AJP - Lung Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Lung Cell Mol Physiol 290: L777-L789, 2006. First published November 18, 2005; doi:10.1152/ajplung.00293.2005
1040-0605/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
290/4/L777    most recent
00293.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van Tuyl, M.
Right arrow Articles by Post, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van Tuyl, M.
Right arrow Articles by Post, M.

Iroquois genes influence proximo-distal morphogenesis during rat lung development

Minke van Tuyl,1,2 Jason Liu,1 Freek Groenman,1,2 Ross Ridsdale,1 Robin N. N. Han,1 Vikram Venkatesh,1 Dick Tibboel,4 and Martin Post1,2,3

1Lung Biology Program, Hospital for Sick Children Research Institute, Toronto; Departments of 2Pediatrics and 3Physiology, University of Toronto, Toronto, Canada; and 4Department of Pediatric Surgery, Sophia Children's Hospital, Erasmus University Medical Centre Rotterdam, Rotterdam, The Netherlands

Submitted 6 July 2005 ; accepted in final form 9 November 2005


   ABSTRACT
TOP
 ABSTRACT
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Lung development is a highly regulated process directed by mesenchymal-epithelial interactions, which coordinate the temporal and spatial expression of multiple regulatory factors required for proper lung formation. The Iroquois homeobox (Irx) genes have been implicated in the patterning and specification of several Drosophila and vertebrate organs, including the heart. Herein, we investigated whether the Irx genes play a role in lung morphogenesis. We found that Irx1–3 and Irx5 expression was confined to the branching lung epithelium, whereas Irx4 was not expressed in the developing lung. Antisense knockdown of all pulmonary Irx genes together dramatically decreased distal branching morphogenesis and increased distention of the proximal tubules in vitro, which was accompanied by a reduction in surfactant protein C-positive epithelial cells and an increase in beta-tubulin IV and Clara cell secretory protein positive epithelial structures. Transmission electron microscopy confirmed the proximal phenotype of the epithelial structures. Furthermore, antisense Irx knockdown resulted in loss of lung mesenchyme and abnormal smooth muscle cell formation. Expression of fibroblast growth factors (FGF) 1, 7, and 10, FGF receptor 2, bone morphogenetic protein 4, and Sonic hedgehog (Shh) were not altered in lung explants treated with antisense Irx oligonucleotides. All four Irx genes were expressed in Shh- and Gli2-deficient murine lungs. Collectively, these results suggest that Irx genes are involved in the regulation of proximo-distal morphogenesis of the developing lung but are likely not linked to the FGF, BMP, or Shh signaling pathways.

Iroquois homeobox genes; differentiation; sonic hedgehog; fibroblast growth factor; bone morphogenic protein 4

DURING DEVELOPMENT, THE MAMMALIAN LUNG establishes a large diffusible interface with the circulation to facilitate respiratory gas exchange at birth. To form such a large surface area, the developing lung undergoes epithelial airway branching and differentiation while the pulmonary mesenchyme provides the vascular, smooth muscle, and cartilage tissue. Although the exact molecular signals guiding lung development are unknown, several morphogenetic factors have been implicated (56, 60). One of them, Sonic hedgehog (Shh), a vertebrate homolog of Drosophila hedgehog (Hh), is expressed in the lung epithelium (57). The Gli1–3 genes, the vertebrate counterparts of Cubitus interruptus (Ci), which is the principal effector of Hh signaling in Drosophila, are expressed in distinct but overlapping domains in the lung mesenchyme, with highest expression in distal tips (57). Null mutant mice for Shh and the Gli genes all exhibit a mild or severe lung phenotype, from minor lobar defects and lung hypoplasia to lung agenesis (23, 35, 40, 43, 45). Downstream targets for Gli proteins remain to be elucidated. In Drosophila, Ci may regulate the activity of the Iroquois complex of homeobox genes (20). The Iroquois complex (Iro-C) contains three highly related homeobox genes: araucan, caupolican, and mirror, which are members of an evolutionary conserved family of homeodomain containing transcription factors.

In the fruit fly, araucan and caupolican are positive controllers of the proneural genes achaete and scute and vein-forming genes (20). During wing formation, araucan and caupolican are positively controlled by Ci and Decapentaplegic (Dpp) (22). The Iro-C homeoproteins are essential for dorso-ventral patterning of the Drosophila eye, head, and follicle (12, 13, 29, 36). In Xenopus, the amphibian homologs of Iroquois, Xiro1 and Xiro2, control the expression of proneural genes, and similar to araucan and caupolican, Xiro1 and Xiro2 are positively controlled by Ci (21). More recently, Gómez-Skarmeta et al. (19) showed that in Xenopus neural development, Xiro1 represses bone morphogenetic protein (BMP) 4 and that the expression of Xiro requires Wnt signaling. BMP4, a member of the transforming growth factor-beta (TGF-beta) superfamily of proteins and the vertebrate counterpart of Drosophila Dpp, plays a major role in lung morphogenesis. Both overexpression and inhibition of BMP4 signaling result in abnormal lung branching in mice (4, 52, 61).

Six vertebrate homologs of the Iroquois genes, Irx1–6, have been identified. The six members are organized in two cognate clusters of three genes each, Irx1, Irx2, Irx4 and Irx3, Irx5, Irx6, respectively (47). In most tissues, the pattern of expression of the clustered genes, especially of Irx1 and Irx2 and of Irx3 and Irx5, respectively, closely resemble each other (25). The Irx genes show temporal and spatial restricted expression patterns during murine neural and cardiac development (7, 8, 10, 16, 17, 41). In the chicken, Irx4 regulates chamber-specific gene expression (1).

Based on the aforementioned reports, we investigated whether the Irx genes are part of either the Shh/Gli and/or BMP4 signaling pathway that controls lung branching morphogenesis. Because Irx6 is very weakly expressed and in a very restrictive pattern (41) we focused on Irx1–5. We found that Irx1, Irx2, Irx3, and Irx5, but not Irx4, are specifically expressed in developing lung epithelium during the period of active airway branching. Inhibition of Irx signaling in vitro resulted in grossly abnormal lungs with decreased branching and epithelial proximalization of the lung. Addition of BMP4 did not recover the observed lung phenotype, suggesting that BMP4 is not a downstream target of Irx in the developing lung. Furthermore, we observed that Irx inhibition had no effect on Shh expression and that the Irx genes were normally expressed in Shh–/– and Gli2–/– mutant lungs, suggesting that they do not function up- or downstream in the Shh/Gli signaling pathway.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Animals. All rat and mouse protocols were in accordance with Canadian Counsel of Animal Care guidelines and were approved by the Animal Care and Use Committee of the Hospital for Sick Children (Toronto, ON, Canada). Female and male Wistar rats were obtained from Charles River (St. Constant, Quebec, Canada) and were bred in our animal facilities. Rats were killed at embryonic days (E) 13.5–20.5 of gestation (term = 22 days). Shh, Gli2, and Gli3 heterozygous (Shh+/–, Gli2+/–, Gli3+/–) mice were obtained from Dr. C. C. Hui (Hospital for Sick Children). The Shh, Gli2, and Gli3 genotypes were established by PCR analysis of genomic DNA (15).

Lung organ culture. Rat embryos were obtained from timed-pregnant rats at E13.5 (morning of plug is designated as E0.5). Lungs were dissected under sterile conditions and placed on floating 8-µm Whatman Nuclepore polycarbonate membranes (Integra Environmental Burlington, ON, Canada). Explants were cultured in Dulbecco's modified Eagle medium (DMEM; GIBCO-BRL, Grand Island, NY) with 10% (vol/vol) fetal bovine serum and maintained in 20% O2/5% CO2 at 37°C. Medium and oligodeoxynucleotides (ODNs) were changed every other day. Antisense, sense, and scrambled Irx ODNs were added to a final concentration of 20 µM. Recombinant human BMP4 (R&D Systems, Minneapolis, MN) was used in a concentration of 200 ng/ml. All explant experiments were carried out in triplicate and were repeated at least three times.

