsin, a known PAR-2 agonist, or by a synthetic PAR-2 AP. Previous investigations have shown that the trypsin-induced increase of intracellular Ca2+ concentration is mediated by activation of a heterotrimeric G protein coupled to PAR-2, and Miki et al. (22) also demonstrated that HAT increased intracellular Ca2+ in primary human bronchial epithelial cells via PAR-2.

Trypsin cleaves the extracellular NH2- terminus of PAR-2 at a specific activation site that exposes a "tethered ligand" with the sequence SLIGKV. The newly generated ligand binds to the second extracellular loop and activates the receptor (11, 13). Molino et al. (23) demonstrated that MCT cleaved a synthetic peptide corresponding to the NH2 terminus of PAR-2 at the activating site in a manner similar to that of trypsin activity. Recently, we found that that 10–100 nM HAT also cleaves a peptide corresponding to the NH2 terminus of PAR-2 at the activating site (unpublished observation). This result also supports the hypothesis that HAT can activate PAR-2 in HBF and other cells. PAR-2 is coupled to Gq/11 and phospholipase C, leading to hydrolysis of phosphatidylinositol bisphosphate, Ca2+ mobilization, and activation of PKC and MAPK (12, 25). In the present study, U0126 inhibited the HAT-induced DNA synthesis in HBF, and HAT induced phosphorylation of MAPK, as shown by Western blot analysis. In addition, U0126 almost completely inhibited HAT-induced phosphorylation of MAPK as detected by Western blot analysis. These results suggest that an MAPK cascade mediates HAT-induced fibroblast proliferation and also support the hypothesis that HAT stimulates DNA synthesis in HBF via PAR-2.

The results shown in Fig. 12, B and C, support the idea that both HAT and MCT stimulate DNA synthesis mainly via PAR-2 and that HAT acts synergistically with other substances, such as insulin, that stimulate fibroblast proliferation via receptors other than PAR-2. Airway fibroblast proliferation may be regulated by a network of various kinds of fibrogenic mediators, which may be classified into two groups: nonenzymatic substances and serine proteases, including HAT, MCT, and thrombin. Ammit et al. (2) have reported that mast cell number is nearly the same in nonsensitized and sensitized human bronchi, including the epithelium, lamina propria, and adventitia, but is higher in the smooth muscle of sensitized bronchi. These findings indicate that MCT is released into not only the subepithelial layer but also into the epithelial layer of airways. However, the immunohistochemical study using anti-MCT antibody did not detect MCT in extracellular spaces, probably because MCT concentration is lower in the extracellular space compared with the concentration in mast cells (2). Like in the case of MCT, immunohistochemical examination using anti-HAT antibody also did not detect HAT in the extracellular spaces of airways (31). However, HAT is thought to be released from epithelial cells not only into the epithelial layer but also into the subepithelial layer during inflammation and tissue damage. Nakamura et al. (24) showed that bronchial epithelial cells regulate fibroblast proliferation by releasing both growth-stimulating factors and growth-inhibiting factors. Cambrey et al. (9) showed that primary human airway epithelial cells produce insulin-like growth factor I, which stimulates fibroblast proliferation. These reports indicate that the mediators released from bronchial epithelial cells may be related to peribronchial fibrosis. The results of the present study strongly suggest that HAT is one of the fibrogenic mediators released from airway epithelial cells.

Even in healthy individuals, the mucous membranes of airways are frequently injured by various kinds of inhaled toxic substances and infectious agents. In patients with chronic airway diseases, the mucous membranes of airways are more often injured than in healthy subjects due to the chronic inflammation associated with immunological responses and infection. Under these circumstances, fibroblasts proliferate and participate in the regeneration of tissues both in the normal and disease states, as well as in the progression of tissue fibrosis and remodeling in chronic inflammation (17, 19, 26, 28). The pathophysiological roles of fibroblasts may differ depending on the circumstances. For instance, fibroblasts are involved in such remodeling events as the thickening of the subepithelial layer following the deposition of interstitial collagen and fibronectin in chronic bronchial asthma (7, 17) and in the regeneration of tissue during acute inflammation of bronchial airways. The results of the present study strongly suggest that HAT may function to regulate fibroblast proliferation and that it might be involved in certain airway processes during chronic or acute airway diseases.

Recently, we found that HAT stimulates synthesis of IL-8 in primary bronchial epithelial cells via PAR-2 activation (21, 22). Therefore, HAT is thought to be involved in regulation of the biological function of airway epithelial cells via PAR-2. Chokki et al. (10) reported that HAT stimulates mucus production in NCI-H292 cells. Together with previous reports, the present results lead us to propose that HAT may be involved primarily in the defense of airways in healthy as well as diseased individuals and that it may lead to an amplification of the pathological state in chronic airway diseases. Further study will be necessary to clarify whether HAT is involved in the amplification of the subepithelial fibrosis associated with bronchial asthma.