Antisense Irx oligonucleotide inhibition. A phosphorothioate oligonucleotide, 5'-ATGTCCTTCCCCCAGC'-3, targeted against the translation initiation site of rat and murine Irx3 has an overlap of 81% with the translation initiation sites of both murine Irx2 and Irx5 and a 95% overlap with the translation initiation site of murine Irx1 used to target rat Irx1, Irx2, Irx3, and Irx5 gene expression. Sense oligonucleotide (5'-GCTGGGGGAAGGACAT-3') and scrambled sequence oligonucleotide (5'-CCGATGGCAGTGGAGA-3') were used as controls.

Probes. The Irx1, Irx2, Irx3, and Irx5 cDNAs were a gift from Dr. V. M. Christoffels (Academic Medical Centre, Amsterdam, The Netherlands) (16). The Irx4 cDNA was obtained from Dr. B. G. Bruneau (Hospital for Sick Children). Plasmid containing mouse Mash-1 cDNA was obtained from Dr. S. E. Egan (Hospital for Sick Children). Murine surfactant protein (SP)-C and Clara cell secretory protein (CCSP) cDNA fragments were cloned by RT-PCR. Sense and antisense riboprobes for Irx1 (1050 bp), Irx2 (1800 bp), Irx3 (1000 bp), Irx4 (1050 bp), Irx5 (950 bp), Mash-1 (2.8 kb), surfactant protein C (SP-C; 330 bp), and Clara cell secretory protein (CCSP, 315 bp) were digoxigenin (DIG) labeled according to a protocol provided by the manufacturer (Roche, Montreal, PQ, Canada).

RNA extraction and RT-PCR. Total RNA was isolated by using RNeasy total RNA kit (Qiagen, Chatham, CA), and RT-PCR was performed as described previously (59). Primer sequences (from 5' to 3'), size of amplification products, number of cycles, and annealing temperature were: fibroblast growth factor (FGF) 1 GCCATAGTGAGTCCGAGGACC and ACCGAGAGGTTCAACCTGCC, 387 bp, 35 cycles, 55°C (42); FGF7 CTTCCCTTTGACAGGAATCCCCTT and ATCCTGCCAACTCTGCTCTACAGA, 509 bp, 35 cycles, 60°C (48); FGF10 AAGCTCTTGGTCAGGACATGGTGT and TCCATTCAATGCCACATACATTTG, 458 bp, 25 cycles, 55°C (33); FGF receptor (FGFR) 2 AAGGTTTACAGCGATGCCCA and ACCACCATGCAGGCGATTAA, 345 bp, 35 cycles, 47°C (18); and BMP4 TCCATCACGAAGAACATC and TAGTCGTGTGATGAGGTG, 220 bp, 35 cycles, 56°C (52).

In situ hybridization. Isolated lungs and cultured lung explants were fixed in 4% (vol/vol) paraformaldehyde (PFA) in PBS at 4°C for 4–18 h, dehydrated in ethanol, and embedded in paraplast. Sections of 12 µm were cut and mounted on Superfrost slides (Fisher Scientific, Unionville, ON, Canada). The lungs were then assayed for nonradioactive RNA in situ hybridization according to Moorman et al. (39). In brief, after being dewaxed and rehydrated, tissue sections were permeabilized with proteinase K (20 µg/ml), postfixed in 4% PFA and 0.2% glutaraldehyde, and prehybridized for 1 h at 70°C. The sections were hybridized overnight at 70°C with DIG-labeled riboprobes for Irx1–5, SP-C, or CCSP (1 µg/ml). The next day, sections were washed in 50% formamide in 2x SSC, pH 4.5, at 65°C followed by PBS-T (PBS containing 0.1% Tween 20). Subsequently, the sections were incubated with anti-DIG alkaline phosphatase diluted 1:1,000 in blocking solution (Roche) at 4°C. The next day, sections were washed in PBS-T followed by washes in 100 mM NaCl, 100 mM Tris, pH 9.5, 50 mM MgCl2 and then incubated with 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium chromogen. (Roche) at room temperature until a purple color appeared (4–5 h). All slides for one probe were stopped at the same time to make comparison over different stages of development possible. After color development, sections were washed in distilled water, dehydrated in a graded series of ethanol and xylene, and mounted with coverslips using Permount (Fisher Scientific, Unionville, ON, Canada). Pictures were taken with a Leica digital imaging system.

Immunohistochemistry. Lung explants were fixed overnight in 4% PFA in PBS, dehydrated, and embedded in paraplast. Immunohistochemistry was essentially conducted as described by Hsu and coworkers (26). Sections (7 µm) were deparaffinized and rehydrated in a graded series of ethanol. Antigen retrieval was achieved with heating in sodium citrate, pH 6.0. Endogenous peroxidase activity was quenched with 0.15% (vol/vol) hydrogen peroxide in methanol. Nonspecific binding sites were blocked with 5% (vol/vol) normal goat serum (NGS) and 1% (wt/vol) bovine serum albumin followed by overnight incubation at 4°C with a mouse monoclonal anti-thyroid transcription factor (TTF)-1 (Neomarkers, Fremont, CA) (1:50), mouse monoclonal anti-hepatocyte nuclear factor family (HNF)-3beta (Developmental Studies Hybridoma Bank, University of Iowa) (1: 50), mouse monoclonal anti-Shh (Developmental Studies Hybridoma Bank) (1: 50), mouse monoclonal anti-{alpha}-smooth muscle actin ({alpha}-sma) antibody (Neomarkers, Fremont, CA) (1:1,000), mouse monoclonal anti-beta-tubulin IV (Biogenix, San Ramon, CA) (1:100), or mouse monoclonal anti-vimentin (Sigma, St. Louis, MO) (1:600) antibody, all diluted in blocking solution (5% NGS and 1% BSA in PBS). Sections were subsequently incubated with biotinylated secondary antibodies, and color detection was performed according to instructions in the Vectastain ABC and DAB kit (Vector Laboratories, Burlingame, CA). Sections were lightly counterstained with Carazzi hematoxylin and mounted in Permount (Fisher Scientific). Digital images were taken using a Leica imaging system.

Terminal transferase dUTP nick-end labeling assay. Lung explants cultured for 3 days with antisense ODNs targeted against Irx1–5 were fixed in 4% PFA in PBS and then embedded in paraplast. Sections (5 µm) were dewaxed with xylene, rehydrated in a graded series of ethanol, and treated with proteinase K (20 µg/ml) for 15 min at 37°C. After washing in PBS, the terminal transferase dUTP nick-end labeling (TUNEL) assay was conducted according to manufacturer's instructions [In Situ Cell Death Detection (fluorescein) kit, Roche]. Sections were mounted with mounting medium containing 4',6-diamidine-2-phenylindole dihydrochloride. Digital images were taken using a Leica imaging system.

Bromodeoxyuridine labeling of explants. Lung explants cultured for 3–6 days with antisense ODNs targeted against Irx1–5 were incubated for 6 h with 1 µM bromodeoxyuridine (BrdU). Explants were then fixed in Carnoy's fixative and embedded in paraplast, and 5-µm sections were cut and mounted on {alpha}-aminopropyltriethoxysilane-coated slides. Tissue sections were dewaxed in xylene and rehydrated in a graded series of ethanol. The sections were incubated for 20 min in 2 M HCl, transferred to PBS, and incubated for 1 h in 5% (vol/vol) NGS and 1% (wt/vol) BSA in PBS. The excess of blocking solution was carefully removed, and tissue sections were incubated overnight at 4°C with 1:20 mouse monoclonal anti-BrdU antibody (Roche). The tissue sections were washed three times in PBS and incubated for 1 h with a 1:100 dilution of biotinylated secondary sheep anti-mouse IgG followed by a 1-h incubation with 1:150 diluted fluorescein isothiocyanate streptavidin complex. The tissues were washed again in PBS and mounted with DAKO fluorescent mounting solution. No immunofluorescence was observed when primary antibody was omitted. Digital images were taken using a Leica imaging system.