    ACKNOWLEDGMENTS
 
The authors thank Dr. Hiroshi Eguchi and his colleagues at Teijin Institute for Bio-Medical Research, Tokyo, Japan, for the kind gifts of human airway trypsin-like protease, its polyclonal antibodies, and a polyclonal antibody to PAR-2.


    FOOTNOTES
 

Address for reprint requests and other correspondence: R. Matsushima, Dept. of Nutrition and Metabolism, Graduate School of Nutrition and Bioscience, Univ. of Tokushima, 3-18-15 Kuramoto-cho, Tokushima, Japan 770-8503 (e-mail: rie{at}nutr.med.tokushima-u.ac.jp)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Akers IA, Parsons M, Hill MR, Hollenberg MD, Sanjar S, Laurent GJ, and McAnulty RJ. Mast cell tryptase stimulates human lung fibroblast proliferation via protease-activated receptor-2. Am J Physiol Lung Cell Mol Physiol 278: L193–L201, 2000.[Abstract/Free Full Text]
  2. Ammit AJ, Bekir SS, Johnson PR, Hughes JM, Armour CL, and Black JL. Mast cell numbers are increased in the smooth muscle of human sensitized isolated bronchi. Am J Respir Crit Care Med 155: 1123–1129, 1997.[Abstract]
  3. Belham CM, Tate RJ, Scott PH, Pemberton AD, Miller HR, Wadsworth RM, Gould GW, and Plevin R. Trypsin stimulates proteinase-activated receptor-2-dependent and -independent activation of mitogen-activated protein kinases. Biochem J 320: 939–946, 1996.[Web of Science][Medline]
  4. Berger P, Perng DW, Thabrew H, Compton SJ, Cairns JA, McEuen AR, Marthan R, Tunon De Lara JM, and Walls AF. Tryptase and agonists of PAR-2 induce the proliferation of human airway smooth muscle cells. J Appl Physiol 91: 1372–1379, 2001.[Abstract/Free Full Text]
  5. Berger P, Tunon-De-Lara JM, Savineau JP, and Marthan R. Selected contribution: tryptase-induced PAR-2-mediated Ca2+ signaling in human airway smooth muscle cells. J Appl Physiol 91: 995–1003, 2001.[Abstract/Free Full Text]
  6. Bogatkevich GS, Tourkina E, Silver RM, and Ludwicka-Bradley A. Thrombin differentiates normal lung fibroblasts to a myofibroblast phenotype via the proteolytically activated receptor-1 and a protein kinase C-dependent pathway. J Biol Chem 276: 45184–45192, 2001.[Abstract/Free Full Text]
  7. Brewster CE, Howarth PH, Djukanovic R, Wilson J, Holgate ST, and Roche WR. Myofibroblasts and subepithelial fibrosis in bronchial asthma. Am J Respir Cell Mol Biol 3: 507–511, 1990.[Web of Science][Medline]
  8. Cairns JA and Walls AF. Mast cell tryptase stimulates the synthesis of type I collagen in human lung fibroblasts. J Clin Invest 99: 1313–1321, 1997.[Web of Science][Medline]
  9. Cambrey AD, Kwon OJ, Gray AJ, Harrison NK, Yacoub M, Barnes PJ, Laurent GJ, and Chung KF. Insulin-like growth factor I is a major fibroblast mitogen produced by primary cultures of human airway epithelial cells. Clin Sci 89: 611–617, 1995.[Medline]
  10. Chokki M, Yamamura S, Eguchi H, Masegi T, Horiuchi H, Tanabe H, Kamimura T, and Yasuoka S. Human airway trypsin-like protease increases mucin gene expression in airway epithelial cells. Am J Respir Cell Mol Biol 30: 470–478, 2004.[Abstract/Free Full Text]
  11. Cottrell GS, Amadesi S, Schmidlin F, and Bunnett N. Protease-activated receptor 2: activation, signalling and function. Biochem Soc Trans 31: 1191–1197, 2003.[Web of Science][Medline]
  12. DeFea KA, Zalevsky J, Thoma MS, Dery O, Mullins RD, and Bunnett NW. {beta}-Arrestin-dependent endocytosis of proteinase-activated receptor 2 is required for intracellular targeting of activated ERK1/2. J Cell Biol 148: 1267–1281, 2000.[Abstract/Free Full Text]
  13. Dery O, Corvera CU, Steinhoff M, and Bunnett NW. Proteinase-activated receptors: novel mechanisms of signaling by serine proteases. Am J Physiol Cell Physiol 274: C1429–C1452, 1998.[Abstract/Free Full Text]
  14. Dery O, Thoma MS, Wong H, Grady EF, and Bunnett NW. Trafficking of proteinase-activated receptor-2 and {beta}-arrestin-1 tagged with green fluorescent protein. {beta}-Arrestin-dependent endocytosis of a proteinase receptor. J Biol Chem 274: 18524–18535, 1999.[Abstract/Free Full Text]
  15. Hartmann T, Ruoss SJ, Raymond WW, Seuwen K, and Caughey GH. Human tryptase as a potent, cell-specific mitogen: role of signaling pathways in synergistic responses. Am J Physiol Lung Cell Mol Physiol 262: L528–L534, 1992.[Abstract/Free Full Text]
  16. Hooper JD, Clements JA, Quigley JP, and Antalis TM. Type II transmembrane serine proteases. Insights into an emerging class of cell surface proteolytic enzymes. J Biol Chem 276: 857–860, 2001.[Free Full Text]