Transmission electron microscopy. Lung explants were minced and fixed for 1 h in 4% (wt/vol) PFA and 1% (wt/vol) glutaraldehyde in PBS. Tissues were then rinsed three times in PBS and exposed to 1% (wt/vol) osmium tetroxide for 1 h followed by another three rinses with PBS. The samples were then dehydrated through an ascending alcohol series ending in propylene oxide. Propylene oxide was then exchanged with an increasing concentration of Epon (Marivac, St. Laurent, Qc, Canada) until the samples were fully infiltrated with 100% Epon. Samples were placed in molds, and the Epon was polymerized at 70°C overnight. Ultrathin sections of the resulting blocks were cut with a diamond knife on a Reichert Ultracut microtome and placed onto 400-mesh copper grids. All samples were stained 10 min in 3% (wt/vol) uranyl acetate in double-distilled water 5 min in 1% (wt/vol) lead citrate followed by a double wash with distilled water to remove excess stain. Samples were examined on a Philips 430 electron microscope.


   RESULTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 GRANTS
 REFERENCES
 
Irx expression in the developing rat lung. In situ hybridization analysis revealed that all Irx genes, except for Irx4, display a similar developmental expression pattern during rat lung development (Figs. 1 and 2). Irx4 was not expressed in developing lung (results not shown). Irx1 (Fig. 1, A–C), Irx3 (Fig. 1, D–F), Irx2 (Fig. 2, A–C), and Irx5 (Fig. 2, D–F) were highly expressed during the pseudoglandular stage of lung development (E13–E18), a period of active branching morphogenesis. During that developmental stage, expression of Irx1, Irx2, Irx3, and Irx5 was confined to branching lung endoderm, with no expression in mesenchymal or endothelial lung tissue. In addition, Irx expression appears to be equal throughout the epithelium and is not restricted to branch points. The Irx expression declines during the late pseudoglandular/early canalicular stage of development (E18–E19) and becomes more restricted to the distal epithelium. Irx mRNA is undetectable at later stages (E20–E22), when the distal air-exchange units are developing (not shown). No signal was detected when sense riboprobes were used (Fig. 1, G–I). These expression data are indicative of a role for the Irx genes in early rat lung development, especially during the formation of the bronchial tree.


Figure 1
View larger version (111K):
[in this window]
[in a new window]
  		Fig. 1. Irx1 (A–C) and Irx3 (D–F) expression in the developing rat lung. In situ hybridization (ISH) using antisense digoxigenin (DIG)-labeled probes showed that Irx1 and Irx3 mRNA were expressed at high levels in early gestational rat lung epithelium [A and D and B and E, at embryonic day (E) 13.5 and E16.5, respectively], whereas their expression decreased at later stages (C and F, at E18.5 for Irx1 and Irx3, respectively). No staining was observed in mesenchymal or endothelial tissue or when sense probes (G–I for sense Irx1; sense Irx2, -3, and -5 not shown) were used. Dark purple color is positive ISH staining. Bar: 100 µm.

 

Figure 2
View larger version (70K):
[in this window]
[in a new window]
  		Fig. 2. Irx2 (A–C) and Irx5 (D–F) expression in the developing rat lung. ISH using antisense DIG-labeled probes showed that Irx2 and Irx5 mRNA were expressed at high levels in the early gestational rat lung epithelium (A and D and B and E, at E13.5 and E16.5, respectively) while their expression decreased at later stages (C and F, at E18.5 for Irx2 and Irx5, respectively). No staining was observed in mesenchymal or endothelial tissue or when sense probes were used. Dark purple color is positive ISH staining. Bar: 100 µm.

 
Antisense inhibition of Irx expression reduces lung branching in vitro. To investigate the role of the Irx genes during early lung development, E13.5 rat lung explants were cultured in the presence of a universal antisense ODN targeted against Irx1, 2, 3, and 5 (Fig. 3). E13.5 rat lungs consist of two epithelial buds, which over time in culture undergo progressive branching (Fig. 3, A–C). Treatment of explant cultures with missense Irx ODN (not shown) did not affect lung explant growth or branching morphogenesis compared with control (Fig. 3, A–C) or sense Irx ODN-treated lung explants (Fig. 3, D–F). A dramatic inhibition of lung growth and branching morphogenesis was observed when the universal antisense ODN against Irx was used (Fig. 3, G–I). After 1 and 2 days in culture, lung explants treated with antisense Irx ODN displayed a normal number of main bronchi and lobes, but subsequent peripheral branching was reduced (Fig. 3G). After 4 days in culture, peripheral branching morphogenesis was even further abrogated in the antisense ODN-treated lungs. The reduced peripheral branching was associated with a distension/dilatation of proximal airway tubules (arrow, Fig. 3H). This phenotype persisted at least up till 7 days in culture (arrow, Fig. 3I).


Figure 3
View larger version (177K):
[in this window]
[in a new window]
  		Fig. 3. Effect of Irx inhibition on lung branching morphogenesis in vitro. Sense (A, D–F) or antisense (AS, G–I) oligodeoxynucleotides (ODNs) targeted against the overlapping translation sequence of Irx1–5 were added to the culture in a concentration of 20 µM. Antisense Irx ODN-treated lung explants (G–I) showed a dramatic decrease in branching morphogenesis compared with control (A–C) and sense (D–F) Irx ODN-treated explants. Arrows: dilatated proximal airway structures. Bar: 250 µm (A, D, G); 300 µm (B, E, H); 360 µm (C, F, I).

 
To examine the effectiveness of the universal antisense Irx ODN, we assessed Irx1, 2, 3, and 5 mRNA expression by nonradioactive in situ hybridization in rat lung explants cultured with sense (control) or antisense ODNs targeted against Irx. After 3 days in culture, Irx1, 2, 3, and 5 were expressed in the epithelial cells lining the airway tubules of the sense-treated explants (Fig. 4, A, E, C, and G, respectively). After 6 days in culture, the expression of all four Irx genes declined (not shown) similar to what was observed in the in vivo situation (Figs. 1 and 2). Treatment of lung explants with universal antisense Irx ODNs abolished the epithelial mRNA expression of Irx1, 2, 3, and 5 after 3 (Fig. 4, B, F, D, and H, respectively) and 6 days (not shown) in culture. Even prolonged detection times for the in situ hybridization did not reveal any significant level of Irx1, 2, 3, 5 transcripts in the antisense ODN-treated explants.


Figure 4
View larger version (67K):
[in this window]
[in a new window]
  		Fig. 4. Effect of antisense Irx ODN on expression of Irx1–3 and Irx5. ISH with DIG-labeled antisense probes for Irx1 (A and B), Irx3 (C and D), Irx2 (E and F), and Irx5 (G and H) genes in sense (control: A, C, E, G) and antisense Irx ODN-treated lung explants (B, D, F, H) after 3 days in culture. All 4 Irx genes, which were highly expressed in the epithelial cells of the sense Irx ODN-treated (control) explants [Irx1 (A), Irx3 (C), Irx2 (E), or Irx5 (G)], were hardly detected in the antisense Irx ODN-treated lung explants [Irx1 (B), Irx3 (D), Irx2 (F), or Irx5 (H)]. Dark purple color is positive ISH staining. Bar: 100 µm.

 
Proliferation and apoptosis in antisense Irx-treated lung explants. BrdU incorporation into DNA was used to investigate the proliferation in sense (control) and antisense Irx ODN-treated lung explants. Proliferation in epithelial and mesenchymal cells was similar in sense and antisense Irx ODN-treated lung explants after 3 days in culture (not shown). After 6 days in culture, a dramatic decrease in the number of proliferating mesenchymal cells was noted in the antisense Irx ODN-treated lung explants (Fig. 5, A f and h and C) compared with sense explants (Fig. 5, A b and d and C). TUNEL assay was performed to assess apoptosis in the lung explants. Mesenchymal apoptosis was dramatically increased in antisense Irx ODN-treated lung explants after 3 days in culture (Fig. 5, Bd and C) compared with sense explants (Fig. 5, Bb and C).


Figure 5
View larger version (89K):
[in this window]
[in a new window]
  		Fig. 5. Effect of Irx inhibition on proliferation and apoptosis. A: explants treated with sense (control) or antisense Irx ODN for 6 days (a–h; c, d, g, and h are enlargements of boxed sections in a and e) were pulsed with bromodeoxyuridine (BrdU) for 6 h, and subsequent BrdU incorporation was visualized by anti-BrdU immunofluorescence (b, d, f, and h). Cell nuclei were visualized with 4',6-diamidine-2-phenylindole dihydrochloride (DAPI; a, c, e, and g). The number of BrdU-immunopositive mesenchymal cells decreased dramatically after 6 days in antisense Irx-ODN-treated lung explants (f and h) compared with sense control ODN-treated explants (b and d). B: terminal transferase dUTP nick-end labeling (TUNEL) analysis of sense (control) and antisense Irx ODN-treated lung explants after 3 days in culture. Cell nuclei were visualized with DAPI (a and c). Few TUNEL-positive cells were seen throughout the epithelium of sense Irx ODN-treated (control) explants (b). Large numbers of TUNEL-positive cells were found in the mesenchyme (x) of antisense Irx ODN-treated lung explants (d). C: percentage of BrdU-positive (after 6 of days culture) and TUNEL-positive cells (after 3 days of culture) (black bar, sense-treated explants; grey bar, antisense-treated explants; means ± SE cells, n ≥ 1,000 cells). EPI, epithelium; MES, mesenchyme. BrdU cells were counted at bar: 100 µm (A: a, b, e, and f), 40 µm (A: c, d, g, and h), 100 µm (B: a–d).

 
Mesenchymal cell markers in antisense Irx-treated lung explants. To examine whether airway muscularization was affected by the antisense Irx knockdown, we performed immunohistochemistry for {alpha}-sma. In lung explants treated with sense (control) Irx ODNs for 6 days, {alpha}-sma-immunopositive reactivity staining was detected in a thin layer around the proximal bronchioles and larger blood vessels (Fig. 6, A and B). In the antisense Irx ODN-treated lung explants, the layer of {alpha}-sma-positive cells was disorganized. The {alpha}-sma-positive cell layer was regularly interrupted and failed to form a smooth layer supporting proximal bronchioles and larger blood vessels (Fig. 6E). Additionally, it appeared that antisense Irx ODN treatment resulted in a loss of mesenchymal mass compared with the sense ODN-treated lung explants (compare Fig. 6, A and D). Because vimentin is normally expressed throughout the proximal and distal mesenchymal compartment of the lung, we carried out vimentin immunoanalysis. In sense Irx ODN-treated lung explants, abundant positive staining for vimentin was observed throughout the mesenchymal compartment of the lung explants after 6 days in culture (Fig. 6C). In the explants treated with the universal antisense Irx ODN, the mesenchymal compartment had indeed dramatically decreased in volume but exhibited positive staining for vimentin (Fig. 6F).


Figure 6
View larger version (77K):
[in this window]
[in a new window]
  		Fig. 6. Effect of Irx inhibition on smooth muscle cell formation. Immunostaining was performed for {alpha}-smooth muscle actin ({alpha}-sma; A, B, D, and E) and vimentin (C and F) in sense (control; A–C) and antisense Irx ODN-treated (D–F) E13.5 rat lung explants after 6 days in culture. B and E are higher magnifications of A and D, respectively. In sense (control) Irx ODN-treated explants vimentin immunoreactivity was present in mesenchymal cells surrounding epithelial tubules (C), while {alpha}-sma identified the smooth muscle cell layer at the base of developing airways (A and B). In antisense Irx ODN-treated lung explants, vimentin (F) and {alpha}-sma (D and E) were expressed in a decreased and disorganized manner. Brown color is positive immunostaining. Bar: 250 µm (A, D); 40 µm (B, E); 100 µm (C, F).

 
Epithelial cell markers in antisense Irx-treated lung explants. Because all four Irx genes were knocked down in epithelial cells after treatment with the universal antisense Irx ODN, we investigated epithelial cell differentiation by nonradioactive in situ hybridization. SP-C, a marker for distal respiratory epithelium (62), was expressed in distal epithelial cells of lung explants treated for 3–6 days with sense (control) Irx ODNs (Fig. 7A). In the antisense Irx ODN-treated lung explants, however, SP-C mRNA was barely detectable in epithelial cells after a 3-day culture (not shown), and only a few mRNA positive clusters were found after culturing for 6 days (Fig. 7B). CCSP and beta-tubulin IV, markers for proximal nonciliated and ciliated epithelial cells (30, 55, 58, 67), respectively, were expressed after 6 days in culture in sense Irx ODN-treated explants, and their expression was restricted to the proximal airways (Figs. 7C and 8, A–C). In the antisense Irx ODN-treated lung explants, almost all epithelial lining cells were beta-tubulin IV and CCSP positive (Figs. 7D and 8, D–F). The proximal phenotype of the epithelial structures in the antisense-treated explants was corroborated by transmission electron microscopy (Fig. 8, J–L vs. Fig. 8, G–I). Because the expression of both SP-C (63) and CCSP (5, 6) is regulated by TTF-1 and HNF-3beta, we then assessed the expression of both transcription factors in sense and antisense Irx ODN-treated lung explants. Positive immunoreactivity for TTF-1 (Fig. 7, E and F) and HNF-3beta (Fig. 7, G and H) was detected in epithelial cells of both sense and antisense Irx ODN-treated lung explants. No obvious major differences were notable. Thus the lack of SP-C expression in antisense Irx ODN-treated lung explants is likely not due to a reduction in TTF-1 or HNF-3beta expression.


Figure 7
View larger version (72K):
[in this window]
[in a new window]
  		Fig. 7. Effect of Irx inhibition on epithelial cell differentiation. ISH was performed with DIG-labeled antisense probes for surfactant protein (SP)-C (A and B) and Clara cell secretory protein (CCSP, C and D) in sense (control; A, C, E, and G) and antisense Irx ODN-treated (B, D, F, and H) E13.5 rat lung explants after 6 days in culture. In the control (sense Irx ODN-treated) explants, SP-C mRNA was expressed in distal pulmonary epithelium (A). In the antisense Irx ODN-treated lung explants however, SP-C mRNA expression was dramatically decreased (B), and expression was only observed in some remaining distal epithelial cells. In the control (sense Irx ODN-treated) explants, CCSP was expressed in proximal epithelial cells (C). In the antisense Irx ODN-treated explants, CCSP was expressed in almost the entire explant (D). Dark purple color is positive ISH staining. Immunostaining for thyroid transcription factor (TTF)-1 (G and H) and hepatocyte nuclear factor (HNF)-3beta (E and F) revealed an epithelium-specific expression in sense (control: E and G) and antisense Irx ODN-treated (F and H) lung explants. No difference was observed between sense (control) and antisense Irx ODN-treated lung explants for either TTF-1 or HNF-3beta protein. Brown staining is positive staining. Bar: 250 µm (A–D); 100 µm (E–H).

 

Figure 8
View larger version (76K):
[in this window]
[in a new window]
  		Fig. 8. Immunohistochemical staining for beta-tubulin VI and transmission electron microscopy of explants treated with sense (control) or antisense Irx ODNs. In 6-day antisense-treated explants the ciliated cell marker beta-tubulin VI was expressed in almost all epithelial structures of the explant (D–F; n = 3 separate explants), whereas its expression was confined to the proximal epithelial cells in sense control explants (A–C; n = 3 separate explants). Transmission electron microscopy revealed greater numbers of ciliated proximal airway cells in 6-day antisense-treated explants (J–L) compared with sense control explants (G–I). Lamellar body containing cells were present in the sense control explants (see inset in I), but not in antisense-treated explants. Bar: 250 µm (A–F), 100 µm (G and J), 2 µm (H, I, K, and L).