  17. Hoshino M, Nakamura Y, and Sim JJ. Expression of growth factors and remodelling of the airway wall in bronchial asthma. Thorax 53: 21–27, 1998.[Abstract]
  18. Iwakiri K, Ghazizadeh M, Jin E, Fujiwara M, Takemura T, Takezaki S, Kawana S, Yasuoka S, and Kawanami O. Human airway trypsin-like protease induces PAR-2-mediated IL-8 release in psoriasis vulgaris. J Invest Dermatol 122: 937–944, 2004.[CrossRef][Web of Science][Medline]
  19. Kelley J. Cytokines of the lung. Am Rev Respir Dis 141: 765–788, 1990.[Web of Science][Medline]
  20. Knight DA, Lim S, Scaffidi AK, Roche N, Chung KF, Stewart GA, and Thompson PJ. Protease-activated receptors in human airways: upregulation of PAR-2 in respiratory epithelium from patients with asthma. J Allergy Clin Immunol 108: 797–803, 2001.[CrossRef][Web of Science][Medline]
  21. Miki M, Nakamura Y, and Yasuoka S. Human airway trypsin-like protease (HAT) enhances synthesis of interleukin-8 in bronchial epithelial cells. Proc Airway Sec Res IV: 45–54, 2002.
  22. Miki M, Nakamura Y, Takahashi A, Nakaya Y, Eguchi H, Masegi T, Yoneda K, Yasuoka S, and Sone S. Effect of human airway trypsin-like protease on intracellular free Ca2+ concentration in human bronchial epithelial cells. J Med Invest 50: 95–107, 2003.[Medline]
  23. Molino M, Barnathan ES, Numerof R, Clark J, Dreyer M, Cumashi A, Hoxie JA, Schechter N, Woolkalis M, and Brass LF. Interactions of mast cell tryptase with thrombin receptors and PAR-2. J Biol Chem 272: 4043–4049, 1997.[Abstract/Free Full Text]
  24. Nakamura Y, Tate L, Ertl RF, Kawamoto M, Mio T, Adachi Y, Romberger DJ, Koizumi S, Gossman G, Robbins RA, Spurzem JR, and Rennard SI. Bronchial epithelial cells regulate fibroblast proliferation. Am J Physiol Lung Cell Mol Physiol 269: L377–L387, 1995.[Abstract/Free Full Text]
  25. Pages G, Lenormand P, L'Allemain G, Chambard JC, Meloche S, and Pouyssegur J. Mitogen-activated protein kinases p42mapk and p44mapk are required for fibroblast proliferation. Proc Natl Acad Sci USA 90: 8319–8323, 1993.[Abstract/Free Full Text]
  26. Roche WR, Beasley R, Williams JH, and Holgate ST. Subepithelial fibrosis in the bronchi of asthmatics. Lancet 1: 520–524, 1989.[CrossRef][Web of Science][Medline]
  27. Ruoss SJ, Hartmann T, and Caughey GH. Mast cell tryptase is a mitogen for cultured fibroblasts. J Clin Invest 88: 493–499, 1991.[Web of Science][Medline]
  28. Sappino AP, Schurch W, and Gabbiani G. Differentiation repertoire of fibroblastic cells: expression of cytoskeletal proteins as marker of phenotypic modulations. Lab Invest 63: 144–161, 1990.[Web of Science][Medline]
  29. Smith TJ, Hougland MW, and Johnson DA. Human lung tryptase. Purification and characterization. J Biol Chem 259: 11046–11051, 1984.[Abstract/Free Full Text]
  30. Sommerhoff CP. Mast cell tryptases and airway remodeling. Am J Respir Crit Care Med 164: S52–S58, 2001.[Abstract/Free Full Text]
  31. Takahashi M, Sano T, Yamaoka K, Kamimura T, Umemoto N, Nishitani H, and Yasuoka S. Localization of human airway trypsin-like protease in the airway: an immunohistochemical study. Histochem Cell Biol 115: 181–187, 2001.[Web of Science][Medline]
  32. Tanaka N, Morita T, Nezu A, Tanimura A, Mizoguchi I, and Tojyo Y. Thrombin-induced Ca2+ mobilization in human gingival fibroblasts is mediated by protease-activated receptor-1 (PAR-1). Life Sci 73: 301–310, 2003.[Medline]
  33. Tani K, Yasuoka S, Ogushi F, Asada K, Fujisawa K, Ozaki T, Sano N, and Ogura T. Thrombin enhances lung fibroblast proliferation in bleomycin-induced pulmonary fibrosis. Am J Respir Cell Mol Biol 5: 34–40, 1991.[Medline]
  34. Temkin V, Kantor B, Weg V, Hartman ML, and Levi-Schaffer F. Tryptase activates the mitogen-activated protein kinase/activator protein-1 pathway in human peripheral blood eosinophils, causing cytokine production and release. J Immunol 169: 2662–2669, 2002.[Abstract/Free Full Text]
  35. Yamaoka K, Masuda K, Ogawa H, Takagi K, Umemoto N, and Yasuoka S. Cloning and characterization of the cDNA for human airway trypsin-like protease. J Biol Chem 273: 11895–11901, 1998.[Abstract/Free Full Text]
  36. Yasuoka S, Ohnishi T, Kawano S, Tsuchihashi S, Ogawara M, Masuda K, Yamaoka K, Takahashi M, and Sano T. Purification, characterization, and localization of a novel trypsin-like protease found in the human airway. Am J Respir Cell Mol Biol 16: 300–308, 1997.[Abstract]
  37. Yoshinaga S, Nakahori Y, and Yasuoka S. Fibrinogenolytic activity of a novel trypsin-like enzyme found in human airway. J Med Invest 45: 77–86, 1998.[Medline]