 
FGF expression in antisense Irx-treated lung explants. The extended family of FGFs plays a critical role in the development of many organs, including the lung. FGF1, FGF2, FGF7, FGF9, FGF10, and FGF18 are all expressed in the developing lung, but only FGF10 has been shown to be critically necessary for the initiation of lung development (51). FGF1, FGF7, and FGF10, which are produced by the pulmonary mesenchyme, bind to and activate the FGF receptor FGFR2IIIb, which is present on pulmonary epithelial cells (51). Using semiquantitative RT-PCR, we investigated whether the Irx knockdown in culture affected the FGF/FGFR2 signaling pathway. No obvious differences in expression of FGF1, FGF7, FGF10, or FGFR2 were observed between control, sense, and antisense Irx ODN-treated lung explants after 3 or 6 days in culture (Fig. 9A). Although spatial effects cannot be excluded, this finding makes it unlikely that reduced branching morphogenesis in the antisense Irx ODN-treated lung explants is the result of a deficiency in of FGF1, 7, and 10 or their receptor, FGFR2.


Figure 9
View larger version (106K):
[in this window]
[in a new window]
  		Fig. 9. Effect of Irx inhibition on bone morphogenetic protein (BMP) 4 and FGF1, FGF7, and FGF10 expression. A: semiquantitative RT-PCR showed comparable levels of mRNA expression for FGF1, FGF7, FGF10, and FGF receptor (FGFR) 2 in control (C), sense, and antisense Irx ODN-treated lung explants. B: to determine whether Irx genes were upstream of BMP4, rat lung explants were incubated for 3 (a–d) and 6 (e–h) days with 200 ng/ml recombinant BMP (rBMP) 4. rBMP4-treatment of control lung explants (b and f) did not result in obvious differences in epithelial branching compared with untreated control explants (a and e). Both antisense Irx ODN-treated lung explants (c and g) and antisense Irx ODN-treated lung explants cultured with rBMP4 (d and h) showed a dramatic decrease in distal airway branching with a concomitant increase in the size of proximal airways. rBMP4 did not restore distal branching morphogenesis in antisense Irx ODN-treated lung explants after 3 (a–d) or 6 (e–h) days in culture. C: semiquantitative RT-PCR revealed no differences in BMP4 mRNA expression between control, sense, and antisense Irx-ODN-treated lung explants. RNA integrity and recovery were demonstrated by beta-actin RT-PCR. Bar: 250 µm.

 
BMP4 expression in antisense Irx ODN-treated lung explants. The reduction in SP-C expression and concurrent increased CCSP expression in the antisense Irx ODN-treated lung explants is very similar to the lung phenotype described for mice overexpressing either Xnoggin, a BMP4 antagonist, or a dominant-negative BMP4 receptor in distal epithelial cells (61). Both mice displayed a severe reduction in distal epithelial cells and a concurrent increase in proximal cells. Given that reduced BMP4 signaling results in a proximalization phenotype of the lung, we added recombinant BMP4 to the medium of sense (control) and antisense Irx ODN-treated lung explant cultures. Recombinant BMP4 (200 ng/ml) did, however, not restore distal branching morphogenesis in antisense Irx ODN-treated lung explants after 3 (Fig. 9B, a–d) or 6 (Fig. 9B, e–h) days in culture. To analyze whether BMP4 expression was affected by Irx knockdown in the lung explants, we performed semiquantitative RT-PCR. No obvious differences in the relative expression of BMP4 mRNA were detected between control, sense, and antisense Irx ODN-treated lung explants after 3 or 6 days in culture (Fig. 9C). These results suggest that the antisense Irx ODN-induced defect in branching and proximal-distal differentiation is not a consequence of BMP4 deficiency.

Irx gene expression in Shh and Gli2 mutant lungs. Various reports have implicated the Shh/Gli pathway in lung development (3, 23, 35, 40, 45). Because the Drosophila homolog of Gli1–3, Ci, has been shown to positively control araucan and caupolican, the Drosophila counterparts of vertebrate Irx genes (20), we investigated the expression of Irx1, 2, 3, and 5 in lungs of Shh and Gli2 mutant mice. In situ hybridization analysis showed that Irx1 and Irx2 (Fig. 10I, B and E) and Irx3 and Irx5 (not shown) were normally expressed in distal bronchioles of E13.5 and E14.5 Gli2–/– lungs compared with wild-type lungs (Fig. 10I, A and D). Shh–/– lungs were severely hypoplastic, but Irx1 and 2 mRNA (Fig. 10I, C and F) and Irx3 and 5 mRNA (not shown) expression in these lungs was comparable to that of littermate wild-type lungs (Fig. 10I, A and D). We also investigated the expression of Shh in the antisense Irx ODN-treated lungs. Immunohistochemically, Shh was expressed in the epithelium of the distal end buds of the control (Fig. 10II, A and B) as well the antisense Irx ODN-treated lung explants (Fig. 10II, C). These results indicate that at least in the developing lung the Irx genes are not upstream or downstream from the Shh/Gli2 signaling pathway.


Figure 10
View larger version (90K):
[in this window]
[in a new window]
  		Fig. 10. Irx expression in murine Gli2–/– and Sonic hedgehog knockout (Shh–/–) lungs and Shh expression in antisense Irx-ODN-treated lung explants. I: ISH using antisense DIG-labeled probes showed that in E13.5–14.5 murine lungs, Irx1 and Irx2 mRNA were expressed in epithelial cells lining the lung tubules (A and D, respectively). Despite the hypoplastic appearance of Gli2–/– (B and E) and Shh–/– (C and F) lungs, the pattern and level of expression of Irx1 and Irx2 mRNA were similar compared with control lungs (A and D, respectively). Dark purple color is positive ISH staining. II: immunostaining for Shh in control (A), sense Irx-ODN treated (B), and antisense Irx-ODN-treated (C) rat lung explants after 6 days culture. Bar: 250 µm.

 

   DISCUSSION
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
GRANTS
 REFERENCES
 
Herein, we demonstrate that Irx homeobox genes play a role in proximo-distal morphogenesis of the lung in vitro. Evidence is provided that the Irx genes are not components of well-known signaling pathways critical for lung development such as the Shh, BMP4, and FGF signaling pathways. We speculate that Irx genes are additional transcriptional components of the complex genetic network directing lung morphogenesis.

In the present study we found that Irx1, Irx2, Irx3, and Irx5 are specifically expressed in developing rat lung epithelium during the period of active airway branching. Houweling et al. (25) showed similar expression patterns for Irx1–5 in the developing murine lung. In the E10.5 murine lung, Irx1 and Irx2 were expressed at high levels in the mesoderm adjacent to the endoderm of the laryngo-tracheal groove, while Irx3 and Irx5 expression was restricted to the endoderm of the groove and foregut (25). From E10.5 onward (until E13.5) Irx1–3 and Irx5 expression was confined to the epithelial layer of the murine lung buds and bronchi (25). Similar murine pulmonary expression patterns for Irx1, Irx2, and Irx5 have been reported by others (2, 7, 34). In the E11.5 murine lung, Irx2 expression localized to the distal tips of the developing bronchi, while Irx2 expression decreased at 13.5 and was no longer visible at E14.5 (2). A comparable expression pattern was found for Irx1, with the difference that Irx1 was still prominently expressed throughout the lung epithelium at E13.5 but disappeared in the developing murine lung at the beginning of the alveolar phase (2). In the present study, we showed that Irx1–3 and Irx5 are expressed throughout the pulmonary rat lung epithelium up to E18.5, which is the pseudoglandular phase of rat lung development and equals the E13.5–16.5 mouse lung. Similar to the mouse lung, the intensity of expression for all four Irx genes decreased dramatically with advancing gestational age. In contrast to the reported mouse findings, we did not observe any specific spatial expression pattern for any of the Irx genes, although the expression became more restricted to distal epithelial cells with advancing gestation. This may be due to the different in situ hybridization techniques employed. Becker et al. (2) used whole mount in situ hybridization to investigate Irx gene expression, whereas we performed in situ hybridization on tissue sections.

On the basis of the expression patterns, we hypothesized that the Irx genes are involved in early lung branching morphogenesis. Because of the overlapping expression patterns of the four Irx genes, we decided to silence all four pulmonary expressed Irx genes using an in vitro antisense ODN approach. Moreover, silencing of individual Irx genes in vivo has yet not resulted in any major lung phenotype (34), suggesting that the loss of an Irx gene may be compensated by others. The use of antisense ODNs targeted against a common translation sequence of all four Irx genes resulted in a complete loss of Irx1–3 and Irx5 expression in E13.5 rat lung explants, which was accompanied by a dramatic decrease in epithelial branching morphogenesis. After 6 days in culture, control E13.5 lung explants displayed a complex branching network with some larger airways in the middle of the explant and more finer and complex branching in the periphery of the explant. Antisense Irx ODN treatment resulted in distension of the proximal airway tubules, whereas hardly any distal epithelial structures were detected. These results suggest that Irx genes are not required for bronchial branching, although they may regulate airway size, but are involved in the formation of the smaller distal airways.

In the present study, antisense Irx ODN-treated explants exhibited a reduced and disorganized airway smooth muscle cell differentiation. Furthermore, antisense Irx knockdown increased apoptosis in the mesenchymal compartment of the lung explants, whereas proliferation decreased. This overall loss in mesenchymal cells and disorganized muscularization of the airways suggest that Irx genes may have a role in the formation of visceral smooth muscle cells, which arise from the mesenchymal cells during lung development (64, 65).

In situ hybridization revealed an epithelial proximalization in antisense Irx ODN-treated explants compared with control lung explants. CCSP and beta-tubulin IV were abundantly expressed in the epithelial cells lining the large, ballooning airways of the antisense Irx ODN-treated lung explants, while in control lung explants CCSP and beta-tubulin IV were only expressed in few larger airways in the center of the lung explants. In contrast, SP-C was highly expressed in the distal airways of control lung explants but was barely detectable in antisense Irx ODN-treated lung explants. Expression of both SP-C (63) and CCSP (5, 6) is regulated by Nkx2.1 (or TTF-1) and Foxa2 (or HNF-3beta). TTF-1 is expressed in pulmonary epithelium from the start of normal lung development (31, 32). Mice deficient for TTF-1 die at birth with severely hypoplastic lungs, no thyroid gland, and brain abnormalities (31). Additional analysis of the rudimentary TTF-1–/– lungs revealed cyst-like structures lined with columnar epithelial cells and an overall proximalized phenotype (38, 66), which resembles the phenotype of the Irx-deficient lung explants of the present study. However, immunohistochemical analysis revealed a normal expression pattern for TTF-1 in antisense Irx ODN-treated lung explants. Also, HNF-3beta was normally expressed in both sense (control) and antisense Irx ODN-treated lung explants. Thus Irx proteins appear not to signal via these transcription factors. Whether Irx proteins directly influence SP-C transcription remains to be established. Another possibility is that the loss in SP-C expression is tertiary to the effects of Irx inhibition on the mesenchyme.

Proximalization of the lung has been described as a consequence of inhibition of BMP4 signaling by Weaver et al. (61). Interestingly, the Drosophila Irx orthologs, araucan and caupolican, are positively controlled by Dpp, the fly homolog of vertebrate BMP4. In Xenopus it has been shown that Xiro1, one of the Xenopus Irx orthologs, and BMP4 control each other (19). Furthermore, Xiro1 and Xiro2 are controlled by Noggin, a BMP4 antagonist (21). Given that inhibition of BMP4 signaling results in proximalization of the lung (61) and the interaction between Irx and BMP4 orthologs in invertebrates (21), we performed semiquantitative RT-PCR for BMP4 but did not find a difference in BMP4 mRNA expression between sense (control) and antisense Irx ODN-treated lung explants. Also, addition of recombinant BMP4 to antisense Irx ODN-treated lung cultures did not restore distal branching morphogenesis. These data suggest that the Irx genes are not upstream of BMP4. However, the experiments do not rule out the possibility that BMP4 is upstream from the Irx genes.

FGFs are very important for lung development. Without FGF10, no lung will develop below the trachea (37, 39) and in vitro, FGF10 induces outgrowth of two primary lung buds by chemoattraction (44). FGF7-deficient mice have no lung abnormalities (24); however, in vitro studies reveal a role for FGF7 in widespread epithelial proliferation and SP-C expression (48, 53). The importance of FGFR2IIIb was shown when a soluble dominant-negative FGFR2IIIb was expressed throughout the entire developing embryo and resulted in lung bud initiation, but no branching morphogenesis (14). Similarly, when a soluble dominant-negative FGFR2IIIb was overexpressed in distal epithelial cells, a trachea and two unbranched bronchi developed, without any further lung formation (46). Marker analysis of the latter lung rudiments revealed CCSP expression in remaining air sacs and no SP-C expression, similar to what we found in antisense Irx ODN-treated lung explants. Shannon et al. (50) showed that uncommitted E13.5 rat tracheal epithelium expressed SP-C mRNA when cultured in specified medium with FGF1 and FGF7. However, when cultured without FGF1 and FGF7 the tracheal epithelium was negative for SP-C, but positive for CCSP, suggesting that FGF signaling is important for epithelial cell differentiation and maintenance. In the present study, loss of Irx signaling in the explants did not affect the expression of FGF1, FGF7, or FGF10 and their receptor FGFR2, implying that the Irx genes are likely not a component of the FGF signaling pathway. However, it is possible that Irx genes control the formation or degradation of extracellular matrix molecules such as proteoglycans, which regulate the bioavailability of FGFs to their receptors.

The Shh signaling pathway plays an important role in the development of multiple organs (27). In the lung, Shh is required for proper branching morphogenesis and endoderm patterning (35, 45). Shh signaling is mediated via Gli1–3, the vertebrate counterparts of Ci in Drosophila (57). In the fly, the Iro-C genes araucan and caupolican, are positively controlled by Ci (22). Furthermore, Becker et al. (2) showed that Gli1–3 and Irx1 and Irx2 genes are coexpressed in the developing lung in adjacent tissues. Suggestions have been made of Shh/Gli and Mash-1 being upstream and downstream factors, respectively, in the Irx regulation cascade (2, 8). The hypoplastic phenotype seen in both antisense Irx ODN-treated rat lungs and Shh/Gli2-deficient murine lungs supports an interaction between both signaling cascades. However, all four Irx genes (Irx1–3, 5) were normally expressed in the different E13.5/14.5 Shh and Gli2 mutant lungs (comparable to E15.5/16.5 in rats). Moreover, Shh expression was not altered by antisense Irx ODN treatment. Thus it is unlikely that the Irx genes are upstream or downstream in the Shh signaling cascade in the developing lung. In contrast to Drosophila, in which araucan has been shown to regulate the gene activity of the achaete-scute complex (AS-C) (20), we also found that Irx ablation did not affect the expression of the mammalian homolog of AS-C, Mash-1, implying that Mash-1 is not downstream of Irx signaling (not shown). Therefore, we speculate that the Irx genes function in another signaling pathway.