This article has been cited by other articles:


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
E. Ostrowska, E. Sokolova, and G. Reiser
PAR-2 activation and LPS synergistically enhance inflammatory signaling in airway epithelial cells by raising PAR expression level and interleukin-8 release
Am J Physiol Lung Cell Mol Physiol, November 1, 2007; 293(5): L1208 - L1218.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
G. Skibinski, J. S. Elborn, and M. Ennis
Bronchial epithelial cell growth regulation in fibroblast cocultures: the role of hepatocyte growth factor
Am J Physiol Lung Cell Mol Physiol, July 1, 2007; 293(1): L69 - L76.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
N. Beaufort, D. Leduc, H. Eguchi, K. Mengele, D. Hellmann, T. Masegi, T. Kamimura, S. Yasuoka, F. Fend, M. Chignard, et al.
The human airway trypsin-like protease modulates the urokinase receptor (uPAR, CD87) structure and functions
Am J Physiol Lung Cell Mol Physiol, May 1, 2007; 292(5): L1263 - L1272.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
R. Ramachandran, L. R. Sadofsky, Y. Xiao, A. Botham, M. Cowen, A. H. Morice, and S. J Compton
Inflammatory mediators modulate thrombin and cathepsin-G signaling in human bronchial fibroblasts by inducing expression of proteinase-activated receptor-4
Am J Physiol Lung Cell Mol Physiol, March 1, 2007; 292(3): L788 - L798.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
E. Bottcher, T. Matrosovich, M. Beyerle, H.-D. Klenk, W. Garten, and M. Matrosovich
Proteolytic Activation of Influenza Viruses by Serine Proteases TMPRSS2 and HAT from Human Airway Epithelium
J. Virol., October 1, 2006; 80(19): 9896 - 9898.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
R. Ramachandran, A. H. Morice, and S. J. Compton
Proteinase-Activated Receptor2 Agonists Upregulate Granulocyte Colony-Stimulating Factor, IL-8, and VCAM-1 Expression in Human Bronchial Fibroblasts
Am. J. Respir. Cell Mol. Biol., July 1, 2006; 35(1): 133 - 141.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
290/2/L385    most recent
00098.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (11)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Matsushima, R.
Right arrow Articles by Yasuoka, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Matsushima, R.
Right arrow Articles by Yasuoka, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2006 by the American Physiological Society.