A phenotype resembling the antisense Irx ODN-treated lungs, was seen in retinoic acid (RA)-treated mouse lung explants (11). In Xenopus, RA increases Xiro expression in the neural plate, but it decreases Xiro expression outside this plate (21). If we extrapolate these findings to the present study, it would mean that RA downregulates the Irx genes, which in turn leads to outgrowth of proximal and inhibition of distal lung structures. Wnt7b null lungs also resemble the antisense Irx-treated lungs (54). Downregulation of Wnt7b leads to lung hypoplasia, which is mainly due to a thinned layer of mesenchyme surrounding the distal airways (54). Furthermore, vascular smooth muscle layers have holes, and FGF10 expression is not altered in Wnt7b-deficient lungs (54). These phenotypic similarities as well as the mutual expression of Wnt7b97 and Irx1–4 in airway epithelium suggest an potential interaction between Wnt and Irx. The existence of such interaction is supported by recent reports showing that the expression of Xiro1 (19), Iro1 and 7 (28), and Irx3 (9) is dependent on Wnt signaling. Further investigations will be required to explore the putative RA-Irx and Wnt-Irx interaction during lung development.

In summary, we found that Irx1, 2, 3, and 5 are expressed in the early branching lung epithelium. Antisense knockdown experiments in vitro revealed that these Irx genes together play an important role in proximo-distal epithelial differentiation and branching morphogenesis of the lung. The importance of each individual Irx remains to be investigated, but overall Irx signaling appeared not to be linked to Shh, FGF, and BMP signaling cascades known to be critical for lung development.


   GRANTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
REFERENCES
 
This work was supported by the Canadian Institutes of Health Research (M. Post) and the Sophia Foundation for Medical Research, The Netherlands (SSWO #342, M. van Tuyl; and SSWO #460, F. Groenman).


   ACKNOWLEDGMENTS
 
We thank A. Griffin for animal handling and care and I. Tseu and M. Kuliszewski for technical assistance.

Martin Post is the holder of a Canadian Research Chair (tier 1) in Respiration.


   FOOTNOTES
 

Address for reprint requests and other correspondence: M. Post, Program in Lung Biology, Hospital for Sick Children Research Inst., 555 Univ. Ave., Toronto, Ontario M5G 1X8, Canada (e-mail: martin.post{at}sickkids.ca)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   REFERENCES
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Bao ZZ, Bruneau BG, Seidman JG, Seidman CE, and Cepko CL. Regulation of chamber-specific gene expression in the developing heart by Irx4. Science 283: 1161–1164, 1999.[Abstract/Free Full Text]
  2. Becker MB, Zulch A, Bosse A, and Gruss P. Irx1 and Irx2 expression in early lung development. Mech Dev 106: 155–158, 2001.[CrossRef][ISI][Medline]
  3. Bellusci S, Furuta Y, Rush MG, Henderson R, Winnier G, and Hogan BL. Involvement of Sonic hedgehog (Shh) in mouse embryonic lung growth and morphogenesis. Development 124: 53–63, 1997.[Abstract]
  4. Bellusci S, Henderson R, Winnier G, Oikawa T, and Hogan BL. Evidence from normal expression and targeted misexpression that bone morphogenetic protein (Bmp-4) plays a role in mouse embryonic lung morphogenesis. Development 122: 1693–1702, 1996.[Abstract]
  5. Bingle CD, Hackett BP, Moxley M, Longmore W, and Gitlin JD. Role of hepatocyte nuclear factor-3 alpha and hepatocyte nuclear factor- 3 beta in Clara cell secretory protein gene expression in the bronchiolar epithelium. Biochem J 308: 197–202, 1995.[Medline]
  6. Bohinski RJ, Di Lauro R, and Whitsett JA. The lung-specific surfactant protein B gene promoter is a target for thyroid transcription factor 1 and hepatocyte nuclear factor 3, indicating common factors for organ-specific gene expression along the foregut axis. Mol Cell Biol 14: 5671–5681, 1994.[Abstract/Free Full Text]
  7. Bosse A, Stoykova A, Nieselt-Struwe K, Chowdhury K, Copeland NG, Jenkins NA, and Gruss P. Identification of a novel mouse Iroquois homeobox gene, Irx5, and chromosomal localisation of all members of the mouse Iroquois gene family. Dev Dyn 218: 160–174, 2000.[CrossRef][ISI][Medline]
  8. Bosse A, Zulch A, Becker MB, Torres M, Gomez-Skarmeta JL, Modolell J, and Gruss P. Identification of the vertebrate Iroquois homeobox gene family with overlapping expression during early development of the nervous system. Mech Dev 69: 169–181, 1997.[CrossRef][ISI][Medline]
  9. Braun MM, Etheridge A, Bernard A, Robertson CP, and Roelink H. Wnt signaling is required at distinct stages of development for the induction of the posterior forebrain. Development 130: 5579–5587, 2003.[Abstract/Free Full Text]
  10. Bruneau BG, Bao ZZ, Tanaka M, Schott JJ, Izumo S, Cepko CL, Seidman JG, and Seidman CE. Cardiac expression of the ventricle-specific homeobox gene Irx4 is modulated by Nkx2–5 and dHand. Dev Biol 217: 266–277, 2000.[CrossRef][ISI][Medline]
  11. Cardoso WV, Williams MC, Mitsialis SA, Joyce-Brady M, Rishi AK, and Brody JS. Retinoic acid induces changes in the pattern of airway branching and alters epithelial cell differentiation in the developing lung in vitro. Am J Respir Cell Mol Biol 12: 464–476, 1995.[Abstract]
  12. Cavodeassi F, Diez Del Corral R, Campuzano S, and Dominguez M. Compartments and organising boundaries in the Drosophila eye: the role of the homeodomain Iroquois proteins. Development 126: 4933–4942, 1999.[Abstract]
  13. Cavodeassi F, Modolell J, and Campuzano S. The Iroquois homeobox genes function as dorsal selectors in the Drosophila head. Development 127: 1921–1929, 2000.[Abstract]
  14. Celli G, LaRochelle WJ, Mackem S, Sharp R, and Merlino G. Soluble dominant-negative receptor uncovers essential roles for fibroblast growth factors in multi-organ induction and patterning. EMBO J 17: 1642–1655, 1998.[CrossRef][ISI][Medline]
  15. Chiang C, Litingtung Y, Lee E, Young KE, Corden JL, Westphal H, and Beachy PA. Cyclopia and defective axial patterning in mice lacking Sonic hedgehog gene function. Nature 383: 407–413, 1996.[CrossRef][Medline]
  16. Christoffels VM, Keijser AG, Houweling AC, Clout DE, and Moorman AF. Patterning the embryonic heart: identification of five mouse Iroquois homeobox genes in the developing heart. Dev Biol 224: 263–274, 2000.[CrossRef][ISI][Medline]
  17. Cohen DR, Cheng CW, Cheng SH, and Hui CC. Expression of two novel mouse Iroquois homeobox genes during neurogenesis. Mech Dev 91: 317–321, 2000.[CrossRef][ISI][Medline]
  18. De Moerlooze L, Spencer-Dene B, Revest J, Hajihosseini M, Rosewell I, and Dickson C. An important role for the IIIb isoform of fibroblast growth factor receptor 2 (FGFR2) in mesenchymal-epithelial signalling during mouse organogenesis. Development 127: 483–492, 2000.[Abstract]
  19. Gómez-Skarmeta J, de la Calle-Mustienes E, and Modolell J. The Wnt-activated Xiro1 gene encodes a repressor that is essential for neural development and downregulates Bmp4. Development 128: 551–560, 2001.[Abstract]
  20. Gomez-Skarmeta JL, Diez del Corral R, de la Calle-Mustienes E, Ferre-Marco D, and Modolell J. Araucan and caupolican, two members of the novel Iroquois complex, encode homeoproteins that control proneural and vein-forming genes. Cell 85: 95–105, 1996.[CrossRef][ISI][Medline]
  21. Gomez-Skarmeta JL, Glavic A, de la Calle-Mustienes E, Modolell J, and Mayor R. Xiro, a Xenopus homolog of the Drosophila Iroquois complex genes, controls development at the neural plate. EMBO J 17: 181–190, 1998.[CrossRef][ISI][Medline]
  22. Gómez-Skarmeta JL and Modolell J. Araucan and caupolican provide a link between compartment subdivisions and patterning of sensory organs and veins in the Drosophila wing. Genes Dev 10: 2935–2945, 1996.[Abstract/Free Full Text]
  23. Grindley JC, Bellusci S, Perkins D, and Hogan BL. Evidence for the involvement of the Gli gene family in embryonic mouse lung development. Dev Biol 188: 337–348, 1997.[CrossRef][ISI][Medline]
  24. Guo L, Degenstein L, and Fuchs E. Keratinocyte growth factor is required for hair development but not for wound healing. Genes Dev 10: 165–175, 1996.[Abstract/Free Full Text]
  25. Houweling AC, Dildrop R, Peters T, Mummenhoff J, Moorman AF, Ruther U, and Christoffels VM. Gene and cluster-specific expression of the Iroquois family members during mouse development. Mech Dev 107: 169–174, 2001.[CrossRef][ISI][Medline]
  26. Hsu SM, Raine L, and Fanger H. Use of avidin-biotin-peroxidase complex (ABC) in immunoperoxidase techniques: a comparison between ABC and unlabeled antibody (PAP) procedures. J Histochem Cytochem 29: 577–580, 1981.[Abstract]
  27. Ingham PW and McMahon AP. Hedgehog signaling in animal development: paradigms and principles. Genes Dev 15: 3059–3087, 2001.[Free Full Text]
  28. Itoh M, Kudoh T, Dedekian M, Kim CH, and Chitnis AB. A role for iro1 and iro7 in the establishment of an anteroposterior compartment of the ectoderm adjacent to the midbrain-hindbrain boundary. Development 129: 2317–2327, 2002.[Medline]
  29. Jordan KC, Clegg NJ, Blasi JA, Morimoto AM, Sen J, Stein D, McNeill H, Deng WM, Tworoger M, and Ruohola-Baker H. The homeobox gene mirror links EGF signalling to embryonic dorso-ventral axis formation through notch activation. Nat Genet 24: 429–433, 2000.[CrossRef][ISI][Medline]
  30. Khoor A, Gray ME, Singh G, and Stahlman MT. Ontogeny of Clara cell-specific protein and its mRNA: their association with neuroepithelial bodies in human fetal lung and in bronchopulmonary dysplasia. J Histochem Cytochem 44: 1429–1438, 1996.[Abstract]
  31. Kimura S, Hara Y, Pineau T, Fernandez-Salguero P, Fox CH, Ward JM, and Gonzalez FJ. The T/ebp null mouse: thyroid-specific enhancer-binding protein is essential for the organogenesis of the thyroid, lung, ventral forebrain, and pituitary. Genes Dev 10: 60–69, 1996.[Abstract/Free Full Text]
  32. Lazzaro D, Price M, de Felice M, and Di Lauro R. The transcription factor TTF-1 is expressed at the onset of thyroid and lung morphogenesis and in restricted regions of the foetal brain. Development 113: 1093–1104, 1991.[Abstract]
  33. Lebeche D, Malpel S, and Cardoso WV. Fibroblast growth factor interactions in the developing lung. Mech Dev 86: 125–136, 1999.[CrossRef][ISI][Medline]
  34. Lebel M, Agarwal P, Cheng CW, Kabir MG, Chan TY, Thanabalasingham V, Zhang X, Cohen DR, Husain M, Cheng SH, Bruneau BG, and Hui CC. The Iroquois homeobox gene Irx2 is not essential for normal development of the heart and midbrain-hindbrain boundary in mice. Mol Cell Biol 23: 8216–8225, 2003.[Abstract/Free Full Text]
  35. Litingtung Y, Lei L, Westphal H, and Chiang C. Sonic hedgehog is essential to foregut development. Nat Genet 20: 58–61, 1998.[CrossRef][ISI][Medline]
  36. McNeill H, Yang CH, Brodsky M, Ungos J, and Simon MA. Mirror encodes a novel PBX-class homeoprotein that functions in the definition of the dorsal-ventral border in the Drosophila eye. Genes Dev 11: 1073–1082, 1997.[Abstract/Free Full Text]
  37. Min H, Danilenko DM, Scully SA, Bolon B, Ring BD, Tarpley JE, DeRose M, and Simonet WS. Fgf-10 is required for both limb and lung development and exhibits striking functional similarity to Drosophila branchless. Genes Dev 12: 3156–3161, 1998.[Abstract/Free Full Text]
  38. Minoo P, Su G, Drum H, Bringas P, and Kimura S. Defects in tracheoesophageal and lung morphogenesis in Nkx2.1 mouse embryos. Dev Biol 209: 60–71, 1999.[CrossRef][ISI][Medline]
  39. Moorman AF, Houweling AC, de Boer PA, and Christoffels VM. Sensitive nonradioactive detection of mRNA in tissue sections: novel application of the whole-mount in situ hybridization protocol. J Histochem Cytochem 49: 1–8, 2001.[Abstract/Free Full Text]
  40. Motoyama J, Liu J, Mo R, Ding Q, Post M, and Hui CC. Essential function of Gli2 and Gli3 in the formation of lung, trachea and oesophagus. Nat Genet 20: 54–57, 1998.[CrossRef][ISI][Medline]
  41. Mummenhoff J, Houweling AC, Peters T, Christoffels VM, and Ruther U. Expression of Irx6 during mouse morphogenesis. Mech Dev 103: 193–195, 2001.[CrossRef][ISI][Medline]
  42. Ozawa K, Uruno T, Miyakawa K, Seo M, and Imamura T. Expression of the fibroblast growth factor family and their receptor family genes during mouse brain development. Brain Res Mol Brain Res 41: 279–288, 1996.[Medline]
  43. Park HL, Bai C, Platt KA, Matise MP, Beeghly A, Hui CC, Nakashima M, and Joyner AL. Mouse Gli1 mutants are viable but have defects in SHH signaling in combination with a Gli2 mutation. Development 127: 1593–1605, 2000.[Abstract]
  44. Park WY, Miranda B, Lebeche D, Hashimoto G, and Cardoso WV. FGF-10 is a chemotactic factor for distal epithelial buds during lung development. Dev Biol 201: 125–134, 1998.[CrossRef][ISI][Medline]
  45. Pepicelli CV, Lewis PM, and McMahon AP. Sonic hedgehog regulates branching morphogenesis in the mammalian lung. Curr Biol 8: 1083–1086, 1998.[CrossRef][ISI][Medline]
  46. Peters K, Werner S, Liao X, Wert S, Whitsett J, and Williams L. Targeted expression of a dominant negative FGF receptor blocks branching morphogenesis and epithelial differentiation of the mouse lung. EMBO J 13: 3296–3301, 1994.[ISI][Medline]
  47. Peters T, Dildrop R, Ausmeier K, and Ruther U. Organization of mouse Iroquois homeobox genes in two clusters suggests a conserved regulation and function in vertebrate development. Genome Res 10: 1453–1462, 2000.[Abstract/Free Full Text]
  48. Post M, Souza P, Liu J, Tseu I, Wang J, Kuliszewski M, and Tanswell AK. Keratinocyte growth factor and its receptor are involved in regulating early lung branching. Development 122: 3107–3115, 1996.[Abstract]
  49. Sekine K, Ohuchi H, Fujiwara M, Yamasaki M, Yoshizawa T, Sato T, Yagishita N, Matsui D, Koga Y, Itoh N, and Kato S. Fgf10 is essential for limb and lung formation. Nat Genet 21: 138–141, 1999.[CrossRef][ISI][Medline]
  50. Shannon JM, Gebb SA, and Nielsen LD. Induction of alveolar type II cell differentiation in embryonic tracheal epithelium in mesenchyme-free culture. Development 126: 1675–1688, 1999.[Abstract]
  51. Shannon JM and Hyatt BA. Epithelial-mesenchymal interactions in the developing lung. Annu Rev Physiol 66: 625–645, 2004.[CrossRef][ISI][Medline]
  52. Shi W, Zhao J, Anderson KD, and Warburton D. Gremlin negatively modulates BMP-4 induction of embryonic mouse lung branching morphogenesis. Am J Physiol Lung Cell